WO1998034624A1

WO1998034624A1 - Use of the p-ten suppressor gene in diagnosis and treatment of cancer

Info

Publication number: WO1998034624A1
Application number: PCT/US1998/002615
Authority: WO
Inventors: Ramon E. Parsons; Michael H. Wigler
Original assignee: The Trustees Of Columbia University In The City Of New York; Cold Spring Harbor Laboratory
Priority date: 1997-02-07
Filing date: 1998-02-06
Publication date: 1998-08-13
Also published as: EP1023076A4; EP1023076A1; CA2280097A1; AU6653698A

Abstract

This invention provides a nucleic acid encoding P-TEN or an altered form thereof. This invention also provides a purified P-TEN or an altered form thereof. This invention further provides the above-described P-TENs, wherein the P-TEN has an altered, truncated, or deleted phosphatase domain. Further, this invention provides a method of diagnosing whether a patient has cancer which comprises detecting the presence in a suitable sample from the patient of either an altered form of P-TEN or a nucleic acid encoding an altered form of P-TEN. Further, this invention provides a method of identifying a chemical compound which may be useful as a drug for the treatment of cancer which comprises testing compounds for effects on P-TEN activity and identifying compounds which exhibit such an effect.

Description

USE OF THE PTEN SUPPRESSOR GENE IN DIAGNOSIS AND TREATMENT OF CANCER

This application claims the benefit of U.S. Provisional Application Serial No. 60/036,943, filed February 7, 1997, the content of which is incorporated into this application by reference.

Throughout this application, various references are referred to within parentheses. Disclosures of these publications in their entireties are hereby incorporated by reference into this application to more fully describe the state of the art to which this invention pertains.

This invention concerns the identification of a tumor suppressor gene designated PTEN and its use in the diagnosis and treatment of cancer.

Background of the Invention

Cancer cells have multiple genomic alterations not found in normal host DNA. These include point mutations, insertions, deletion, chromosomal rearrangements, amplifications (which increase gene copy number) , as well as a variety of karyotypic abnormalities (such as aneuploidy, supernumary chromosomes and losses of parental chromosomes) . Specific genomic changes are known to alter two main categories of cancer-related proteins: oncoproteins, which become activated or over- expressed; and tumor suppressor proteins, which become inactivated or diminished in expression. Loss of genetic information in cancer cells, a particular form of genomic alteration which is relevant here, is often characterized by loss of heterozygosity (LOH) , in which alleles from one parent are found missing, and homozygous deletion

(HD) , in which alleles from both parents are found missing. LOH and HD are associated with tumor suppressor genes

Knowledge of the alterations of cancer cells is useful in many ways. First, certain alterations are the hallmarks of certain cancers and are useful in diagnosis, staging, and classification, which can lead to the selection of a therapeutic regimen.

Second, the presence of a particular genetic lesion can be used to detect the presence of cancer cells, useful when the physician wants to monitor the patient's progress and response to therapy. In principle, such hallmarks could be employed to screen for the presence of cancer cells in otherwise asymptomatic patients. The example of the c-abl/bcr fusion resulting from the chromosome 9/21 rearrangement illustrates both of the first two uses. The presence of this alteration is used to diagnose chronic myelogenous leukemia, and to monitor recurrence .

Third, oncoproteins which are found altered in cancers can be the target of therapeutic discovery and intervention. Several clinical trials are now underway to test drugs that inhibit RAS function, ERB2 function, and CDK4 function. Many drug discovery programs are targeting the tyrosine kinase type oncogene .

Fourth, tumor suppressor proteins which are mutated in cancers can be the target of therapeutic discovery and intervention. For example, gene therapy experiments in animal models are underway to test the efficacy of restoring a tumor suppressor gene (p53) to cancer cells that have mutated p53. Again, if the tumor suppressor protein is an extracellular protein, it may be replaceable therapeutically . Also, one may induce the expression of a tumor suppressor gene by chemical agents, or restore function to a mutated protein, or elevate activity of an attenuated protein, or activate another gene product of similar function.

Fifth, altered oncoproteins or tumor suppressor proteins may be the target for immunotherapy and vaccination.

Detection of mutated genes is desirable, clinically, for the diagnosis of the mutation in patients, and, for research purposes, for the verification that a candidate oncogene or tumor suppressor gene is such. A variety of techniques have been employed to detect mutation. These fall into two categories: the analysis of the gene itself and the analysis of the gene product .

Most directly, when the sequence of a normal gene is known, the gene of a cancer cell may be sequenced and compared to the normal sequence. This can proceed by directly cloning, or producing by PCR, the subject gene from the cancer cell, and analyzing either the cDNA corresponding to the expressed mRNA or the genomic sequences in which the expressed sequences are embedded. The presence of specific mutations within specific genes can be determined by oligonucleotide hybridization. Most recently, this has been accomplished by "chip" technology, wherein the subject oligonucleotide is placed on a solid surface, and then contacted with single- stranded DNA derived from the cancer cell. The thermal stability of the duplex formed is measured and used to detect the presence of mutation. The advantage of chip technology is that it allows for miniaturization and multiple queries in a high throughput format.

Other less direct methods are available for examining the sequence of the subject gene, including: comparison of the electrophoretic mobility of the subject gene from the cancer with that of the normal gene under a variety of denaturing conditions; the altered mobility of the product of the cancer gene in in vitro translation or coupled transcription/translation systems; and the altered functionality of the cancer gene product following the transfection of the subject gene into an appropriate host cell .

When antibodies directed to the gene product are available, the protein can be examined directly from the cancer cell. Its level of expression may be assayed by immuno-cytochemistry, or, following its purification from the cancer cell, its altered electrophoretic mobility, or even its enzymatic function may be assessed. Antibodies to the subject gene-product can be obtained once the gene sequence is known by methods standard in the art.

Summary of the Invention

This invention concerns the identification of a tumor suppressor gene, PTEN, which has homology to tyrosine phosphatase and tensin and which is mutated in multiple types of cancer, including breast, prostate, and brain cancer.

This invention further concerns use of this gene including altered forms thereof and its gene product

(including altered forms thereof) in the diagnosis and treatment of cancer.

This invention provides a nucleic acid encoding P-TEN or an altered form thereof. This invention also provides a purified P-TEN or an altered form thereof.

This invention further provides the above-described P- TENs, wherein the P-TEN has an altered, truncated, or deleted phosphatase domain.

This invention additionally provides the above-described P-TENs, wherein the P-TEN is altered, truncated, or deleted at any of the amino acids between positions 90 and 141 inclusively, wherein the positions are set forth in figure 4A.

Further, this invention provides a method of diagnosing whether a patient has cancer which comprises detecting the presence in a suitable sample from the patient of either an altered form of P-TEN or a nucleic acid encoding an altered form of P-TEN.

Additionally, this invention provides the above-described method of diagnosis, wherein the altered form of P-TEN is detected based on a loss of heterozygosity or a homozygous deletion at the PTEN locus. This invention provides a method of diagnosing whether a patient has Cowden disease which comprises detecting the presence in a suitable sample from the patient of either an altered form of P-TEN or a nucleic acid encoding an altered form of P-TEN.

This invention further provides a method of treating a cancer patient who has an altered form of P-TEN which comprises introducing into the patient wild-type P-TEN or a nucleic acid which expresses wild-type P-TEN in the subject .

This invention also provides the above-described methods, wherein the altered form of P-TEN has reduced or no phosphatase activity.

Further, this invention provides a method of identifying a chemical compound which may be useful as a drug for the treatment of cancer which comprises testing compounds for effects on P-TEN activity and identifying compounds which exhibit such an effect.

Brief Description of the Figures

Figures 1A and IB

Nucleotide sequence of the cDNA of PTEN.

Figures 2A and 2B

Region of homozygous deletion on chromosome 10q23.

Figure 2A The STS-based YAC map of the region surrounding CY17. Marker locations are taken from the Whitehead STS-based map. RH indicates the radiation hybrid interval for CY17. Yac Map indicates the YACs containing CY17 and their location on the map. Cen., centromere; Tel., telomere.

Figure 2B

Map of homozygous deletions on 10q23, showing the STS markers spanning the deleted region, the four BACs overlapping the region, and the location of PTEN with respect to the STS markers. STS markers Not-5', PTPD, and ET-1 contain exonic sequences of the PTEN gene. Absence of homozygous deletion is indicated with a "+" , and presence of homozygous deletion with a "-" . Numbers to the right indicate the fraction of tumor cell lines and xenografts with the deletion. Breast cancer samples with deletion are xenografts Bxll and Bx38. The glioblastoma line with a deletion encompassing markers JL25 through KP8 is A172, and that with the deletion affecting only ET-1 is DBTRG-05MG. The glioblastoma samples with a deletion across the entire region are the cell line U105 and xenografts 2, 3, and 11, and the samples with deletion of only PTPD, which contains the phosphatase domain, are xenografts 22, 23, 24, 25, and 32. The prostate cancer cell lines with homozygous deletion are NCI H660 and PC-3. The 5' end of the PTEN cDNA was determined to be coincidental with the Not I site 20 Kb from the centromeric end of BAC D by sequencing this BAC with cDNA primers. These maps are not drawn to scale.

Figures 3A, 3B, and 3C Homozygous deletions in tumor cell lines and xenografts.

Figure 3A

Amplification of AFMA086WG9 from breast cancer cell lines and xenografts. A 6% polyacrylamide sequencing gel showing the products of PCR. Lane 1, MDA-MB-330, lane 2, MDA-MB-157, lane 3, MDA-MB-134-VI , lane 4, MDA-MB-435S, and breast xenografts , lane 5, Bxll, lane 6, Bxl5, lane 7, Bx38, and lane 8, Bx39.

Figure 3B

Southern blot analysis of tumor xenografts. Genomic DNA was digested with Eco RI , the fragments resolved on a 1% agarose gel, and transferred to a nylon membrane. The blot was probed with a 3 kb Eco RI fragment containing the STS marker JL25, which is within the region of homozygous deletion (top) or to a second 2 kb Eco RI fragment from chromosome 8 (bottom) . Lane M, bacteriophage lambda Hind III marker. Other lanes contain DNA from breast xenografts 10, 11, 19, and 38 and brain xenografts 2, 3, and 11. Breast xenografts 10 and 19 were loaded as controls and were not expected to have homozygous deletions.

Figure 3C Homozygous deletions of exon ET-1 in glioblastoma cell lines. Genomic DNA samples were PCR amplified using intronic primers that amplify exon ET-1. The products were resolved on a 1.2% agarose gel and then stained with ethidium bromide. Lane 1 contains a DNA marker. The remaining lanes contain PCR products from control templates and seven glioblastoma cell lines: lane 2, lymphocyte DNA, lane 3, water , lane 4, U118MG, lane 5, A172, lane 6, DBTRG-05MG, lane 7, U373, lane 8, T-98G, lane 9, U-87MG, and lane 10, U138MG. Full length products are present for all templates except water, A172, and DBTRG-05MG.

Figure 4A

Predicted amino acid sequence of P-TEN. The putative phosphatase domain is underlined. The nucleotide sequence has been deposited in the GenBank (accession number U93051) . Abreviations for amino acids are A, Ala; C, Cys; D, Asp; E, Glu; F, Phe ; G, Gly; H, His; I, lie; K, Lys;, L, Leu; M, Met; N, Asn; P, Pro; Q, Gin; R, Arg; S, Ser; T, Thr; V, Val ; W, Trp ; and Y, Tyr.

Figure 4B

Homology of P-TEN to protein tyrosine phosphatases . The sequence alignment was performed by ClustalW (http : //dot . imgen. bcm. tmc . edu: 9331/multi-align/Options/ clustal.html). NCBI ID numbers are P53916 (Y50.2), M61194 (CDC14) , A56059 (PRL1) , 1246236 (PTP-IV1), 1125812 (CPTPH) , and P24656 (BVP) . Black boxes indicate amino acid identities and gray boxes indicate similarities.

Figure 4C Homology of P-TEN to tensin and auxilin. Alignment was performed as in (B) over the region of highest homology.

NCBI ID numbers are A54970 (tensin) and 485269 (auxilin) .

Only the chicken form of tensin and the bovine form of auxilin have been deposited in Genbank.

Figure 5

Mutations of PTEN in cancer cell lines and primary tumors .

Figure 5A

Mutation of breast cancer cell line BT549. Sequence of nucleotides 831 to 785 (bottom to top) using an antisense primer shows a deletion of a C (arrow) in the right hand sample (BT549) but not in the left hand sample (breast cancer cell line ZR-75-30) .

Figure 5B

Mutation of glioblastoma cell line DBTRG-05MG. Sequence of nucleotides 1039 to 1010 in the antisense orientation from prostate cancer cell lines DU145 (left) , LNCaP (middle) , and the glioblastoma cell line DBTRG-05MG (right) . Arrow indicates the in-frame deletion of nucleotides 822 to 1025 in DBTRG-05MG.

Figure 5C

Mutation of prostate cancer cell line LNCaP. Sequence of nucleotides 34 to 2 of the prostate cancer cell line

LNCaP (left) and the glioblastoma cell line DBTRG-05MG

(right) using an antisense primer. Arrow indicates the deletion of two T nucleotides in LNCaP.

Figure 5D

Mutation of primary glioblastoma 534. Sequence of nucleotides 26 to 63 of genomic DNA from blood (left) and primary tumor 534 (right) from the same patient using a sense primer. Arrow indicates insertion of AG in the primary tumor. A, C, G, and T lanes are loaded next to each other to better detect mutations.

Figures 6A and 6B

Meiotic recombinants define a minimal region for the Cowden disease locus.

Figure 6A

Partial pedigree of Cowden family 0014 and lOq haplotypes. Black bars represent the Cowden haplotype . Individual III-l has a double recombinant and carries the affected haplotype centromeric of D10S541 and telomeric of D10S1753 . Individual III -3 has a single recombinant with the affected haplotype centromeric to D10S1753 . Taken together, these results indicate that the Cowden locus is centromeric of D10S541 . Roman numerals indicate generation number and arabic numerals individual number. The specific numbers correspond to those of Nelen et al (1996) .

Figure 6B

Consensus critical interval containing Cowden disease locus. Black bars represent the affected haplotype, while open bars indicate the unaffected haplotypes.

Cowden-critical interval 1, defined as between D10S215 and D10S564 , as of 1996 (Nelen et al . 1996). Critical interval 2 as derived from panel a above. Critical region 3 represents the shortest region of overlap between 1 and 2, placing the interval between D10S215 and

D10S541 .

Figures 7A, 7B, and 7C Mutations of PTEN in Cowden disease families. The start and stop codons are underlined.

Figure 7A

Mutation in affected and unaffected individuals in family 2053. Sequence of nucleotides 382 to 392 (bottom to top) using a sense primer shows a G to A substitution (denoted by arrow) at nucleotide 386 in an affected family member in lane 10. The unaffected family member is shown in lane 11. Normal, unrelated control is shown in the "+" lane.

Figure 7B

Mutation in family D. Nucleotides 463 to 476 (bottom to top) are shown in the sense orientation. A single base change (G to T) at nucleotide 469 of the affected individual is seen in lane 4, indicated by the arrow. An unaffected family member is in lane 5 and a unrelated control in lane "+" .

Figure 7C

Mutation in family C. Nucleotides 693 to 701 (bottom to top) are shown in the sense orientation. A single base change (C to T) is seen at nt 697 (arrow) in the affected individual in lane 9. The unaffected family member is in lane 8. Sequencing reactions were performed directly on PCR products.

Figures 8A, 8B, and 8C

Illustration of codon mutations found in the glioblastoma cases. Case numbers and mutated positions refer to Table 4. Arrows indicate the mutated codons . Lanes were loaded in the normal-tumor order. All cases were sequenced with sense primers except for case 15 and case 29 where antisense primers were used. Nucleotide sequences shown for each case: case 2, 393-447; case 6, 1001-1019; case 8, 1007-1025; case 10, 668-686; case 15, partial intron 5 and 493-507; case 19, 220-241; case 20, 374-397; case 21, 1007-1025; case 26, 308-331; case 29, partial intron 8 and 1050-1027; case 30, 346-381.

Figure 8A Frameshift mutations

Figure 8B

Nonsense mutations.

Figure 8C

Missense mutations.

Figure 9

LOH analysis for 34 glioblastoma cases. Solid box, LOH; shaded box, no allelic loss; open box, not informative;

R, replication error. Cases with codon mutations are indicated (Table 4) . FS, frameshift; HD, homozygous delet ion .

Figures 10A and 10B

Potential homozygous deletion at PTEN. Case 25 and case 33 are presented. Dinucleotide repeat markers are indicated with the prefix "D10S" left off. C, control, shown from case 22 which is not informative at PTENCA. The potential homozygous deletion region was proposed based on the retention of heterozygosity at PTENCA. Case 25 and case 33 are not informative at D10S541 and D10S532, respectively. Dotted line, missing allele.

Detailed Description of the Invention

This invention provides a nucleic acid encoding P-TEN or an altered form thereof.

Nucleic acids encoding an altered form of P-TEN may have deletions, additions, or substitutions in the nucleic acid sequence, thereby, resulting an altered P-TEN product .

This invention further provides the above-described nucleic acid, wherein the nucleic acid is mRNA, cDNA, or genomic DNA.

Further, this invention provides the above-described nucleic acids, wherein the nucleic acid has substantially the same sequence as the sequence shown in figures 1A and IB.

Based on the degenerency of the nucleic acid code and the important functional and structural domains of P-TEN one skilled in the art would be able to identify sequences that are "substantially the same" as those shown in figures 1A and IB.

This invention further provides the above-described nucleic acids, wherein the nucleic acid encodes a protein having an altered, truncated,^' or deleted phosphatase domain.

An altered, truncated, or deleted phosphatase domain may have amino acid deletion, substitutions, or additions. In an embodiment these changes will reduce or eliminate the phosphatase activity.

This invention also provides an oligonucleotide probe having a sequence which renders it capable of specifically hybridizing with the above-described nucleic acids .

Several probes that "specifically hybridize" with the above-described nucleic acids are identified in the paper. One skilled in the art would be able identify other probes based on routine experimentation using the sequence of the PTEN gene as a guide .

In addition, this invention provides a nucleic acid which upon transcription gives rise to one of the above- described nucleic acids .

This invention also provides a purified P-TEN or an altered form thereof. For example, altered forms of P- TEN may have amino acid substitutions, deletions, or additions .

This invention also provides the above-described P-TENs, wherein the P-TEN is altered, truncated, or deleted at any of the amino acids between positions 82 and 131 inclusively, wherein the positions are set forth in figure 4B .

This invention further provides the above-described P- TENs, wherein the P-TEN is altered, truncated, or deleted at any of the amino acids between positions 15 and 64 inclusively, wherein the positions are set forth in f igure 4C .

In addition, this invention provides a peptide having a sequence which is present within the above-described proteins and absent from any other human protein.

This invention also provides an antibody or fragment thereof which specifically binds to the above-described proteins or peptides.

As used in the subject invention, the term "antibody" includes, but is not limited to, both naturally occurring and non-naturally occurring antibodies. The term "antibody" includes polyclonal and monoclonal antibodies, and binding fragments thereof. Furthermore, the term "antibody" includes chimeric antibodies and wholly synthetic antibodies, and fragments thereof.

Further, this invention provides a method of diagnosing whether a patient has cancer which comprises detecting the presence in a suitable sample from the patient of either an altered form of P-TEN or a nucleic acid encoding an altered form of P-TEN. In an example, a "suitable sample" may be obtained from blood, urine, or tissue samples.

Additionally, this invention provides the above-described method of diagnosis, wherein the altered form of P-TEN is detected based on a loss of heterozygosity or a homozygous deletion at the PTEN locus.

In a "loss of heterozygosity (LOH) , " alleles from one parent are found missing. In a "homozygous deletion," alleles from both parents are found missing.

This invention also provides the above-described methods, wherein the cancer results in a gliobastoma. In addition, this invention provides the above-described methods, wherein the nucleic acid encoding an altered form of P-TEN has mutations or deletions in exons 4, 5, 6, 7, 8, or 9.

Further, this invention provides the above-described methods, wherein the nucleic acid encoding an altered form of P-TEN has mutations or deletions in exons 5 or 8.

This invention also provides the above-described methods, wherein the cancer is breast, prostate, melanoma, or brain cancer.

This invention provides a method of diagnosing whether a patient has Cowden disease which comprises detecting the presence in a suitable sample from the patient of either an altered form of P-TEN or a nucleic acid encoding an altered form of P-TEN.

This invention further provides the compounds identified by the above-described methods This invention also provides the compounds identified by the above-described methods and a suitable carrier.

Suitable carriers are well known to those skilled in the art and include, but are not limited to, aqueous or non- aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol , polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers such as those based on Ringer's dextrose, and the like. Preservatives and other additives may also be present, such as, for example, antimicrobials, antioxidants , chelating agents, inert gases and the like.

In addition, this invention provides the compounds identified by the above-described methods and pharmaceutically acceptable carrier.

Pharmaceutically acceptable carriers are well known to those skilled in the art and include, but are not limited to, 0.01-O.lM and preferably 0.05M phosphate buffer or 0.8% saline. Additionally, such pharmaceutically acceptable carriers may be aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non- aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers such as those based on Ringer's dextrose, and the like. Preservatives and other additives may also be present, such as, for example, antimicrobials, antioxidants, chelating agents, inert gases and the like.

Additionally, this invention provides the above-described methods, wherein the effect comprises inhibition, activation or enhancement of enzymatic activity.

Further, this invention provides the above-described methods, wherein the enzymatic activity comprises phosphatase activity.

Also, this invention provides the above-described methods, wherein the effect comprises inhibition, activation or enhancement of expression of the PTEN gene.

This invention also provides a previously unknown compound capable of mimicking the activity of P-TEN.

This invention also provides a pharmaceutical composition comprising a compound capable of mimicking the activity of P-TEN and a pharmaceutically acceptable carrier.

This invention will be better understood from the Experimental Details which follow. However, one skilled in the art will readily appreciate that the specific methods and results discussed are merely illustrative of the invention as described more fully in the claims which follow thereafter. First Series of Experiments

Positional cloning requires the jumping of several hurdles to obtain the gene of interest . Perhaps the most difficult hurdle is the identification of a small chromosomal region that is clearly associated with a disease phenotype . In the case of sporadic solid tumors, this is exceedingly difficult. LOH, which has been the mainstay for identifying sporadic tumor suppressor loci, has rarely been successful in identifying tumor suppressor genes. When genes have been identified by this approach, typically it has been with the aid of one or more intragenic homozygous deletions. We have used the RDA technique to directly identify a homozygous deletion on 10q23. With the aid of the human genome map our RDA marker could be placed on the STS-based YAC map, which is densely annotated with STS markers. This led to the isolation of a nearby hot-spot of homozygous deletion. Large genomic clones from this region were used to trap exons, whose sequences were identical to ESTs in the dBEST database. Clones corresponding to the trapped exons were ordered through the I.M.A.G.E. consortium, sequenced, and used to assemble a presumably full length sequence. Deletion break points were found to occur within the gene. In addition, frame-shift and missense mutations were detected in many of the brain, breast and prostate samples tested.

Mapping of homozygous deletions on human chromosone 10q23 has led to the isolation of a candidate tumor suppressor gene, PTEN, that appears to be mutated at considerable frequency in human cancers. In preliminary screens, mutations of PTEN were detected in 31% (13/42) of glioblastoma cell lines and xenografts, 100% (4/4) of prostate cancer cell lines, 6% (4/65) of breast cancer cell lines and xenografts, and 17% (3/18) of primary glioblastomas . The predicted PTEN product has a protein tyrosine phosphatase domain and extensive homology to Tensin, a protein that interacts with the cytoskeleton at focal adhesions. These homologies suggest that P-TEN may suppress tumors by antagonizing protein tyrosine kinases and may regulate tumor invasion and metastasis through interactions at focal adhesions.

As tumors progress to more advanced stages, they acquire an increasing number of genetic alterations. One alteration that occurs at high frequency in a variety of human tumors is loss of heterozygosity (LOH) at chromosome 10q23. This change appears to occur late in tumor development : although rarely seen in low-grade glial tumors and early-stage prostate cancers, LOH at 10q23 occurs in -70% of glioblastomas (the most advanced form of glial tumor) and -60% of advanced prostate cancers (1 , 2) . This pattern of LOH and the recent finding that introduction of wild-type chromosome 10 into glioblastoma cancer cells suppresses tumorigenesis in mice, suggest that 10q23 encodes a tumor suppressor gene (3) .

To identify this putative tumor suppressor gene, we performed representational difference analysis (RDA) on 12 primary breast tumors (4) . A probe, CY17, derived from one of the tumors was mapped to chromosome 10q23, near markers WI-9217 and WI-4264, on the Whitehead-MIT radiation hybrid map (5) . To^' more precisely map the location of CY17, we isolated three yeast artificial chromosomes (YACs) containing CY17 that are present on the sequence-tagged-site (STS) -based map of the human genome ( 6, 7) . These YACs placed CY17 slightly centromeric to the position determined by radiation hybridization and precisely identified its location (Fig. 2A) . LOH analysis of a panel of 32 primary invasive breast cancers revealed a frequency of 50% LOH in this region (data not shown) . No homozygous deletions of CY17 were detected in a panel of 65 breast tumor cell lines (25) and xenografts (40) ( 8) , so eight additional markers were analyzed in the 10q23 region (D10S579, D10S215, AFMA086WG9, D10S541, AFM280WE1, WI-10275, WI-8733, WI-6971) . We identified homozygous deletions of AFMA086WG9 in two xenografts, Bxll and Bx38 (Fig. 2B) (Fig. 3A) and then screened a bacterial artificial chromosome (BAC) library with this marker ( 9) . Using new STSs from four independent BAC clones, we determined that the minimal region of deletion was within BAC C (Fig. 2B) ( 10) . Homozygous deletions of AFMA086WG9 were also detected in two of eight glioblastoma cell lines and three of 34 glioblastoma xenografts, and two of four prostate cancer cell lines ( 11) . One of the glioblastoma samples, cell line A172, had the same deletion pattern as the original breast xenografts; the deletions in the other samples were larger (Fig. 2B) .

To confirm the presence of homozygous deletions, we hybridized a Southern (DNA) blot with a 3 kb probe derived from a genomic clone spanning the region of deletion ( 12) . Xenografts anticipated to have a homozygous deletion did not hybridize to this probe; the control xenografts hybridized to the expected 3 kb band

(Fig. 3B) .

To identify genes within the 10q23 region, we performed exon trapping on BACs C and D (Fig. 2B) ( 13) . Two trapped exons, ET-1 and ET-2, had sequences that were perfect matches to an unmapped UNIGENE assembly of expressed sequence tags (ESTs) as well as several unassembled ESTs ( 6) . Clones containing the ESTs were sequenced and used to assemble an open reading frame (ORF) of 403 amino acids (Fig. 4A) .

To verify the location of this cDNA, we obtained the intronic sequence around ET-1 by directly sequencing BAC C. An STS primer pair (ET-1) was generated that mapped back to BACs A, B, and C (Fig. 2B) . In addition, we screened the Map Panel #2 monochromosome human-rodent hybrid panel to confirm the unique location of this exon on chromosome 10 ( 14) .

Our entire series of xenografts and cell lines was screened with this primer pair and we identified an additional glioblastoma cell line (DBTRG-05MG) with a deletion of 180 bp (Fig. 2B) (Fig. 3C) . Sequence analysis revealed that the deletion had removed 180 bp of exonic sequence and the splice donor site from this 225 bp exon. This deletion was not present in 52 normal blood samples or in over 125 other primary tumors, xenografts, and cell lines tested.

Sequence analysis of the ORF revealed a protein tyrosine phosphatase domain (Fig. 4B) and a large region of homology (-175 amino acids) to chicken tensin and bovine auxilin (Fig. 4C) . We therefore call the gene PTEN for Phosphatase and Tensin homolog deleted on chromosome Ten.

The phosphatase domain of PTEN contained the critical (I/V) -H-C-X-A-G-X-X-R- (S/T) -G motif found in tyrosine and dual -specificity phosphatases ( 15) . The phosphatase domain exon mapped within all four BACs and was deleted in all of the homozygously deleted samples with the exception of DBTRG-05MG, thus placing this exon within the region of homozygous deletion near JL25 and AFMA086WG9 (Fig 2B) . We then screened the remaining xenografts and cell lines for additional homozygous deletions and identified in five more glioblastoma xenografts lacking this exon. These data indicate that the phosphatase domain encoded by PTEN was targeted for mutations in tumor xenografts and cell lines.

The phosphatase domain of encoded by PTEN is most related in sequence to those of CDC14, Phosphatase of Regenerating Liver (PRL-1) , and Baculovirus PTP (BVP) (Fig. 4B) . CDC14 and BVP are dual-specificity phosphatases that remove phosphate groups from tyrosine as well as serine and threonine ( 16) . These phosphatases can be distinguished from the more well characterized VHl-like enzymes by their sequence differences outside of the core conserved domain. Both PRL-1 and CDC14 are involved in cell growth, and CDC14 appears to play a role in the initiation of DNA replication ( 17) . In contrast to PTEN, these phosphatases do not have extensive homology to tensin and auxilin. PTEN is also homologous to the protein tyrosine phosphatase domains of three ORFs

(Y50.2, PTP-IV1, CPTPH) , for which protein products have not been characterized. Of these hypothetical proteins, only the putative yeast phosphatase, Y50.2 (NCBI ID P53916) , has significant homology to tensin.

Although tensin and auxilin are not phosphatases they have sequence similarities with this class of enzymes ( 18) . Both of these proteins have elements of the critical protein tyrosine phosphatase signature sequence, which suggests that they may share a tertiary structure that is similar to the one that is conserved among all protein tyrosine phosphatases ( 19) .

If PTEN is a tumor suppressor gene, the PTEN allele retained in tumor cells with LOH should contain inactivating mutations. To search for such mutations, we performed a protein truncation test on 20 breast, six glioblastoma, and two prostate tumor cell lines (20) . Two truncating mutations in PTEN were identified in the breast samples (Table 1) . BT549 cells had 1-bp deletion of a G, leading to the formation of a stop codon TAA (Fig. 5A) , and MDA-MB-468 cells had a deletion of 44 bp at codon 70, which resulted in a frameshift on the amino terminal side of the tyrosine phosphatase domain. Mutations in PTEN were also identified in three of the six glioblastoma cell lines: DBTRG-05MG cells had an in- frame deletion of 204 bp caused by the genomically deleted exon ET-1 (Fig. 5B) ,U373MG had a 2-bp insertion at codon 242, and U87MG had a frameshift at codon 54. Both of the prostate tumor cell lines had PTEN mutations: LNCaP cells had a 2-bp deletion at codon 6, leading to a frameshift (Fig. 5C) , and DU145 cells had a Met = Leu substitution at codon 134, within the phosphatase domain. The latter mutation was detected by a change in the pattern of in vitro translation initiation and was not found in >50 other alleles tested. However, Met-134 is not required for phosphatase activity (Fig. 4B) , so this alteration could be a polymorphism. With one exception

(DU145) , all of the cell lines retained a mutant PTEN allele and lost the other allele, indicating that these cells are null for PTEN.

Table 1 Summary of PTEN Mutations Identified by Sequencing That Are Found in Tumor Cell Lines and Primary Tumors

Tumor sample Tissue of origin Codon Mutation Predicted effect

LNCaPt Prostate 6 AAA to A§ frameshift

534Tt Glioblastoma 15 AGA to AGAGA frameshift

U87MGt Glioblastoma 54 49 bp deletion frameshift

MDA-MB-468t Breast 70 44 bp deletion frameshift

132Tt Glioblastoma 129 GGA to AGA Gly to Arg

DU145t Prostate 134 ATG to TTG Met to Leu

U373 MGt Glioblastoma 241 TTT to TTT TT frameshift

BT549t Breast 274 GTA AAT to TAA AT stop

DBTRG-05MG*t Glioblastoma 274 - 342 delete 204 bp in-frame deletion

134Tt Glioblastoma 337 4 bp deletion frameshift

* DBTRG-05MG has a genomic deletion of 180 bp within exon ET-1, which includes nearly the entire exon and the splice donor site. Because of the genomic deletion in this cell line, th transcript contains an in-frame deletion of codons 274-342. tTumor cell lines. tPrimary tumors. SMutations are indicated in the sense orientation. All mutations in primary tumors were not found in matched blood DNA.

To determine whether PTEN mutations are present in primary tumors, we screened genomic DNA from 18 primary glioblastomas for mutations in three exons (21) . Mutations in PTEN were found in three of these tumors: a 2-bp insertion at codon 15 (534T) , a point muataion resulting in a Gly => Arg change at 129 (132T) , and a 4-bp framshift mutation at codon 337 (134T) (Table 1 and Fig. 5D) . The mutation at codon 129 is within the signature sequence for tyrosine phophatases (Fig. 4B) . All three tumors appeared to have LOH in the PTEN region since the wild-type allele was substantially reduced in intensity. In addition, the tumor mutations were not detected in paired blood DNA.

In summary, we detected homozygous deletions, frameshift, or nonsense mutations in PTEN in 63% (5/8) of glioblastima cell lines, 100% (4/4) of prostat cancer cell lines, and 10% (2/20) of breast cancer cell lines. These frequencies are likely to be underestimates since the cell lines were not systematically screened for point mutations. We screened xenografts only for homozygous deletions in PTEN and detected them in 24% (8/34) of glioblastoma xenografts and 5% (2/40) of breast cancer xenografts. Finally, we detected PTEN mutations in 17% (3/18) of primary glioblastmas ; this frequency is also likely to be an underestimate ^'since the entire coding sequence was not analyzed. The results of these preliminary screens suggest that a large fraction of glioblastimas and advanced prostate cancer may harbor

PTEN muations, whereas the mutation frequency in breast cancer may be lower. Future systematic analysis of all tumor types will be of interest .

With one exception (the Methionine to Alanine missense alteration in DU145) all the mutations identified have undergone loss of heterozygosity of the second allele indicating that these cells are null for P-Ten. The lack of LOH seen with the Methionine to Alanine mutation in DU145 makes this alteration either an excellant candidate for a dominant-negative mutation or a polymorphism.

The likely function of the P-TEN tumor suppressor as an enzyme that removes phosphate from tyrosines is intriguing, given that many oncoproteins function in the reverse process - to phophorylate tyrosines (22) . P-TEN and tyrosine kinase oncoproteins may share substrates and the tight control of these substrates through phophorylation is likely to regulate a critical pathway that is altered late in tumor development . The homology of P-TEN to tensin is also of interest. Tensin appears to bind actin filaments at focal adhesions - complexesy that contain intergrins, focal adhesion kinase (FAK) , Src, and growth factor receptors (23) . Integrins have been implicated in cell growth regulation (24) and in tumor cell invasion, angiogenesis, and metatasis (25) , so it is conceivable that PTEN regulates one or more of thes processes. Finally, the identification of P-TEN as a likely tumor suppressor raises the possibility that this protein and its substrates will be useful targets for the development of new therapeutics for cancer.

References and Notes for the First Series of Experiments

1. S. H. Bigner et al . , Cancer Res. 48, 405 (1988); C. D. James, et al., Cancer Res. 48, 5546 (1988); B. K. A. Rasheed et al . , Oncogene 10, 2243 (1995).

2. I. C. Gray et al . , Cancer Res. 55, 4800 (1995); M. Ittman, Cancer Res. 56, 2143 (1996) ; T. Trybus , A. Burgess, K. Wojno, T. Glover, J. Macoska, Cancer Res. 56, 2263 (1996) .

3. S. Hsu et al., Cancer Res. 56, 5684 (1996) .

4. N. Lisitsyn, N. Lisitsyn, M. Wigler, Science 259, 946 (1993); N. A. Lisitsyn et al . , Proc . Natl.

Acad. Sci. U.S.A. 92, 151 (1995); M. Schutte et al . , Proc. Natl. Acad. Sci. U.S.A. 92, 5950 (1995). RDA was performed as described in Lisitsyn et al . , Proc Natl Acad Sci 92, 151 (1995) . Diploid and aneuploid nuclei from primary breast cancer cells were separated with a fluorescence activated cell sorter. DNA (100 ng) from each fraction was digested with Bgl II and used to prepare amplicons for 12 separate RDA reactions. Probe CY17 was isolated from one of these reactions, was 236 bp long and was present in the diploid but not in the aneuploid amplicon from which it was derived. Hybridization of CY17 to normal genomic DNA samples digested with Bgl II revealed no evidence of restriction length polymorphism.

5. D. R. Cox, M. Burmeister, E. R. Price, S. Kim, R. M. Myers, Science 250, 245 (1990) . We generated primers to amplify CY17 and screened the GeneBridge4 radiation hybrid panel. The primers were

5 ' -ATCTAGTGAGTTGGGGGACAGAGG- 3 ' and

5' -CTGGGTTGGGATTCTGCTCAG-3' . Amplification conditions were 95 °C for 30 s, 56 °C for 1 min, 70 °C for 1 min, for 35 cycles.

6. T. J. Hudson et al . , Sci ence 270, 1945 (1995).

7. The CEPH B library (Research Genetics, Huntsville) was screened by PCR using a series of tiered pools to identify unique clones.

8. The forward PCR primer was labeled with (³²P) ATP and used to amplify 40 ng of genomic DNA (11) . The samples were then subjected to electrophoresis and autoradiography . The samples included 25 human breast tumor cell lines available from American Type Culture Collection (ATCC) as well as 40 human primary breast tumors xenografted into nude mice. The cell lines were HS578T, SK-BR-3, UACC812, UACC893, MDA-MB-453, MDA-MB- 175-VII , MDA-MB468, MDA-MB-361, MDA-MB-231, MDA-MB-436, MDA-MB-415, MDA-MB-330, MDA-MB-157, MDA-MB- 134 -VI , MDA-MB-435S,

ZR 75-30, ZR 75-1, BT-549, BT-483, T-47D, BT-474, DU4475, CAMA1, MCF7 , and BT-20.

9. U. Kim et al . , Genomics 34, 213 (1996) . Clones were isolated from a BAC library (Research Genetics) using AFMA086WG9 as a STS probe.

10. BAC DNA was prepared using the Nucleobond kit (Nest Group, Southboro, MA) . BACs were digested with Not I and subjected to electrophoresis on a field inversion apparatus. BACs A, B, C, and D were 240, 200, 175, and 120 kb, respectively (see Fig. 2B) . A Not I site was present 20 kb from one end of BAC D. Twelve new STS sites were generated by sequencing both ends of BACs B, C, and D, and shotgun cloning Eco RI fragments. Plasmid DNA was prepared from the cloned Eco RI fragments. DNA was cycle sequenced with appropriate primers using a ³³P ddNTP cycle sequencing kit (Amersham, Cleveland) . STS primers were designed and the relative location of the STSs determined by testing for their presence in the BAC contig. Primer sequences are available upon request .

11. The glioblastoma lines included U105, U118MG, A172, DBTRG-05MG, U373MG, T-98G, U-87MG, and U138MG and 34 glioblastoma xenografts. The prostate cancer cell lines tested were DU145, LNCaP, NCI H660, and PC-3. Microsatellite analysis was performed on the prostate lines and each was found to be unique. With the exception of U105, all lines were obtained from the ATCC.

12. DNA (10 (g) was digested with Eco RI , resolved on a 1% agarose gel and transferred to nylon. The JL25 3-kb probe and the 2-kb contol probe were randomly labelled and hybridized to the blot consecutively.

13. A. J. Buckler et al . , Proc . Na tl . Acad . Sci . U. S . A . 88, 4005 (1991) . BACs C and D were digested with Bam HI, Bgl II, or both enzymes and ligated into the trapping vector pSPL3. Libraries were transfected into C0S1 cells with lipofectamine and poly(-A)⁺ RNA was extracted after 2 days . An exon trapping kit was purchased from GIBCO/BRL.

14. The map panel #2 monochromosome panel was purchased from the National Institute of General Medical Science (NIGMS) Human Mutant Genetic Cell Repository.

15. N. K. Tonks and B. G. Neel, Cell 87, 365 (1996).

16. E. B. Fauman and M.A. Saper, Trends Biochem . Sci . 21, 413 (1996) ; Z. Sheng and H. Charboneau, J. Biol . Che . 268, 4728 (1993) .

17. R. H. Diamond, D.E. Cressman, T. M. Laz, C. S. Abrams, R. Taub, Mol . Cell. Biol. 14, 3752 (1994) ;

E. Hogan and D. Koshland, Proc. Natl. Acad. Sci. U.S.A. 89, 3098 (1992) .

18. D. T. Haynie and C. P. Ponting, Protein Sci. 5, 2643 (1996) .

19. J. M. Denu, J. A. Stuckey, M. A. Saper, J. E. Dixon. Cell 87, 361 (1996) .

20. S. M. Powell et al . , New Engl . J^". Med. 329, 1982

(1993) ; P. A. M. Roest, R. G. Roberts, S. Sugino, J.

B. van Ommen, J. T. den Dunnen, Human Mol. Genet.

2, 1719 (1993) . Randomly primed cDNA was prepared from each of the cell lines studied. Reverse transcription-PCR reactions were performed with 2 overlapping primer pairs to screen the entire ORF . Primer pairs were as follows :

5 ' - G G A T C C T A A T A C G A C T C A C T A TAGGGAGACCACCATGGAGTCGCCTGTCACCATTTC-3 ' and 5 ' T T C C A G C T T T A C A G T G A A T T G - 3 ' ;

5 ' -GGATCCTAATACGACTCACTATAGGGAGACCACCATGGGATTTCCTG CAGAAAG-3' and 5 ' -TTTTTTCATGGTGTTTTATCCCTC-3 ' . In vitro transcription and translation was performed with the T7 TNT kit (Promega, Madison) and translated products resolved by electrophoresis.

The RT-PCR products that produced truncated proteins were directly cycle sequenced (20 ng each) to identify potential mutations. All mutations were verified by repeating the RT-PCR and mutation analysis. cDNA primer sequences are available from upon request . 21. STSs Not-5', PTPD and ET-1 were amplified from primary glioblastoma and blood DNA and the exonic regions sequenced.

22. T. Hunter, Cell 50, 823 (1987).

23. J. A. Wilkins, M. A. Risinger, S. Lin, J. Cell Biol . 103, 1483 (1986); J. Z. Chuang, D. C. Lin, S. Lin, J^" Cell Biol . 128, 1095 (1995); S. Miyamoto et al . , J^" Cell Biol . 131, 791 (1995). S. Miyamoto, S. K.

Akiyama, K. M. Yamada, Science 267 , 883 (1995) .

24. X. Zhu , M. Ohtsubo, R. M. Bohmer, J. M. Roberts, R. K. Assoian, J Cell Biol . 133, 391 (1996); K. K. Wary, F. Mainiero, S. J. Isakoff, E. E. Marcantonio, and F. E. Giancotti. Cell 87, 733 (1996).

25. S. K. Akiyama, K. Olden, K. M. Yamada, Cancer Metastasis Rev. 14, 173 (1995) .

Second Series of Experiments

Cowden disease (CD) is an autosomal dominant cancer predisposition syndrome associated with an elevated risk for tumours of the breast, thyroid, and skin (1,2) . Lhermitte-Duclos disease (LDD) cosegregates with a subset of CD families and is associated with macrocephaly, ataxia, and dysplastic cerebellar gangliocytomatosis (3,4) . The common feature of these diseases is a predisposition to hamartomas, benign tumours containing differentiated but disorganised cells indigenous to the tissue of origin. Linkage analysis has determined that a single locus within chromosome 10q23 is likely to be responsible for both of these diseases (5) . A candidate tumour suppressor gene ( PTEN) within this region is mutated in sporadic brain, breast, and prostate cancer

(6) . Another group has independently isolated the same gene, which they call MMAC1 , and also found somatic mutations throughout the gene in advanced sporadic cancers (7) .

Mutational analysis of PTEN in CD kindreds has identified germline mutations in four of five families. Nonsense and missense mutations were found that are predicted to disrupt the protein tyrosine/dual-specificity phosphatase domain of this gene. Thus, PTEN appears to behave as a tumour suppressor gene in the germline. These data also imply that PTEN may play a role in organising the relationship of different cell types within an organ during development .

The hallmark of Cowden disease (CD) [MIM 158350] , also known as multiple hamartoma syndrome, is hamartomas of multiple organs, including skin, intestine, breast, and thyroid (8) . In addition to benign disease, breast cancers develop in approximately 30-50% of affected women and thyroid cancers are found in 10% of affected individuals (9,10) . One-third of CD patients have macrocephaly; and brain tumours, especially meningiomas, are noted as well (9-11) . Lhermitte-Duclos disease

(LDD) , a condition in which a glial mass in the cerebellum leads to altered gait and seizures, is seen in some families with CD (4,11) .

We had previously mapped the putative CD susceptibility gene to a 5 cM interval between the markers D10S215 and D10S564 (5) . CD families and families with both CD and LDD were found to be linked to this region. We identified a recombinant in one of the linked families, which placed the critical interval centromeric to D10S541 (Figs. 6A and 6B) . This localised the consensus region to a narrow interval of less than 1 cM between D10S215 and D10S541 . We have recently identified a candidate tumour suppressor gene, PTEN, within this interval that is mutated in sporadic brain, breast, and prostate cancers (6) . The PTEN open reading frame contains a putative protein tyrosine phosphatase domain as well as a region of homology to tensin, a protein that interacts with focal adhesions. Somatic frameshift and nonsense mutations were found throughout the gene in the tumours. In addition, two missense mutations were identified that are predicted to cause amino acid substitutions at codons 129 and 134 within the phosphatase domain. Based on its location on 10q23 and the identification of mutations in sporadic breast and brain tumours, we decided to examine the potential role of PTEN in CD.

Mutational analysis of PTEN was performed in five CD families that met the operational diagnostic criteria of the International Cowden Consortium, criteria which include the presence of six facial papules per individual with at least three papules being trichilemmomas (5) . Four of these five have been described previously and were shown to be linked to chromosome 10q23 (5) . Sequencing of the individual exons of PTEN in these individuals revealed a number of point mutations (Table 2, and Fig 7A, 7B, and 7C) . In family 2053, affected individuals were found to have a G to A substitution, resulting in a Gly to Glu alteration at codon 129 (G129E) in exon 5. In a second family (BH) , the same codon 129 mutation was identified; however, the haplotypes from the two families were distinct (results not shown) . In family D, a G to T substitution produced a nonsense alteration at codon 157, which is also located in exon 5. In family C, affected individuals had a C to T substitution, resulting in the creation of a nonsense alteration at codon 233 in exon 7. With the exception of family BH, available affected and unaffected family members were subjected to mutation analysis. In all cases, the mutations segregated with CD.

Table 2. Clinical Features* and PTEN Mutation Status in i Cowden Disease Families

Family Number of Skin Breast Thyroid CNS Mutation Predicted Effect Affecteds

2053 2 M Melanoma Adenocarcinoma N Glioblastoma GGA to GAA Glyl29 to Glul29 Trichilemmoma Nucleotide 386

BH 2 M Trichilemmoma N Follicular N GGA to GAA Glyl29 to Glul29 Adenoma Nucleotide 386

C 3 F Trichilemmoma N Multinodul Macrocephaly CGA to TGA Arg233 to Stop ar Goiter Nucleotide 697

D 2 M, 2 F Trichilemmoma Fibroadenoma/ N Macrocephaly GAA to TAA Glul 57 to Stop Hamartoma Lhermitte-Duclos Nucleotide 469

0014 3 M, 6 F Trichilemmoma Adenocarcinoma Follicular N ND ND Carcinoma

^♦Phenotypes described represent the aggregate of those found in clinically affected individuals for each family (aggregate familial phenotypes are standard for such analyses as described previously¹⁶). ND=Not detected, N=absent, F=female, M=male.

To determine whether the missense mutation at codon 129 and the nonsense mutation at codon 157 might represent common polymorphisms, we sequenced exon 5 from unrelated controls and found no evidence of these mutations in 90 alleles. Further, exon 5 was amplified from an additional 28 unrelated individuals and subjected to restiction digestion analysis using the enzyme BsmFI . This restriction site is lost (GGGAC to GGAAC) in the presence of the missense alteration at codon 129 found in families 2053 and BH. All of these control samples yielded two digestion products, while heterozygous loss of the restriction site was evident in samples from affected members of families 2053 and BH (data not shown) . For family C, all affected members had a codon 233 nonsense mutation while all unaffecteds and five normal controls did not. Therefore, this alteration is probably etiologic for Cowden disease in this family although we cannot rigorously exclude the unlikely possibility that this represents a polymorphism. Mutations were not identified in family 0014. This may be due to alterations in the promoter or exons two, three, and four, which were not screened for mutation due to difficulty in obtaining intronic boundaries.

All affected individuals of these five families manifested trichilemmomas, which ^'are pathognomonic of CD, regardless of whether their mutation was a missense mutation, as in families 2053 and BH, or a nonsense mutation, as in families C and D (Table 2) . Nonsense mutations were associated with macrocephaly in two families. A premature stop codon at position 157 was associated with LDD while a stop codon at position 233 was not. Perhaps, the more amino-terminal truncation is responsible for the more severe LDD phenotype of central nervous system and cancer manifestations. Genotype-phenotype relationships will have to be formally analysed using more CD families.

The mutations in families 2053, BH, C, and D fall within the putative tyrosine phosphatase domain of the gene and would be expected to disrupt its function (12) . In fact, the codon G129E missense mutations observed in familes 2053 and BH occurred within the signature sequence found in all protein tyrosine phosphatases and dual-specificity phosphatases (13) . This motif is present within the catalytic core of these enzymes. Interestingly, the glycine at codon 129 is typically conserved in protein tyrosine phosphatases but not in dual-specificity phosphatases, which have serine and threonine as their substrates. The nonsense mutations at codons 157 and 233 in families D and C, respectively, also would be expected to disrupt the tertiary structure of the protein tyrosine phosphatase domain. In addition, loss of heterozygosity (LOH) of the wild type allele was found in hamartomas from families BH and D in the interval between D10S579 and D10S541 , which contains PTEN

(manuscript submitted) . Taken together, the mutation and LOH data implicate PTEN as a classic tumour suppressor.

With the identification of germline mutations of PTEN in CD, both predictive and diagnostic testing are now theoretically possible. If young apparently unaffected individuals are shown to carry the family-specific PTEN mutation, they can receive heightened cancer surveillance for the development of breast and thyroid neoplasms . Since the majority of CD presents as isolated cases, the discovery of the susceptibility gene will allow clinicians to make a DNA-based diagnosis. This was not possible with linkage analysis.

Because germline mutations of PTEN predispose to a breast and thyroid cancer syndrome, and somatic mutations are found in sporadic breast cancer, PTEN becomes an obvious candidate for non-CD breast cancer predisposition. Molecular epidemiologic studies of PTEN in apparently sporadic breast and thyroid cancer cases will be useful to determine if PTEN plays a role as a common low penetrance susceptibility gene. The results of these studies may have important consequences in altering the management of patients with such common cancers as those of the breast and the thyroid.

Finally, the cardinal phenotype of CD could hint at PTEN' s physiological function. Multiple hamartomas are the sine qua non of CD; these are disorganised masses composed of cells and tissues normally found in the organ of origin. Therefore, PTEN may act in normal tissues to guide the development of cellular interactions such that cells, tissues, and organs are properly formed with respect to one another. Given that disruptive germline mutations in PTEN are associated with CD, one can postulate that heterozygous mutation, in combination with LOH of the wild type allele, could cause a proliferative and disorganisational tendency, leading to hamartoma formation. This cellular proliferation and disorganisation would be the background on which malignant transformation could occur due to somatic mutation of other tumour suppressor genes and oncogenes .

METHODS

Families A total of 12 affected and 8 unaffected individuals belonging to five independent CD families were analysed for germline mutations in PTEN. Families 0014, 2053, BH, C, and D are classic CD families that meet the consensus operational diagnostic criteria of the International Cowden Consortium (5,10). Families 0014, 2053, C, and D have been described previously (9,10,14) . Family BH comprises two brothers, both of whom have multiple hamartomas of the skin, lung, kidney, follicular adenoma of the thyroid and hamarto atous polyps of the colon.

Genotyping Fourteen dinucleotide repeat markers located on lOq encompassing the Cowden critical interval were used for fine structure typing of Cowden family 0014: D10S537, D10S580 , D10S219 , D10S573 , D10S215, D10S541 , D10S2177, D10S2281 , D10S1739, D10S1615, D10S1571 , D10S1442 , D10S1753 , D10S564 . Each forward primer was 5 'labelled with fluorescent dyes HEX or 6-FAM (Genosys Biotechnologies, Inc., The Woodlands, TX, USA). PCR and electrophoresis conditions as well as data analysis have been described previously (15) .

Mutational Analysis

Intronic primers were designed for amplifying six exons of the PTEN gene (Table 3) . Cycle sequencing was performed directly on PCR products using a nested sequencing primer and the ³³P- dideoxy-labelled terminators kit (Amersham, Cleveland, OH, USA) and the ABI Prism Dye Terminator Cycle Sequencing Ready Reaction Kit. The products of cycle sequencing were electrophoresed on standard 6% acrylamide gels or analysed on an ABI 373A or 377 automated DNA sequencer (Perkin-Elmer Corp, Norwalk, CT, USA) . All mutations were independently confirmed ^' using both sequencing methods .

Table 3. Primers for PCR amplification of PTEN exons

Exon 1 5' forward primer 5'AGT CGC CTG TCA CCA TTT C3' 3' reverse primer 5 'ACT ACG GAC ATT TTC GCA TC3' sequencing primer (forward) 5 'CAT TTC CAT CCT GCA GAA G3'

Exon 5 5' forward primer 5' ACC TGT TAA GTT TGT ATG CAA C3' 3' reverse primer 5'TCC AGG AAG AGG AAA GGA AA3' sequencing primer (forward) 5'TCT AAA GTT ACC TAC TTG TTA AT3'

Exon 6 5' forward primer 5 'CAT AGC AAT TTA GTG AAA TAA CT3' 3' reverse primer 5'GAT ATG GTT AAG AAA ACT GTT C3' sequencing primer (reverse) 5 'CCA ATA CAT GGA AGG ATG AG3'

Exon 7 5' forward primer 5'TGA CAG TTT GAC AGT TAA AGG3' 3' reverse primer 5 'GGA TAT TTC TCC CAA TGA AAG3' sequencing primer (forward) 5 'CAG TTA AAG GCA TTT CCT GTG3'

Exon 8 5' forward primer 5'CTC AGA TTG CCT TAT AAT AGT C3' 3' reverse primer 5 'TCA TGT TAC TGC TAC GTA AAC3' sequencing primer (reverse) 5'AAC TTG TCA AGC AAG TTC TTC3'

Exon 9 5' forward primer 5'AAG GCC TCT TAA AAG ATC ATG3' 3' reverse primer 5' TT TCA TGG TGT TTT ATC CCT C3' sequencing primer (forward) 5'AGT AGA GGA GCC GTC AAA TC3' sequencing primer (reverse) 5 'ATT CTC TGG ATC AGA GTC AG3'

For family 2053, two affecteds, both males, and three unaffecteds were studied for mutations. For family C, three affecteds, all females, and three unaffecteds were tested. For family D, four affecteds, two males and two females, and two unaffecteds were tested. For family BH, two affected males and no unaffecteds were tested. For 0014, one affected individual was analysed. Mutations were also confirmed by restriction digestion analysis. For the codon 129 mutation found in exon 5 of families 2053 and BH, the restriction site for BsmFI was disrupted by mutation. For the codon 233 mutation in exon 7 of family C, a Nla III restriction site is created by the mutation. Exons were amplified, subjected to digestion, resolved by electrophoresis, and scored for the presence or absence of mutation based upon the digestion pattern.

References for the Second Series of Experiments

1. Lloyd, K.M. & Dennis, M. Cowden' s disease: a possible new symptom complex with multiple system involvement. Ann . Intern . Medi . 58, 136-142 (1963) .

2. Mallory, S.B. Cowden syndrome (multiple hamartoma symdrome) . Derm . Clini cs . 13, 27-31 (1995) .

3. Longy, M. & Lacomb, D. Cowden disease. Report of a family and review. Ann . Genet . 39, 35-42 (1996) .

4. Padberg, G.W., Schot, J.D.L., Vielvoye, G.J., Bots, G.T.A.M. & deBeer, F.C. Lhermitte-Duclos disease and Cowden syndrom: a single phakomatosis . Ann . Neurol . 29, 517-523 (1991) .

5. Nelen, M.R. et al . Localization of the gene for Cowden disease to chromosome 10q22-23. N a t u r e Genetics. 13, 114-116 (1996) .

6. Li, J. et al . PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science . 275, 1943-1947 (1997) .

Steck, P.A. et al . Identification of a candidate tumour suppressor gene, MMACl, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nature Geneti cs . 15, 356-362 (1997) .

Eng, C. et al . Cowden syndrome and Lhermitte-Duclos disease in a family: a single genetic syndrome with pleiotropy? J^". Med . Genet . 31, 458-461 (1994) .

9. Carlson, H.E. et al . Cowden disease: gene marker studies and measurements of epidermal growth factor. Am. J. Hum . Genet . 38, 908-917 (1986) . 10. Starink, T.M. et al . The Cowden syndrome: a clinical and genetic study in 21 patients. Clnical Geneti cs . 29, 222-233 (1986) .

11. Eng, C. Cowden syndrome. J^". Genet. Counsel , in press .

12. Tonks, N.K. & Neel , B.G. From form to function: signaling by protein tyrosine phosphatases. Cell 87, 365-368 (1996) .

13. Fauman, E.B. & Saper, M.A. Structure and function of the protein tyrosine phosphatases. Trends Biochem . Sci . 21, 413-417 (1996) .

14. Mulvihill, J.J. & McKeen, E.A. Discussion: genetics of mutiple primary tumors: a clinical etiological approach illustrated by three patients. Cancer . 40, 1867-1871 (1977) .

15. Marsh, D.J. et al . Differential loss of heterozygosity in the region of the Cowden locus within 10q22-23 in follicular thyroid adenomas and carcinomas. Cancer Res . 57, 500-503 (1997) .

16. Eng, C. et al . The relationship between specific RET proto-oncogene mutations and disease phenotype in multiple endocrine neoplasia type 2. Internal RET mutation consortium analysis. JAMA 276, 1575-1579 (1996) . Third Series of Experiments

Somatic mutations of PTEN in glioblastoma multiforme.

Alterations of the PTEN gene occur in glioblastoma multiforme. To determine the frequency of PTEN alteration, 34 consecutive glioblastomas were studied in detail. Sequencing each of the nine exons amplified from tumor DNA revealed 11 mutations. Analysis of polymorphic markers within and surrounding the PTEN gene identified an additional four homozygous deletion mutations. Loss of heterozygosity (LOH) was observed in 25 of 34 (74%) cases. All mutations occurred in the presence of LOH. PTEN was mutated in 44% (15/34) of all glioblastomas studied and 60% (15/25) of tumors with LOH on lOq. Thus, PTEN appears to be the major target of inactivation on chromosome lOq in glioblastoma multiforme.

Glioblastoma multiforme is the most aggressive form of glioma, and patients diagnosed with glioblastoma typically survive less than two years (1) . Genetic analysis of glioblastoma tumorigenesis has identified alterations of pl5/pl6/Rb/CDK4 , p53/MDM2 and EGFR

(Reference 2 and references therein) . Mutations affecting cyclin D activity are present in nearly all glioblastomas. The majority of tumors have mutations deleting pl5 and pl6 (3,4) . Tumors lacking mutations in these genes frequently harbor inactivating mutations of Rb or an amplification of CDK4 (5) . p53 and MDM2 are mutated in approximately 30% and 10% of tumors, respectively (6 and references therein) . Gene amplification of EGFR concomitant with augmented expression of the receptor occurs in 40-50% of glioblastomas (7) , and alterations of EGFR and p53 are mutually exclusive in the tumor (8) . Loss of chromosome lOq occurs in the vast majority of glioblastomas (9-11) and is associated with alterations of both EGFR and p53 ( 8 , 12 ) .

The PTEN gene, a tumor suppressor recently discovered on chromosome 10q23, contains a phosphatase domain, and its protein product has phosphatase activity (13-15) . Mutations of this gene have been detected in glioblastoma cell lines and tumors (13,14) . In addition, other types of cancer and the inherited predisposition to cancer, Cowden disease, are associated with PTEN mutations (13,14,16). To determine the frequency of PTEN alterations in glioblastomas, 34 normal-tumor pairs were investigated. The results showed that 74% (25/34) of glioblastomas demonstrated LOH at the PTEN locus, and 60%

(15/25) of these cases contained somatic PTEN mutations of both alleles, implicating the PTEN gene in tumor development .

MATERIALS AND METHODS

Tumor samples

34 normal-tumor pairs of glioblastoma multiforme were kindly provided by the Columbia Comprehensive Cancer Center Tumor Bank (Department of Pathology, Columbia University) . Preparation of genomic DNA from blood and tumor tissues has been described previously (17) .

LOH analysis

Four highly polymorphic dinucleotide-repeat markers flanking the PTEN gene, D10S532, D10S1687, D10S541 and D10S583 (Research Genetics, Huntsville, AL) , which have been mapped on the STS-based map of the human genome (18), were used to determine allelic imbalance in this locus. Another polymorphic dinucleotide-repeat marker PTENCA (forward primer, 5 ' -GTTAGATAGAGTACCTGCACTC-3 ' and reverse primer, 5' -TTATAAGGACTGAGTGAGGGA-3 ' ) derived from

(BAC) clone D that contains the 5' end of the gene was also included in the analysis (13) . Each forward primer was labeled with (γ-32P) ATP by T4 polynucleotide kinase

(New England Biolabs) and the PCR product was analyzed by

6% polyacrylamide gel electrophoresis. In addition, a missense polymorphism was found 32 bp from the splice donor site of intron 8, TTG (T/G) TGACTT, and was used to test for LOH by sequencing normal -tumor paired DNA. Loss of heterozygosity was defined as a reduction of band intensity of more than 90% relative to the second allele for at least two markers. Only one case demonstrated loss of only one marker (case 18) and was clearly displaying microsatellite instability at other loci.

Mutational analysis

Intronic primer pairs were designed to amplify and sequence each exon, including the splice junctions (16) . Forward and reverse primer sequences for exon 2 are 5 ' - GTTTGATTGCTGCATATTTCAG- 3 ' and 5' -GGCTTAGAAATCTTTTCTAAATG-3' , respectively, for exon 3, 5 ' - AATGACATGATTACTACTCTA - 3 ' and 5' -TTAATCGGTTTAGGAATACAA-3 ' , respectively, and for exon 4 , 5 ' - CATTATAAAGATTCAGGCAATG - 3 ' and 5' -GACAGTAAGATACAGTCTATC-3' , respectively. The sequencing primer for exon 2 is 5' -TCTAAATGAAAACACAACATGAA-3' (antisense), for exon 4, 5' -GATTCAGGCAATGTTTGTTAG-3' (sense). The reverse PCR primer for exon 3 was used as a sequencing primer for the same exon. All primers used in this study were purchased from DNAgency (Malvern, PA) . 10-50 ng of genomic DNA were amplified at 94°C for 30 sec, 54 °C for 1 min and 72 °C for 1 min for 35 cycles. Prior to sequencing reactions, PCR products were treated with 10 units of exonuclease I and 2 units of shrimp alkaline phosphatase for 25 min at 37 °C and incubated at 80 °C for 15 min. Cycle sequencing (Amersham Life Science) was performed for 25 cycles. Sequencing reactions were resolved on 5% polyacrylamide gels buffered with taurine . Each mutation has been verified independently at least 2 times. RESULTS

Somatic PTEN mutations.

Glioblastoma multiforme samples from 34 tumor cases were sequenced throughout all 9 exons of the PTEN gene, and mutations were found in 11 cases (Table 4) . Frameshift mutations (Fig. 8A) that resulted in premature translational termininations were detected in three cases (2, 19 and 21) . In case 2, an A insertion at cysteine 136 resulted in a subsequent termination at codon 146; in case 19, an AT deletion at nucleotide positions 227-228 converted tyrosine 76 to a stop codon; in case 21, a 4-bp deletion from nucleotide positions 1011-1014 at codon 337 resulted in a subsequent termination at codon 343. Nonsense mutations were detected at tyrosine 225, arginine 335 and tyrosine 336 in cases 10, 6, and 8, respectively (Fig. 8B) . Five missense mutations were found (Fig. 8C) . A G to T mutation in case 26 resulted in a glutamate 107 to tyrosine alteration, and a G to C change in case 30 resulted in alanine 121 to proline. Glycine 129 and glycine 165 were mutated to arginine in case 20 and case 15, respectively. In case 29, leucine 345 was mutated to glutamine . No mutations were detected in the blood-derived DNA, indicating that all mutations were somatic.

Table 4 Summary of PTEN mutations in primary glioblastoma multiforme

Predicted

Case no Codon change" Mutation Exon alteration

2 ^T(JT408 -*ATGT₄₀₈ Frameshift C136ls 6 CGA_|(M)S -→TGA_|(H)S Nonsense 8 TAC_I(K)8 -→TACi_|()( Nonsense 8 Y336Amber

10 TAT₆₇₅ →^'1AG₆₇₅ Nonsense 7 Y225Amber 15 ⁽ϊGA_4<)5 → GA₄,,.₅ Missense 6 G165R 19 1AT₂₂₈ → Δ|AT]₂₂₇_₂₂₈ Frameshift 4 Y76fs 20 C,GA₃₈₇ →AGA₃₈₇ Missense 5 G 129R 21 TTT_10I2 →Δ[TTCT]_I0II__10I4 Frameshift 8 F3371s 26 CAT_32I →TAT ₂₁ Missense 5 DI07Y 29 »G_{| )35} →CAG_|( Missense 9 L345Q 30 GCA ₆, →CCA,₆, Missense 5 AI2IP

" Mutated nucleotides are in boldface type.

Positions refer to the deduced PTEN protein sequence (13); fs, frameshift

LOH at the PTEN locus.

Four microsatellite markers flanking the PTEN gene, D10S532, D10S1687, D10S541 and D10S583, were initially used to evaluate allelic loss in this locus (Fig. 9) . Individually, the frequency of LOH was 83% (19/23) for D10S532, 81% (17/21) for D10S1687, 57% (12/21) for D10S541 and 64% (18/28) for D10S583. Tumors with microsatellite instability were detected in two cases (7 and 18) . Further, there were 8 cases with no detectable chromosomal lesions. To identify polymorphisms within the PTEN gene, a BAC spanning the 5' end was probed with a poly(CA)n oligonucleotide to identify novel CA repeats. A highly polymorphic marker, PTENCA, was obtained that is located within the PTEN gene. This marker was informative for 82% (28/34) of samples. LOH was detected in 68% (19/28) of the samples and all these cases were also hemizygously deleted in at least one of the flanking loci. A point mutation polymorphism in intron eight of PTEN demonstrated LOH in 68% (15/22) of informative samples. Of 34 glioblastoma cases analyzed with the above markers, 25 cases (74%) showed loss of heterozygosity at two or more of these loci (Fig. 9) .

Homozygous deletions of PTEN.

Four cases (4, 12, 25, and 33^') were identified which contained homozygous deletions in the PTEN locus (Figs. 10A and 10B) , as determined by retention of heterozygosity flanked by LOH (19) . The results revealed that the retention was present between D10S1687 and D10S583 in case 25 and case 33 and between PTENCA and D10S583 in case 4 and case 12 (Figs. 9, 10A, and 10B) . In case 25 and case 33, the homozygous deletions appear to target PTENCA, whereas case 4 and case 16 appear to target the 3' end of the gene and includes D10S541. Discussion

Overall, 15 cases were mutated for both alleles of PTEN (Figs. 8A, 8B, and 8C) . Mutations were found in exons 4- 9; no mutations could be found in exons 1-3. Exon 5, which codes for a phosphatase domain, and exon 8 were the most frequently mutated. In addition, we have demonstrated that one copy of PTEN is lost through LOH for 74% (25/34) of glioblastomas (Fig. 9) . Moreover, 60% (15/25) of the cases with LOH carried somatic mutations of the second copy of PTEN, including 11 codon mutations (Figs. 8A, 8B, and 8C) and 4 homozygous deletions (Fig. 9, 10A, and 10B) . Interestingly, our previous study has shown that 63% (5/8) of glioblastoma cell lines contain mutations (13) but in this study only 44% (15/34) of primary glioblastoma cases were mutated (Fig. 9) . The mutation rate of PTEN in this study could be underestimated due to the inability to detect all homozygous deletions or alterations of the promoter.

Previous glioblastoma studies have shown the LOH frequency on chromosome lOq ranges from 83%- 95% with the epicenter of loss located at 10q24-25 (9-11) . The epicenter of LOH on 10q24-25 may be a summation of deletions targeting PTEN and random partial chromosomal losses distal to the PTEN locus. Consistent with the thought that PTEN is the major ^'target of deletion, all examples of LOH indicate chromosomal break points that are centromeric to PTEN (Fig. 9) . These data indicate that LOH in this region typically includes the PTEN gene. Alternatively, another tumor suppressor may exist distal to PTEN.

The genetic analysis of glial tumor development clearly implicates chromosome lOq and therefore PTEN in the transition from anaplastic astrocytoma to glioblastoma multiforme (2) . Of the genetic alterations identified in gliomas, only p53 is altered in all grades of astrocytoma-derived tumors, suggesting that p53 inactivation is an early step in glial tumor formation (6) . Progression to anaplastic astrocytoma is associated with mutations of pl5/pl6/Rb/CDK4 (4,5) . The transition to glioblastoma correlates with loss of chromosome lOq and an increase in the freqency of alterations affecting the cyclin D pathway (4,5) . Many glioblastomas are diagnosed in the absence of a prior lower grade glial tumor, however. In these cases, p53 mutations are not commonly observed, rather EGFR amplifications are seen at high frequency along with alterations of lOq and the cyclin D pathway. Interestingly, p53 and EGFR alterations are not found in the same tumor (8) . Thus, at a minimum individual tumors accumulate alterations in the cyclin D regulatory pathway, chromosome lOq, for which PTEN is the likely target, and either p53 or EGFR.

References for the Third Series of Experiments

1. Louis, D. N. and Cavenee, W. K. in Cancer: Principles and practice of oncology, edited by DeVita, Jr., V. T., Hellman, S., and Rosenberg, S.

A., fifth edition, pp .2013-2017. Lippincott-Raven Publishers, Philadelphia, 1997.

2. von Deimling, A., Louis, D. N. , and Wiestler, O. D. Molecular pathways in the formation of gliomas.

Glia 15:328-338, 1995.

3. Jen, J., Harper, J. ., Bigner, S. H., Bigner, D. D. , Papadopoulos , N. , Markowitz, S., illson, J. K. V., Kinzler, K. W. , and Vogelstein, B. Deletion of pl6 and pl5 genes in brain tumors. Cancer Res. 54: 6353-6358, 1994.

4. Schmidt, E. E., Ichimura, K. , Reifenberger, G. , and Collins, V. P. CDKN2 (plδ/MTSl) gene deletion or

CDK4 amplification occurs in the majority of glioblastomas. Cancer Res. 54:6321-6324, 1994.

5. Ichimura, K. , Schmidt, E. E., Goike, H. M. , and Collins, V. P. Human glioblastomas with no alterations of the CDKN2A (pl6, INK4A, MTSl) and CDK4 genes have frequent mutations of the retinoblastoma gene. Oncogene 13: 1065-1072, 1996.

6. Boegler, 0., Huang, H. J. S., Kleihues, P., and Cavenee, . K. The p53 gene and its role in human brain tumors. Glia 15: 308-327, 1995.

7. Collins, V. P. Gene amplification in human gliomas. Glia 15: 289-296, 1995.

8. Rasheed, B. K. A., McLendon, R. E., Herndon, J. E., Friedman, H. S., Friedman, A. H., Bigner, D. D. and Bigner, S. H. Alterations of the TP53 gene in human gliomas. Cancer Res. 54: 1324-1330, 1994.

9. Albarosa, R. , Colombo, B. M., Roz, L., Magnani , I., Polio, B., Cirenei, N., Giani, C, Conti, A. M. F., DiDonato, S., and Finocchiaro, G. Deletion mapping of gliomas suggests the presence of two small regions for candidate tumor- suppressor genes in a 17 -cM interval on chromosome lOq. Am. J. Hum.

Genet. 58: 1260-1267, 1996.

10. Rasheed, B. K. A., Fuller, G. N. , Friedman, A. H., Darrel, D., Bigner, D. D. and Bigner, S. H. Loss of heterozygosity for lOq loci in human gliomas. Genes Chromo. Cancer 5: 75-82, 1992.

11. Karlbom, A. E., James, C. D. , Boethius, J., Cavenee, . K. , Collins, V. P., Nordenskjoeld, Larsson, C. Loss of heterozygosity in malignant gliomas involves at least three distinct regions on chromosome 10. Hum. Genet. 92: 169-174, 1993.

12. von Deimling, A., Louis, D. N. , von Ammon, K. , Petersen, I., Hoell, T., Chung, R. Y., Martuza, R.

L., Schoenfeld, D. A., Yasargil, G., iestler, O. D., and Seizinger, B. R. Association of epidermal growth factor receptor gene amplification with loss of chromosome 10 in human glioblastoma multiforme. J. Neurosurg. 77: 295-301, 1992.

13. Li, J., Yen, C, Liaw, D., Podsypanina, K. , Bose, S., Wang, S. I., Puc, J., Miliaresis, C, Rodgers, L. , McCombie, R., Bigner, S. H. , Giovanella, B. C, Ittmann, M. , Tycko, B., Hibshoosh, H., Wigler, M.

H., and Parsons, R. PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science 275: 1943-1947, 1997.

14. Steck, P. A., Pershouse, M. A., Jasser, S. A., Yung, . K. , A., Lin, H., Ligon, A. H., Langford, L. A.,

Baumgard, M. L., Hattier, T., Davis, T., Frye, C, Hu, R., Swedlund, B., Teng, D. H. F., and Tavtigian, S. V. Identification of a candidate tumour suppressor gene, MMACl, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nature

Genetics 15: 356-362, 1997.

15. Li, D., and Sun, H. TEP1, encoded by a candidate tumor suppressor locus, is a novel protein tyrosine phosphatase regulated by transforming growth factor b. Cancer Res. 57: 2124-2129, 1997.

16. Liaw, D., Marsh, D. J., Li, J., Dahia, D. L. M. , Wang, S. I., Zheng, Z., Bose, S., Call, K. M. , Tsou, H. C, Peacocke, M. , Eng, C, and Parsons, R.

Germline mutations of the PTEN gene in Cowden disease, an inherited breast and thyroid cancer syndrome. Nature Genetics 16: 64-67, 1997.

17. Moulton, T., Samara, G. , Chung, W. Y., Yuan, L., Desai, R. , Sisti, M. , Bruce, J., and Tycko, B.

MTSl/pl6/CDKN2 lesions in primary glioblastoma multiforme. Am. J. Pathol .^' 146: 613-619, 1995.

18. Hudson, T. J., Stein, L. D., Gerety, S. S., Ma, J. , Castle, A. B., Silva, J., Slonim, D. K. , Baptista,

R., Druglyak, L., Xu, S. H. , Hu, X., Colbert, A. M. E., Rosenberg, C, Reeve-Daly, M. P., Rozen, S., Hui, L., Wu, X., Vestergaard, C, Wilson, K. M. , Bae, J. S., Maitra, S., Ganiatsas, S., Evans, C. A., DeAngelis, M. M. , Ingalls, K. A., Nahf , R. W.,

Horton, Jr., L. T., Anderson, M. 0., Collymore, A. J., Ye, W., Kouyoumjian, V., Zemsteva, I. S., Tarn, J., Devine, R. , Courtney, D. F., Renaud, M. T., Nguyen, H. , O'Connor, T. J. , Fizames, C, Faure, S., Gyapay, G., Dib, C, Morissette, J., Orlin, J. B., Birren, B. W., Goodman, N. , Weissenbach, J., Hawkins, T. L., Foote, S., Page, D. C, and Landers,

E. S. An STS-based map of the human genome. Science 270: 1945-1954, 1995.

19. Cairns, P., Polascik, T. J. , Eby, Y., Tokino, K. , Califano, J. , Merlo, A., Mao, L., Herath, J. ,

Jenkins, R. , Westra, W. , Rutter, J. L. , Buckler, A., Gabrielson, E., Tockman, M., Cho, K. R. , Hedrick, L., Bova, G. S., Isaacs, W., Koch, W. , Schwab, D., and Sidransky, D. Nature Genetics 11: 210-212, 1995.

Claims

What is claimed is :

1. A nucleic acid encoding P-TEN or an altered form thereof .

2. The nucleic acid of claim 1, wherein the nucleic acid is mRNA, cDNA, or genomic DNA.

3. The nucleic acid of claim 1, wherein the nucleic acid has substantially the same sequence as the sequence shown in figures 1A and IB.

4. The nucleic acid of claim 1, wherein the nucleic acid encodes a protein having an altered, truncated, or deleted phosphatase domain.

5. An oligonucleotide probe having a sequence which renders it capable of specifically hybridizing with the nucleic acid of claim 1.

A nucleic acid which upon transcription gives rise to the nucleic acid of claim 1.

Purified P-TEN or an altered form thereof.

The P-TEN of claim 7, wherein the P-TEN has an altered, truncated, or deleted phosphatase domain.

9, The P-TEN of claim 7, wherein the P-TEN is altered, truncated, or deleted at any of the amino acids between positions 90 and 141 inclusively, wherein the positions are set forth in figure 4A.

10. The P-TEN of claim 7, wherein the P-TEN is altered, truncated, or deleted at any of the amino acids between positions 82 and 131 inclusively, wherein the positions are set forth in figure 4B.

11. The P-TEN of claim 7, wherein the P-TEN is altered, truncated, or deleted at any of the amino acids between positions 15 and 64 inclusively, wherein the positions are set forth in figure 4C.

12. A peptide having a sequence which is present within the protein of claim 7 and absent from any other human protein.

13. An antibody of fragment thereof which specifically binds to a protein of claim 7 or a peptide of claim 12.

14. A method of diagnosing whether a patient has cancer which comprises detecting the presence in a suitable sample from the patient of either an altered form of

P-TEN or a nucleic acid encoding an altered form of

P-TEN.

15. The method of diagnosis of claim 14, wherein the altered form of P-TEN is detected based on a loss of heterozygosity or a homozygous deletion at the PTEN locus .

16. The method of claim 14, wherein the cancer results in a gliobastoma.

17. The method of claim 16, wherein the nucleic acid encoding an altered form of P-TEN has mutations or deletions in exons 4, 5, 6, 7, 8, or 9.

18. The method of claim 16, wherein the nucleic acid encoding an altered form of P-TEN has mutations or deletions in exons 5 or 8.

19. A method of claim 14, wherein the cancer is breast, prostate, melanoma, or brain cancer.

20. A method of diagnosing whether a patient has Cowden disease which comprises detecting the presence in a suitable sample from the patient of either an altered form of P-TEN or a nucleic acid encoding an altered form of P-TEN.

21. A method of treating a cancer patient who has an altered form of P-TEN which comprises introducing into the patient wild-type P-TEN or a nucleic acid which expresses wild-type P-TEN in the subject.

22. The method of treatment of claim 21, wherein the altered form of P-TEN has reduced or no phosphatase activity.

23. A method of identifying a chemical compound which may be useful as a drug for the treatment of cancer which comprises testing compounds for effects on P- TEN activity and identifying compounds which exhibit such an effect.

24. The method of claim 23, wherein the compound was not previously known.

25. The compound identified by the method of claim 24.

26. A composition comprising the compound identified by the method of claim 23 and a suitable carrier.

27. A pharmaceutical composition comprising the compound identified by the method of claim 23 and pharmaceutically acceptable carrier.

28. The method of claim 23, wherein the effect comprises inhibition, activation or enhancement of enzymatic activity.

29. The method of claim 28, wherein the enzymatic activity comprises phosphatase activity.

30. The method of claim 23, wherein the effect comprises inhibition, activation or enhancement of expression of the PTEN gene.

31. A previously unknown compound capable of mimicking the activity of P-TEN.

32. A pharmaceutical composition comprising a compound capable of mimicking the activity of P-TEN and a pharmaceutically acceptable carrier.