WO1998032878A1 - Gene based assay for agents with potential therapeutic efficacy in the treatment of obsessive compulsive disorder and disorders related thereto - Google Patents

Gene based assay for agents with potential therapeutic efficacy in the treatment of obsessive compulsive disorder and disorders related thereto Download PDF

Info

Publication number
WO1998032878A1
WO1998032878A1 PCT/US1998/000644 US9800644W WO9832878A1 WO 1998032878 A1 WO1998032878 A1 WO 1998032878A1 US 9800644 W US9800644 W US 9800644W WO 9832878 A1 WO9832878 A1 WO 9832878A1
Authority
WO
WIPO (PCT)
Prior art keywords
comt
levels
mouse
mao
knockout
Prior art date
Application number
PCT/US1998/000644
Other languages
French (fr)
Inventor
Maria Karayiorgou
Joseph A. Gogos
Original Assignee
The Rockefeller University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Rockefeller University filed Critical The Rockefeller University
Priority to AU62405/98A priority Critical patent/AU6240598A/en
Publication of WO1998032878A1 publication Critical patent/WO1998032878A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0276—Knock-out vertebrates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1003—Transferases (2.) transferring one-carbon groups (2.1)
    • C12N9/1007—Methyltransferases (general) (2.1.1.)
    • C12N9/1011—Catechol O-methyltransferase (2.1.1.6)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/035—Animal model for multifactorial diseases
    • A01K2267/0356—Animal model for processes and diseases of the central nervous system, e.g. stress, learning, schizophrenia, pain, epilepsy
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S435/00—Chemistry: molecular biology and microbiology
    • Y10S435/81—Packaged device or kit

Definitions

  • the present invention relates generally to methods for diagnosing and treating obsessive-compulsive disorder and disorders related thereto, and to knockout mouse models for testing compounds useful in said diagnosis and treatment.
  • Obsessive-Compulsive Disorder is a common and severe psychiatric condition, which affects 2-3 % of the population 1 an 2 and is characterized by anxiety-producing intrusive thoughts and performance of anxiety -reducing rituals.
  • OCD 3 Several studies suggest a genetic component in the etiology of OCD 3 , but unlike schizophrenia and bipolar illness, no genome-wide search for genes has yet been reported for this disorder. Very little is known about the pathogenesis of the disorder.
  • OCD obsessive compulsive disorder
  • DA dopamine
  • NE norepinepherine
  • epinepherine 5 epinepherine 5
  • the present invention extends to a method for detecting a susceptibility to, or the presence of, obsessive-compulsive disorder, or disorders related thereto in a subject, comprising the steps of measuring the levels of activity of an enzyme involved in the metabolic degradation of dopamine (DA), norepinepherine (NE) or epinepherine, and comparing the levels to a standard, whereby modulated levels of activity relative to the standard indicate a susceptibility to, or the presence of, obsessive compulsive disorder, or disorders related thereto.
  • DA dopamine
  • NE norepinepherine
  • epinepherine epinepherine
  • Disorders related to obsessive compulsive disorder include, but are not limited to, major depression, dysthymia, bipolar disorder, and anxiety disorders such as panic disorder, panic disorder with agrophobia, social phobia, attention deficit hyperactivity disorder, eating disorders and Tourette's Syndrome 6 .
  • DA dopamine
  • NE norepinepherine
  • epinepherine catechol-0-methyltransferase
  • This enzyme is a Mg 2+ -dependent enzyme which catalyzes the transfer of methyl groups from S-adenosyl methionine to a hydroxyl group of a catecholic substrate: dopamine is converted into 3-methoxytyramine (3-MT) and norepinephrine is converted into normetanephrine 7 .
  • COMT is widely distributed in the mammalian brain, although results from pharmacological studies suggest that the relative importance of methylation (by COMT) versus deamination (by monoamine oxidase (MAO)) in the metabolic degradation of catecholamines varies among brain regions, with methylation accounting for about 15% of released DA in striatum and in nucleus accumbens and for more than 60% in frontal cortex 8 .
  • COMT is absent from the dopaminergic terminals and is thought to be involved in the catabolism of extraneuronal dopamine in glial cells and/or postsynaptic neurons 7 .
  • the gene for COMT is located at the ql 1 band of human chromosome 22, which has been previously reported to be hemizygously deleted in patients with schizophrenia, childhood onset schizophrenia and obsessive compulsive disorder (OCD) 9, 10 .
  • OCD obsessive compulsive disorder
  • a high frequency of psychiatric symptoms, including anxiety, depression and obsessive compulsive symptoms"' l2 has been described in children and adults with the 22ql l microdeletion.
  • the invention extends to a method for detecting a susceptibility to, or the presence of, obsessive compulsive disorder in a subject, or disorders related thereto, comprising the steps of measuring the levels of activity of COMT and comparing the levels to a standard. Decreased levels of COMT activity in the subject relative to the standard indicates that the subject has OCD, or a disorder related thereto, or a susceptibility to such disorders.
  • the present invention relates to the use of all members of the herein disclosed family of Catechol-O-methyltransferases.
  • the present invention also relates to a recombinant DNA molecule or cloned gene, or a degenerate variant thereof, which encodes a Catechol-O-methyltransferase; preferably a nucleic acid molecule, in particular a recombinant DNA molecule or cloned gene, encoding the Catechol-O-methyltransferase, which can be used therapeutically to treat patients suffering from obsessive-compulsive disorder, or disorders related thereto.
  • the human and murine DNA sequences of the Catechol- -methyltransferase of the present invention or portions thereof, may be prepared as probes to screen for complementary sequences and genomic clones in the same or alternate species.
  • the present invention thus extends to probes so prepared that may be provided for screening cDNA and genomic libraries for the Catechol-O-methyltransferase.
  • the probes may be prepared with a variety of known vectors, such as the phage ⁇ vector.
  • the present invention also includes the preparation of plasmids including such vectors, and the use of the DNA sequences to construct vectors expressing antisense RNA or ribozymes which would attack the mRNAs of any or all of the DNA sequences encoding Catechol-O-methyltransferase.
  • the full DNA sequence of the recombinant DNA molecule or cloned gene so determined may be operatively linked to an expression control sequence which may be introduced into an appropriate host.
  • the invention accordingly extends to unicellular hosts transformed with the cloned gene or recombinant DNA molecule comprising a DNA sequence encoding the present Catechol-O-methyltransferase(s) which can be utilized to administer Catechol- -methyltransferase to patients in need of such therapy.
  • the present invention naturally contemplates several means for preparation of the Catechol-O-methyltransferase, including as illustrated herein known recombinant techniques, and the invention is accordingly intended to cover such synthetic preparations within its scope.
  • the isolation of the cDNA and amino acid sequences disclosed herein facilitates the reproduction of the Catechol-O-methyltransferase by such recombinant techniques, and accordingly, the invention extends to expression vectors prepared from the disclosed DNA sequences for expression in host systems by recombinant DNA techniques, and to the resulting transformed hosts.
  • the invention also includes an assay system for screening of potential drugs effective to modulate Catechol-O-methyltransferase activity of target mammalian cells by potentiating the activity, or increasing the amount of Catechol-O- methyltransferase.
  • the test drug could be administered to an animal or cellular sample containing the Catechol-O-methyltransferase or an extract containing Catechol-O-methyltransferase to determine its effect upon the activity (modification of any appropriate substrate including neurotransmitters such as dopamine and noradrenaline) of the Catechol-O-methyltransferase, by comparison with a control.
  • the assay system could more importantly be adapted to identify drugs or other entities that are capable of binding to the Catechol-O-methyltransferase, in the cytoplasm or in the cellular membrane, thereby increasing or potentiating its activity .
  • Such assay would be useful in the development of drugs that would be specific against particular cellular activity, or that would potentiate such activity, in time or in level of activity.
  • such drugs might be used to effectively treat diseases wherein COMT activity is diminished or decreased, especially in the instance of obsessive-compulsive disorder, and related disorders such as major depression, dysthymia, bi-polar disorder, and anxiety disorders such as panic disorder, panic disorder with agoraphobia, social phobia, attention deficit hyperactivity disorder, eating disorders and Tourette's Syndrome, or to treat other pathologies.
  • the present invention includes an assay system which may be prepared in the form of a test kit for the quantitative analysis of the extent of the presence and/or activity of the COMT, or to identify drugs or other agents that may potentiate or increase such activity.
  • the system or test kit may comprise a labeled component prepared by one of the radioactive and/or enzymatic techniques discussed herein, coupling a label to the COMT, their agonists and/or antagonists, and one or more additional immunochemical reagents, at least one of which is a free or immobilized ligand, capable either of binding with the labeled component, its binding partner, one of the components to be determined or their binding partner(s).
  • the system or test kit may also comprise a polymerase chain reaction based (PCR) assay which can be used to quantify the COMT levels of a sample.
  • PCR polymerase chain reaction based
  • the present invention relates to certain therapeutic methods which would be based upon the activity of the COMT(s), its (or their) subunits, or active fragments thereof, or upon agents or other drugs determined to possess the same activity.
  • a first therapeutic method is associated with the prevention of the manifestations of conditions causally related to or following from the decreased levels of COMT activity, either individually or in mixture with each other in an amount effective to prevent the development of those conditions in the host.
  • drugs may be administered to increase or potentiate COMT activity, thereby decreasing or preventing the symptoms of obsessive-compulsive disorder or disorders related thereto.
  • the therapeutic method generally referred to herein could include the method for the treatment of obsessive-compulsive disorder or disorder related thereto, by the administration of pharmaceutical compositions that may comprise effective enhancers of activity of COMT, or other equally effective drugs developed, for instance by a drug screening assay, prepared and used in accordance with a further aspect of the present invention.
  • pharmaceutical compositions that may comprise effective enhancers of activity of COMT, or other equally effective drugs developed, for instance by a drug screening assay, prepared and used in accordance with a further aspect of the present invention.
  • drugs or other binding partners to the COMT may be administered to increase the amount of, or the level of activity of COMT.
  • MAO- A is expressed at highest levels in catecholaminergic neurons. .
  • the present invention extends to a method for detecting a susceptibility to, or the presence of obsessive disorder, or disorders related thereto, comprising the steps of measuring levels of activity MAO-A , and comparing of the levels to a standard, whereby modulated levels, i.e. levels different from the standard, indicate the susceptibility to, or the presence of, obsessive compulsive disorder, or disorders related thereto.
  • Modulated levels of activity of MAO-A which indicate such susceptibility or presence of OCD, or disorders related thereto, can be greater than the standard, or less than the standard.
  • the present invention also extends to a recombinant DNA molecule or cloned gene, or a degenerate variant thereof, which encodes a monoamine oxidase- A; preferably a nucleic acid molecule, in particular a recombinant DNA molecule or cloned gene, encoding the monoamine oxidase-A, which can be used therapeutically to treat patients suffering from obsessive-compulsive disorder, and disorders related thereto, as described above.
  • the human and murine DNA sequences of the monoamine oxidase-A of the present invention, degenerate variants thereof, or fragments thereof, may be prepared as probes to screen for complementary sequences and genomic clones in the same or alternate species.
  • the present invention extends to probes so prepared that may be provided for screening cDNA and genomic libraries for the DNA sequence encoding Monoamine oxidase A.
  • the probes may be prepared with a variety of known vectors, such as the phage ⁇ vector.
  • the present invention also includes the preparation of plasmids including such vectors, and the use of the DNA sequences to construct vectors expressing antisense RNA or ribozymes which would attack the mRNAs of any or all of the DNA sequences encoding monoamine oxidase A.
  • the full DNA sequence of the recombinant DNA molecule encoding monoamine oxidase A, or cloned gene so determined may be operatively linked to an expression control sequence which may be introduced into an appropriate host.
  • the invention accordingly extends to unicellular hosts transformed with the cloned gene or recombinant DNA molecule comprising a DNA sequence encoding monoamine oxidase A(s) which can be utilized to administer monoamine oxidase A to patients in which modulation of levels of activity of MAO-A involve decreased levels relative to a standard.
  • the present invention naturally contemplates several means for preparation of the monoamine oxidase A, including as illustrated herein known recombinant techniques, and the invention is accordingly intended to cover such synthetic preparations within its scope.
  • the isolation of the cDNA and amino acid sequences disclosed herein facilitates the reproduction of the monoamine oxidase A by such recombinant techniques, and accordingly, the invention extends to expression vectors prepared from the disclosed DNA sequences for expression in host systems by recombinant DNA techniques, and to the resulting transformed hosts.
  • the invention further includes an assay system for screening of potential drugs effective to modulate monoamine oxidase A activity of target mammalian cells. Such drugs can potentiate activity, or increase the amount of monoamine oxidase A. Moreover, the assay system can also screen for drugs capable of decreasing monoamine oxidase activity . Such drugs may effectively treat obsessive compulsive disorder, or disorders related thereto, in a subject exhibiting modulated levels of activity of monoamine oxidase A relative to a standard.
  • the test drug could be administered to an animal or cellular sample containing the monoamine oxidase A or an extract containing monoamine oxidase A to determine its effect upon the activity (modification of any appropriate substrate including neurotransmitters such as dopamine and noradrenaline) of the monoamine oxidase A, by comparison with a control.
  • the assay system can be adapted to identify drugs or other entities that are capable of binding to the monoamine oxidase A, in the cytoplasm or in the cellular membrane, thereby modulating its activity.
  • Such assay would be useful in the development of drugs that would be specific against particular cellular activity, or that would modulate such activity, in time or in level of activity.
  • such drugs might be used to effectively treat diseases wherein MAO-A activity is modulated relative to a standard, especially in the instance of obsessive-compulsive disorder, and related disorders such as major depression, dysthymia, bipolar disorder, and anxiety disorders such as panic disorder, panic disorder with agoraphobia, social phobia, attention deficit hyperactivity disorder, eating disorders and Tourette's Syndrome, or to treat other pathologies.
  • a standard especially in the instance of obsessive-compulsive disorder, and related disorders such as major depression, dysthymia, bipolar disorder, and anxiety disorders such as panic disorder, panic disorder with agoraphobia, social phobia, attention deficit hyperactivity disorder, eating disorders and Tourette's Syndrome, or to treat other pathologies.
  • the present invention includes an assay system which may be prepared in the form of a test kit for the quantitative analysis of the extent of the presence and/or activity of the monoamine oxidase A, or to identify drugs or other agents that may modulate such activity.
  • the system or test kit may comprise a labeled component prepared by one of the radioactive and/or enzymatic techniques discussed herein, coupling a label to the MAO-A, their agonists and/or antagonists, and one or more additional immunochemical reagents, at least one of which is a free or immobilized ligand, capable either of binding with the labeled component, its binding partner, one of the components to be determined or their binding partner(s).
  • the system or test kit may also comprise a polymerase chain reaction based (PCR) assay which can be used to quantify the MAO-A levels of a sample.
  • PCR polymerase chain reaction based
  • the present invention relates to certain therapeutic methods which would be based upon the levels of activity of the MAO-A(s), its (or their) subunits, or active fragments thereof, or upon agents or other drags determined to possess the same activity.
  • a first therapeutic method is associated with the prevention of the manifestations of conditions causally related to or following from the modulated levels of MAO-A activity relative to a standard, either individually or in mixture with each other in an amount effective to prevent the development of those conditions in the host.
  • drugs may be administered to increase or potentiate MAO-A activity.
  • drugs may be administered to decrease MAO-A activity. Administration of such a drug, depending on the levels of MAO-A exhibited by a subject relative to the standard, and decreasing or preventing the symptoms of obsessive-compulsive disorder, or disorders related thereto and described above.
  • the therapeutic method generally referred to herein could include the method for the treatment of obsessive-compulsive disorder, or disorders related thereto, by the administration of pharmaceutical compositions that may comprise effective enhancers of activity of MAO-A, or other equally effective drugs developed for instance by a drug screening assay prepared and used in accordance with a further aspect of the present invention.
  • drugs or other binding partners to the MAO-A may be administered to increase the amount of, or the level of activity of MAO-A, and be beneficial to subject suffering from OCD or a disorder related thereto, wherein the subject exhibits levels of activity of MAO-A lower than a standard.
  • a therapeutic method referred to herein could include a treatment for OCD, or disorders related thereto, by the administration of pharmaceutical compositions that may comprise effective inhibitors of activity of MAO-A.
  • Such drugs can be developed by a drug screening assay disclosed herein.
  • drags determined to decrease the levels of activity of MAO-A in subjects suffering from OCD, or disorders related thereto can be used to treat such subjects exhibiting increased levels of activity of MAO-A relative to a standard.
  • a knockout mouse of the present invention comprises a first and second allele capable of expressing functional COMT, wherein the first allele comprises a defect, and this defect prevents the first allele from expressing functional COMT.
  • the present invention further extends to another embodiment of the knockout mouse of the present invention, wherein the second allele also comprises a defect which prevents its expression of functional COMT.
  • a knockout mouse is unable to express functional COMT (Gogos et al., submitted).
  • Examples of defects in an allele encoding COMT that can prevent the allele from expressing functional COMT, and to which the present invention extends, include, but are not limited to, a substitution, insertion, and/or deletion of one or more nucleotides in an allele encoding COMT.
  • the present invention extends to a knockout mouse in which a defect in an allele encoding COMT involves a substitution of a portion of a fragment of an allele comprising the entire set of coding exons of COMT with an DNA sequence comprising a neomycin phosphotransferase (neo) gene (SEQ ID NO: 10) under the control of a PGK promoter (SEQ ID NO:4).
  • neo neomycin phosphotransferase
  • a knockout male mouse of the present invention wherein both alleles have a defect in the gene encoding COMT (also referred to herein as a homozygous knockout mouse), has a phenotype comprising increased in levels of dopamine in the frontal cortex of the brain as determined in situ, relative to levels of dopamine in the frontal cortex of a wild type male mouse, as determined in situ, decreased levels of dopamine in the amygdala as determined in situ relative to levels of dopamine in the amygdala of a wild type male mouse, as determined in situ, and increased levels of norepinepherine in the hypothalamus as determined in situ, relative to levels of norepinepherine in the hypothalamus of a wild type mouse, determined in situ.
  • a knockout male mouse in which one allele comprises a defect in the gene encoding COMT exhibits a phenotype different from that of a wild type mouse.
  • a knockout male mouse with a defect in one gene encoding COMT exhibited increased frequency of aggressive behavior with shorter latencies to initial aggression relative to the frequency and latency of initial aggression observed in a wild-type mouse (Gogos et al., submitted).
  • the phenotype of a female knockout mouse of the present invention wherein both alleles have a defect in the gene encoding COMT (homozygous knockout mouse), has been elucidated.
  • its phenotype is different from that of male knockout mice as described above, in that it comprises decreased levels of dopamine in the frontal cortex of the brain as determined in situ, relative to levels of dopamine in the frontal cortex of the brain of a wild type female mouse, as determined in situ, decreased levels of dopamine in the amygdala as determined in situ, relative to levels of dopamine in the amygdala of a wild type female mouse, and decreased levels of norepinepherine in the hypothalamus as determined in situ, relative to levels of norepinepherine in the hypothalamus of a wild type female mouse, as determined in situ.
  • an increase in any anxiety-like behaviors was observed in a female knockout mouse of the present invention relative to any anxiety-like behaviors observed in a
  • the present invention further extends to a method for making a knockout mouse disclosed herein.
  • the method comprises the steps of determining the DNA sequence of genomic DNA encoding COMT, providing a vector comprising the nucleotide sequence of genomic DNA encoding COMT and a selector gene contained therein, providing embryonic stem cells, and inserting the vector into the embryonic stem cells.
  • the selector gene used herein is a neo gene under the control of a PGK promoter.
  • numerous selector genes are known in the art, and have applications in this embodiment of the present invention.
  • an embryonic stem cell which has integrated the vector into its genome is selected.
  • the DNA sequence containing the selector gene therein replaces the endogenous genomic DNA of an allele which encodes COMT.
  • This embryonic stem cell is then injected into a blastocyte.
  • a second insertion step then occurs in which the blastocyte is inserted into a pseudopregnant female mouse so that the pseudopregnant mouse gives birth to a heterozygous knockout mouse.
  • the heterozygous knockout mouse can then be crossed with a wild type mouse.
  • Classical Mendelian genetics predicts that 50% of the offspring will be knockout mice with one allele incapable of expressing functional COMT.
  • Methods for selecting which offspring are knockout mice of the present invention are known to those skilled in this art.
  • the present invention further extends to a knockout mouse which is homozygous in that both alleles comprise a defect and are incapable of expressing functional COMT.
  • the present invention encompasses a method for producing such a knockout mouse, comprising the steps of crossing a first knockout mouse of the invention in which one allele is incapable of expressing functional COMT with a second knockout mouse of the invention with one allele incapable of expressing functional COMT. Approximately 25 % of the offspring from this cross will be knockout mice in which both alleles contain a defect which prevents the expression of functional COMT. Methods of selecting offspring are knockout mice of the present invention, and unable to express functional COMT, are well known in the art.
  • the embryonic stem cells are A7ES cells.
  • the step of inserting the vector into the embryonic stem cell comprises electroporating the embryonic stem cell in the presence of the vector.
  • the blastocyte used in the methods of the invention to produce a knockout mice is a C57B6 blastocyte.
  • the present invention further extends to methods for selecting a therapeutic agent for possible use in the treatment of OCD, or disorders related thereto, as described above. More specifically, a method of selecting a therapeutic agent for possible use in the treatment of a psychiatric disorder is disclosed, which comprises administering a potential therapeutic agent to a knockout mouse of the present invention, measuring the effects of the agent vis- ⁇ -vis the behavioral and physiological effects exhibited by the knockout mouse, comparing the effects of the agent to those of a control, and selecting a therapeutic agent by comparing the test responses.
  • One embodiment of the invention involves a method for selecting a therapeutic agent for possible use in treating obsessive compulsive disorder (OCD), or disorders related thereto in a subject, comprising the steps of administering a potential therapeutic agent to a knockout mouse of the present invention, measuring levels of dopamine in the frontal cortex of the knockout mouse, and comparing the measurement of dopamine levels with levels of dopamine in the frontal cortex of a control knockout mouse. If the difference between the levels of dopamine in the knockout mouse treated with the potential therapeutic agent and the levels of dopamine in the control knockout mouse are statistically significant, the therapeutic agent has a possible use in treating OCD, or disorders related thereto.
  • OCD obsessive compulsive disorder
  • the present invention further extends to another embodiment for selecting a therapeutic agent for possible use in treating obsessive compulsive disorder (OCD) disorders related thereto.
  • the method disclosed herein comprises the steps of administering a potential agent to a knockout mouse of the present invention, observing behaviors of the knockout mouse, and comparing those behaviors with the behaviors of a control knockout mouse. A difference in behaviors of the knockout mouse and the control indicate the therapeutic agent has a possible use in the treatment of OCD and disorders related thereto.
  • a heterozygous knockout male mouse of the present inventio exhibits an increase in the frequency of aggressive behavior with shorter latencies to initial aggression relative to the frequency and latency of initial aggression observed in a wild type mouse.
  • a potential agent is administered to such a knockout, which then exhibits a decrease in frequency of aggressive behavior compared to a control knockout mouse which did not receive the agent, then the agent has a possible use in treating OCD, and disorders related thereto.
  • the potential agent can be administered to a female knockout mouse of the present invention. If such a female knockout mouse exhibited less anxiety-like behaviors than are exhibited in a control female knockout mouse of the invention, then the agent has a possible use in the treatment of obsessive compulsive disorder (OCD), and disorders related thereto.
  • OCD obsessive compulsive disorder
  • Another method for selecting a therapeutic agent for possible use in the treatment of obsessive compulsive disorder, and disorders related thereto comprises the steps of administering a potential therapeutic agent to a knockout mouse of the present invention, measuring the ratio of homovanillic acid (HVA) to DOPAC (L-3,4- dihydroxyphenylacetic acid) in a region of the brain of the knockout mouse, and comparing that measurement to the ratio of HVA to DOPAC in the same region of the brain a control knockout mouse. A statistically significant difference between these ratios indicates the therapeutic agent has a possible use in treating obsessive compulsive disorder in a subject.
  • Regions of the brain in which the measurement of the ratio of HVA to DOPAC can be measured in this embodiment are the striatum, the frontal cortex, the amygdala, or the hypothalamus.
  • Yet another method for selecting a therapeutic agent for possible use in the treatment of obsessive compulsive disorder, or disorders related thereto involves measuring levels of norepinepherine in the hypothalamus of a knockout mouse of the present invention.
  • Such a method comprising the steps of administering a potential therapeutic agent to a knockout mouse of the present invention, measuring levels of norepinepherine in the hypothalamus of the knockout mouse, and comparing the measurement with levels of norepinepherine in the hypothalamus of a control knockout mouse which does not receive the agent.
  • disorders related to OCD include, but are not limited to major depression, dysthymia, bipolar disorder, and anxiety disorders such as panic disorder, panic disorder with agoraphobia, social phobia, attention deficit hyperactivity disorder, as well as eating disorders and Tourette's Syndrome.
  • compositions for use in therapeutic methods which comprise or are based upon the COMT, its subunits, their binding partner(s), as well as molecules whose activity or production depend on COMT; or upon molecules or agents or drags that control the production, stability and degradation, or that mimic the activities of the COMT.
  • DA dopamine
  • NE norepinepherine
  • epinepherine epinepherine
  • DA dopamine
  • NE norepinepherine
  • MAO-A epinepherine
  • Still another object of the present invention is to provide a knockout mouse in which both alleles have a defect in the gene encoding COMT, so that the knockout mouse is unable to express functional COMT.
  • Yet still another object of the present invention is to provide numerous methods for the selection of a therapeutic agent to treat potentially OCD, or disorders related thereto, using a knockout mouse of the present invention.
  • Still yet another object of the present invention is to provide a knockout male mouse having a phenotype that is different from the phenotype of female knockout mice of the present invention.
  • FIGURES Figure 1A is an amino acid sequence alignment of mouse COMT (SEQ ID NO: 5) and human COMT (SEQ ID NO:3). Single and double asterisks indicate the membrane bound and soluble initiation methionines respectively (by analogy to the rat and human clones). Arrowhead indicates codon 158 of the human gene where a met/val variation determines low or high activity of COMT (Gogos et al., submitted).
  • Figure IB is a schematical drawing of the targeting construct of the mouse COMT locus in embryonic stem cells and mice.
  • a Hindll ⁇ -Sacl fragment was shown to encompass the entire set of coding exons of the COMT gene.
  • part of this fragment was replaced by a cassette including the neo gene under the control of PGK promoter.
  • Cell culture, electroporation of A7ES cells and generation of the chimeric mice were performed using a procedure as set forth in Reference 39. About 15 % of the tested ES cell clones were positive for homologous recombination and three clones were selected for karyotyping and injection into C57B6 blastocytes.
  • FI heterozygous knockout males were then mated with C57B6 females and DNA from tail biopsies of FI agouti coat pups was typed by Southern blotting and PCR at the COMT genomic locus.
  • FI heterozygous mice were mated and F2 mice of all three genotypes and of mixed 129/J/C57B6 background were obtained.
  • Arrow lines indicate the diagnostic EcoRV restriction fragment.
  • the probe used for Southern analysis is shown as a thick black line. Also shown is a schematic -drawing of the mouse gene for COMT and the comparison knockout mouse gene lacking COMT 16 .
  • Figure IC is a genomic Southern Blot analysis of tail biopsies. Genetic DNA was isolated from offspring obtained following breeding of heterozygous mice, digested with EcoRV and probed with a ⁇ 1 kb fragment adjacent to the right arm of the targeting construct or the 3' coding portion of the mouse COMT cDNA. In the former case, wild type and recombinant restriction fragments are 11.5 kb and 3.5 kb respectively.
  • Figure 2A is a Northern analysis of mRNA extracted from the liver and brain of the homozygote knockout mice of the present invention as well as from wild type controls, showing the elimination of the expression of the COMT gene in the homozygous knockout mouse and wild type animals. Two mRNA species are observed in the liver, corresponding (by analogy to the rat and human gene) to two distinct sites of transcriptional initiation. As a control the Northern blot was probed with a probe from rat ⁇ actin.
  • Figure 2B is a graph showing the HVA/DOPAC ratio in the striatum, frontal cortex, amygdala, and hypothalamus of male and female homozygous knockout mice of the present invention and wild type animals. Values are the average+S.E.M. for wild type (gray bar) and homozygous knockout (solid bar) mice. Differences between wild type and homozygous mice tested by Mann- Whitney
  • Figure 3 has four (4) panels of graphs showing the effect of COMT gene disruption on dopamine (DA), norepinepherine (NE), serotonin (5-HT), and its metabolite 5- hydroxyindole acetic acid (5-HIAA).
  • the graphs of panels A-D show steady-state levels of DA (A), NE (B), as well 5-HT (C) and 5-HIAA (D) in the striatum, frontal cortex, amygdala, and hypothalamus of homozygous knockout and wild type animals of both sexes. Values are average (+ S.E.M) for wild type (gray bar) and homozygous knockout (solid bar) mice.
  • (Panel B) NE levels: For Hypothalamus, A ⁇ OVA: Sex x Genotype, F(l ,25) 12.2, pO.OOl .
  • Figures 4 A and 4B have panels with graphs showing the effect of COMT gene disruption on emotionality and sensory gating in knockout mice of the present invention.
  • Homozygous knockout females took longer to emerge into the light than did wild-type females ( Figure 4A, Panel B), and they also spent less time ambulating in the light compartment ( Figure 4A, Panel D).
  • Bonferroni correction showed that homozygous knockout females differed from both wild-type (p ⁇ 0.05) and knockout heterozygous (p ⁇ 0.05) female mice, whereas the latter two groups did not differ from each other.
  • Figure 5 has panels with graphs that show the effects of COMT gene disruption on aggressive behaviors of knockout mice of the present invention. Data were analyzed by a two-way analysis of variance (ANOVA) for repeated measurements for the main effects of genotype and test day and their interaction.
  • Figure 6 is a schematical drawing of the COMT Low allele with a functional polymorphism at codon 158 of the gene encoding COMT. This polymorphism causes an amino acid substitution (from Val to Met) and therefore decreases enzyme activity by 30 % .
  • Figure 7 shows the results of the testing of families with OCD to determine whether polymorphism set forth in Figure 6 is preferentially transmitted in families.
  • results of a Transmission Disequilibrium Test (TDT) and Haplotype Based Haplotype Relative Risk (HHRR) test are disclosed which show the preferential transmission of allele 2 in males with OCD.
  • Allele 2 is the COMT Low allele with a polymorphism as set forth in Figure 6.
  • Figure 8 is a schematical drawing of a functional polymorphism of the monoamine oxidase A (MAO-A) gene, which is associated with Low MAO-A (allele 1) or High MAO-A (allele 2) activity of the enzyme.
  • MAO-A monoamine oxidase A
  • Figure 9 shows the results of testing the same families that were tested to produce the test results set forth in Figure 7, to determine whether the polymorphism schematically set forth Figure 8 is preferentially transmitted in families.
  • a TDT and HHRR were performed, and the results support a role for the MAO-A gene as a susceptibility factor for OCD in males, since preferential transmission of allele 2 in males with OCD was observed under both tests.
  • the role of the gene for Catechol- -methyltransferase (COMT), a key modulator of dopaminergic and noradrenergic neurotransmission, is elucidated with respect to a genetic predisposition to OCD or disorders related thereto. It can be shown that a functional allele of this gene which results in a three-to-four-fold reduction in enzyme activity, is significantly associated in a recessive manner with susceptibility of males to OCD or disorders related thereto. The mechanism underlying this association remains to be defined, but it appears to be most likely related to sexual dimorphism in COMT activity and the existence of yet largely undefined subtypes of OCD.
  • COMP Catechol- -methyltransferase
  • MAO- A monoamine oxidase A
  • a common genetic polymorphism in humans has been shown to be associated with a three-to-four-fold variation in COMT enzyme activity. It has been shown that this variation in activity is due to a G-> A transition at codon 158 of the COMT gene that results in a valine (Val) to methionine (Met) substitution 13, 14, 15 .
  • the two alleles (Val 158 or High and Met 158 or Low) and the three genotypes (Val 158 /Val 158 or
  • Val 158 /Met 158 or High/Low; Met l58 /Met 158 or Low/Low) can be identified with a PCR-based restriction fragment length polymorphism analysis using the restriction enzyme Nlalll.
  • Odds ratios (approximate relative risks) in r ⁇ ales relative to one genotype over another were computed. Results in Table 2 below show that genotypes H/L and H/H do not differ significantly from each other in their effect as risk factors for disease, while the L/L/ genotype appears to be a strong risk factor. Thus, the COMT gene appears to act in a recessive manner. Pooling genotypes H/L and H/H leads to an approximate relative risk of 5.91 for genotype L/L versus non-L/L (last line in Table 2). Analogous results shown below in Table 3 were obtained when analyses were carried out for alleles rather than genotypes, that is, association is essentially confined to males. Table 2. Odds Ratio (approximate relative risk) for disease with genotype as a risk factor (confidence interval computed as logit limits)
  • dopamine antagonists in the regimens of patients resistant to serotonin reuptake inhibitors appears to be an approach of choice for a subset of OCD patients, most notably, but not exclusively, for the ones with a comorbid chronic tic disorder (e.g. , Tourette's syndrome) and possibly for those with concurrent psychotic spectrum disorders 4 .
  • a comorbid chronic tic disorder e.g. , Tourette's syndrome
  • This test takes affected individuals with their two parents. All three are typed for a marker, one allele of which is believed to be associated with the disease. The 'control' is not a real individual, but consists of the two parental alleles which were not transmitted to the affected person.
  • a 2x2 table is made of marker frequencies in the probands and controls, and significance tested by a simple ⁇ 2 test (Table 4). In its simplest form, as shown, no distinction is made between probands homozygous or heterozygous for the marker, not between affected and unaffected parents .
  • TDT Transmission Disequilibrium Test
  • the HHRR test The controls arc made from the two marker alleles which the parents of the affected pr ⁇ band did not transmit to the proband.
  • the TDT families arc selected where affected probands have at least one parent who is heterozygous for M l .
  • the transmitted and nontransmitted parental alleles arc compared.
  • results of the TDT show a clear link between the Low COMT allele in male affected offspring of these families, and a susceptibility to OCD, or disorders related thereto.
  • the present invention also discloses that a polymorphism of a gene encoding monoamine oxidase A (MAO-A) is also involved in the pathophysiology l ' OCD and disorders related thereto, and can also be targeted in the treatment of this disease.
  • Figure 8 is a schematical drawing of the polymorphism. Using the same families that were used in the HHRR and TDT conducted regarding the Low COMT allele, HHRR and TDT tests were performed to determine whether the MAO-A polymorphism is preferentially transferred in families, and is related to OCD.
  • proteins displaying substantially equivalent or altered activity are likewise contemplated.
  • modifications may be deliberate, for example, such as modifications obtained through site-directed mutagenesis, or may be accidental, such as those obtained through mutations in hosts that are producers of the complex or its named subunits.
  • OCD osteoporous compulsive disorder and (OCD), and any variants not specifically listed may be used herein interchangeably.
  • amino acid residues described herein are preferred to be in the "L" isomeric form.
  • residues in the "D” isomeric form can be substituted for any L- amino acid residue, as long as the desired functional property of immunoglobulin- binding is retained by the polypeptide.
  • NH 2 refers to the free amino group present at the amino terminus of a polypeptide.
  • COOH refers to the free carboxy group present at the carboxy terminus of a polypeptide.
  • a “replicon” is any genetic element (e.g. , plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo; i.e., capable of replication under its own control.
  • a "vector” is a replicon, such as plasmid, phage or cosmid, to which another DNA segment may be attached so as to bring about the replication of the attached segment.
  • a "DNA molecule” refers to the polymeric form of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in its either single stranded form, or a double- stranded helix. This term refers only to the primary and secondary stracture of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear DNA molecules (e.g. , restriction fragments), viruses, plasmids, and chromosomes.
  • sequences may be described herein according to the normal convention of giving only the sequence in the 5 ' to 3' direction along the nontranscribed strand of DNA (i.e. , the strand having a sequence homologous to the mRNA).
  • a DNA "coding sequence” is a double-stranded DNA sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5 ' (amino) terminus and a translation stop codon at the 3' (carboxyl) terminus.
  • a coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g. , mammalian) DNA, and even synthetic DNA sequences.
  • a polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence.
  • Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, polyadenylation signals, terminators, and the like, that provide for the expression of a coding sequence in a host cell.
  • a “promoter sequence” is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3 ' direction) coding sequence.
  • the promoter sequence is bounded at its 3 ' terminus by the transcription initiation site and extends upstream (5 ' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background.
  • a transcription initiation site (conveniently defined by mapping with nuclease SI), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
  • Eukaryotic promoters will often, but not always, contain "TATA" boxes and "CAT” boxes.
  • Prokaryotic promoters contain Shine-Dalgarno sequences in addition to the -10 and -35 consensus sequences.
  • An “expression control sequence” is a DNA sequence that controls and regulates the transcription and translation of another DNA sequence.
  • a coding sequence is "under the control" of transcriptional and translational control sequences in a cell when RNA polymerase transcribes the coding sequence into mRNA, which is then translated into the protein encoded by the coding sequence.
  • a "signal sequence” can be included before the coding sequence. This sequence encodes a signal peptide, N-terminal to the polypeptide, that communicates to the host cell to direct the polypeptide to the cell surface or secrete the polypeptide into the media, and this signal peptide is clipped off by the host cell before the protein leaves the cell. Signal sequences can be found associated with a variety of proteins native to prokaryotes and eukaryotes.
  • oligonucleotide as used herein in referring to the probe of the present invention, is defined as a molecule comprised of two or more ribonucleotides, preferably more than three. Its exact size will depend upon many factors which, in turn, depend upon the ultimate function and use of the oligonucleotide.
  • primer refers to an oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product, which is complementary to a nucleic acid strand, is induced, i.e. , in the presence of nucleotides and an inducing agent such as a DNA polymerase and at a suitable temperature and pH.
  • the primer may be either single-stranded or double-stranded and must be sufficiently long to prime the synthesis of the desired extension product in the presence of the inducing agent.
  • the exact length of the primer will depend upon many factors, including temperature, source of primer and use of the method. For example, for diagnostic applications, depending on the complexity of the target sequence, the oligonucleotide primer typically contains 15-25 or more nucleotides, although it may contain fewer nucleotides.
  • the primers herein are selected to be “substantially" complementary to different strands of a particular target DNA sequence. This means that the primers must be sufficiently complementary to hybridize with their respective strands. Therefore, the primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5' end of the primer, with the remainder of the primer sequence being complementary to the strand. Alternatively, non-complementary bases or longer sequences can be interspersed into the primer, provided that the primer sequence has sufficient complementarity with the sequence of the strand to hybridize therewith and thereby form the template for the synthesis of the extension product.
  • a cell has been "transformed” by exogenous or heterologous DNA when such DNA has been introduced inside the cell.
  • the transforming DNA may or may not be integrated (covalently linked) into chromosomal DNA making up the genome of the cell.
  • the transforming DNA may be maintained on an episomal element such as a plasmid.
  • a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the transforming DNA.
  • a "clone” is a population of cells derived from a single cell or common ancestor by mitosis.
  • a "cell line” is a clone of a primary cell that is capable of stable growth in vitro for many generations.
  • Two DNA sequences are "substantially homologous" when at least about 75% (preferably at least about 80% , and most preferably at least about 90 or 95 %) of the nucleotides match over the defined length of the DNA sequences. Sequences that are substantially homologous can be identified by comparing the sequences using standard software available in sequence data banks, or in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g. , Maniatis et al. , supra; DNA Cloning, Vols. I & II, supra; Nucleic Acid Hybridization, supra.
  • DNA sequences encoding Catechol- -methyltransferase which code for a Catechol-O- methyltransferase having the same amino acid sequence, but which are degenerate thereto.
  • degenerate DNA sequences which encode for monoamine oxidase-A having the same amino acid sequence.
  • degenerate to is meant that a different three-letter codon is used to specify a particular amino acid. It is well known in the art that the following codons can be used interchangeably to code for each specific amino acid:
  • codons specified above are for RNA sequences.
  • the corresponding codons for DNA have a T substituted for U.
  • Mutations can be made in the DNA of COMT or the DNA of MAO-A such that a particular codon is changed to a codon which codes for a different amino acid. Such a mutation is generally made by making the fewest nucleotide changes possible.
  • a substitution mutation of this sort can be made to change an amino acid in the resulting protein in a non-conservative manner ⁇ i.e. , by changing the codon from an amino acid belonging to a grouping of amino acids having a particular size or characteristic to an amino acid belonging to another grouping) or in a conservative manner ⁇ i.e. , by changing the codon from an amino acid belonging to a grouping of amino acids having a particular size or characteristic to an amino acid belonging to the same grouping).
  • Such a conservative change generally leads to less change in the structure and function of the resulting protein.
  • a non- conservative change is more likely to alter the structure, activity or function of the resulting protein.
  • the present invention should be considered to include sequences containing conservative changes which do not significantly alter the activity or binding characteristics of the resulting protein.
  • Another grouping may be those amino acids with phenyl groups:
  • Another grouping may be according to molecular weight (i.e. , size of R groups):
  • Amino acid substitutions may also be introduced to substitute an amino acid with a particularly preferable property.
  • a Cys may be introduce a potential site for disulfide bridges with another Cys.
  • a His may be introduced as a particularly "catalytic" site (i.e., His can act as an acid or base and is the most common amino acid in biochemical catalysis).
  • Pro may be introduced because of its particularly planar structure, which induces ⁇ -turns in the protein's stracture.
  • Two amino acid sequences are "substantially homologous" when at least about 70% of the amino acid residues (preferably at least about 80% , and most preferably at least about 90 or 95 %) are identical, or represent conservative substitutions.
  • a "heterologous" region of the DNA construct is an identifiable segment of DNA within a larger DNA molecule that is not found in association with the larger molecule in nature.
  • the gene when the heterologous region encodes a mammalian gene, the gene will usually be flanked by DNA that does not flank the mammalian genomic DNA in the genome of the source organism.
  • Another example of a heterologous coding sequence is a construct where the coding sequence itself is not found in nature (e.g., a cDNA where the genomic coding sequence contains introns, or synthetic sequences having codons different than the native gene). Allelic variations or naturally-occurring mutational events do not give rise to a heterologous region of DNA as defined herein.
  • an “antibody” is any immunoglobulin, including antibodies and fragments thereof, that binds a specific epitope.
  • the term encompasses polyclonal, monoclonal, and chimeric antibodies, the last mentioned described in further detail in U.S. Patent Nos. 4,816,397 and 4,816,567.
  • an "antibody combining site” is that structural portion of an antibody molecule comprised of heavy and light chain variable and hypervariable regions that specifically binds antigen.
  • antibody molecule in its various grammatical forms as used herein contemplates both an intact immunoglobulin molecule and an immunologically active portion of an immunoglobulin molecule.
  • Exemplary antibody molecules are intact immunoglobulin molecules, substantially intact immunoglobulin molecules and those portions of an immunoglobulin molecule that contains the paratope, including those portions known in the art as Fab, Fab' , F(ab') 2 and F(v), which portions are preferred for use in the therapeutic methods described herein.
  • Fab and F(ab') 2 portions of antibody molecules are prepared by the proteolytic reaction of papain and pepsin, respectively, on substantially intact antibody molecules by methods that are well-known. See for example, U.S. Patent No. 4,342,566 to Theofilopolous et al. Fab' antibody molecule portions are also well- known and are produced from F(ab') 2 portions followed by reduction of the disulfide bonds linking the two heavy chain portions as with mercaptoethanol, and followed by alkylation of the resulting protein mercaptan with a reagent such as iodoacetamide.
  • An antibody containing intact antibody molecules is preferred herein.
  • the phrase "monoclonal antibody” in its various grammatical forms refers to an antibody having only one species of antibody combining site capable of immunoreacting with a particular antigen.
  • a monoclonal antibody thus typically displays a single binding affinity for any antigen with which it immunoreacts.
  • a monoclonal antibody may therefore contain an antibody molecule having a plurality of antibody combining sites, each immunospecific for a different antigen; e.g. , a bispecific (chimeric) monoclonal antibody.
  • pharmaceutically acceptable refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.
  • terapéuticaally effective amount is used herein to mean an amount sufficient to treat, and preferably increase by at least about 30 percent, more preferably by at least 50 percent, most preferably by at least 90 percent, a clinically significant change in obsessive-compulsive disorder, and disorders related thereto, due to the lowered levels of COMT.
  • levels of MAO-A are used herein to mean an amount sufficient to treat, and preferably increase by at least about 30 percent, more preferably by at least 50 percent, most preferably by at least 90 percent, a clinically significant change in obsessive-compulsive disorder, and disorders related thereto, due to the lowered levels of COMT.
  • terapéuticaally effective amount as used herein means an amount to treat, and preferably to increase by at least 30 present, more preferably by at least 50 % , most preferably by at least 90% , a clinically significant change in obsessive-compulsive disorder, or disorders related thereto, due to modulating levels of activity of MAO- A.
  • a DNA sequence is "operatively linked" to an expression control sequence when the expression control sequence controls and regulates the transcription and translation of that DNA sequence.
  • the term "operatively linked” includes having an appropriate start signal (e.g. , ATG) in front of the DNA sequence to be expressed and maintaining the correct reading frame to permit expression of the DNA sequence under the control of the expression control sequence and production of the desired product encoded by the DNA sequence. If a gene that one desires to insert into a recombinant DNA molecule does not contain an appropriate start signal, such a start signal can be inserted in front of the gene.
  • standard hybridization conditions refers to salt and temperature conditions substantially equivalent to 5 x SSC and 65 °C for both hybridization and wash. However, one skilled in the art will appreciate that such “standard hybridization conditions” are dependent on particular conditions including the concentration of sodium and magnesium in the buffer, nucleotide sequence length and concentration, percent mismatch, percent formamide, and the like. Also important in the determination of “standard hybridization conditions” is whether the two sequences hybridizing are RNA-RNA, DNA-DNA or RNA-DNA. Such standard hybridization conditions are easily determined by one skilled in the art according to well known formulae, wherein hybridization is typically 10-20°C below the predicted or determined T m with washes of higher stringency, if desired.
  • the present invention concerns the identification of a patient population having modulated levels of COMT, which indicates a high susceptibility to obsessive-compulsive disorder, and disorders related thereto.
  • the present invention concerns the identification of a patient population having modulated levels of MAO-A, which indicates a high susceptibility to obsessive-compulsive disorder, and disorders related thereto.
  • the present invention relates to all members of the herein disclosed COMT, and all members of the herein disclosed MAO-A.
  • the present invention also relates to a recombinant DNA molecule or cloned gene, or a degenerate variant thereof, which encodes a COMT, or a fragment thereof; preferably a nucleic acid molecule, in particular a recombinant DNA molecule or cloned gene, encoding the COMT, which can be used to therapeutically administer COMT to a patient in need of such therapy.
  • Such a DNA molecule can be used to therapeutically administer MAO-A to a subject with modulated levels of MAO-A.
  • the present invention contemplates pharmaceutical intervention in the cascade of reactions in which the levels of COMT is implicated, to moderate or abate the symptoms of obsessive-compulsive disorder.
  • modulated levels of MAO-A in a subject are also related to the exhibition of obsessive compulsive disorder, or disorders related thereto, in a subject.
  • modulation results from a polymorphism in the allele comprising the MAO-A gene.
  • a G to A substitution at the third base of codon 941 of the MAO-A results in a Fnu4Ul RFLP site, which results in a modulation of levels of activity of MAO-A as compared to a standard.
  • This modulation is related to a susceptibility for, or presence of, OCD, or disorders related thereto.
  • the COMT or their binding partners may be prepared in pharmaceutical compositions, with a suitable carrier and at a strength effective for administration by various means to a patient experiencing the symptoms of obsessive-compulsive disorder or disorders related thereto.
  • the present invention extends to pharmaceutical compositions comprising a modulator of MAO-A activity, including MAO-A, and a pharmaceutically acceptable carrier thereof. Such compositions can be used to modulate the activity of MAO-A in subjects in order to ameliorate the symptoms of obsessive compulsive disorder, or disorders related thereto.
  • a variety of administrative techniques may be utilized, among them parenteral techniques such as subcutaneous, intravenous and intraperitoneal injections, catheterizations and the like. Average quantities of the COMT or MAO-A, or their subunits may vary and in particular should be based upon the recommendations and prescription of a qualified physician or veterinarian.
  • antibodies including both polyclonal and monoclonal antibodies, and drags that modulate the production or activity of the COMT and/or their subunits, or MAO-A and/or their subunits, may possess certain diagnostic applications and may for example, be utilized for the purpose of detecting and/or measuring the susceptibility to or presence of obsessive-compulsive disorder.
  • the COMT or their subunits, or MAO-A and their subunits may be used to produce both polyclonal and monoclonal antibodies to themselves in a variety of cellular media, by known techniques such as the hybridoma technique utilizing, for example, fused mouse spleen lymphocytes and myeloma cells.
  • small molecules that mimic the activity (ies) of the COMT or MAO-A may be discovered or synthesized, and may be used in diagnostic and/or therapeutic protocols.
  • Panels of monoclonal antibodies produced against COMT can be screened for various properties; i.e. , isotope, epitope, affinity, etc.
  • monoclonal antibodies that neutralize the activity of the COMT or its subunits. Such monoclonals can be readily identified in COMT activity assays. High affinity antibodies are also useful when immunoaffinity purification of native or recombinant COMT is possible.
  • the anti-COMT antibody used in the diagnostic methods of this invention is an affinity purified polyclonal antibody. More preferably, the antibody is a monoclonal antibody (mAb).
  • mAb monoclonal antibody
  • the anti- antibody molecules used herein be in the form of Fab, Fab' , F(ab') 2 or F(v) portions of whole antibody molecules.
  • Panels of monoclonal antibodies produced against MAO-A can also be screened for various properties; i.e. , isotope, epitope, affinity, etc.
  • monoclonal antibodies that neutralize the activity of the MAO-A or their subunits can be readily identified in MAO-A activity assays.
  • High affinity antibodies are also useful when immunoaffinity purification of native or recombinant MAO-A is possible.
  • an anti-COMT or anti -MAO- A antibody used in the diagnostic methods of this invention is an affinity purified polyclonal antibody. More preferably, the antibody is a monoclonal antibody (mAb).
  • mAb monoclonal antibody
  • the anti- antibody molecules used herein be in the form of Fab, Fab' , F(ab') 2 or F(v) portions of whole antibody molecules.
  • one diagnostic method of the present invention comprises examining a cellular sample or medium by means of an assay including an effective amount of an antagonist to a COMT/protein, such as an anti- COMT antibody, preferably an affinity -purified polyclonal antibody, and more preferably a mAb.
  • an antagonist to a COMT/protein such as an anti- COMT antibody, preferably an affinity -purified polyclonal antibody, and more preferably a mAb.
  • the anti-COMT antibody molecules used herein be in the form of Fab, Fab' , F(ab') 2 or F(v) portions or whole antibody molecules.
  • patients capable of benefitting from this method include those suffering from OCD and related disorders such as major depression, dysthymia, bipolar disorder, and anxiety disorders such as panic disorder, panic disorder with agoraphobia, social phobia, attention deficit hyperactivity disorder, as well as eating disorders and Tourette's Syndrome.
  • OCD and related disorders such as major depression, dysthymia, bipolar disorder, and anxiety disorders such as panic disorder, panic disorder with agoraphobia, social phobia, attention deficit hyperactivity disorder, as well as eating disorders and Tourette's Syndrome.
  • Another diagnostic method of the present invention comprises examining a cellular sample or medium by means of an assay including an effective amount of an antagonist to an MAO-A/protein, such as an anti- MAO-A antibody, preferably an affinity -purified polyclonal antibody, and more preferably a mAb.
  • an antagonist to an MAO-A/protein such as an anti- MAO-A antibody, preferably an affinity -purified polyclonal antibody, and more preferably a mAb.
  • the anti-MAO-A antibody molecules used herein be in the form of Fab, Fab' , F(ab') 2 or F(v) portions or whole antibody molecules.
  • Patients capable of benefitting from this method include those suffering from OCD and related disorders which are described above.
  • a myeloma or other self-perpetuating cell line is fused with lymphocytes obtained from the spleen of a mammal hyperimmunized with a COMT-binding portion thereof, or COMT, or an origin-specific DNA-binding portion thereof.
  • a self-perpetuating cell line is fused with lymphocytes obtained from the spleen of a mammal hyperimmunized with an MAO-A-binding portion thereof, or MAO-A.
  • Splenocytes are typically fused with myeloma cells using polyethylene glycol (PEG) 6000.
  • Fused hybrids are selected by their sensitivity to HAT.
  • Hybridomas producing a monoclonal antibody useful in practicing this invention are identified by their ability to immunoreact with the present COMT or MAO-A and their ability to inhibit either specified COMT activity or specified MAO-A activity in target cells.
  • a monoclonal antibody useful in practicing the present invention can be produced by initiating a monoclonal hybridoma culture comprising a nutrient medium containing a hybridoma that secretes antibody molecules of the appropriate antigen specificity.
  • the culture is maintained under conditions and for a time period sufficient for the hybridoma to secrete the antibody molecules into the medium.
  • the antibody -containing medium is then collected.
  • the antibody molecules can then be further isolated by well-known techniques.
  • DMEM Dulbecco's minimal essential medium
  • a subject therapeutic composition includes, in admixture, a pharmaceutically acceptable excipient (carrier) and one or more of a COMT, polypeptide analog thereof or fragment thereof, as described herein as an active ingredient.
  • the present invention extends to therapeutic compositions useful in modulating levels of MAO-A in a subject, and hence ameliorating in the subject the symptoms of OCD, or disorders related thereto.
  • a therapeutic composition includes, in admixture, a pharmaceutically acceptable excipient (carrier) and one or more of an MAO-A, polypeptide analog thereof, or fragment thereof, as described herein as the active ingredient.
  • compositions which contain polypeptides, analogs or active fragments as active ingredients are well understood in the art.
  • such compositions are prepared as injectables, either as liquid solutions or suspensions, however, solid forms suitable for solution in, or suspension in, liquid prior to injection can also be prepared.
  • the preparation can also be emulsified.
  • the active therapeutic ingredient is often mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like and combinations thereof.
  • the composition can contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents which enhance the effectiveness of the active ingredient.
  • a polypeptide, analog or active fragment can be formulated into the therapeutic composition as neutralized pharmaceutically acceptable salt forms.
  • Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the polypeptide or antibody molecule) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed from the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the like.
  • the therapeutic polypeptide-, analog- or active fragment-containing compositions are conventionally administered intravenously, as by injection of a unit dose, for example.
  • unit dose when used in reference to a therapeutic composition of the present invention refers to physically discrete units suitable as unitary dosage for humans, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required diluent; i.e. , carrier, or vehicle.
  • compositions are administered in a manner compatible with the dosage formulation, and in a therapeutically effective amount.
  • quantity to be administered depends on the subject to be treated, and the severity of the disease under treatment. Precise amounts of active ingredient required to be administered depend on the judgment of the practitioner and are peculiar to each individual. However, suitable dosages may range from about 0.1 to 20, preferably about 0.5 to about 10, and more preferably one to several, milligrams of active ingredient per kilogram body weight of individual per day and depend on the route of administration.
  • compositions of the present invention intended to increase levels of COMT in a subject may further include an effective amount of a dopamine antagonist in combination with the COMT or COMT agonist which is an agent capable of mimicking the activity of COMT.
  • a dopamine antagonist in combination with the COMT or COMT agonist which is an agent capable of mimicking the activity of COMT.
  • dopamine antagonists are those such as haloperidol and pimozide. Exemplary formulations are given below:
  • Intravenous Formulation I Ingredient mg/ml Ingredient mg/ml
  • COMT/COMT agonist 10.0 dextrose USP 45.0 sodium bisulfite USP 3.2 edetate disodium USP 0.1 water for injection q.s.a.d. 1.0 ml
  • Intravenous Formulation II Ingredient mg/ml COMT/COMT agonist 5.0 haloperidol 5.0 sodium bisulfite USP 3.2 disodium edetate USP 0.1 water for injection q.s.a.d. 1.0 ml
  • pg means picogram
  • ng means nanogram
  • ug means nanogram
  • ug means microgram
  • mg means milligram
  • ul means microliter
  • ml means milliliter
  • 1 means liter.
  • DNA sequences disclosed herein may be expressed by operatively linking them to an expression control sequence in an appropriate expression vector and employing that expression vector to transform an appropriate unicellular host.
  • Such operative linking of a DNA sequence of this invention to an expression control sequence includes, if not already part of the DNA sequence, the provision of an initiation codon, ATG, in the correct reading frame upstream of the DNA sequence.
  • a wide variety of host/expression vector combinations may be employed in expressing the DNA sequences of this invention.
  • Useful expression vectors may consist of segments of chromosomal, non-chromosomal and synthetic DNA sequences.
  • Suitable vectors include derivatives of SV40 and known bacterial plasmids, e.g. , E. coli plasmids col ⁇ l, pCRl, pBR322, pMB9 and their derivatives, plasmids such as RP4; phage DNAS, e.g.
  • phage ⁇ e.g., NM989, and other phage DNA
  • yeast plasmids such as the 2 ⁇ plasmid or derivatives thereof
  • vectors useful in eukaryotic cells such as vectors useful in insect or mammalian cells
  • vectors derived from combinations of plasmids and phage DNAs such as plasmids that have been modified to employ phage DNA or other expression control sequences; and the like.
  • any of a wide variety of expression control sequences sequences that control the expression of a DNA sequence operatively linked to it — may be used in these vectors to express the DNA sequences of this invention.
  • useful expression control sequences include, for example, the early or late promoters of SV40, CMV, vaccinia, polyoma or adenovirus, the lac system, the trp system, the TAC system, the TRC system, the LTR system, the major operator and promoter regions of phage ⁇ , the control regions of fd coat protein, the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase (e.g. , Pho5), the promoters of the yeast ⁇ -mating factors, and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof.
  • a wide variety of unicellular host cells are also useful in expressing the DNA sequences of this invention.
  • These hosts may include well known eukaryotic and prokaryotic hosts, such as strains of E. coli, Pseudomonas, Bacillus, Streptomyces, fungi such as yeasts, and animal cells, such as CHO, Rl.l, B-W and L-M cells, African Green Monkey kidney cells (e.g. , COS 1, COS 7, BSC1, BSC40, and BMT10), insect cells (e.g. , Sf9), and human cells and plant cells in tissue culture.
  • eukaryotic and prokaryotic hosts such as strains of E. coli, Pseudomonas, Bacillus, Streptomyces, fungi such as yeasts, and animal cells, such as CHO, Rl.l, B-W and L-M cells, African Green Monkey kidney cells (e.g. , COS 1, COS 7, BSC1, BSC
  • Suitable unicellular hosts will be selected by consideration of, e.g. , their compatibility with the chosen vector, their secretion characteristics, their ability to fold proteins correctly, and their fermentation requirements, as well as the toxicity to the host of the product encoded by the DNA sequences to be expressed, and the ease of purification of the expression products.
  • COMT and MAO-A analogs may be prepared from their respective nucleotide sequences encoding their respective protein complex/ subunit derived within the scope of the present invention.
  • Analogs, such as fragments may be produced, for example, by pepsin digestion of COMT or MAO-A material.
  • Other analogs, such as muteins can be produced by standard site-directed mutagenesis of coding sequences of the proteins.
  • Analogs exhibiting "COMT-activity" such as small molecules, whether functioning as promoters or inhibitors, may be identified by known in vivo and/or in vitro assays. Likewise, similar assays may be used to identify analogs exhibiting "MAO-A- activity. " In addition, should modulation of levels of MAO-A be greater than a standard, then these assays can be used to determine whether any MAO-A analogs exhibit an anti-MAO-A activity, or an antagonistic activity towards MAO-A. Such antagonist analogs or derivatives of MAO-A will decrease MAO-A activity so that it approaches the level set forth in the standard. Pharmaceutical compositions can then be made comprising an analog or derivative of MAO-A and a pharmaceutically acceptable carrier thereof.
  • DNA sequences encoding either COMT or MAO-A can be prepared synthetically rather than cloned.
  • a DNA sequence can be designed with the appropriate codons for the COMT amino acid sequence, or for the MAO-A amino acid sequence. In general, one will select preferred codons for the intended host if the sequence will be used for expression.
  • the complete sequence is assembled from overlapping oligonucleotides prepared by standard methods and assembled into a complete coding sequence. See, e.g. , Edge, Nature, 292:756 (1981); Nambair et al. , Science, 223: 1299 (1984); Jay et al. , J. Biol. Chem. , 259:6311 (1984).
  • Synthetic DNA sequences allow convenient construction of genes which will express either COMT or MAO-A analogs or "muteins".
  • DNA encoding muteins can be made by site-directed mutagenesis of native COMT or MAO-A genes or their respective cDNAs, Muteins for these proteins can also be made directly using conventional polypeptide synthesis.
  • the present invention also relates to a variety of diagnostic applications, including methods for detecting a susceptibility to, or the presence of, obsessive-compulsive disorder, or disorders related thereto, by reference to the amount of COMT present in a patient when compared to controls.
  • the COMT can be used to produce antibodies to itself by a variety of known techniques, and such antibodies could then be isolated and utilized as in tests for the presence of particular COMT activity in suspect target cells.
  • the present invention relates to a variety of diagnostic applications and methods for detecting a susceptibility to, or the presence of, OCD, or disorders related thereto, in relation to levels of MAO-A present in a patient as compared to a standard or control.
  • Anti-MAO-A described above have broad applications in these types of diagnostic applications and methods.
  • antibody (ies) to either the COMT or the MAO-A can be produced and isolated by standard methods including the well known hybridoma techniques.
  • the antibody (ies) to the COMT will be referred to herein as Ab, and antibody(ies) raised in another species as Ab 2 (secondary antibody).
  • the presence of COMT in cells can be ascertained by the usual immunological procedures applicable to such determinations.
  • a number of useful procedures are known. Three such procedures which are especially useful utilize either the COMT labeled with a detectable label, antibody Abj labeled with a detectable label, or antibody Ab 2 labeled with a detectable label.
  • the procedures may be summarized by the following equations wherein the asterisk indicates that the particle is labeled, and "COMT" stands for the Catechol-O-methyltransferase:
  • the COMT forms complexes with one or more antibody (ies) or binding partners and one member of the complex is labeled with a detectable label.
  • a complex has formed and, if desired, the amount thereof, can be determined by known methods applicable to the detection of labels .
  • Ab 2 will react with Ab,. This is because Ab, raised in one mammalian species has been used in another species as an antigen to raise the antibody Ab 2 .
  • Ab 2 may be raised in goats using rabbit antibodies as antigens. Ab 2 therefore would be anti-rabbit antibody raised in goats.
  • Ab will be referred to as a primary or anti-COMT antibody, and Ab 2 will be referred to as a secondary or anti-Ab, antibody.
  • Similar diagnostic methods can be used to determine levels of activity of MAO-A in a sample, except that anti-MAO-A antibodies would be used, and secondary antibodies would be made against anti-MAO-A antibodies .
  • the labels most commonly employed for these studies are radioactive elements, enzymes, chemicals which fluoresce when exposed to ultraviolet light, and others.
  • fluorescent materials are known and can be utilized as labels. These include, for example, fluorescein, rhodamine, auramine, Texas Red, AMCA blue and Lucifer Yellow.
  • a particular detecting material is anti-rabbit antibody prepared in goats and conjugated with fluorescein through an isothiocyanate.
  • the COMT or its binding partner(s), or MAO-A or its binding partner(s), can also be labeled with a radioactive element or with an enzyme.
  • the radioactive label can be detected by any of the currently available counting procedures.
  • the preferred isotope may be selected from ⁇ , 14 C, 32 P, 5 S, 6 C1, 51 Cr, 57 Co, 58 Co, 59 Fe, 90 Y, 125 I, 131 I, and 186 Re.
  • Enzyme labels are likewise useful, and can be detected by any of the presently utilized calorimetric, spectrophotometric, fluorospectrophotometric, amperometric or gasometric techniques.
  • the enzyme is conjugated to the selected particle by reaction with bridging molecules such as carbodiimides, diisocyanates, glutaraldehyde and the like. Many enzymes which can be used in these procedures are known and can be utilized. The preferred are peroxidase, ⁇ -glucuronidase, ⁇ -D-glucosidase, ⁇ -D-galactosidase, urease, glucose oxidase plus peroxidase and alkaline phosphatase.
  • U.S. Patent Nos. 3,654,090; 3,850,752; and 4,016,043 are referred to by way of example for their disclosure of alternate labeling material and methods.
  • a particular assay system developed and utilized in accordance with the present invention is known as a receptor assay.
  • the material to be assayed is appropriately labeled and then certain cellular test colonies are inoculated with a quantity of both the labeled and unlabeled material after which binding studies are conducted to determine the extent to which the labeled material binds to the cell receptors. In this way, differences in affinity between materials can be ascertained.
  • a purified quantity of the COMT or MAO-A may be radiolabeled and combined, for example, with antibodies or other inhibitors thereto, after which binding studies would be carried out. Solutions would then be prepared that contain various quantities of labeled and unlabeled uncombined COMT or MAO-A, and cell samples would then be inoculated and thereafter incubated. The resulting cell monolayers are then washed, solubilized and then counted in a gamma counter for a length of time sufficient to yield a standard error of ⁇ 5 % . These data are then subjected to Scatchard analysis after which observations and conclusions regarding material activity can be drawn. While the foregoing is exemplary, it illustrates the manner in which a receptor assay may be performed and utilized, in the instance where the cellular binding ability of the assayed material may serve as a distinguishing characteristic.
  • an assay useful and contemplated in accordance with the present invention is known as a "cis/trans” assay. Briefly, this assay employs two genetic constructs, one of which is typically a plasmid that continually expresses a particular receptor of interest when transfected into an appropriate cell line, and the second of which is a plasmid that expresses a reporter such as luciferase, under the control of a receptor/ligand complex.
  • one of the plasmids would be a construct that results in expression of the receptor in the chosen cell line, while the second plasmid would possess a promoter linked to the luciferase gene in which the response element to the particular receptor is inserted.
  • the compound under test is an agonist for the receptor
  • the ligand will complex with the receptor, and the resulting complex will bind the response element and initiate transcription of the luciferase gene.
  • the resulting chemiluminescence is then measured photometrically, and dose response curves are obtained and compared to those of known ligands.
  • the foregoing protocol is described in detail in U.S. Patent No. 4,981 ,784 and PCT International Publication No. WO 88/03168, for which purpose the artisan is referred.
  • PCR assay can be utilized.
  • the following primers were used: F: 5' TCACCATCGAGATCAACCCC (SEQ ID NO:6), R: 5' ACAACGGGTCAGGCATGCA (SEQ ID NO: 7).
  • PCR was performed with the thermostable enzyme Taq polymerase (1.5u/sample) (AmpliTaq, Perkin Elmer Cetus) and a programmable PCR apparatus (MJ Research, Inc.).
  • Target sequences were amplified in a lO ⁇ l reaction mixture containing lOOng of genomic DNA in 75m KCI, lOmM Tris-HCl (pH 9.2), 1.5m MgCl 2 , 5pmol of each primer, lOOm of each dNTP (dATP, dCTP, dGTP, dTTP) and 2 P-dCTP.
  • Amplification was as follows: 94°Cx3min. (IX), 94°Cx30sec./64 o Cxlmin. / 72°Cxlmin. (35X), 72°Cx7min. (IX), 4°Cx5min.
  • 5/xl of the amplified product was digested with MAIU in a 10/xl reaction volume, according to the manufacturer's specifications.
  • the digested product was diluted 1:1 with formamide-dye, denatured at 95°Cx5min. , and electrophoresed in a 6% 1XTBE polyacrylamide gel, at l,200Vx2.5h at room temperature. Gels were dried and signal was detected by overnight autoradiography without an intensifying screen.
  • PCR can also be used to detect a polymorphism of MAO-A in a sample, which modulates levels of activity of MAO-A, and is related to OCD, or disorders related thereto in males, is present.
  • the following primers have been used (in 5' end 3' order): GACCTTGACTGCCAAGAT (SEQ ID NO:8)(sense orientation) and
  • CTTCTTCTTCCAGAAGGCC (SEQ ID NO: 9) (antisense orientation).
  • PCR can be performed with the thermostable enzyme Taq polymerase (1.5u/sample) (AmpliTaq, Perkin Elmer Cetus) and a programmable PCR apparatus (MJ Research Inc.).
  • Target sequences can be amplified in a lO ⁇ l reaction mixture containing 100 ng of genomic DNA in 50mM KCI, lOmM Tris-HCl (pH 8.3), ImM MgCl 2 , 5pmol of each primer, and lOOmM of each dNTP (dATP, dCTP, dGTP, dTTP).
  • Amplification was as follows: 94°Cx4.5min. (IX), 94°Cx30sec. 57 o Cx40sec. 72°Cx40sec. (35X), 72°Cxl0min. (IX), 4°Cx5min.
  • the amplified product is then digested with Fnu4Hl in a 20 ⁇ ,l reaction volume, according to the manufacturer's specifications.
  • the digested product is electrophoresed in a 4% 1XTBE NuSieve agarose gel, at 100Vx2.5h at room temperature.
  • the Gel should then be stained, for example with ethidium bromide, and photographed under ultraviolet light.
  • an activity assay such as described by Weinshilboum and Raymond (1977) 21 , can be utilized to determine the percentage of COMT activity in a sample.
  • test kits suitable for use by a medical specialist may be prepared to determine the presence or absence of predetermined COMT or MAO-A activity, or predetermined COMT or MAO-A activity capability in target patient populations.
  • kits will contain at least the labeled COMT or its binding partner, for instance an antibody specific thereto, and directions, of course, depending upon the method selected, e.g. , “competitive, " "sandwich,” “DASP” and the like.
  • the kits may also contain peripheral reagents such as buffers, stabilizers, etc.
  • kits may also include PCR reagents, such as oligonucleotide primers, enzymes, gel matrixes, buffers, etc.
  • a test kit may be prepared for the diagnosis or detection of a susceptibility to obsessive-compulsive disorder, or disorders related thereto, which comprises measurement of the levels of COMT activity, comprising:
  • kits for measuring the levels of COMT activity may comprise PCR reagents, such as oligonucleotide primers, enzymes, gel matrixes, buffers, directions, including comparison levels of COMT, for use of said kit.
  • a still further alternate can utilize reagents for measuring the levels of COMT activity as described by Weinshiboum and Raymond (1977); and directions, including comparison levels of COMT, for use of said kit.
  • the diagnostic test kit may comprise: (a) a known amount of the COMT as described above (or a binding partner) generally bound to a solid phase to form an immunosorbent, or in the alternative, bound to a suitable tag, or plural such end products, etc. (or their binding partners) one of each;
  • test kit may be prepared and used for the purposes stated above, which operates according to a predetermined protocol (e.g. "competitive, " “sandwich, “ “double antibody, “ etc.), and comprises: (a) a labeled component which has been obtained by coupling the COMT to a detectable label;
  • an assay system for screening potential drags effective to increase the levels of, or the activity of, the COMT may be prepared.
  • the COMT may be introduced into a test system, and the prospective drag may also be introduced into the resulting cell culture, and the culture thereafter examined to observe any changes in the COMT activity of the cells, due either to the addition of the prospective drag alone, or due to the effect of added quantities of the known COMT.
  • kits will contain at least the labeled MAO-A or its binding partner, such as an anti-MAO-A antibody, and directions for using the kit. The directions will be dependent upon the method selected, e.g. , “competitive, " “sandwich, “ “DASP” and the like.
  • the kits may also contain peripheral reagents such as buffers, stabilizers, etc.
  • a test kit may be prepared for the diagnosis or detection of a susceptibility to obsessive-compulsive disorder, or disorders related thereto, which comprises measurement of the levels of MAO-A activity, comprising:
  • An alternate test kit for measuring the levels of MAO-A activity may comprise PCR reagents, such as oligonucleotide primers, enzymes, gel matrixes, buffers, directions, including comparison levels of, MAO-A for use of said kit.
  • PCR reagents such as oligonucleotide primers, enzymes, gel matrixes, buffers, directions, including comparison levels of, MAO-A for use of said kit.
  • a still further alternate can utilize reagents for measuring the levels of MAO-A activity as described by Weinshiboum and Raymond (1977); and directions, including comparison levels of MAO-A, for use of said kit.
  • the diagnostic test kit may comprise:
  • test kit may be prepared and used for the purposes stated above, which operates according to a predetermined protocol (e.g. "competitive, " “sandwich,” “double antibody, “ etc.), and comprises:
  • an assay system for screening potential drags effective to modulate levels of MAO-A may be prepared.
  • the MAO-A may be introduced into a test system, and the prospective drug may also be introduced into the resulting cell culture, and the culture thereafter examined to observe any changes in the MAO-A activity of the cells, due either to the addition of the prospective drag alone, or due to the effect of added quantities of the known MAO- A.
  • disorders related to OCD include but are not limited to, major depression, dysthymia, bipolar disorder and anxiety disorders such as panic disorder, panic disorder with agoraphobia, social phobia, attention deficit hyperactivity disorder, as well as eating disorders and Tourette's Syndrome.
  • a mouse model has been developed and characterized in which at least one allele comprises a defect and is unable to express functional COMT.
  • the introduced defect was transmitted through the germline, and knockout mice homozygous for the defect have been obtained.
  • the expression of the gene for COMT and the activity of the COMT enzyme was examined in these mice.
  • a human COMT cDNA probe was used to screen a mouse brain cDNA library.
  • a full length cDNA clone was isolated ( Figure 1) and part of it used to screen a mouse 129/Sv genomic library.
  • a positive phage encompassing the entire set of COMT coding exons was isolated and used to prepare a targeting construct ( Figure IB).
  • part of the positive phage was replaced by a cassette including the neo gene under the control of PGK promoter. The construct was then inserted into an embryonic stem (ES) cell via electroporation.
  • ES embryonic stem
  • Heterozygous knockout males were mated with C57B6 females and DNA from tail biopsies of FI agouti coat pups was typed by Southern blotting and PCR at the COMT genomic locus.
  • FI heterozygous knockout mice were mated and F2 mice of all three genotypes and of mixed 129/J/C57B6 background were obtained.
  • Heterozygous knockout mice showed the expected pattern of gene disruption ( Figure 1 C), were viable.
  • Homozygous knockout mice i.e. knockout mice of the present invention wherein both alleles comprise a defect and are unable to express functional COMT, were obtained by crossing two heterozygous knockout mice. The frequency at which homozygous knockout mice were obtained was expected (data not shown). The homozygous knockout mice were apparently physically healthy, fertile and gained weight normally.
  • mice brains were rapidly excised following decapitation and were frozen on powdered dry ice. Coronal sections were made with a razor blade, mounted on to a microscope slide and stored at -70°C until sampling. Brain areas were micro-punched from the sections with a 500 mM diameter cannula while the slide rested on the stage of a dissecting microscope which was maintained at -15° C. The frontal cortex block was cut from the brain just anterior to the optic chiasm and four punches were removed from the dorsal frontal cortex.
  • punched tissue was expelled into a sodium acetate buffer (pH 5.0) containing 1 x 10 7 M of a-methyl dopamine as an internal standard (120 ml for striatum and 60 ml for the other areas). Following freeze-thawing and centrifugation, the supernatant was removed and 2 ⁇ l of a 1 mg/ml ascorbate oxidase solution (Sigma Chemical Co.) was added to each sample to minimize the front. 40 ⁇ l were injected in a Waters Associates chromatographic system consisting of a 717 Plus autosampler, 590 pump and C-18 reverse-phase 3 micron Velosep column (Rainin).
  • An EsA 5011 Coulocomb 3100 A electrochemical detector with the screening electrode set at +0.05V and the detecting electrode at +0.35V was utilized. Concentrations of neurotransmitters and metabolites were calculated by reference to standards using peak integration with a computer assisted Waters Millenium system. The pellet was dissolved in 100 ⁇ l of 0.2 N NaOH for protein determination by the Bradford method. Concentrations are expressed as pg/ ⁇ g protein. Measurements were made in two cohorts of mice consisting of male and female homozygous and wild type and pooled for statistical analysis when no sex differences were observed. Brain morphology appeared identical in both homozygous knockout mice and their wild type littermates by gross evaluation.
  • Dopamine is involved in controls over motor function and affect, as well as, central processes (such as sensorimotor gating) which are affected in patients with psychiatric disorders 23 .
  • central processes such as sensorimotor gating
  • mice of both sexes and all three genotypes were housed individually for 5-6 months with free access to food and water.
  • Prepulse inhibition of the startle response PPI was assayed several weeks following the dark/light test. Methods were similar to refs. 24 & 25.
  • Each of two startle chambers (SR-Lab, San Diego Instruments) contained a transparent acrylic cylinder (4 cm in diameter) mounted on a frame to which a motion sensor was attached for the detection and transduction of movement, and a sound generation system for the delivery of background white noise and acoustic stimuli.
  • a CompuAdd 386 microprocessor and SDI interface board and software were used for the delivery of stimuli and response recording (100 1-ms readings beginning at startle stimulus onset). Response amplitude was calculated as the maximum response level occurring during the 100 ms recording.
  • Both chambers were calibrated for equivalent stimulus intensities and response sensitivities, and experimental groups were balanced across chambers.
  • the animal was given a 4 min acclimation period during which background noise (65 dB) was continually present, and then received 4 no-stimulus trials, 4 startle stimulus alone trials, and then 10 sets of the following 4 trial types counterbalanced to control for order: 40 ms, 115 dB noise burst alone (startle stimulus); startle stimulus preceded 100 ms by a 20 ms, 71 dB or 77 dB noise burst; and no-stimulus. Intertrial interval was variable (average 15 sec). At the end of this block of 40 trials, the animal again received 4 startle stimulus alone trials followed by 4 no-stimulus trials.
  • Spontaneous locomotor activity was tested with the protocol described above in an open field apparatus 26 equipped with infrared sensors for the automatic recording of horizontal activity.
  • animals were handled and preexposed to the chamber prior to testing, and activity was monitored under indirect, very dim light and sound-attenuated conditions (unlike the quite aversive classical open-field assays performed under bright light). No significant differences in activity, or in stereotypic behavior were observed among homozygous and wild type animals of either sex (data not shown).
  • any anxiety-like behaviors (collectively termed anxiety, reactivity or emotionality) was recorded using the protocol described above.
  • Apparatus used in this protocol involved a dark/light exploratory model in a 2-compartment light/dark box, a modified open field apparatus, where an enclosed black acrylic box was inserted into the right half of the activity chamber with an opening allowing for passage between a dark and a brightly lit open compartment.
  • Previous work assessing the effects of anxiolytic and anxiogenic agents has established the validity of this procedure in evaluating any anxiety-like behaviors in rodents 27 29 .
  • Variables recorded as a measure of anxiety included latency to emerge from the dark compartment into the more aversive brightly lit compartment, and amount of time spent ambulating in each of the two compartments.
  • Sensorimotor gating is a central processing mechanism that is affected in patients with schizophrenia 23 (one of the neuropsychiatric disorders associated with hemizygous 22ql 1 deletions) 9 - ".
  • Attenuation of the startle response by prepulse inhibition (PPI) provides a measure of sensorimotor gating.
  • PPI occurs when an abrupt startling acoustic stimulus is preceded 30-500 msec by a barely detectable prestimulus or "prepulse”. Mice demonstrate a robust and reliable PPI, which can be disrupted by drugs such as apomorphine and PCP that are known to interfere with dopamine neurotransmission 30 .
  • PPI was recorded in homozygous knockout mice using the protocol described above and expressed as:
  • Homozygous knockout female mice demonstrated altered emotional reactivity in the dark/light exploratory model providing evidence for a role of COMT in the control of some aspects of emotionality in mice. In sharp contrast, sensory reception and processing were unaffected, at least for the stimuli and for the genetic background tested. Behavioral and pharmacological studies on inbred lines using the dark/light exploratory model of anxiety, suggest that the type of emotional behavior assayed in the present study is a central nervous system state with a genetic basis 31 .
  • a knockout male mouse in which both alleles comprise a defect and is incapable of expressing functional COMT has phenotype comprising increased levels of dopamine in the frontal cortex of the brain as determined in situ relative to levels of dopamine in the frontal cortex of a wild type male mouse, as determined in situ, decreased levels of dopamine in the amygdala as determined in situ relative to levels of dopamine in the amygdala of a wild type male mouse, as determined in situ, and increased levels of norepinepherine in the hypothalamus as determined in situ relative of levels of norepinepherine in the hypothalamus of a wild type male mouse, as determined in situ.
  • Applicants have also discovered a knockout mouse in which one allele comprises a defect and is unable to express functional COMT (heterozygous), having a phenotype that exhibits an increase in the frequency of aggressive behavior with shorter latencies to 1 st attack, as determined in situ, relative to the frequency of aggressive behavior in a wild type male mouse, as determined in situ.
  • a knockout female mouse of the present invention in which both alleles comprise a defect, and are unable to express functional COMT (homozygous), has been discovered .
  • its phenotype is unlike that of the homozygous knockout male.
  • a knockout homozygous female mouse of the present invention has a phenotype comprising decreased levels of dopamine in the frontal cortex of the brain as determined in situ relative to levels of dopamine relative to levels of dopamine in the frontal cortex of the brain of a wild type female mouse, as determined in situ, decreased levels of dopamine in the amygdala as determined in situ relative to levels of dopamine in the amygdala of a wild type female mouse as determined in situ, decreased levels of norepinepherine in the hypothalamus as determined in situ relative to levels of norepinepherine in the hypothalamus of a wild type female mouse, as determined in sit, and an increase in any anxiety-like behaviors relative to any anxiety-like behaviors in a wild type female mouse.
  • the behavior of the knockout mice of the present invention is useful for analysis in that test compounds suspected of possessing potential therapeutic utility to ascertain their effects upon the behavioral traits can be administered to the knockout mice. If the behavior of the mice after administration changes relative to the behavior of a control knockout mouse, then the agent has a possible use in the treatment of OCD, or disorders related thereto.
  • the effect of the COMT gene deletion on certain neurotransmitter systems in the brain can be analyzed, and test compounds administered to ascertain their effects thereon.
  • a knockout mouse of the present invention can be used as a bioassay for selecting therapeutic agents potentially useful in the treatment of OCD and disorders related thereto, wherein the method comprises:
  • a method of selecting a therapeutic agent for possible use in the treatment of obsessive compulsive disorder comprises the steps of administering a potential therapeutic agent to a knockout mouse of the present invention, measuring the ratio of homovanillic acid (HVA) to DOPAC in a region of the brain of the knockout mouse, and comparing that measurement to the ratio of HVA to DOPAC in the same region of the brain a control knockout mouse.
  • HVA homovanillic acid
  • disorders related to OCD include, but are not limited to, major depression, dystrophia, bi polar disorder, and anxiety disorders, such as panic disorder, panic disorder with agoraphobia, social phobia, attention deficit hyperactivity disorder, eating disorders and Tourette's Syndrome.6
  • Another method of selecting a therapeutic agent for possible use in the treatment of obsessive compulsive disorder, and disorders related thereto comprises the steps of administering a potential therapeutic agent to a knockout mouse of the present invention, measuring levels of dopamine in the frontal cortex of the knockout mouse, and comparing the measured level of dopamine to levels of dopamine in the frontal cortex of a control knockout mouse of the present invention.
  • a statistically significant difference between the levels of dopamine measured in the frontal cortex of the knockout mouse of the present invention to which the potential therapeutic agent was administered relative to levels of dopamine in the frontal cortex of the control knockout mouse indicates the therapeutic agent has a possible use in the treatment of anxiety disorders.
  • the present invention further extends to methods for selecting a therapeutic agent for possible use in treating obsessive compulsive disorder (OCD) and disorders related thereto.
  • the method disclosed herein comprises the steps of administering a potential agent to a knockout mouse of the present invention, observing behaviors of the knockout mouse, and comparing those behaviors with the behaviors of a control knockout mouse which did not receive the therapeutic agent. A difference in behaviors of the knockout mouse and the control indicate the therapeutic agent has a possible use in the treatment of OCD and disorders related thereto.
  • a knockout male mouse of the present invention with one allele comprising a defect which prevents the allele from expressing functional COMT exhibits an increase in the frequency of aggressive behavior with shorter latencies to initial aggression relative to the frequency and latency of initial aggression observed in a wild-type mouse.
  • a potential agent is administered to such a knockout, which then exhibits a decrease in the frequency of aggressive behavior and latency of initial aggression compared to a control knockout male mouse which did not receive the agent, then the agent has a possible use in treating OCD, and disorders related thereto.
  • the potential agent can be administered to a female knockout mouse of the present invention. If such a female knockout mouse exhibited less anxiety-like behaviors than are exhibited in a control female knockout mouse of the invention, then the agent has a possible use in the treatment of obsessive compulsive disorder (OCD), and disorders related thereto.
  • OCD obsessive compulsive disorder
  • Yet another method for selecting a therapeutic agent for possible use in the treatment of obsessive compulsive disorder, or disorders related thereto, in a subject involves measuring levels of norepinepherine in the hypothalamus of a knockout mouse of the present invention.
  • Such a method comprising the steps of administering a potential therapeutic agent to a knockout mouse of the present invention, measuring levels of norepinepherine in the hypothalamus of the knockout mouse, and comparing the measurement with levels of norepinepherine in the hypothalamus of a control knockout mouse.
  • the therapeutic agent has a possible use in treating OCD and disorders related thereto.
  • disorders related to OCD include, but are not limited to major depression, dysthymia, bipolar disorder and anxiety disorders such as panic disorder, panic disorder with agoraphobia, social phobia, attention deficit hyperactivity disorder, as well as eating disorders and Tourette's Syndrome.
  • mice strains can also be used to identify strain specific modifiers of a COMT associated phenotype.
  • a mouse strain where the low activity form of the human COMT gene can be introduced as a trans gene in a COMT(-) background. These animals can be also utilized in testing compounds that could potentially increase COMT activity and stability.
  • CAGGCATCAA ATCCCGTGCC TGGGGATCCA AGTTCCCCTC TCTCCACCTG TGCTCACCTC 1740
  • TTAACTACCT TTGGCTTAAT TCCAATCATT GTTAAAGTAA AAACAATTCA AAGAATCACC 1800
  • GGAATTCAGA TCTTGAATTG ATGTTACCCT CATAAAGCAC GTGGCCTCTT ATCGAGAAAG 60
  • AAATTACCGT CGCTCGTGAT TTGTTTGCAA AAAGAACAAA ACTGAAAAAA CCCAGACACG 120
  • MOLECULE TYPE other nucleic acid
  • MOLECULE TYPE other nucleic acid
  • MOLECULE TYPE other nucleic acid

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Environmental Sciences (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Physics & Mathematics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Methods of identifying subjects having a susceptibility to obsessive-compulsive disorder, and disorders related thereto, resulting from a reduced level of Cathechol-O-methyltransferase (COMT), or modulated levels of monoamine oxidase A are described. In addition, knockout mice expressing decreased levels of COMT relative to a wild type mouse are disclosed and characterized herein, along with methods for selecting therapeutic agents for possible use in the treatment of OCD or disorder related thereto.

Description

GENE BASED ASSAY FOR AGENTS WITH POTENTIAL THERAPEUTIC
EFFICACY IN THE TREATMENT OF OBSESSIVE COMPULSIVE
DISORDER AND DISORDERS RELATED THERETO
TECHNICAL FIELD OF THE INVENTION
The present invention relates generally to methods for diagnosing and treating obsessive-compulsive disorder and disorders related thereto, and to knockout mouse models for testing compounds useful in said diagnosis and treatment.
BACKGROUND OF THE INVENTION
Obsessive-Compulsive Disorder (OCD) is a common and severe psychiatric condition, which affects 2-3 % of the population1 an 2 and is characterized by anxiety-producing intrusive thoughts and performance of anxiety -reducing rituals. Several studies suggest a genetic component in the etiology of OCD3, but unlike schizophrenia and bipolar illness, no genome-wide search for genes has yet been reported for this disorder. Very little is known about the pathogenesis of the disorder.
Numerous early studies involving the serotonin-specific reuptake inhibitor clomipramine led to the hypothesis that OCD may be associated with dysregulation of serotonergic neurotransmission. Indeed, serotonin reuptake inhibitors have been established as the first-line pharmacotherapy of OCD. However, approximately one-half of the patients who receive an adequate trial with these agents remain clinically unchanged. Use of dopamine antagonists to augment treatment of patients resistant to serotonin uptake inhibitors appears to be a useful approach for a subset of OCD patients, thus implicating involvement of dopaminergic pathways.4 However, there has heretofore been no method available to screen patients to ascertain the appropriate course of therapy. Often, it can take weeks, or even months, to establish the inappropriateness of the therapy, resulting in a continuance or worsening of the patient's condition.
Therefore, in view of the aforementioned deficiencies attendant with prior art methods of diagnosing and treating obsessive-compulsive disorder, it should be apparent that there still exists a need in the art for a method which can reliably distinguish between the populations for which therapy with dopamine antagonists is appropriate, so that early treatment can be initiated.
SUMMARY OF THE INVENTION
In accordance with the present invention, Applicants have discovered heretofore unknown relationships between a subject's susceptibility to obsessive compulsive disorder (OCD), and disorders related thereto, and modulated levels of enzymes involved in the metabolic degradation of dopamine (DA), norepinepherine (NE) and epinepherine5.
Broadly, the present invention extends to a method for detecting a susceptibility to, or the presence of, obsessive-compulsive disorder, or disorders related thereto in a subject, comprising the steps of measuring the levels of activity of an enzyme involved in the metabolic degradation of dopamine (DA), norepinepherine (NE) or epinepherine, and comparing the levels to a standard, whereby modulated levels of activity relative to the standard indicate a susceptibility to, or the presence of, obsessive compulsive disorder, or disorders related thereto. Disorders related to obsessive compulsive disorder include, but are not limited to, major depression, dysthymia, bipolar disorder, and anxiety disorders such as panic disorder, panic disorder with agrophobia, social phobia, attention deficit hyperactivity disorder, eating disorders and Tourette's Syndrome6. One example of an enzyme involved in the metabolic degradation of dopamine (DA), norepinepherine (NE) and epinepherine is catechol-0-methyltransferase (COMT). This enzyme is a Mg2+-dependent enzyme which catalyzes the transfer of methyl groups from S-adenosyl methionine to a hydroxyl group of a catecholic substrate: dopamine is converted into 3-methoxytyramine (3-MT) and norepinephrine is converted into normetanephrine7. COMT is widely distributed in the mammalian brain, although results from pharmacological studies suggest that the relative importance of methylation (by COMT) versus deamination (by monoamine oxidase (MAO)) in the metabolic degradation of catecholamines varies among brain regions, with methylation accounting for about 15% of released DA in striatum and in nucleus accumbens and for more than 60% in frontal cortex8. COMT is absent from the dopaminergic terminals and is thought to be involved in the catabolism of extraneuronal dopamine in glial cells and/or postsynaptic neurons7. The gene for COMT is located at the ql 1 band of human chromosome 22, which has been previously reported to be hemizygously deleted in patients with schizophrenia, childhood onset schizophrenia and obsessive compulsive disorder (OCD)9, 10. In addition, a high frequency of psychiatric symptoms, including anxiety, depression and obsessive compulsive symptoms"' l2, has been described in children and adults with the 22ql l microdeletion.
Applicants have discovered a polymorphism in the gene encoding COMT13' 14, 15. In one allele, hereinafter referred to as the high activity COMT allele or High COMT, codon 158 of the COMT gene encodes for valine. This allele results in the production of COMT having high activity. The nucleic acid sequence for the human COMT gene in High COMT is set forth in SEQ ID NO: 1. In the other allele, hereafter referred to as the low activity COMT allele or Low COMT, an adenine is substituted for a guanine in codon 158, such that this codon encodes for methionine. COMT produced from an allele comprising this polymorphism has much 30% less activity than COMT produced by the High allele. Applicants have discovered a relationship between OCD and the presence of at least one Low allele in a subject's genotype. Data supporting COMT's role in susceptibility of OCD is disclosed herein in Figure 7, and Tables 1, 2 and 3, infra.
Hence, the invention extends to a method for detecting a susceptibility to, or the presence of, obsessive compulsive disorder in a subject, or disorders related thereto, comprising the steps of measuring the levels of activity of COMT and comparing the levels to a standard. Decreased levels of COMT activity in the subject relative to the standard indicates that the subject has OCD, or a disorder related thereto, or a susceptibility to such disorders.
In a particular embodiment, the present invention relates to the use of all members of the herein disclosed family of Catechol-O-methyltransferases.
The present invention also relates to a recombinant DNA molecule or cloned gene, or a degenerate variant thereof, which encodes a Catechol-O-methyltransferase; preferably a nucleic acid molecule, in particular a recombinant DNA molecule or cloned gene, encoding the Catechol-O-methyltransferase, which can be used therapeutically to treat patients suffering from obsessive-compulsive disorder, or disorders related thereto.
The human and murine DNA sequences of the Catechol- -methyltransferase of the present invention or portions thereof, may be prepared as probes to screen for complementary sequences and genomic clones in the same or alternate species. The present invention thus extends to probes so prepared that may be provided for screening cDNA and genomic libraries for the Catechol-O-methyltransferase. For example, the probes may be prepared with a variety of known vectors, such as the phage λ vector. The present invention also includes the preparation of plasmids including such vectors, and the use of the DNA sequences to construct vectors expressing antisense RNA or ribozymes which would attack the mRNAs of any or all of the DNA sequences encoding Catechol-O-methyltransferase. In a further embodiment of the invention, the full DNA sequence of the recombinant DNA molecule or cloned gene so determined may be operatively linked to an expression control sequence which may be introduced into an appropriate host. The invention accordingly extends to unicellular hosts transformed with the cloned gene or recombinant DNA molecule comprising a DNA sequence encoding the present Catechol-O-methyltransferase(s) which can be utilized to administer Catechol- -methyltransferase to patients in need of such therapy.
The present invention naturally contemplates several means for preparation of the Catechol-O-methyltransferase, including as illustrated herein known recombinant techniques, and the invention is accordingly intended to cover such synthetic preparations within its scope. The isolation of the cDNA and amino acid sequences disclosed herein facilitates the reproduction of the Catechol-O-methyltransferase by such recombinant techniques, and accordingly, the invention extends to expression vectors prepared from the disclosed DNA sequences for expression in host systems by recombinant DNA techniques, and to the resulting transformed hosts.
The invention also includes an assay system for screening of potential drugs effective to modulate Catechol-O-methyltransferase activity of target mammalian cells by potentiating the activity, or increasing the amount of Catechol-O- methyltransferase. In one instance, the test drug could be administered to an animal or cellular sample containing the Catechol-O-methyltransferase or an extract containing Catechol-O-methyltransferase to determine its effect upon the activity (modification of any appropriate substrate including neurotransmitters such as dopamine and noradrenaline) of the Catechol-O-methyltransferase, by comparison with a control.
The assay system could more importantly be adapted to identify drugs or other entities that are capable of binding to the Catechol-O-methyltransferase, in the cytoplasm or in the cellular membrane, thereby increasing or potentiating its activity . Such assay would be useful in the development of drugs that would be specific against particular cellular activity, or that would potentiate such activity, in time or in level of activity. For example, such drugs might be used to effectively treat diseases wherein COMT activity is diminished or decreased, especially in the instance of obsessive-compulsive disorder, and related disorders such as major depression, dysthymia, bi-polar disorder, and anxiety disorders such as panic disorder, panic disorder with agoraphobia, social phobia, attention deficit hyperactivity disorder, eating disorders and Tourette's Syndrome, or to treat other pathologies.
The present invention includes an assay system which may be prepared in the form of a test kit for the quantitative analysis of the extent of the presence and/or activity of the COMT, or to identify drugs or other agents that may potentiate or increase such activity. The system or test kit may comprise a labeled component prepared by one of the radioactive and/or enzymatic techniques discussed herein, coupling a label to the COMT, their agonists and/or antagonists, and one or more additional immunochemical reagents, at least one of which is a free or immobilized ligand, capable either of binding with the labeled component, its binding partner, one of the components to be determined or their binding partner(s). The system or test kit may also comprise a polymerase chain reaction based (PCR) assay which can be used to quantify the COMT levels of a sample.
In a further embodiment, the present invention relates to certain therapeutic methods which would be based upon the activity of the COMT(s), its (or their) subunits, or active fragments thereof, or upon agents or other drugs determined to possess the same activity. A first therapeutic method is associated with the prevention of the manifestations of conditions causally related to or following from the decreased levels of COMT activity, either individually or in mixture with each other in an amount effective to prevent the development of those conditions in the host. For example, drugs may be administered to increase or potentiate COMT activity, thereby decreasing or preventing the symptoms of obsessive-compulsive disorder or disorders related thereto.
More specifically, the therapeutic method generally referred to herein could include the method for the treatment of obsessive-compulsive disorder or disorder related thereto, by the administration of pharmaceutical compositions that may comprise effective enhancers of activity of COMT, or other equally effective drugs developed, for instance by a drug screening assay, prepared and used in accordance with a further aspect of the present invention. For example, drugs or other binding partners to the COMT, may be administered to increase the amount of, or the level of activity of COMT.
Another enzyme involved in the metabolic degradation of dopamine (DA), norepinepherine (NE) and epinepherine is monoamine oxidase (MO A). This enzyme is a flavin-containing enzyme which degrades a variety of biogenic amines, including the neurotransmitters norepinephrine, dopamine and serotonin. Two forms of the enzyme, MAO- A and MAO-B, have been identified on the basis of the difference in molecular weight, substrate affinities, inhibitor sensitivities, and immunological properties . These enzymes are expressed throughout the body but differ in developmental and cell-specific expression. MAO-A is expressed at highest levels in catecholaminergic neurons. . Recently, full-length cDNA clones for human MAO-A and MAO-B have been characterized. The nucleotide and amino acid sequences for human MAO-A and MAO-B, as well as for bovine MAO-A and MAO-B, indicate that these two proteins are encoded in separate genes. Genes for MAO-A and MAO-B have been mapped to the p. 11.23-11.4 region of the human X chromosome. The DNA sequence of human MAO-A is set forth in SEQ ID NO:2.
Levels of MAO-A and MAO-B activities are under strong genetic control. Values measured in cells from monozygotic twins are highly correlated, thus suggesting a strong genetic determinant of activity.
It has been determined that a G to T substitution at the third base of codon 941 of human MAO-A results in a FnuAHl RFLP site [Hotamisligil et al., Am. J. Hum. Genet. (1991), 49:383-392] . This MAO-A polymorphism has been associated with high MAO-A activity in vitro when the FnuΑl site is present. This substitution does not result in a change in amino acid at this position. Yet surprisingly, this polymorphism results in a modulation in the level of activity of MAO-A as compared to a standard, and Applicants have discovered that such modulation indicates a susceptibility for, or presence of, OCD, disorders related thereto.
Consequently, the present invention extends to a method for detecting a susceptibility to, or the presence of obsessive disorder, or disorders related thereto, comprising the steps of measuring levels of activity MAO-A , and comparing of the levels to a standard, whereby modulated levels, i.e. levels different from the standard, indicate the susceptibility to, or the presence of, obsessive compulsive disorder, or disorders related thereto. Modulated levels of activity of MAO-A which indicate such susceptibility or presence of OCD, or disorders related thereto, can be greater than the standard, or less than the standard.
The present invention also extends to a recombinant DNA molecule or cloned gene, or a degenerate variant thereof, which encodes a monoamine oxidase- A; preferably a nucleic acid molecule, in particular a recombinant DNA molecule or cloned gene, encoding the monoamine oxidase-A, which can be used therapeutically to treat patients suffering from obsessive-compulsive disorder, and disorders related thereto, as described above.
The human and murine DNA sequences of the monoamine oxidase-A of the present invention, degenerate variants thereof, or fragments thereof, may be prepared as probes to screen for complementary sequences and genomic clones in the same or alternate species. The present invention extends to probes so prepared that may be provided for screening cDNA and genomic libraries for the DNA sequence encoding Monoamine oxidase A. For example, the probes may be prepared with a variety of known vectors, such as the phage λ vector. The present invention also includes the preparation of plasmids including such vectors, and the use of the DNA sequences to construct vectors expressing antisense RNA or ribozymes which would attack the mRNAs of any or all of the DNA sequences encoding monoamine oxidase A.
In a further embodiment of the invention, the full DNA sequence of the recombinant DNA molecule encoding monoamine oxidase A, or cloned gene so determined may be operatively linked to an expression control sequence which may be introduced into an appropriate host. The invention accordingly extends to unicellular hosts transformed with the cloned gene or recombinant DNA molecule comprising a DNA sequence encoding monoamine oxidase A(s) which can be utilized to administer monoamine oxidase A to patients in which modulation of levels of activity of MAO-A involve decreased levels relative to a standard.
The present invention naturally contemplates several means for preparation of the monoamine oxidase A, including as illustrated herein known recombinant techniques, and the invention is accordingly intended to cover such synthetic preparations within its scope. The isolation of the cDNA and amino acid sequences disclosed herein facilitates the reproduction of the monoamine oxidase A by such recombinant techniques, and accordingly, the invention extends to expression vectors prepared from the disclosed DNA sequences for expression in host systems by recombinant DNA techniques, and to the resulting transformed hosts.
The invention further includes an assay system for screening of potential drugs effective to modulate monoamine oxidase A activity of target mammalian cells. Such drugs can potentiate activity, or increase the amount of monoamine oxidase A. Moreover, the assay system can also screen for drugs capable of decreasing monoamine oxidase activity . Such drugs may effectively treat obsessive compulsive disorder, or disorders related thereto, in a subject exhibiting modulated levels of activity of monoamine oxidase A relative to a standard. In one instance, the test drug could be administered to an animal or cellular sample containing the monoamine oxidase A or an extract containing monoamine oxidase A to determine its effect upon the activity (modification of any appropriate substrate including neurotransmitters such as dopamine and noradrenaline) of the monoamine oxidase A, by comparison with a control.
Moreover, the assay system can be adapted to identify drugs or other entities that are capable of binding to the monoamine oxidase A, in the cytoplasm or in the cellular membrane, thereby modulating its activity. Such assay would be useful in the development of drugs that would be specific against particular cellular activity, or that would modulate such activity, in time or in level of activity. For example, such drugs might be used to effectively treat diseases wherein MAO-A activity is modulated relative to a standard, especially in the instance of obsessive-compulsive disorder, and related disorders such as major depression, dysthymia, bipolar disorder, and anxiety disorders such as panic disorder, panic disorder with agoraphobia, social phobia, attention deficit hyperactivity disorder, eating disorders and Tourette's Syndrome, or to treat other pathologies.
The present invention includes an assay system which may be prepared in the form of a test kit for the quantitative analysis of the extent of the presence and/or activity of the monoamine oxidase A, or to identify drugs or other agents that may modulate such activity. The system or test kit may comprise a labeled component prepared by one of the radioactive and/or enzymatic techniques discussed herein, coupling a label to the MAO-A, their agonists and/or antagonists, and one or more additional immunochemical reagents, at least one of which is a free or immobilized ligand, capable either of binding with the labeled component, its binding partner, one of the components to be determined or their binding partner(s). The system or test kit may also comprise a polymerase chain reaction based (PCR) assay which can be used to quantify the MAO-A levels of a sample.
In a further embodiment, the present invention relates to certain therapeutic methods which would be based upon the levels of activity of the MAO-A(s), its (or their) subunits, or active fragments thereof, or upon agents or other drags determined to possess the same activity. A first therapeutic method is associated with the prevention of the manifestations of conditions causally related to or following from the modulated levels of MAO-A activity relative to a standard, either individually or in mixture with each other in an amount effective to prevent the development of those conditions in the host. For example, drugs may be administered to increase or potentiate MAO-A activity. Furthermore, drugs may be administered to decrease MAO-A activity. Administration of such a drug, depending on the levels of MAO-A exhibited by a subject relative to the standard, and decreasing or preventing the symptoms of obsessive-compulsive disorder, or disorders related thereto and described above.
More specifically, the therapeutic method generally referred to herein could include the method for the treatment of obsessive-compulsive disorder, or disorders related thereto, by the administration of pharmaceutical compositions that may comprise effective enhancers of activity of MAO-A, or other equally effective drugs developed for instance by a drug screening assay prepared and used in accordance with a further aspect of the present invention. For example, drugs or other binding partners to the MAO-A, may be administered to increase the amount of, or the level of activity of MAO-A, and be beneficial to subject suffering from OCD or a disorder related thereto, wherein the subject exhibits levels of activity of MAO-A lower than a standard. In another embodiment, a therapeutic method referred to herein could include a treatment for OCD, or disorders related thereto, by the administration of pharmaceutical compositions that may comprise effective inhibitors of activity of MAO-A. Such drugs can be developed by a drug screening assay disclosed herein. Hence, drags determined to decrease the levels of activity of MAO-A in subjects suffering from OCD, or disorders related thereto, can be used to treat such subjects exhibiting increased levels of activity of MAO-A relative to a standard.
Furthermore, the present invention extends to a knockout mouse useful for determining the obsessive-compulsive disorder related pharmacological activity of a compound with a phenotype that comprises a complete or diminished capacity to express COMT. More specifically, in one embodiment, a knockout mouse of the present invention comprises a first and second allele capable of expressing functional COMT, wherein the first allele comprises a defect, and this defect prevents the first allele from expressing functional COMT.
The present invention further extends to another embodiment of the knockout mouse of the present invention, wherein the second allele also comprises a defect which prevents its expression of functional COMT. Hence, in this embodiment of the invention, a knockout mouse is unable to express functional COMT (Gogos et al., submitted).
Examples of defects in an allele encoding COMT that can prevent the allele from expressing functional COMT, and to which the present invention extends, include, but are not limited to, a substitution, insertion, and/or deletion of one or more nucleotides in an allele encoding COMT.
More specifically, the present invention extends to a knockout mouse in which a defect in an allele encoding COMT involves a substitution of a portion of a fragment of an allele comprising the entire set of coding exons of COMT with an DNA sequence comprising a neomycin phosphotransferase (neo) gene (SEQ ID NO: 10) under the control of a PGK promoter (SEQ ID NO:4). With this substitution in both alleles, a knockout mouse of the present invention is unable to express functional COMT.
Applicants have also discovered that the phenotype of a knockout mice of the present invention is sexually dimorphic, and that levels of certain neurotransmitters in the brain of a knockout mouse of the present invention are region specific. For example, a knockout male mouse of the present invention wherein both alleles have a defect in the gene encoding COMT (also referred to herein as a homozygous knockout mouse), has a phenotype comprising increased in levels of dopamine in the frontal cortex of the brain as determined in situ, relative to levels of dopamine in the frontal cortex of a wild type male mouse, as determined in situ, decreased levels of dopamine in the amygdala as determined in situ relative to levels of dopamine in the amygdala of a wild type male mouse, as determined in situ, and increased levels of norepinepherine in the hypothalamus as determined in situ, relative to levels of norepinepherine in the hypothalamus of a wild type mouse, determined in situ.
Moreover, a knockout male mouse in which one allele comprises a defect in the gene encoding COMT (also referred to herein as a heterozygous knockout mouse) exhibits a phenotype different from that of a wild type mouse. In particular, a knockout male mouse with a defect in one gene encoding COMT exhibited increased frequency of aggressive behavior with shorter latencies to initial aggression relative to the frequency and latency of initial aggression observed in a wild-type mouse (Gogos et al., submitted).
The phenotype of a female knockout mouse of the present invention, wherein both alleles have a defect in the gene encoding COMT (homozygous knockout mouse), has been elucidated. Surprisingly, its phenotype is different from that of male knockout mice as described above, in that it comprises decreased levels of dopamine in the frontal cortex of the brain as determined in situ, relative to levels of dopamine in the frontal cortex of the brain of a wild type female mouse, as determined in situ, decreased levels of dopamine in the amygdala as determined in situ, relative to levels of dopamine in the amygdala of a wild type female mouse, and decreased levels of norepinepherine in the hypothalamus as determined in situ, relative to levels of norepinepherine in the hypothalamus of a wild type female mouse, as determined in situ. Furthermore, an increase in any anxiety-like behaviors was observed in a female knockout mouse of the present invention relative to any anxiety-like behaviors observed in a wild type female mouse (Gogos et al., submitted).
The present invention further extends to a method for making a knockout mouse disclosed herein. In one embodiment, the method comprises the steps of determining the DNA sequence of genomic DNA encoding COMT, providing a vector comprising the nucleotide sequence of genomic DNA encoding COMT and a selector gene contained therein, providing embryonic stem cells, and inserting the vector into the embryonic stem cells. The selector gene used herein is a neo gene under the control of a PGK promoter. However, numerous selector genes are known in the art, and have applications in this embodiment of the present invention.
After this first insertion step, an embryonic stem cell which has integrated the vector into its genome is selected. With this integration, the DNA sequence containing the selector gene therein replaces the endogenous genomic DNA of an allele which encodes COMT. This embryonic stem cell is then injected into a blastocyte. A second insertion step then occurs in which the blastocyte is inserted into a pseudopregnant female mouse so that the pseudopregnant mouse gives birth to a heterozygous knockout mouse.
The heterozygous knockout mouse can then be crossed with a wild type mouse. Classical Mendelian genetics predicts that 50% of the offspring will be knockout mice with one allele incapable of expressing functional COMT. Methods for selecting which offspring are knockout mice of the present invention are known to those skilled in this art.
As stated above, the present invention further extends to a knockout mouse which is homozygous in that both alleles comprise a defect and are incapable of expressing functional COMT. Hence, the present invention encompasses a method for producing such a knockout mouse, comprising the steps of crossing a first knockout mouse of the invention in which one allele is incapable of expressing functional COMT with a second knockout mouse of the invention with one allele incapable of expressing functional COMT. Approximately 25 % of the offspring from this cross will be knockout mice in which both alleles contain a defect which prevents the expression of functional COMT. Methods of selecting offspring are knockout mice of the present invention, and unable to express functional COMT, are well known in the art.
In a preferred embodiment of this method, the embryonic stem cells are A7ES cells. Moreover, the step of inserting the vector into the embryonic stem cell comprises electroporating the embryonic stem cell in the presence of the vector. However, numerous methods are known in the art which would be just as effective.
Moreover, it is preferred that the blastocyte used in the methods of the invention to produce a knockout mice is a C57B6 blastocyte.
The present invention further extends to methods for selecting a therapeutic agent for possible use in the treatment of OCD, or disorders related thereto, as described above. More specifically, a method of selecting a therapeutic agent for possible use in the treatment of a psychiatric disorder is disclosed, which comprises administering a potential therapeutic agent to a knockout mouse of the present invention, measuring the effects of the agent vis-ά-vis the behavioral and physiological effects exhibited by the knockout mouse, comparing the effects of the agent to those of a control, and selecting a therapeutic agent by comparing the test responses.
One embodiment of the invention involves a method for selecting a therapeutic agent for possible use in treating obsessive compulsive disorder (OCD), or disorders related thereto in a subject, comprising the steps of administering a potential therapeutic agent to a knockout mouse of the present invention, measuring levels of dopamine in the frontal cortex of the knockout mouse, and comparing the measurement of dopamine levels with levels of dopamine in the frontal cortex of a control knockout mouse. If the difference between the levels of dopamine in the knockout mouse treated with the potential therapeutic agent and the levels of dopamine in the control knockout mouse are statistically significant, the therapeutic agent has a possible use in treating OCD, or disorders related thereto.
The present invention further extends to another embodiment for selecting a therapeutic agent for possible use in treating obsessive compulsive disorder (OCD) disorders related thereto. Specifically, the method disclosed herein comprises the steps of administering a potential agent to a knockout mouse of the present invention, observing behaviors of the knockout mouse, and comparing those behaviors with the behaviors of a control knockout mouse. A difference in behaviors of the knockout mouse and the control indicate the therapeutic agent has a possible use in the treatment of OCD and disorders related thereto. As explained above, a heterozygous knockout male mouse of the present inventio exhibits an increase in the frequency of aggressive behavior with shorter latencies to initial aggression relative to the frequency and latency of initial aggression observed in a wild type mouse. Hence, if a potential agent is administered to such a knockout, which then exhibits a decrease in frequency of aggressive behavior compared to a control knockout mouse which did not receive the agent, then the agent has a possible use in treating OCD, and disorders related thereto.
In another example, the potential agent can be administered to a female knockout mouse of the present invention. If such a female knockout mouse exhibited less anxiety-like behaviors than are exhibited in a control female knockout mouse of the invention, then the agent has a possible use in the treatment of obsessive compulsive disorder (OCD), and disorders related thereto.
Another method for selecting a therapeutic agent for possible use in the treatment of obsessive compulsive disorder, and disorders related thereto, comprises the steps of administering a potential therapeutic agent to a knockout mouse of the present invention, measuring the ratio of homovanillic acid (HVA) to DOPAC (L-3,4- dihydroxyphenylacetic acid) in a region of the brain of the knockout mouse, and comparing that measurement to the ratio of HVA to DOPAC in the same region of the brain a control knockout mouse. A statistically significant difference between these ratios indicates the therapeutic agent has a possible use in treating obsessive compulsive disorder in a subject. Regions of the brain in which the measurement of the ratio of HVA to DOPAC can be measured in this embodiment are the striatum, the frontal cortex, the amygdala, or the hypothalamus.
Yet another method for selecting a therapeutic agent for possible use in the treatment of obsessive compulsive disorder, or disorders related thereto, involves measuring levels of norepinepherine in the hypothalamus of a knockout mouse of the present invention. Such a method comprising the steps of administering a potential therapeutic agent to a knockout mouse of the present invention, measuring levels of norepinepherine in the hypothalamus of the knockout mouse, and comparing the measurement with levels of norepinepherine in the hypothalamus of a control knockout mouse which does not receive the agent. If the difference between the levels of norepinepherine in the hypothalamus of the knockout mouse treated with the potential therapeutic agent and the levels of norepinepherine in the hypothalamus of control knockout mouse is statistically significant, the therapeutic agent has a possible use in treating OCD and disorders related thereto. As explained above, disorders related to OCD include, but are not limited to major depression, dysthymia, bipolar disorder, and anxiety disorders such as panic disorder, panic disorder with agoraphobia, social phobia, attention deficit hyperactivity disorder, as well as eating disorders and Tourette's Syndrome.
Accordingly, it is a principal object of the present invention to provide a method and associated assay system for screening patients in order to determine their susceptibility to obsessive-compulsive disorder or disorders related thereto, and to likewise select an appropriate course of therapy therefor.
It is further an object of the present invention to provide substances such as drugs, agents and the like, potentially effective in either potentiating the effects of COMT levels or increasing such levels in mammalian, especially human patients.
It is a still further object of the present invention to provide a method for the treatment of mammals to modulate the amount or activity of the COMT or subunits thereof, or MAO-A or subunits thereof, so as to alter the adverse consequences of diminished levels of COMT, or modulated levels of activity of MAO-A, either of which can result in OCD, or disorders related thereto.
It is a still further object of the present invention to provide pharmaceutical compositions for use in therapeutic methods which comprise or are based upon the COMT, its subunits, their binding partner(s), as well as molecules whose activity or production depend on COMT; or upon molecules or agents or drags that control the production, stability and degradation, or that mimic the activities of the COMT.
It is yet still another object of the present invention to provide methods of determining a susceptibility for, or presence of, obsessive compulsive disorder, or disorders related thereto, by determining the levels of enzymes involved in the metabolic degradation of dopamine (DA), norepinepherine (NE) and epinepherine, wherein such enzymes include COMT and MAO-A.
It is still yet another object of the present invention to provide nucleic acid sequences with polymorphisms and encode enzymes involved in metabolic degradation of dopamine (DA), norepinepherine (NE) and epinepherine, such as COMT and MAO-A, which are related to a susceptibility for, or presence of OCD, or disorders related thereto.
It is yet another object to provide a knockout mouse which comprising at least one allele that has a defect in the gene encoding COMT, such that the allele is unable to express functional COMT.
Still another object of the present invention is to provide a knockout mouse in which both alleles have a defect in the gene encoding COMT, so that the knockout mouse is unable to express functional COMT.
Yet still another object of the present invention is to provide numerous methods for the selection of a therapeutic agent to treat potentially OCD, or disorders related thereto, using a knockout mouse of the present invention.
Still yet another object of the present invention is to provide a knockout male mouse having a phenotype that is different from the phenotype of female knockout mice of the present invention.
Other objects and advantages will become apparent to those skilled in the art from a review of the ensuing description which proceeds.
BRIEF DESCRIPTION OF THE DRAWING FIGURES Figure 1A is an amino acid sequence alignment of mouse COMT (SEQ ID NO: 5) and human COMT (SEQ ID NO:3). Single and double asterisks indicate the membrane bound and soluble initiation methionines respectively (by analogy to the rat and human clones). Arrowhead indicates codon 158 of the human gene where a met/val variation determines low or high activity of COMT (Gogos et al., submitted).
Figure IB is a schematical drawing of the targeting construct of the mouse COMT locus in embryonic stem cells and mice. A Hindllϊ-Sacl fragment was shown to encompass the entire set of coding exons of the COMT gene. For the construction of the targeting construct in the ppNT vector, part of this fragment was replaced by a cassette including the neo gene under the control of PGK promoter. Cell culture, electroporation of A7ES cells and generation of the chimeric mice were performed using a procedure as set forth in Reference 39. About 15 % of the tested ES cell clones were positive for homologous recombination and three clones were selected for karyotyping and injection into C57B6 blastocytes. Heterozygous knockout males were then mated with C57B6 females and DNA from tail biopsies of FI agouti coat pups was typed by Southern blotting and PCR at the COMT genomic locus. FI heterozygous mice were mated and F2 mice of all three genotypes and of mixed 129/J/C57B6 background were obtained. Arrow lines indicate the diagnostic EcoRV restriction fragment. The probe used for Southern analysis is shown as a thick black line. Also shown is a schematic -drawing of the mouse gene for COMT and the comparison knockout mouse gene lacking COMT16.
Figure IC is a genomic Southern Blot analysis of tail biopsies. Genetic DNA was isolated from offspring obtained following breeding of heterozygous mice, digested with EcoRV and probed with a ~ 1 kb fragment adjacent to the right arm of the targeting construct or the 3' coding portion of the mouse COMT cDNA. In the former case, wild type and recombinant restriction fragments are 11.5 kb and 3.5 kb respectively. Figure 2A is a Northern analysis of mRNA extracted from the liver and brain of the homozygote knockout mice of the present invention as well as from wild type controls, showing the elimination of the expression of the COMT gene in the homozygous knockout mouse and wild type animals. Two mRNA species are observed in the liver, corresponding (by analogy to the rat and human gene) to two distinct sites of transcriptional initiation. As a control the Northern blot was probed with a probe from rat β actin.
Figure 2B is a graph showing the HVA/DOPAC ratio in the striatum, frontal cortex, amygdala, and hypothalamus of male and female homozygous knockout mice of the present invention and wild type animals. Values are the average+S.E.M. for wild type (gray bar) and homozygous knockout (solid bar) mice. Differences between wild type and homozygous mice tested by Mann- Whitney
U-test where ***p<0.0002, **p<0.002. The calculated HVA/DOPAC ratios for homozygous (Homo) versus wild type (wt) animals are as follows:
HVA/DOPAC = 0.05±0.009 vs 0.94±0.71 (p=0.0001);
HVA/DOPAC „k = 0.13±0.04 vs 2.77±0.59 (p=0.003);
HVA/DOPAC , , ,= 0.25±0.09 vs 3.05±0.37 (p=0.002);
HVA/DOPA →Λ = 0.09±0.009 vs 1.56±0.17 (p=0.0002); HVA/DOPAC^ „„„ = 0 vs 0.41±0.05 (p=0.0006);
HVA/DOPAC^ „„ t = 0 vs 0.04±0.008 (p=0.002).
(Str=striatum; Fctx=Frontal cortex; Amygd=Amygdala, Hyp=Hypothalamus). The number of the animals tested (n=) is indicated.
Figure 3 has four (4) panels of graphs showing the effect of COMT gene disruption on dopamine (DA), norepinepherine (NE), serotonin (5-HT), and its metabolite 5- hydroxyindole acetic acid (5-HIAA). The graphs of panels A-D show steady-state levels of DA (A), NE (B), as well 5-HT (C) and 5-HIAA (D) in the striatum, frontal cortex, amygdala, and hypothalamus of homozygous knockout and wild type animals of both sexes. Values are average (+ S.E.M) for wild type (gray bar) and homozygous knockout (solid bar) mice. Data were analyzed by a two-way ANOVA (Sex vs Genotype) and difference between all groups tested by Fisher's LSD test where *p<0.05 and **p<0.01. If the ANOVA was not significant, data from males and females were pooled and differences between wild type and homozygous animals tested by Student's t-test where *p<0.05 and **p<0.01. For some areas, male and female data is presented even though no sex differences were present in order to contrast with other transmitters in the same area where sex differences were present. (Panel A) DA levels: For Frontal cortex, ANOVA: Sex, F(l,16) = 3.44, p<0.08; Genotype, F(l,16) = 5.10, p<0.04; Sex x Genotype, F(l,16) = 15.3, pθ.001. (Panel B) NE levels: For Hypothalamus, AΝOVA: Sex x Genotype, F(l ,25) = 12.2, pO.OOl . (Panels C and D) 5 -LIT and 5-HIAA levels: No significant differences in data. (Str=striatum; F=Frontal cortex; Am= Amygdala, H=Hypothalamus). The number of the animals tested (n=) is indicated.
Figures 4 A and 4B have panels with graphs showing the effect of COMT gene disruption on emotionality and sensory gating in knockout mice of the present invention. Homozygous knockout females took longer to emerge into the light than did wild-type females (Figure 4A, Panel B), and they also spent less time ambulating in the light compartment (Figure 4A, Panel D). An ANOVA of genotype by latency to emerge was significant [F(2,29) = 6.056; pO.Ol] for females. Follow up multiple comparison tests using the Bonferroni correction showed that homozygous knockout females differed from both wild-type (p<0.05) and knockout heterozygous (p<0.05) female mice, whereas the latter two groups did not differ from each other. A planned comparison of wild-type and homozygous knockout females on total time spent in the light was short of significant (not shown). However, planned comparison of wild-type and homozygous knockout females on time spent ambulating in the light was significant [t(20) = 2.12; p<0.05], while the same comparison for ambulation in the dark was not (p=0.56). Males did not differ on either measure of emotionality (Figure 4A, Panels A and C). Prepulse inhibition was examined for two prepulse dB levels; higher Y-axis values represent greater percent inhibition. There were no effects of genotype for either males (Figure 4B, Panel E) or females (Figure 4B, Panel F) (*p<0.05).
Figure 5 has panels with graphs that show the effects of COMT gene disruption on aggressive behaviors of knockout mice of the present invention. Data were analyzed by a two-way analysis of variance (ANOVA) for repeated measurements for the main effects of genotype and test day and their interaction. (Figure 5, Panel A). Mean (+SEM) latency to the first aggressive behavior act. There were overall genotype differences (F(2, 9) = 5.057, p < 0.05) and heterozygous knockout male mice showed significantly shorter latency to aggression (p < 0.05) compared to both wild-type and homozygous knockout mice, which were not different from each other. It was also found that latency decreased over 3 days (F(2, 18)= 4.838, p < 0.05). ( Figure 5, Panel B). Significant genotype differences were found in the total number of aggressive behavior bouts during 15 min tests (F(2, 9) = 8.708, p < 0.01). Heterozygous knockout pairs were significantly more aggressive (p < 0.05) than both wild-type and homozygous knockout pairs. The latter two groups were not different from each other, although further testing with an additional set of animals (that were not included in the present analysis because of differences in previous experiences) indicated a trend in which wild-type mice became more aggressive than homozygous knockout mice after repeated behavioral tests for aggression (data not shown).
Figure 6 is a schematical drawing of the COMT Low allele with a functional polymorphism at codon 158 of the gene encoding COMT. This polymorphism causes an amino acid substitution (from Val to Met) and therefore decreases enzyme activity by 30 % .
Figure 7 shows the results of the testing of families with OCD to determine whether polymorphism set forth in Figure 6 is preferentially transmitted in families. In particular, results of a Transmission Disequilibrium Test (TDT) and Haplotype Based Haplotype Relative Risk (HHRR) test are disclosed which show the preferential transmission of allele 2 in males with OCD. Allele 2 is the COMT Low allele with a polymorphism as set forth in Figure 6.
Figure 8 is a schematical drawing of a functional polymorphism of the monoamine oxidase A (MAO-A) gene, which is associated with Low MAO-A (allele 1) or High MAO-A (allele 2) activity of the enzyme.
Figure 9 shows the results of testing the same families that were tested to produce the test results set forth in Figure 7, to determine whether the polymorphism schematically set forth Figure 8 is preferentially transmitted in families. A TDT and HHRR were performed, and the results support a role for the MAO-A gene as a susceptibility factor for OCD in males, since preferential transmission of allele 2 in males with OCD was observed under both tests.
DETAILED DESCRIPTION OF THE INVENTION
In the present invention, the role of the gene for Catechol- -methyltransferase (COMT), a key modulator of dopaminergic and noradrenergic neurotransmission, is elucidated with respect to a genetic predisposition to OCD or disorders related thereto. It can be shown that a functional allele of this gene which results in a three-to-four-fold reduction in enzyme activity, is significantly associated in a recessive manner with susceptibility of males to OCD or disorders related thereto. The mechanism underlying this association remains to be defined, but it appears to be most likely related to sexual dimorphism in COMT activity and the existence of yet largely undefined subtypes of OCD.
Also disclosed are two alleles for the gene encoding monoamine oxidase A (MAO- A). It has been established an allele comprising a significantly associated in a recessive manner with susceptibility for, or the presence of, OCD or disorders related thereto. It has been determined that a G to T substitution at the third base of codon 941 of MAO-A results in a Fnu4Ul RFLP site [Hotamisligil et al. , Am. J. Hum. Genet. (1991), 49:383-392], Applicants have discovered this polymorphism results in a modulation of levels of MAO-A relative to levels of a standard, and that his modulation is directly related to the susceptibility for, or presence of, OCD, or disorders related thereto, such as major depression, dysthymia, bipolar disorder, and anxiety disorders such as panic disorder, panic disorder with agoraphobia, social phobia, attention deficit hyperactivity disorder, eating disorders and Tourette's Syndrome.
A common genetic polymorphism in humans has been shown to be associated with a three-to-four-fold variation in COMT enzyme activity. It has been shown that this variation in activity is due to a G-> A transition at codon 158 of the COMT gene that results in a valine (Val) to methionine (Met) substitution13, 14, 15. The two alleles (Val158 or High and Met158 or Low) and the three genotypes (Val158/Val158 or
High/High; Val158/Met158 or High/Low; Metl58/Met158 or Low/Low) can be identified with a PCR-based restriction fragment length polymorphism analysis using the restriction enzyme Nlalll.
The distribution of the COMT genotypes in an OCD patient group consisting of 73 Caucasian patients (43 males, and 30 females), and a control group consisting of 143 ethnically matched Caucasians (75 males, and 68 females), recruited from the same site as the patient group (Bethesda, MD), and who had been evaluated and found free of any psychiatric symptoms was tested. A chi-square test of homogeneity in genotype distributions (see Table 1 below) among cases and controls and males and females was highly significant (x2=28.67, 6 df, p=0.0001)5. Partitioning of chi-square into three components with 2 df each provided the following empirical significance levels: p =0.0206 for the "Disease" main effect, p=0.0618 for the "Sex" main effect, and p=0.0005 for the "Disease" by "Sex" interaction. Because of the high significance of the interaction term, "Disease" effects were investigated separately for males and females resulting in p =0.0002 for males and p=0.0841 for females. Clearly, association between COMT and disease is highly significant in males but not very pronounced (not formally significant) in females5.
Table 1. Genotype Distribution at COMT gene by disease category and sex
A.
OCD SAMPLE CONTROL SAMPLE
Males Females Males Females
Genotypes
L/L 20 (48%) 3 (10%) 23 10 (13 %) 15 (22%) 25
L/H 17 (40%) 19 (61 %) 36 44 (59%) 26 (38%) 70
H/H 5 (12%) 9 (29%) 14 21 (28%) 27 (40%) 48
42 31 73 75 68 143
B. X2 df 2p
SOURCE
Disease 7.76 2 0.0206
Sex 5.57 2 0.0618
DxS 15.34 2 0.0005
Total 28.67 6 0.0001
C. Effect of disease by sex: Males: x2 = 17.19 2p= 0.0002 (n= 117)
Females: x2=4.95 2p=0.0841
(n=99)
Odds ratios (approximate relative risks) in rηales relative to one genotype over another were computed. Results in Table 2 below show that genotypes H/L and H/H do not differ significantly from each other in their effect as risk factors for disease, while the L/L/ genotype appears to be a strong risk factor. Thus, the COMT gene appears to act in a recessive manner. Pooling genotypes H/L and H/H leads to an approximate relative risk of 5.91 for genotype L/L versus non-L/L (last line in Table 2). Analogous results shown below in Table 3 were obtained when analyses were carried out for alleles rather than genotypes, that is, association is essentially confined to males. Table 2. Odds Ratio (approximate relative risk) for disease with genotype as a risk factor (confidence interval computed as logit limits)
Genotype Odds ratio 95% confidence interval
L/L vs. H/L 5.18 (2.02, 13.29)
H/L vs. H/H 1.62 (0.53, 5.00)
L/L vs. H/H 8.40 (2.44, 28.91)
L/L vs. (H/L and H/H) 5.91 (2.40, 14.53)
Table 3. Analysis of Allelic Association of the COMT High and Low
Activity Polymorphism
A. Allele Distribution at COMT gene by Disease and Sex
OCD SAMPLE CONTROL SAMPLE Males Females Males Females
Alleles L 57 (0.68) 25 (0.40) 64 (0.43) 61 (0.42)
H 27 (0.32) 37 (0.60) 86 (0.57) 85 (0.58)
B. Chi-Square Test of Homogeneity in Allele Distribution
SOURCE X2 df 2p
Disease 7.84 1 0.0052
Sex 5.03 1 0.0250
DxS 5.89 1 0.0152
Total 18.76 3 0.0003
Effect of Disease by Sex
Males: x2= 13.68 2p= 0.0002 Females: x2 = 0.01 2p=0.9097 In a case controlled study design, such as the one described above, an association between a genetic polymorphism and a phenotype can arise either because of a direct relationship between the gene and the disease phenotype, or because subpopulations that have different frequencies of the polymorphism also happen to differ in average susceptibility to the disease (population stratification). To circumvent these risks, association studies following the transmission of alleles to affected offspring in families is desirable (see Figure 7, infra). However, the strength and the sex-specificity of the association described here5 make it unlikely that it is the result of a population stratification effect. Previous analysis of the distribution of the COMT alleles and genotypes in patients with schizophrenia (another psychiatric condition associated with 22ql 1 deletions) did not reveal significant differences13. In addition, an extensive mutational analysis of this gene in 156 schizophrenic patients failed to reveal any mutations14.
As mentioned above, use of dopamine antagonists in the regimens of patients resistant to serotonin reuptake inhibitors appears to be an approach of choice for a subset of OCD patients, most notably, but not exclusively, for the ones with a comorbid chronic tic disorder (e.g. , Tourette's syndrome) and possibly for those with concurrent psychotic spectrum disorders4. In that respect it is interesting to note a trend for an increased frequently of comorbid tic disorders among males with the L/L genotype than among males with the non-L/L genotype in our sample [odds ratio 2.24 (0.56, 8.91)]5.
No systematic studies have addressed the issue of sex-specific differences of COMT activity in humans. A limited number of studies in other species suggest that COMT activity can be affected epigenetically by estrogen (decreased) and by the process of sexual differentiation of the brain16. Along these lines, it has also been suggested that estrogens could directly modulate neurotransmission through their conversion into catecholestrogens (CE)17, 18, which are known to be powerful inhibitors of COMT. Moreover, statistical data from particular families whose members suffer from OCD have been gathered and demonstrate a direct link between the Low allele of COMT, and susceptibility of a subject to OCD. A Haplotype Based Haplotype Relative Risk (HHRR) test19 was performed on data from families in which some members suffered from OCD. This test takes affected individuals with their two parents. All three are typed for a marker, one allele of which is believed to be associated with the disease. The 'control' is not a real individual, but consists of the two parental alleles which were not transmitted to the affected person. A 2x2 table is made of marker frequencies in the probands and controls, and significance tested by a simple χ2 test (Table 4). In its simplest form, as shown, no distinction is made between probands homozygous or heterozygous for the marker, not between affected and unaffected parents .
The results of the HHRR, set forth in Figure 7, clearly show there is a preferential transmission of the Low COMT allele in male affected offspring of these families, and that transmission is directly related to a susceptibility to OCD.
To confirm these results, a Transmission Disequilibrium Test (TDT)20 was performed with the same data used in the HHRR. The TDT starts with families with one or more affected offspring, where at least one parent is heterozygous at the marker allele (Ml) which is suspected of being associated with the disease. One of the two marker alleles of each heterozygous parent is transmitted to each affected offspring and one is not. The test compares the frequency of Ml among the transmitted and nontransmitted alleles. Again, the significance of the association is tested by a simple χ2 test (Table 4). Table 4: Tests to determine whether marker allele Ml is associated with a disease.
HHRR test Controls
Cases M present M absent
M present a b M absent c d
TDT test Nontransmitted allele
Transmitted allele Ml Not Ml
Ml a b not M 1 c d
For either test, χ2 ( 1 degree of freedom) = (b-c)2 / (b+c)
The HHRR test: The controls arc made from the two marker alleles which the parents of the affected prυband did not transmit to the proband. The TDT: families arc selected where affected probands have at least one parent who is heterozygous for M l . The transmitted and nontransmitted parental alleles arc compared.
The results of the TDT, also set forth in Figure 7, show a clear link between the Low COMT allele in male affected offspring of these families, and a susceptibility to OCD, or disorders related thereto.
Hence, these results, along with the drag response data mentioned above, demonstrate that both the 5-IIT and dopamine. systems (and more specifically COMT) are involved in the pathophysiology of OCD or disorders related thereto, and can be targeted in the treatment of this disease.
Moreover, the present invention also discloses that a polymorphism of a gene encoding monoamine oxidase A (MAO-A) is also involved in the pathophysiology l' OCD and disorders related thereto, and can also be targeted in the treatment of this disease. Figure 8 is a schematical drawing of the polymorphism. Using the same families that were used in the HHRR and TDT conducted regarding the Low COMT allele, HHRR and TDT tests were performed to determine whether the MAO-A polymorphism is preferentially transferred in families, and is related to OCD.
The results of these tests are set forth in Figure 9. Both the HHRR and the TDT demonstrate a link between the allele of the MAO-A gene schematically shown in Figure 8, with a susceptibility to OCD. Hence, G to T substitution at the third base of codon 941 of MAO-A, results in a FnuAHl RFLP site. This substitution does not result in a change in amino acid at this position. Yet surprisingly, Applicants have discovered this polymorphism results in a modulation in the level of activity of MAO-A as compared to a standard, and that such modulation indicates a susceptibility for, or presence of, OCD, disorders related thereto.
In accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g. , Sambrook et al, "Molecular Cloning: A Laboratory Manual" (1989); "Current Protocols in Molecular Biology" Volumes I-III [Ausubel, R. M., ed. (1994)]; "Cell Biology: A Laboratory Handbook" Volumes Mil [J. E. Celis, ed. (1994))]; "Current Protocols in Immunology" Volumes I-III [Coligan, J. E., ed. (1994)]; "Oligonucleotide Synthesis" (M.J. Gait ed. 1984); "Nucleic Acid Hybridization" [B.D. Hames & S.J. Higgins eds. (1985)]; "Transcription And Translation" [B.D. Hames & S.J. Higgins, eds. (1984)]; "Animal Cell Culture" [R.I. Freshney, ed. (1986)]; "Immobilized Cells And Enzymes" [IRL Press, (1986)]; B. Perbal, "A Practical Guide To Molecular Cloning" (1984).
Therefore, if appearing herein, the following terms shall have the definitions set out below. The terms "Catechol-O-methyltransferase" , "COMT", and any variants not specifically listed, may be used herein interchangeably, and as used throughout the present application and claims refer to proteinaceous material including single or multiple proteins, and extends to those proteins having the amino acid sequence data described in Lundstrom et al, DNA and Cell Biology, 10:3, 181-189 (1991). Accordingly, proteins displaying substantially equivalent or altered activity are likewise contemplated. These modifications may be deliberate, for example, such as modifications obtained through site-directed mutagenesis, or may be accidental, such as those obtained through mutations in hosts that are producers of the complex or its named subunits.
Likewise, the terms "monoamine oxidase-A", "MAO-A", and any variants not specifically listed, may be used herein interchangeably, and as used throughout the present application and claims refer to proteinaceous material including single or multiple proteins, and extends to those proteins having the amino acid sequence data described in Lundstrom et al, DNA and Cell Biology, 10:3, 181-189 (1991). Accordingly, proteins displaying substantially equivalent or altered activity are likewise contemplated. These modifications may be deliberate, for example, such as modifications obtained through site-directed mutagenesis, or may be accidental, such as those obtained through mutations in hosts that are producers of the complex or its named subunits.
The terms "obsessive compulsive disorder and (OCD), and any variants not specifically listed may be used herein interchangeably.
The amino acid residues described herein are preferred to be in the "L" isomeric form. However, residues in the "D" isomeric form can be substituted for any L- amino acid residue, as long as the desired functional property of immunoglobulin- binding is retained by the polypeptide. NH2 refers to the free amino group present at the amino terminus of a polypeptide. COOH refers to the free carboxy group present at the carboxy terminus of a polypeptide. In keeping with standard polypeptide nomenclature, J. Biol. Chem. , 243:3552-59 (1969), abbreviations for amino acid residues are shown in the following Table of Correspondence:
TABLE OF CORRESPONDENCE
SYMBOL AMINO ACID
1 -Letter 3 -Letter Y Tyr tyrosine G Gly gly cine F Phe phenylalanine M Met methionine A Ala alanine S Ser serine I He isoleucine L Leu leucine T Thr threonine V Val valine P Pro proline K Lys lysine H His histidine
Q Gin glutamine E Glu glutamic acid w Trp tryptophan
R Arg arginine D Asp aspartic acid
N Asn asparagine C Cys cysteine It should be noted that all amino-acid residue sequences are represented herein by formulae whose left and right orientation is in the conventional direction of amino- terminus to carboxy-terminus. Furthermore, it should be noted that a dash at the beginning or end of an amino acid residue sequence indicates a peptide bond to a further sequence of one or more amino-acid residues . The above Table is presented to correlate the three-letter and one-letter notations which may appear alternately herein.
A "replicon" is any genetic element (e.g. , plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo; i.e., capable of replication under its own control.
A "vector" is a replicon, such as plasmid, phage or cosmid, to which another DNA segment may be attached so as to bring about the replication of the attached segment.
A "DNA molecule" refers to the polymeric form of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in its either single stranded form, or a double- stranded helix. This term refers only to the primary and secondary stracture of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear DNA molecules (e.g. , restriction fragments), viruses, plasmids, and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5 ' to 3' direction along the nontranscribed strand of DNA (i.e. , the strand having a sequence homologous to the mRNA).
An "origin of replication" refers to those DNA sequences that participate in DNA synthesis. A DNA "coding sequence" is a double-stranded DNA sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5 ' (amino) terminus and a translation stop codon at the 3' (carboxyl) terminus. A coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g. , mammalian) DNA, and even synthetic DNA sequences. A polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence.
Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, polyadenylation signals, terminators, and the like, that provide for the expression of a coding sequence in a host cell.
A "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3 ' direction) coding sequence. For purposes of defining the present invention, the promoter sequence is bounded at its 3 ' terminus by the transcription initiation site and extends upstream (5 ' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined by mapping with nuclease SI), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. Eukaryotic promoters will often, but not always, contain "TATA" boxes and "CAT" boxes. Prokaryotic promoters contain Shine-Dalgarno sequences in addition to the -10 and -35 consensus sequences.
An "expression control sequence" is a DNA sequence that controls and regulates the transcription and translation of another DNA sequence. A coding sequence is "under the control" of transcriptional and translational control sequences in a cell when RNA polymerase transcribes the coding sequence into mRNA, which is then translated into the protein encoded by the coding sequence.
A "signal sequence" can be included before the coding sequence. This sequence encodes a signal peptide, N-terminal to the polypeptide, that communicates to the host cell to direct the polypeptide to the cell surface or secrete the polypeptide into the media, and this signal peptide is clipped off by the host cell before the protein leaves the cell. Signal sequences can be found associated with a variety of proteins native to prokaryotes and eukaryotes.
The term "oligonucleotide," as used herein in referring to the probe of the present invention, is defined as a molecule comprised of two or more ribonucleotides, preferably more than three. Its exact size will depend upon many factors which, in turn, depend upon the ultimate function and use of the oligonucleotide.
The term "primer" as used herein refers to an oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product, which is complementary to a nucleic acid strand, is induced, i.e. , in the presence of nucleotides and an inducing agent such as a DNA polymerase and at a suitable temperature and pH. The primer may be either single-stranded or double-stranded and must be sufficiently long to prime the synthesis of the desired extension product in the presence of the inducing agent. The exact length of the primer will depend upon many factors, including temperature, source of primer and use of the method. For example, for diagnostic applications, depending on the complexity of the target sequence, the oligonucleotide primer typically contains 15-25 or more nucleotides, although it may contain fewer nucleotides.
The primers herein are selected to be "substantially" complementary to different strands of a particular target DNA sequence. This means that the primers must be sufficiently complementary to hybridize with their respective strands. Therefore, the primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5' end of the primer, with the remainder of the primer sequence being complementary to the strand. Alternatively, non-complementary bases or longer sequences can be interspersed into the primer, provided that the primer sequence has sufficient complementarity with the sequence of the strand to hybridize therewith and thereby form the template for the synthesis of the extension product.
A cell has been "transformed" by exogenous or heterologous DNA when such DNA has been introduced inside the cell. The transforming DNA may or may not be integrated (covalently linked) into chromosomal DNA making up the genome of the cell. In prokaryotes, yeast, and mammalian cells for example, the transforming DNA may be maintained on an episomal element such as a plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the transforming DNA. A "clone" is a population of cells derived from a single cell or common ancestor by mitosis. A "cell line" is a clone of a primary cell that is capable of stable growth in vitro for many generations.
Two DNA sequences are "substantially homologous" when at least about 75% (preferably at least about 80% , and most preferably at least about 90 or 95 %) of the nucleotides match over the defined length of the DNA sequences. Sequences that are substantially homologous can be identified by comparing the sequences using standard software available in sequence data banks, or in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g. , Maniatis et al. , supra; DNA Cloning, Vols. I & II, supra; Nucleic Acid Hybridization, supra.
It should be appreciated that also within the scope of the present invention are DNA sequences encoding Catechol- -methyltransferase which code for a Catechol-O- methyltransferase having the same amino acid sequence, but which are degenerate thereto. Likewise, within the scope of the invention are degenerate DNA sequences which encode for monoamine oxidase-A having the same amino acid sequence. By "degenerate to" is meant that a different three-letter codon is used to specify a particular amino acid. It is well known in the art that the following codons can be used interchangeably to code for each specific amino acid:
Phenylalanine (Phe or F) UUU or UUC Leucine (Leu or L) UUA or UUG or CUU or CUC or CUA or CUG Isoleucine (He or I) AUU or AUC or AUA Methionine (Met or M) AUG Valine (Val or V) GUU or GUC of GUA or GUG Serine (Ser or S) UCU or UCC or UCA or UCG or AGU or AGC Proline (Pro or P) CCU or CCC or CCA or CCG Threonine (Thr or T) ACU or ACC or ACA or ACG Alanine (Ala or A) GCU or GCG or GCA or GCG Tyrosine (Tyr or Y) UAU or UAC . Histidine (His or H) CAU or CAC Glutamine (Gin or Q) CAA or CAG Asparagine (Asn or N) AAU or AAC Lysine (Lys or K) AAA or AAG Aspartic Acid (Asp or D) GAU or GAC Glutamic Acid (Glu or E) GAA or GAG Cysteine (Cys or C) UGU or UGC Arginine (Arg or R) CGU or CGC or CGA or CGG or AGA or AGG Glycine (Gly or G) GGU or GGC or GGA or GGG
Tryptophan (Trp or W) UGG
Termination codon UAA (ochre) or UAG (amber) or UGA (opal)
It should be understood that the codons specified above are for RNA sequences. The corresponding codons for DNA have a T substituted for U.
Mutations can be made in the DNA of COMT or the DNA of MAO-A such that a particular codon is changed to a codon which codes for a different amino acid. Such a mutation is generally made by making the fewest nucleotide changes possible. A substitution mutation of this sort can be made to change an amino acid in the resulting protein in a non-conservative manner {i.e. , by changing the codon from an amino acid belonging to a grouping of amino acids having a particular size or characteristic to an amino acid belonging to another grouping) or in a conservative manner {i.e. , by changing the codon from an amino acid belonging to a grouping of amino acids having a particular size or characteristic to an amino acid belonging to the same grouping). Such a conservative change generally leads to less change in the structure and function of the resulting protein. A non- conservative change is more likely to alter the structure, activity or function of the resulting protein. The present invention should be considered to include sequences containing conservative changes which do not significantly alter the activity or binding characteristics of the resulting protein.
The following is one example of various groupings of amino acids:
Amino acids with nonpolar R groups
Alanine Valine Leucine Isoleucine Proline Phenylalanine Tryptophan Methionine
Amino acids with uncharged polar R groups
Glycine Serine
Threonine
Cysteine
Tyrosine
Asparagine Glutamine
Amino acids with charged polar R groups (negatively charged at pH 6.0)
Aspartic acid Glutamic acid
Basic amino acids (positively charged at pH 6.0)
Lysine Arginine
Histidine (at pH 6.0)
Another grouping may be those amino acids with phenyl groups:
Phenylalanine Tryptophan Tyrosine
Another grouping may be according to molecular weight (i.e. , size of R groups):
Glycine 75
Alanine 89
Serine 105
Proline 115 Valine 117
Threonine 119
Cysteine 121
Leucine 131
Isoleucine 131 Asparagine 132
Aspartic acid 133
Glutamine 146
Lysine 146
Glutamic acid 147 Methionine 149
Histidine (at pH ό.O) 155
Phenylalanine 165
Arginine 174
Tyrosine 181 Tryptophan 204
Particularly preferred substitutions are:
- Lys for Arg and vice versa such that a positive charge may be maintained;
- Glu for Asp and vice versa such that a negative charge may be maintained; - Ser for Thr such that a free -OH can be maintained; and - Gin for Asn such that a free NH2 can be maintained.
Amino acid substitutions may also be introduced to substitute an amino acid with a particularly preferable property. For example, a Cys may be introduce a potential site for disulfide bridges with another Cys. A His may be introduced as a particularly "catalytic" site (i.e., His can act as an acid or base and is the most common amino acid in biochemical catalysis). Pro may be introduced because of its particularly planar structure, which induces β-turns in the protein's stracture.
Two amino acid sequences are "substantially homologous" when at least about 70% of the amino acid residues (preferably at least about 80% , and most preferably at least about 90 or 95 %) are identical, or represent conservative substitutions.
A "heterologous" region of the DNA construct is an identifiable segment of DNA within a larger DNA molecule that is not found in association with the larger molecule in nature. Thus, when the heterologous region encodes a mammalian gene, the gene will usually be flanked by DNA that does not flank the mammalian genomic DNA in the genome of the source organism. Another example of a heterologous coding sequence is a construct where the coding sequence itself is not found in nature (e.g., a cDNA where the genomic coding sequence contains introns, or synthetic sequences having codons different than the native gene). Allelic variations or naturally-occurring mutational events do not give rise to a heterologous region of DNA as defined herein.
An "antibody" is any immunoglobulin, including antibodies and fragments thereof, that binds a specific epitope. The term encompasses polyclonal, monoclonal, and chimeric antibodies, the last mentioned described in further detail in U.S. Patent Nos. 4,816,397 and 4,816,567.
An "antibody combining site" is that structural portion of an antibody molecule comprised of heavy and light chain variable and hypervariable regions that specifically binds antigen.
The phrase "antibody molecule" in its various grammatical forms as used herein contemplates both an intact immunoglobulin molecule and an immunologically active portion of an immunoglobulin molecule.
Exemplary antibody molecules are intact immunoglobulin molecules, substantially intact immunoglobulin molecules and those portions of an immunoglobulin molecule that contains the paratope, including those portions known in the art as Fab, Fab' , F(ab')2 and F(v), which portions are preferred for use in the therapeutic methods described herein.
Fab and F(ab')2 portions of antibody molecules are prepared by the proteolytic reaction of papain and pepsin, respectively, on substantially intact antibody molecules by methods that are well-known. See for example, U.S. Patent No. 4,342,566 to Theofilopolous et al. Fab' antibody molecule portions are also well- known and are produced from F(ab')2 portions followed by reduction of the disulfide bonds linking the two heavy chain portions as with mercaptoethanol, and followed by alkylation of the resulting protein mercaptan with a reagent such as iodoacetamide. An antibody containing intact antibody molecules is preferred herein.
The phrase "monoclonal antibody" in its various grammatical forms refers to an antibody having only one species of antibody combining site capable of immunoreacting with a particular antigen. A monoclonal antibody thus typically displays a single binding affinity for any antigen with which it immunoreacts. A monoclonal antibody may therefore contain an antibody molecule having a plurality of antibody combining sites, each immunospecific for a different antigen; e.g. , a bispecific (chimeric) monoclonal antibody. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.
The phrase "therapeutically effective amount" is used herein to mean an amount sufficient to treat, and preferably increase by at least about 30 percent, more preferably by at least 50 percent, most preferably by at least 90 percent, a clinically significant change in obsessive-compulsive disorder, and disorders related thereto, due to the lowered levels of COMT. In regard to levels of MAO-A,
"therapeutically effective amount" as used herein means an amount to treat, and preferably to increase by at least 30 present, more preferably by at least 50 % , most preferably by at least 90% , a clinically significant change in obsessive-compulsive disorder, or disorders related thereto, due to modulating levels of activity of MAO- A.
A DNA sequence is "operatively linked" to an expression control sequence when the expression control sequence controls and regulates the transcription and translation of that DNA sequence. The term "operatively linked" includes having an appropriate start signal (e.g. , ATG) in front of the DNA sequence to be expressed and maintaining the correct reading frame to permit expression of the DNA sequence under the control of the expression control sequence and production of the desired product encoded by the DNA sequence. If a gene that one desires to insert into a recombinant DNA molecule does not contain an appropriate start signal, such a start signal can be inserted in front of the gene.
The term "standard hybridization conditions" refers to salt and temperature conditions substantially equivalent to 5 x SSC and 65 °C for both hybridization and wash. However, one skilled in the art will appreciate that such "standard hybridization conditions" are dependent on particular conditions including the concentration of sodium and magnesium in the buffer, nucleotide sequence length and concentration, percent mismatch, percent formamide, and the like. Also important in the determination of "standard hybridization conditions" is whether the two sequences hybridizing are RNA-RNA, DNA-DNA or RNA-DNA. Such standard hybridization conditions are easily determined by one skilled in the art according to well known formulae, wherein hybridization is typically 10-20°C below the predicted or determined Tm with washes of higher stringency, if desired.
As explained above, the present invention concerns the identification of a patient population having modulated levels of COMT, which indicates a high susceptibility to obsessive-compulsive disorder, and disorders related thereto.
Furthermore, the present invention concerns the identification of a patient population having modulated levels of MAO-A, which indicates a high susceptibility to obsessive-compulsive disorder, and disorders related thereto.
In a particular embodiment, the present invention relates to all members of the herein disclosed COMT, and all members of the herein disclosed MAO-A.
The present invention also relates to a recombinant DNA molecule or cloned gene, or a degenerate variant thereof, which encodes a COMT, or a fragment thereof; preferably a nucleic acid molecule, in particular a recombinant DNA molecule or cloned gene, encoding the COMT, which can be used to therapeutically administer COMT to a patient in need of such therapy.
Also disclosed is a recombinant DNA molecule or cloned gene, or degenerate variants thereof, which encode MAO-A, or fragments thereof. Such a DNA molecule can be used to therapeutically administer MAO-A to a subject with modulated levels of MAO-A. The possibilities both diagnostic and therapeutic that are raised by the existence of the relationship between COMT levels and obsessive-compulsive disorder or disorders related thereto, derive from the fact that the low levels of COMT appear to participate in direct and causal protein-protein interaction which results in the exhibition of the obsessive-compulsive disorder symptoms. As suggested earlier and elaborated further on herein, the present invention contemplates pharmaceutical intervention in the cascade of reactions in which the levels of COMT is implicated, to moderate or abate the symptoms of obsessive-compulsive disorder.
Moreover, modulated levels of MAO-A in a subject are also related to the exhibition of obsessive compulsive disorder, or disorders related thereto, in a subject. Such modulation results from a polymorphism in the allele comprising the MAO-A gene. In particular a G to A substitution at the third base of codon 941 of the MAO-A results in a Fnu4Ul RFLP site, which results in a modulation of levels of activity of MAO-A as compared to a standard. This modulation is related to a susceptibility for, or presence of, OCD, or disorders related thereto.
Instances where either insufficient levels of COMT or MAO-A, or both, are present can be remedied by the introduction of additional quantities of the COMT or MAO- A, or their chemical or pharmaceutical cognates, analogs, fragments and the like.
As discussed earlier, the COMT or their binding partners, as well as molecules whose activity or production depends on COMT, or other molecules or ligands or agents exhibiting mimicry of the COMT or control over its production and activity, may be prepared in pharmaceutical compositions, with a suitable carrier and at a strength effective for administration by various means to a patient experiencing the symptoms of obsessive-compulsive disorder or disorders related thereto. Moreover, the present invention extends to pharmaceutical compositions comprising a modulator of MAO-A activity, including MAO-A, and a pharmaceutically acceptable carrier thereof. Such compositions can be used to modulate the activity of MAO-A in subjects in order to ameliorate the symptoms of obsessive compulsive disorder, or disorders related thereto.
A variety of administrative techniques may be utilized, among them parenteral techniques such as subcutaneous, intravenous and intraperitoneal injections, catheterizations and the like. Average quantities of the COMT or MAO-A, or their subunits may vary and in particular should be based upon the recommendations and prescription of a qualified physician or veterinarian.
Also, antibodies including both polyclonal and monoclonal antibodies, and drags that modulate the production or activity of the COMT and/or their subunits, or MAO-A and/or their subunits, may possess certain diagnostic applications and may for example, be utilized for the purpose of detecting and/or measuring the susceptibility to or presence of obsessive-compulsive disorder.
For example, the COMT or their subunits, or MAO-A and their subunits, may be used to produce both polyclonal and monoclonal antibodies to themselves in a variety of cellular media, by known techniques such as the hybridoma technique utilizing, for example, fused mouse spleen lymphocytes and myeloma cells. Likewise, small molecules that mimic the activity (ies) of the COMT or MAO-A, may be discovered or synthesized, and may be used in diagnostic and/or therapeutic protocols.
The general methodology for making monoclonal antibodies by hybridomas is well known. Immortal, antibody -producing cell lines can also be created by techniques other than fusion, such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein-Barr virus. See, e.g. , M. Schreier et al. , "Hybridoma Techniques" (1980); Hammerling et al. , "Monoclonal Antibodies And T-cell Hybridomas" (1981); Kennett et al. , "Monoclonal Antibodies" (1980); see also U.S. Patent Nos. 4,341 ,761 ; 4,399,121; 4,427,783; 4,444,887; 4,451 ,570; 4,466,917; 4,472,500; 4,491,632; 4,493,890.
Panels of monoclonal antibodies produced against COMT can be screened for various properties; i.e. , isotope, epitope, affinity, etc. Of particular interest are monoclonal antibodies that neutralize the activity of the COMT or its subunits. Such monoclonals can be readily identified in COMT activity assays. High affinity antibodies are also useful when immunoaffinity purification of native or recombinant COMT is possible.
Preferably, the anti-COMT antibody used in the diagnostic methods of this invention is an affinity purified polyclonal antibody. More preferably, the antibody is a monoclonal antibody (mAb). In addition, it is preferable for the anti- antibody molecules used herein be in the form of Fab, Fab' , F(ab')2 or F(v) portions of whole antibody molecules.
Moreover, Panels of monoclonal antibodies produced against MAO-A can also be screened for various properties; i.e. , isotope, epitope, affinity, etc. Of particular interest are monoclonal antibodies that neutralize the activity of the MAO-A or their subunits. Such monoclonals can be readily identified in MAO-A activity assays. High affinity antibodies are also useful when immunoaffinity purification of native or recombinant MAO-A is possible.
Preferably, an anti-COMT or anti -MAO- A antibody used in the diagnostic methods of this invention is an affinity purified polyclonal antibody. More preferably, the antibody is a monoclonal antibody (mAb). In addition, it is preferable for the anti- antibody molecules used herein be in the form of Fab, Fab' , F(ab')2 or F(v) portions of whole antibody molecules.
As suggested earlier, one diagnostic method of the present invention comprises examining a cellular sample or medium by means of an assay including an effective amount of an antagonist to a COMT/protein, such as an anti- COMT antibody, preferably an affinity -purified polyclonal antibody, and more preferably a mAb. In addition, it is preferable for the anti-COMT antibody molecules used herein be in the form of Fab, Fab' , F(ab')2 or F(v) portions or whole antibody molecules. As previously discussed, patients capable of benefitting from this method include those suffering from OCD and related disorders such as major depression, dysthymia, bipolar disorder, and anxiety disorders such as panic disorder, panic disorder with agoraphobia, social phobia, attention deficit hyperactivity disorder, as well as eating disorders and Tourette's Syndrome. Methods for isolating the COMT and inducing anti-COMT antibodies and for determining and optimizing the ability of anti-COMT antibodies to assist in the examination of the target cells are all well-known in the art.
Another diagnostic method of the present invention comprises examining a cellular sample or medium by means of an assay including an effective amount of an antagonist to an MAO-A/protein, such as an anti- MAO-A antibody, preferably an affinity -purified polyclonal antibody, and more preferably a mAb. Moreover, just as with ant-COMT antibodies discussed above, it is preferred that the anti-MAO-A antibody molecules used herein be in the form of Fab, Fab' , F(ab')2 or F(v) portions or whole antibody molecules. Patients capable of benefitting from this method include those suffering from OCD and related disorders which are described above.
Methods for isolating COMT and MAO-A, and inducing the production of antibodies against them for use in the examination of the target cells are all well- known in the art.
Methods for producing polyclonal anti-polypeptide antibodies are well-known in the art. See U.S. Patent No. 4,493,795 to Nestor et al. A monoclonal antibody, typically containing Fab and/or F(ab')2 portions of useful antibody molecules, can be prepared using the hybridoma technology described in Antibodies - A Laboratory Manual, Harlow and Lane, eds., Cold Spring Harbor Laboratory, New York (1988), which is incorporated herein by reference. Briefly, to form the hybridoma from which the monoclonal antibody composition is produced, a myeloma or other self-perpetuating cell line is fused with lymphocytes obtained from the spleen of a mammal hyperimmunized with a COMT-binding portion thereof, or COMT, or an origin-specific DNA-binding portion thereof. In making an MAO-A monoclonal antibody, a self-perpetuating cell line is fused with lymphocytes obtained from the spleen of a mammal hyperimmunized with an MAO-A-binding portion thereof, or MAO-A.
Splenocytes are typically fused with myeloma cells using polyethylene glycol (PEG) 6000. Fused hybrids are selected by their sensitivity to HAT. Hybridomas producing a monoclonal antibody useful in practicing this invention are identified by their ability to immunoreact with the present COMT or MAO-A and their ability to inhibit either specified COMT activity or specified MAO-A activity in target cells.
A monoclonal antibody useful in practicing the present invention can be produced by initiating a monoclonal hybridoma culture comprising a nutrient medium containing a hybridoma that secretes antibody molecules of the appropriate antigen specificity. The culture is maintained under conditions and for a time period sufficient for the hybridoma to secrete the antibody molecules into the medium. The antibody -containing medium is then collected. The antibody molecules can then be further isolated by well-known techniques.
Media useful for the preparation of these compositions are both well-known in the art and commercially available and include synthetic culture media, inbred mice and the like. An exemplary synthetic medium is Dulbecco's minimal essential medium (DMEM; Dulbecco et al. , Virol. 8:396 (1959)) supplemented with 4.5 gm/1 glucose, 20 mm glutamine, and 20% fetal calf seram. An exemplary inbred mouse strain is the Balb/c.
Methods for producing monoclonal anti-COMT antibodies and monoclonal anti- MAO- A antibodies are also well-known in the art. See Niman et al. , Proc. Natl. Acad. Sci. USA, 80:4949-4953 (1983). Typically, the present COMT or a peptide analog is used either alone or conjugated to an immunogenic carrier, as the immunogen in the before described procedure for producing anti-COMT monoclonal antibodies. In making monoclonal anti-MAO-A, the present MAO-A or peptide analog would be used. The hybridomas are screened for the ability to produce an anti-COMT antibody that immunoreacts with the a peptide analog of COMT and the present COMT. Similar screening occurs in the production of MAO-A monoclonal antibody, except a peptide analog of MAO-A or present MAO- A is used.
The present invention further contemplates therapeutic compositions useful in practicing the therapeutic methods of this invention. A subject therapeutic composition includes, in admixture, a pharmaceutically acceptable excipient (carrier) and one or more of a COMT, polypeptide analog thereof or fragment thereof, as described herein as an active ingredient.
Likewise, the present invention extends to therapeutic compositions useful in modulating levels of MAO-A in a subject, and hence ameliorating in the subject the symptoms of OCD, or disorders related thereto. Such a therapeutic composition includes, in admixture, a pharmaceutically acceptable excipient (carrier) and one or more of an MAO-A, polypeptide analog thereof, or fragment thereof, as described herein as the active ingredient.
The preparation of therapeutic compositions which contain polypeptides, analogs or active fragments as active ingredients is well understood in the art. Typically, such compositions are prepared as injectables, either as liquid solutions or suspensions, however, solid forms suitable for solution in, or suspension in, liquid prior to injection can also be prepared. The preparation can also be emulsified. The active therapeutic ingredient is often mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like and combinations thereof. In addition, if desired, the composition can contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents which enhance the effectiveness of the active ingredient.
A polypeptide, analog or active fragment can be formulated into the therapeutic composition as neutralized pharmaceutically acceptable salt forms. Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the polypeptide or antibody molecule) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed from the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the like.
The therapeutic polypeptide-, analog- or active fragment-containing compositions are conventionally administered intravenously, as by injection of a unit dose, for example. The term "unit dose" when used in reference to a therapeutic composition of the present invention refers to physically discrete units suitable as unitary dosage for humans, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required diluent; i.e. , carrier, or vehicle.
The compositions are administered in a manner compatible with the dosage formulation, and in a therapeutically effective amount. The quantity to be administered depends on the subject to be treated, and the severity of the disease under treatment. Precise amounts of active ingredient required to be administered depend on the judgment of the practitioner and are peculiar to each individual. However, suitable dosages may range from about 0.1 to 20, preferably about 0.5 to about 10, and more preferably one to several, milligrams of active ingredient per kilogram body weight of individual per day and depend on the route of administration.
The therapeutic compositions of the present invention intended to increase levels of COMT in a subject may further include an effective amount of a dopamine antagonist in combination with the COMT or COMT agonist which is an agent capable of mimicking the activity of COMT. Representative of such dopamine antagonists are those such as haloperidol and pimozide. Exemplary formulations are given below:
Formulations
Intravenous Formulation I Ingredient mg/ml Ingredient mg/ml
COMT/COMT agonist 10.0 dextrose USP 45.0 sodium bisulfite USP 3.2 edetate disodium USP 0.1 water for injection q.s.a.d. 1.0 ml
Intravenous Formulation II Ingredient mg/ml COMT/COMT agonist 5.0 haloperidol 5.0 sodium bisulfite USP 3.2 disodium edetate USP 0.1 water for injection q.s.a.d. 1.0 ml
As used herein, "pg" means picogram, "ng" means nanogram, "ug" or "μg" mean microgram, "mg" means milligram, "ul" or "μ\" mean microliter, "ml" means milliliter, "1" means liter.
Another feature of this invention is the expression of the DNA sequences disclosed herein. As is well known in the art, DNA sequences may be expressed by operatively linking them to an expression control sequence in an appropriate expression vector and employing that expression vector to transform an appropriate unicellular host.
Such operative linking of a DNA sequence of this invention to an expression control sequence, of course, includes, if not already part of the DNA sequence, the provision of an initiation codon, ATG, in the correct reading frame upstream of the DNA sequence.
A wide variety of host/expression vector combinations may be employed in expressing the DNA sequences of this invention. Useful expression vectors, for example, may consist of segments of chromosomal, non-chromosomal and synthetic DNA sequences. Suitable vectors include derivatives of SV40 and known bacterial plasmids, e.g. , E. coli plasmids col Εl, pCRl, pBR322, pMB9 and their derivatives, plasmids such as RP4; phage DNAS, e.g. , the numerous derivatives of phage λ, e.g., NM989, and other phage DNA, e.g., M13 and filamentous single stranded phage DNA; yeast plasmids such as the 2μ plasmid or derivatives thereof; vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian cells; vectors derived from combinations of plasmids and phage DNAs, such as plasmids that have been modified to employ phage DNA or other expression control sequences; and the like.
Any of a wide variety of expression control sequences — sequences that control the expression of a DNA sequence operatively linked to it — may be used in these vectors to express the DNA sequences of this invention. Such useful expression control sequences include, for example, the early or late promoters of SV40, CMV, vaccinia, polyoma or adenovirus, the lac system, the trp system, the TAC system, the TRC system, the LTR system, the major operator and promoter regions of phage λ, the control regions of fd coat protein, the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase (e.g. , Pho5), the promoters of the yeast α -mating factors, and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof.
A wide variety of unicellular host cells are also useful in expressing the DNA sequences of this invention. These hosts may include well known eukaryotic and prokaryotic hosts, such as strains of E. coli, Pseudomonas, Bacillus, Streptomyces, fungi such as yeasts, and animal cells, such as CHO, Rl.l, B-W and L-M cells, African Green Monkey kidney cells (e.g. , COS 1, COS 7, BSC1, BSC40, and BMT10), insect cells (e.g. , Sf9), and human cells and plant cells in tissue culture.
It will be understood that not all vectors, expression control sequences and hosts will function equally well to express the DNA sequences of this invention. Neither will all hosts function equally well with the same expression system. However, one skilled in the art will be able to select the proper vectors, expression control sequences, and hosts without undue experimentation to accomplish the desired expression without departing from the scope of this invention. For example, in selecting a vector, the host must be considered because the vector must function in it. The vector's copy number, the ability to control that copy number, and the expression of any other proteins encoded by the vector, such as antibiotic markers, will also be considered.
In selecting an expression control sequence, a variety of factors will normally be considered. These include, for example, the relative strength of the system, its controllability, and its compatibility with the particular DNA sequence or gene to be expressed, particularly as regards potential secondary structures. Suitable unicellular hosts will be selected by consideration of, e.g. , their compatibility with the chosen vector, their secretion characteristics, their ability to fold proteins correctly, and their fermentation requirements, as well as the toxicity to the host of the product encoded by the DNA sequences to be expressed, and the ease of purification of the expression products.
Considering these and other factors a person skilled in the art will be able to constract a variety of vector/expression control sequence/host combinations that will express the DNA sequences of this invention on fermentation or in large scale animal culture.
It is further intended that COMT and MAO-A analogs may be prepared from their respective nucleotide sequences encoding their respective protein complex/ subunit derived within the scope of the present invention. Analogs, such as fragments, may be produced, for example, by pepsin digestion of COMT or MAO-A material. Other analogs, such as muteins, can be produced by standard site-directed mutagenesis of coding sequences of the proteins.
Analogs exhibiting "COMT-activity" such as small molecules, whether functioning as promoters or inhibitors, may be identified by known in vivo and/or in vitro assays. Likewise, similar assays may be used to identify analogs exhibiting "MAO-A- activity. " In addition, should modulation of levels of MAO-A be greater than a standard, then these assays can be used to determine whether any MAO-A analogs exhibit an anti-MAO-A activity, or an antagonistic activity towards MAO-A. Such antagonist analogs or derivatives of MAO-A will decrease MAO-A activity so that it approaches the level set forth in the standard. Pharmaceutical compositions can then be made comprising an analog or derivative of MAO-A and a pharmaceutically acceptable carrier thereof.
As mentioned above, DNA sequences encoding either COMT or MAO-A can be prepared synthetically rather than cloned. A DNA sequence can be designed with the appropriate codons for the COMT amino acid sequence, or for the MAO-A amino acid sequence. In general, one will select preferred codons for the intended host if the sequence will be used for expression. The complete sequence is assembled from overlapping oligonucleotides prepared by standard methods and assembled into a complete coding sequence. See, e.g. , Edge, Nature, 292:756 (1981); Nambair et al. , Science, 223: 1299 (1984); Jay et al. , J. Biol. Chem. , 259:6311 (1984).
Synthetic DNA sequences allow convenient construction of genes which will express either COMT or MAO-A analogs or "muteins". Alternatively, DNA encoding muteins can be made by site-directed mutagenesis of native COMT or MAO-A genes or their respective cDNAs, Muteins for these proteins can also be made directly using conventional polypeptide synthesis.
A general method for site-specific incorporation of unnatural amino acids into proteins is described in Christopher J. Noren, Spencer J. Anthony-Cahill, Michael C. Griffith, Peter G. Schultz, Science, 244: 182-188 (April 1989). This method may be used to create analogs with unnatural amino acids. The present invention also relates to a variety of diagnostic applications, including methods for detecting a susceptibility to, or the presence of, obsessive-compulsive disorder, or disorders related thereto, by reference to the amount of COMT present in a patient when compared to controls. As mentioned earlier, the COMT can be used to produce antibodies to itself by a variety of known techniques, and such antibodies could then be isolated and utilized as in tests for the presence of particular COMT activity in suspect target cells.
Furthermore, the present invention relates to a variety of diagnostic applications and methods for detecting a susceptibility to, or the presence of, OCD, or disorders related thereto, in relation to levels of MAO-A present in a patient as compared to a standard or control. Anti-MAO-A described above, have broad applications in these types of diagnostic applications and methods.
As described in detail above, antibody (ies) to either the COMT or the MAO-A can be produced and isolated by standard methods including the well known hybridoma techniques. For convenience, the antibody (ies) to the COMT will be referred to herein as Ab, and antibody(ies) raised in another species as Ab2 (secondary antibody).
The presence of COMT in cells can be ascertained by the usual immunological procedures applicable to such determinations. A number of useful procedures are known. Three such procedures which are especially useful utilize either the COMT labeled with a detectable label, antibody Abj labeled with a detectable label, or antibody Ab2 labeled with a detectable label. The procedures may be summarized by the following equations wherein the asterisk indicates that the particle is labeled, and "COMT" stands for the Catechol-O-methyltransferase:
Figure imgf000060_0001
B. COMT + Ab* = COMTAb,* C. COMT + Abi + Ab2* = COMTAb, Ab2* The procedures and their application are all familiar to those skilled in the art and accordingly may be utilized within the scope of the present invention. The "competitive" procedure, Procedure A, is described in U.S. Patent Nos. 3,654,090 and 3,850,752. Procedure C, the "sandwich" procedure, is described in U.S. Patent Nos. RE 31,006 and 4,016,043. Still other procedures are known such as the "double antibody, " or "DASP" procedure.
In each instance, the COMT forms complexes with one or more antibody (ies) or binding partners and one member of the complex is labeled with a detectable label. The fact that a complex has formed and, if desired, the amount thereof, can be determined by known methods applicable to the detection of labels .
It will be seen from the above, that a characteristic property of Ab2 is that it will react with Ab,. This is because Ab, raised in one mammalian species has been used in another species as an antigen to raise the antibody Ab2. For example, Ab2 may be raised in goats using rabbit antibodies as antigens. Ab2 therefore would be anti-rabbit antibody raised in goats. For purposes of this description and claims, Ab, will be referred to as a primary or anti-COMT antibody, and Ab2 will be referred to as a secondary or anti-Ab, antibody.
Similar diagnostic methods can be used to determine levels of activity of MAO-A in a sample, except that anti-MAO-A antibodies would be used, and secondary antibodies would be made against anti-MAO-A antibodies .
The labels most commonly employed for these studies are radioactive elements, enzymes, chemicals which fluoresce when exposed to ultraviolet light, and others.
A number of fluorescent materials are known and can be utilized as labels. These include, for example, fluorescein, rhodamine, auramine, Texas Red, AMCA blue and Lucifer Yellow. A particular detecting material is anti-rabbit antibody prepared in goats and conjugated with fluorescein through an isothiocyanate.
The COMT or its binding partner(s), or MAO-A or its binding partner(s), can also be labeled with a radioactive element or with an enzyme. The radioactive label can be detected by any of the currently available counting procedures. The preferred isotope may be selected from Η, 14C, 32P, 5S, 6C1, 51Cr, 57Co, 58Co, 59Fe, 90Y, 125I, 131I, and 186Re.
Enzyme labels are likewise useful, and can be detected by any of the presently utilized calorimetric, spectrophotometric, fluorospectrophotometric, amperometric or gasometric techniques. The enzyme is conjugated to the selected particle by reaction with bridging molecules such as carbodiimides, diisocyanates, glutaraldehyde and the like. Many enzymes which can be used in these procedures are known and can be utilized. The preferred are peroxidase, β-glucuronidase, β-D-glucosidase, β-D-galactosidase, urease, glucose oxidase plus peroxidase and alkaline phosphatase. U.S. Patent Nos. 3,654,090; 3,850,752; and 4,016,043 are referred to by way of example for their disclosure of alternate labeling material and methods.
A particular assay system developed and utilized in accordance with the present invention, is known as a receptor assay. In a receptor assay, the material to be assayed is appropriately labeled and then certain cellular test colonies are inoculated with a quantity of both the labeled and unlabeled material after which binding studies are conducted to determine the extent to which the labeled material binds to the cell receptors. In this way, differences in affinity between materials can be ascertained.
Accordingly, a purified quantity of the COMT or MAO-A may be radiolabeled and combined, for example, with antibodies or other inhibitors thereto, after which binding studies would be carried out. Solutions would then be prepared that contain various quantities of labeled and unlabeled uncombined COMT or MAO-A, and cell samples would then be inoculated and thereafter incubated. The resulting cell monolayers are then washed, solubilized and then counted in a gamma counter for a length of time sufficient to yield a standard error of < 5 % . These data are then subjected to Scatchard analysis after which observations and conclusions regarding material activity can be drawn. While the foregoing is exemplary, it illustrates the manner in which a receptor assay may be performed and utilized, in the instance where the cellular binding ability of the assayed material may serve as a distinguishing characteristic.
An assay useful and contemplated in accordance with the present invention is known as a "cis/trans" assay. Briefly, this assay employs two genetic constructs, one of which is typically a plasmid that continually expresses a particular receptor of interest when transfected into an appropriate cell line, and the second of which is a plasmid that expresses a reporter such as luciferase, under the control of a receptor/ligand complex. Thus, for example, if it is desired to evaluate a compound as a ligand for a particular receptor, one of the plasmids would be a construct that results in expression of the receptor in the chosen cell line, while the second plasmid would possess a promoter linked to the luciferase gene in which the response element to the particular receptor is inserted. If the compound under test is an agonist for the receptor, the ligand will complex with the receptor, and the resulting complex will bind the response element and initiate transcription of the luciferase gene. The resulting chemiluminescence is then measured photometrically, and dose response curves are obtained and compared to those of known ligands. The foregoing protocol is described in detail in U.S. Patent No. 4,981 ,784 and PCT International Publication No. WO 88/03168, for which purpose the artisan is referred.
Alternatively, a PCR assay can be utilized. For example, for detection of the NMII polymorphism in codon 158 of COMT (the Low COMT allele), the following primers were used: F: 5' TCACCATCGAGATCAACCCC (SEQ ID NO:6), R: 5' ACAACGGGTCAGGCATGCA (SEQ ID NO: 7). PCR was performed with the thermostable enzyme Taq polymerase (1.5u/sample) (AmpliTaq, Perkin Elmer Cetus) and a programmable PCR apparatus (MJ Research, Inc.). Target sequences were amplified in a lOμl reaction mixture containing lOOng of genomic DNA in 75m KCI, lOmM Tris-HCl (pH 9.2), 1.5m MgCl2, 5pmol of each primer, lOOm of each dNTP (dATP, dCTP, dGTP, dTTP) and 2P-dCTP. Amplification was as follows: 94°Cx3min. (IX), 94°Cx30sec./64oCxlmin. /72°Cxlmin. (35X), 72°Cx7min. (IX), 4°Cx5min. 5/xl of the amplified product was digested with MAIU in a 10/xl reaction volume, according to the manufacturer's specifications. The digested product was diluted 1:1 with formamide-dye, denatured at 95°Cx5min. , and electrophoresed in a 6% 1XTBE polyacrylamide gel, at l,200Vx2.5h at room temperature. Gels were dried and signal was detected by overnight autoradiography without an intensifying screen.
Similarly, PCR can also be used to detect a polymorphism of MAO-A in a sample, which modulates levels of activity of MAO-A, and is related to OCD, or disorders related thereto in males, is present. In particular, for detection of the Fnu4Η.l polymorphism of MAO-A, the following primers have been used (in 5' end 3' order): GACCTTGACTGCCAAGAT (SEQ ID NO:8)(sense orientation) and
CTTCTTCTTCCAGAAGGCC (SEQ ID NO: 9) (antisense orientation). PCR can be performed with the thermostable enzyme Taq polymerase (1.5u/sample) (AmpliTaq, Perkin Elmer Cetus) and a programmable PCR apparatus (MJ Research Inc.). Target sequences can be amplified in a lOμl reaction mixture containing 100 ng of genomic DNA in 50mM KCI, lOmM Tris-HCl (pH 8.3), ImM MgCl2, 5pmol of each primer, and lOOmM of each dNTP (dATP, dCTP, dGTP, dTTP). Amplification was as follows: 94°Cx4.5min. (IX), 94°Cx30sec. 57oCx40sec. 72°Cx40sec. (35X), 72°Cxl0min. (IX), 4°Cx5min.
lOμl the amplified product is then digested with Fnu4Hl in a 20μ,l reaction volume, according to the manufacturer's specifications. The digested product is electrophoresed in a 4% 1XTBE NuSieve agarose gel, at 100Vx2.5h at room temperature. The Gel should then be stained, for example with ethidium bromide, and photographed under ultraviolet light.
This protocol was used to determine the rate of transmission of this single-basepair substitution at position 941 in the same set of families used to produce the data set forth in Figure 7. A restriction-digest analysis of PCR-amplified genomic DNA fragments was used. The presence of a 130bp band was scored as allele 1, while presence of two 65bp bands was scored as allele 2. Hence, pursuant to the results of this evaluation, which are set forth in Figure 9, there is a clear and significant relation between the presence of the G to T substitution at the third base of codon 941 of MAO-A, which results in a Fnu4Hl RFLP site, and a susceptibility to or presence of OCD, or disorders related thereto.
In addition, an activity assay, such as described by Weinshilboum and Raymond (1977)21, can be utilized to determine the percentage of COMT activity in a sample.
In a further embodiment of this invention, commercial test kits suitable for use by a medical specialist may be prepared to determine the presence or absence of predetermined COMT or MAO-A activity, or predetermined COMT or MAO-A activity capability in target patient populations.
In accordance with the testing techniques discussed above, one class of such kits will contain at least the labeled COMT or its binding partner, for instance an antibody specific thereto, and directions, of course, depending upon the method selected, e.g. , "competitive, " "sandwich," "DASP" and the like. The kits may also contain peripheral reagents such as buffers, stabilizers, etc.
Another class of such kits may also include PCR reagents, such as oligonucleotide primers, enzymes, gel matrixes, buffers, etc.
Accordingly, a test kit may be prepared for the diagnosis or detection of a susceptibility to obsessive-compulsive disorder, or disorders related thereto, which comprises measurement of the levels of COMT activity, comprising:
(a) a predetermined amount of at least one labeled immunochemically reactive component obtained by the direct or indirect attachment of the present COMT factor or a specific binding partner thereto, to a detectable label;
(b) other reagents; and (c) directions, including comparison levels of COMT, for use of said kit.
An alternate kit for measuring the levels of COMT activity may comprise PCR reagents, such as oligonucleotide primers, enzymes, gel matrixes, buffers, directions, including comparison levels of COMT, for use of said kit. A still further alternate can utilize reagents for measuring the levels of COMT activity as described by Weinshiboum and Raymond (1977); and directions, including comparison levels of COMT, for use of said kit.
More specifically, the diagnostic test kit may comprise: (a) a known amount of the COMT as described above (or a binding partner) generally bound to a solid phase to form an immunosorbent, or in the alternative, bound to a suitable tag, or plural such end products, etc. (or their binding partners) one of each;
(b) if necessary, other reagents; and (c) directions, including comparison levels of COMT, for use of said kit.
In a further variation, the test kit may be prepared and used for the purposes stated above, which operates according to a predetermined protocol (e.g. "competitive, " "sandwich, " "double antibody, " etc.), and comprises: (a) a labeled component which has been obtained by coupling the COMT to a detectable label;
(b) one or more additional immunochemical reagents of which at least one reagent is a ligand or an immobilized ligand, which ligand is selected from the group consisting of: (i) a ligand capable of binding with the labeled component (a);
(ii) a ligand capable of binding with a binding partner of the labeled component (a);
(iii) a ligand capable of binding with at least one of the component(s) to be determined; and (iv) a ligand capable of binding with at least one of the binding partners of at least one of the component(s) to be determined; and
(c) directions for the performance of a protocol for the detection and/or determination of one or more components of an immunochemical reaction between the COMT and a specific binding partner thereto.
In accordance with the above, an assay system for screening potential drags effective to increase the levels of, or the activity of, the COMT may be prepared. The COMT may be introduced into a test system, and the prospective drag may also be introduced into the resulting cell culture, and the culture thereafter examined to observe any changes in the COMT activity of the cells, due either to the addition of the prospective drag alone, or due to the effect of added quantities of the known COMT.
Another class of such kits will contain at least the labeled MAO-A or its binding partner, such as an anti-MAO-A antibody, and directions for using the kit. The directions will be dependent upon the method selected, e.g. , "competitive, " "sandwich, " "DASP" and the like. The kits may also contain peripheral reagents such as buffers, stabilizers, etc.
In another embodiment, a test kit may be prepared for the diagnosis or detection of a susceptibility to obsessive-compulsive disorder, or disorders related thereto, which comprises measurement of the levels of MAO-A activity, comprising:
(a) a predetermined amount of at least one labeled immunochemically reactive component obtained by the direct or indirect attachment of the present MAO-A factor or a specific binding partner thereto, to a detectable label;
(b) other reagents; and
(c) directions, including comparison levels of MAO-A, for use of said kit.
An alternate test kit for measuring the levels of MAO-A activity may comprise PCR reagents, such as oligonucleotide primers, enzymes, gel matrixes, buffers, directions, including comparison levels of, MAO-A for use of said kit. A still further alternate can utilize reagents for measuring the levels of MAO-A activity as described by Weinshiboum and Raymond (1977); and directions, including comparison levels of MAO-A, for use of said kit.
More specifically, the diagnostic test kit may comprise:
(a) a known amount of the MAO-A as described above (or a binding partner) generally bound to a solid phase to form an immunosorbent, or in the alternative, bound to a suitable tag, or plural such end products, etc. (or their binding partners) one of each;
(b) if necessary, other reagents; and
(c) directions, including comparison levels of MAO-A, for use of said kit.
In a further variation, the test kit may be prepared and used for the purposes stated above, which operates according to a predetermined protocol (e.g. "competitive, " "sandwich," "double antibody, " etc.), and comprises:
(a) a labeled component which has been obtained by coupling the MAO-A to a detectable label;
(b) one or more additional immunochemical reagents of which at least one reagent is a ligand or an immobilized ligand, which ligand is selected from the group consisting of:
(i) a ligand capable of binding with the labeled component (a); (ii) a ligand capable of binding with a binding partner of the labeled component (a); (iii) a ligand capable of binding with at least one of the component(s) to be determined; and
(iv) a ligand capable of binding with at least one of the binding partners of at least one of the component(s) to be determined; and
(c) directions for the performance of a protocol for the detection and/or determination of one or more components of an immunochemical reaction between the MAO-A and a specific binding partner thereto.
In accordance with the above, an assay system for screening potential drags effective to modulate levels of MAO-A may be prepared. The MAO-A may be introduced into a test system, and the prospective drug may also be introduced into the resulting cell culture, and the culture thereafter examined to observe any changes in the MAO-A activity of the cells, due either to the addition of the prospective drag alone, or due to the effect of added quantities of the known MAO- A.
Disorders related to OCD, for purposes of the kits described above, include but are not limited to, major depression, dysthymia, bipolar disorder and anxiety disorders such as panic disorder, panic disorder with agoraphobia, social phobia, attention deficit hyperactivity disorder, as well as eating disorders and Tourette's Syndrome.
In a further embodiment of this invention, a mouse model has been developed and characterized in which at least one allele comprises a defect and is unable to express functional COMT. The introduced defect was transmitted through the germline, and knockout mice homozygous for the defect have been obtained. The expression of the gene for COMT and the activity of the COMT enzyme was examined in these mice.
To generate knockout mice of the present invention with both alleles comprising a defect and are incapable of expressing functional COMT, a human COMT cDNA probe was used to screen a mouse brain cDNA library. A full length cDNA clone was isolated (Figure 1) and part of it used to screen a mouse 129/Sv genomic library. A positive phage encompassing the entire set of COMT coding exons was isolated and used to prepare a targeting construct (Figure IB). For the construction of the targeting construct in the ppNT vector, part of the positive phage was replaced by a cassette including the neo gene under the control of PGK promoter. The construct was then inserted into an embryonic stem (ES) cell via electroporation. About 15% of the tested ES cell clones were positive for homologous recombination, and three clones were selected for karyotyping and injection into C57B6 blastocysts. The C57B6 blastocyte were then inserted into a pseudopregnant female mouse which gave birth to a knockout mouse of the present invention in which one allele comprises a defect and is incapable of expressing functional COMT (heterozygous knockout mouse).
Heterozygous knockout males were mated with C57B6 females and DNA from tail biopsies of FI agouti coat pups was typed by Southern blotting and PCR at the COMT genomic locus. FI heterozygous knockout mice were mated and F2 mice of all three genotypes and of mixed 129/J/C57B6 background were obtained. Heterozygous knockout mice showed the expected pattern of gene disruption (Figure 1 C), were viable. Homozygous knockout mice, i.e. knockout mice of the present invention wherein both alleles comprise a defect and are unable to express functional COMT, were obtained by crossing two heterozygous knockout mice. The frequency at which homozygous knockout mice were obtained was expected (data not shown). The homozygous knockout mice were apparently physically healthy, fertile and gained weight normally.
Neurochemical measurements were taken of the brains of homozygous and heterozygous knockout mice, and wild type mice. In order to take such measurements, mice brains were rapidly excised following decapitation and were frozen on powdered dry ice. Coronal sections were made with a razor blade, mounted on to a microscope slide and stored at -70°C until sampling. Brain areas were micro-punched from the sections with a 500 mM diameter cannula while the slide rested on the stage of a dissecting microscope which was maintained at -15° C. The frontal cortex block was cut from the brain just anterior to the optic chiasm and four punches were removed from the dorsal frontal cortex. In a second cut made posterior to the optic chiasm, 2 punches/side were taken in the dorsal striatum. A cut in front of the mammillary bodies provided a block for the hypothalamus and 1 punch/side -which included the dorsal and ventral hypothalamic area- was taken. Finally one punch/side was removed from the amygdala. Levels of DA and its metabolites HVA and DOPAC, as well as of NE, 5-HT and its metabolite 5-HIAA, were measured using high performance liquid chromatography (HPLC) with electrochemical detection as described previously38. Briefly, punched tissue was expelled into a sodium acetate buffer (pH 5.0) containing 1 x 10 7 M of a-methyl dopamine as an internal standard (120 ml for striatum and 60 ml for the other areas). Following freeze-thawing and centrifugation, the supernatant was removed and 2 μl of a 1 mg/ml ascorbate oxidase solution (Sigma Chemical Co.) was added to each sample to minimize the front. 40 μl were injected in a Waters Associates chromatographic system consisting of a 717 Plus autosampler, 590 pump and C-18 reverse-phase 3 micron Velosep column (Rainin). An EsA 5011 Coulocomb 3100 A electrochemical detector with the screening electrode set at +0.05V and the detecting electrode at +0.35V was utilized. Concentrations of neurotransmitters and metabolites were calculated by reference to standards using peak integration with a computer assisted Waters Millenium system. The pellet was dissolved in 100 μl of 0.2 N NaOH for protein determination by the Bradford method. Concentrations are expressed as pg/μg protein. Measurements were made in two cohorts of mice consisting of male and female homozygous and wild type and pooled for statistical analysis when no sex differences were observed. Brain morphology appeared identical in both homozygous knockout mice and their wild type littermates by gross evaluation. Upon microscopic examination of sections, cell groups in the forebrain and diencephalon appeared to be well-formed with no obvious neuroanatomical alterations. In addition, immunocytochemistry using a tyrosine hydroxylase antibody failed to reveal any major anomalies in the distribution of dopaminergic neurons (data not shown).
Northern analysis, using total mRNA extracted from the liver and the brain of the homozygous knockout animals as well as from wild type control animals, demonstrated the anticipated elimination in the expression of this gene in the animals (See Figure 3).
In addition to dopamine, one of the major metabolic pathways COMT participates in, involves methylation and inactivation of the released dopamine as follows: Dopamine — (MAO) — > 3, 4-dihydroxyphenylacetaldehyde — (ALDEHYDE DEHYDROGENASE)— > DOPAC - (COMT)— > HVA
Preliminary measurements of the DOPAC and HVA concentration in three regions of the brain of homozygous knockout mice and wild type control mice revealed a striking increase in the concentration of DOPAC accompanied by an equally striking decrease in the concentration of HVA in the brains of the knockout mice as shown in Table 5 below.
Table 5
DOPAC HVA
(A vg. Values) (Avg . Values)
Striatum Control(wt) Animals 7.5 15.1
Knock-Out Animals 20.2 1.08*
Frontal Cortex Control (wt) Animals 0.9 1.97
Knock-Out Animals 7.7 0.47
Hypothalamus Control (wt) Animals 2.48 5.3
Knock-Out Animals 9.2 0.9*
*Sign. Diff. by T-Test
Comparisons in homozygous knockout and wild type mice using the non-parametric Mann- Whitney U-test showed significant decreases in the HVA/DOPAC ratio in all brain regions tested (Figure 2B).
In order to understand the consequences of the absence of COMT on neurotransmission in several brain regions, steady-state levels of DA, NE as well as serotonin (5-HT) and its metabolite 5-hydroxyindole acetic acid (5-HIAA) were compared in the striatum, frontal cortex, amygdala and hypothalamus of homozygous knockout and wild type mice. Male and female animals were analyzed separately (Figure 3, Panels A-D). Unexpectedly, a twelve-fold increase in the amount of DA in the frontal cortex of male homozygous knockout mice was noted (3.26±0.75 vs 0.27±0.11). Also unexpectedly, female homozygous knockout mice did not demonstrate a similar increase but instead an almost three-fold (presumably compensatory) decrease (0.47±0.11 vs 1.28±0.28) of DA levels was observed in the same brain region. A decrease in the DA content was also observed in the amygdala of both male and female homozygous knockout mice (1.44±0.17 vs 3.30±0.54). Surprisingly, and despite striking changes in the HVA/DOPAC ratio, no accompanying changes of DA content were recorded in both hypothalamus and striatum of either males or females. This latter observation is in agreement with previous microdialysis studies in rats where administration of COMT inhibitors —despite pronounced changes in DA metabolites— failed to affect the levels of striatal DA, unless DA carrier system or MAO-A activity were inhibited by nomifensine or clorgyline, respectively22. NE levels did not change in any region tested with the exception of hypothalamus where a significant increase (-40%) of the NE content was observed in male homozygous knockout mice (21.5±3.0 vs 15.4±1.00) and a significant decrease (-32%) in female homozygous knockout mice (16.2±1.05 vs 24.00±2.2) (Fig. 3B). As expected, 5-HT and 5-HIAA levels remained unchanged (Figure 3, Panels C and D).
Dopamine is involved in controls over motor function and affect, as well as, central processes (such as sensorimotor gating) which are affected in patients with psychiatric disorders23. Given the striking and sexually dimorphic changes observed in DA levels in the brain of COMT-deficient mice, a number of relevant behaviors were investigated in both sexes, separately. The protocols with which relevant behaviors were studies are described below.
Behavioral measures:
Sixty-four mice of both sexes and all three genotypes, 11-16 weeks old at the onset of testing, were housed individually for 5-6 months with free access to food and water.
They were maintained on a reverse 12:12-h light-dark cycle with lights off at 0700 hrs. All testing occurred between 0900 and 1800 hrs. Prior to all testing, animals were handled, weighed, and preexposed to the testing chamber.
Locomotor activity and any anxiety-like behaviors:
To minimize the influence of anxiety on spontaneous locomotor activity level, animals were handled and preexposed to the chamber prior to testing, and activity was monitored under indirect dim light and sound-attenuated conditions. Testing took place in a clear acrylic chamber (40.5 x 40.5 x 30cm) equipped with infrared sensors for the automatic recording of horizontal activity (Digiscan Model RXYZCM, Accuscan Instruments, Inc.). Each subject was initially placed in the center of the chamber and time spent ambulating, as well as total distance traveled over the next 10 min was used as the measure of activity. Following the initial test of locomotor activity, the effect of the mutation on anxiety was recorded in a dark/light exploratory model in a 2-compartment light/dark box. The apparatus and conditions were similar to those used above, except that an enclosed black acrylic box (40 x 20.5 x 20.5cm) was inserted into the right half of the chamber with an opening (13 x 5cm) allowing for passage between the two compartments monitored by an infrared beam. The open compartment was now directly illuminated by a 60-watt bulb placed 40 cm above the floor of the compartment. Animals were initially placed in the center of the dark compartment and data collection commenced immediately for 10 min. Two tests were performed for the locomotor and anxiety assays and at the end of the assays the genotypes of the mice were reconfirmed by Southern blot analysis.
Prepulse inhibition of the startle response: PPI was assayed several weeks following the dark/light test. Methods were similar to refs. 24 & 25. Each of two startle chambers (SR-Lab, San Diego Instruments) contained a transparent acrylic cylinder (4 cm in diameter) mounted on a frame to which a motion sensor was attached for the detection and transduction of movement, and a sound generation system for the delivery of background white noise and acoustic stimuli. A CompuAdd 386 microprocessor and SDI interface board and software were used for the delivery of stimuli and response recording (100 1-ms readings beginning at startle stimulus onset). Response amplitude was calculated as the maximum response level occurring during the 100 ms recording. Both chambers were calibrated for equivalent stimulus intensities and response sensitivities, and experimental groups were balanced across chambers. Immediately after placement in the chamber, the animal was given a 4 min acclimation period during which background noise (65 dB) was continually present, and then received 4 no-stimulus trials, 4 startle stimulus alone trials, and then 10 sets of the following 4 trial types counterbalanced to control for order: 40 ms, 115 dB noise burst alone (startle stimulus); startle stimulus preceded 100 ms by a 20 ms, 71 dB or 77 dB noise burst; and no-stimulus. Intertrial interval was variable (average 15 sec). At the end of this block of 40 trials, the animal again received 4 startle stimulus alone trials followed by 4 no-stimulus trials.
Homogeneous set tests for aggressive behaviors: Pairs of body weight matched knockout males (6-7 months old, individually housed) from the same genotype were tested in a clean neutral cage (30 x 20 x 13cm) over three consecutive days. They were first placed in either side of the test cage, which was separated by a transparent acrylic board in the center. After 5 min adaptation period, the divider was removed and males were tested for aggression for 15 min. For each pair, latency to the first aggressive behavioral act (except tail rattling; 900 sec was given to nonaggressive pairs) and total number of aggressive bouts were scored in a blind fashion. An aggressive bout was defined as a continuous series of behavioral interactions including at least one aggressive behavioral act (see below). Three seconds was the maximum amount of time that could elapse between aggressive behavioral acts to be considered part of the same aggressive bout: if intervals between the occurrences of two behavioral aggressive acts exceeded 3 seconds, the two behavioral acts were scored as two separate aggressive bouts. Aggressive behavior acts consisted of tail rattling, chasing, boxing, biting, offensive attack (often accompanied by biting) and wrestling.
Spontaneous locomotor activity was tested with the protocol described above in an open field apparatus26 equipped with infrared sensors for the automatic recording of horizontal activity. To minimize the influence of anxiety on activity level, animals were handled and preexposed to the chamber prior to testing, and activity was monitored under indirect, very dim light and sound-attenuated conditions (unlike the quite aversive classical open-field assays performed under bright light). No significant differences in activity, or in stereotypic behavior were observed among homozygous and wild type animals of either sex (data not shown).
Having established that no locomotor deficits are present in the homozygous knockout mice, the effect of decreased expression of COMT on any anxiety-like behaviors (collectively termed anxiety, reactivity or emotionality) was recorded using the protocol described above. Apparatus used in this protocol involved a dark/light exploratory model in a 2-compartment light/dark box, a modified open field apparatus, where an enclosed black acrylic box was inserted into the right half of the activity chamber with an opening allowing for passage between a dark and a brightly lit open compartment. Previous work assessing the effects of anxiolytic and anxiogenic agents has established the validity of this procedure in evaluating any anxiety-like behaviors in rodents27 29. Variables recorded as a measure of anxiety included latency to emerge from the dark compartment into the more aversive brightly lit compartment, and amount of time spent ambulating in each of the two compartments.
An ANOVA of genotype by latency to emerge was significant for females (pθ.01). Specifically, homozygous knockout females demonstrated increased anxiety, as they were more reluctant to emerge into the light (it took them on average about nine times longer to emerge), and in addition, once they emerged, they were significantly less ambulatory than wild type animals (Figure 4 A, Panels B and D).
Comparison of wild type and homozygous knockout females on time spent ambulating in the dark was not significant, consistent with Applicants' analysis in the very dimly lit open field test, and suggesting that the observed differences in the dark/light exploratory model are specific and cannot be attributed to generalized locomotor dysfunction of the homozygous mice.
Surprising, and in direct contrast to data obtained on female knockout mice of the present invention, no significant effect of genotype on latency to emerge or time spent ambulating in the light was observed for homozygous knockout males (see Figure 4A, Panels A and C).
Sensorimotor gating is a central processing mechanism that is affected in patients with schizophrenia23 (one of the neuropsychiatric disorders associated with hemizygous 22ql 1 deletions) 9- ". Attenuation of the startle response by prepulse inhibition (PPI) provides a measure of sensorimotor gating. PPI occurs when an abrupt startling acoustic stimulus is preceded 30-500 msec by a barely detectable prestimulus or "prepulse". Mice demonstrate a robust and reliable PPI, which can be disrupted by drugs such as apomorphine and PCP that are known to interfere with dopamine neurotransmission30.
PPI was recorded in homozygous knockout mice using the protocol described above and expressed as:
100-[(response to startle stimulus following pre-pulse/response to startle stimulus alone) x 100]
such that higher percentages represent greater levels of inhibition (Figure 4B, Panels E and F). ANOVAs conducted separately for the two prepulse levels tested, produced no effect of genotype, for either females or males.
Observations of fighting among heterozygous knockout male mice of the present invention housed together in the animal colony, lead to the investigation of aggressive behavior in male mice of all three genotypes (wild type, heterozygous knockout, and homozygous knockout, using the homogeneous set test for aggressive behaviors as described above.
In this test, pairs of body weight matched males from the same genotype were tested in a clean neutral cage over three consecutive days. Latency to the first aggressive behavioral act (Figure 5 Panel A; p<0.05) as well as total number of aggressive behavior bouts during 15min tests (Figure 5 Panel B; p<0.01) were significantly different between genotypes. In contrast to the other behavioral traits described above, however, aggressive behavior was greatly increased in heterozygous knockout mice compared to the other two genotypes. Heterozygous knockout pairs showed significantly higher frequency of aggressive behavior with shorter latencies of initial agression compared to the other two genotypes. Increased aggressiveness of the heterozygous knockout male mice was also observed in a pilot resident-intruder aggression test. In this test, mice of all three genotypes were tested in their home cage against olfactory bulbectomized Swiss Webster male intruder mice, which were not aggressive at all (data not shown).
Homozygous knockout female mice demonstrated altered emotional reactivity in the dark/light exploratory model providing evidence for a role of COMT in the control of some aspects of emotionality in mice. In sharp contrast, sensory reception and processing were unaffected, at least for the stimuli and for the genetic background tested. Behavioral and pharmacological studies on inbred lines using the dark/light exploratory model of anxiety, suggest that the type of emotional behavior assayed in the present study is a central nervous system state with a genetic basis31. Moreover, based on the differential effect of certain drugs on the light/dark choice versus the open field exploratory model, it was proposed that the novelty induced behavior in the open field model is related to "trait" anxiety, whereas the behavior of mice in the light/dark choice model is related to "state" anxiety induced by fear provoking situations 32. A pivotal role for the frontal cortex/amygdala loop in the transmission and interpretation of anxiety and fear has been suggested33"34. Moreover, conditioned fear and stress paradigms have been shown to alter levels of dopamine utilization in both the amygdala34 and the frontal cortex35 of rats. Consequently, the altered propensity for any anxiety-like behaviors observed in homozygous knockout female mice are related to the decreased dopamine levels observed in these brain regions.
It was previously shown that male mice deficient in MAO-A manifested enhanced aggression36. Both serotonin and norepinephrine levels (but not dopamine levels) were increased in the brains of these animals36. In the present study, heterozygous (but not homozygous) knockout male mice exhibited increased aggressive behavior. A similar atypical pattern of genotype/aggression interaction has been previously described for male mice deficient for another relatively widely distributed protein, the a-Calcium-Calmodulin Kinase II. In that case, serotonergic pathways were implicated37. However, it has never before been demonstrated, as set forth herein, that affecting the dopamine degradation pathway results in the unexpected dimorphic sexual phenotypes disclosed herein.
As a result, Applicants have discovered a knockout male mouse in which both alleles comprise a defect and is incapable of expressing functional COMT, has phenotype comprising increased levels of dopamine in the frontal cortex of the brain as determined in situ relative to levels of dopamine in the frontal cortex of a wild type male mouse, as determined in situ, decreased levels of dopamine in the amygdala as determined in situ relative to levels of dopamine in the amygdala of a wild type male mouse, as determined in situ, and increased levels of norepinepherine in the hypothalamus as determined in situ relative of levels of norepinepherine in the hypothalamus of a wild type male mouse, as determined in situ.
Applicants have also discovered a knockout mouse in which one allele comprises a defect and is unable to express functional COMT (heterozygous), having a phenotype that exhibits an increase in the frequency of aggressive behavior with shorter latencies to 1st attack, as determined in situ, relative to the frequency of aggressive behavior in a wild type male mouse, as determined in situ.
Moreover, due to unexpected results from disrupting the expression of COMT, a knockout female mouse of the present invention in which both alleles comprise a defect, and are unable to express functional COMT (homozygous), has been discovered . Surprisingly, its phenotype is unlike that of the homozygous knockout male. In particular, a knockout homozygous female mouse of the present invention has a phenotype comprising decreased levels of dopamine in the frontal cortex of the brain as determined in situ relative to levels of dopamine relative to levels of dopamine in the frontal cortex of the brain of a wild type female mouse, as determined in situ, decreased levels of dopamine in the amygdala as determined in situ relative to levels of dopamine in the amygdala of a wild type female mouse as determined in situ, decreased levels of norepinepherine in the hypothalamus as determined in situ relative to levels of norepinepherine in the hypothalamus of a wild type female mouse, as determined in sit, and an increase in any anxiety-like behaviors relative to any anxiety-like behaviors in a wild type female mouse.
The behavior of the knockout mice of the present invention is useful for analysis in that test compounds suspected of possessing potential therapeutic utility to ascertain their effects upon the behavioral traits can be administered to the knockout mice. If the behavior of the mice after administration changes relative to the behavior of a control knockout mouse, then the agent has a possible use in the treatment of OCD, or disorders related thereto.
Further, the effect of the COMT gene deletion on certain neurotransmitter systems in the brain, including the serotonin system that is known to be affected in OCD can be analyzed, and test compounds administered to ascertain their effects thereon.
Consequently, a knockout mouse of the present invention can be used as a bioassay for selecting therapeutic agents potentially useful in the treatment of OCD and disorders related thereto, wherein the method comprises:
A. administering a potential therapeutic agent to a knockout mouse of the present invention;
B. measuring the effects of the agent vis-a-vis the behavioral effects exhibited by said mouse; C. comparing said effects of the agent to those of a control; and
D. selecting a therapeutic agent by comparing the test responses.
In particular, a method of selecting a therapeutic agent for possible use in the treatment of obsessive compulsive disorder is disclosed, which comprises the steps of administering a potential therapeutic agent to a knockout mouse of the present invention, measuring the ratio of homovanillic acid (HVA) to DOPAC in a region of the brain of the knockout mouse, and comparing that measurement to the ratio of HVA to DOPAC in the same region of the brain a control knockout mouse. A statistically significant difference between these ratios indicates the therapeutic agent has a possible use in treating obsessive compulsive disorder or disorders related thereto. Regions of the brain which can be assayed under this embodiment of the present invention are the striatum, the frontal cortex, the amygdala, or the hypothalamus.
Examples of disorders related to OCD include, but are not limited to, major depression, dystrophia, bi polar disorder, and anxiety disorders, such as panic disorder, panic disorder with agoraphobia, social phobia, attention deficit hyperactivity disorder, eating disorders and Tourette's Syndrome.6
Another method of selecting a therapeutic agent for possible use in the treatment of obsessive compulsive disorder, and disorders related thereto is disclosed. This method comprises the steps of administering a potential therapeutic agent to a knockout mouse of the present invention, measuring levels of dopamine in the frontal cortex of the knockout mouse, and comparing the measured level of dopamine to levels of dopamine in the frontal cortex of a control knockout mouse of the present invention. A statistically significant difference between the levels of dopamine measured in the frontal cortex of the knockout mouse of the present invention to which the potential therapeutic agent was administered relative to levels of dopamine in the frontal cortex of the control knockout mouse indicates the therapeutic agent has a possible use in the treatment of anxiety disorders.
The present invention further extends to methods for selecting a therapeutic agent for possible use in treating obsessive compulsive disorder (OCD) and disorders related thereto. Specifically, the method disclosed herein comprises the steps of administering a potential agent to a knockout mouse of the present invention, observing behaviors of the knockout mouse, and comparing those behaviors with the behaviors of a control knockout mouse which did not receive the therapeutic agent. A difference in behaviors of the knockout mouse and the control indicate the therapeutic agent has a possible use in the treatment of OCD and disorders related thereto.
As explained above, a knockout male mouse of the present invention with one allele comprising a defect which prevents the allele from expressing functional COMT exhibits an increase in the frequency of aggressive behavior with shorter latencies to initial aggression relative to the frequency and latency of initial aggression observed in a wild-type mouse. Hence, if a potential agent is administered to such a knockout, which then exhibits a decrease in the frequency of aggressive behavior and latency of initial aggression compared to a control knockout male mouse which did not receive the agent, then the agent has a possible use in treating OCD, and disorders related thereto.
In another example, the potential agent can be administered to a female knockout mouse of the present invention. If such a female knockout mouse exhibited less anxiety-like behaviors than are exhibited in a control female knockout mouse of the invention, then the agent has a possible use in the treatment of obsessive compulsive disorder (OCD), and disorders related thereto.
Yet another method for selecting a therapeutic agent for possible use in the treatment of obsessive compulsive disorder, or disorders related thereto, in a subject involves measuring levels of norepinepherine in the hypothalamus of a knockout mouse of the present invention. Such a method comprising the steps of administering a potential therapeutic agent to a knockout mouse of the present invention, measuring levels of norepinepherine in the hypothalamus of the knockout mouse, and comparing the measurement with levels of norepinepherine in the hypothalamus of a control knockout mouse. If the difference between the levels of norepinepherine in the hypothalamus of the knockout mouse treated with the potential therapeutic agent and the levels of norepinepherine in the hypothalamus of control knockout mouse are statistically significant, the therapeutic agent has a possible use in treating OCD and disorders related thereto.
As explained above, disorders related to OCD include, but are not limited to major depression, dysthymia, bipolar disorder and anxiety disorders such as panic disorder, panic disorder with agoraphobia, social phobia, attention deficit hyperactivity disorder, as well as eating disorders and Tourette's Syndrome.
Other mouse strains can also be used to identify strain specific modifiers of a COMT associated phenotype.
A mouse strain where the low activity form of the human COMT gene can be introduced as a trans gene in a COMT(-) background. These animals can be also utilized in testing compounds that could potentially increase COMT activity and stability.
The following is a list of documents related to the above disclosure and particularly to the experimental procedures and discussions. The documents should be considered as incorporated by reference in their entirety.
1. Weissman, M.M., Bland, R.C., Canino, G.J., Greenwald, S., Hwu, H.G., Lee C.K., Newman, S.C., Oakley-Browne, M.A., Rubio-Stipec, M., Wickramaratne, P.J., Wittchen, H.U. & Yeh, E.K. J. Clin. Psychiatry 55 (Suppl.), 5-10 (1994)
2. Karno, M., Golding, J.M., Sorenson, S.B. & Burnam, M.A. Arch. Gen. Psychiatry 45, 1094-1099 (1988)
3. Pauls, D.L., Alsobrook, J.P., Phil, M., Goodman, W., Rasmussen, S. & Leckman, J.F. Am. J. Psychiatry 152, 76-84 (1995)
4. McDougle, C.J. , Goodman, W.K. & Price, L.H. Dopamine antagonists in tic-related and psychotic spectram obsessive compulsive disorder. [Review]. J.
Clin. Psych. 55 Suppl, 24-31 (1994).
5. Karayiorgou, M., Altemus, M., Galke, B.L., Goldman, D., Murphy, D.L., Ott, J. & Gogos, J.A. Genotype determining low catechol-O-methyltransf erase activity as a risk factor for obsessive-compulsive disorder. Proc Natl Acad Sci USA 94, 4572-4575 (1997).
6. Rasmussen, S.A., & Eisen, J.L. The epidemiology and clinical features of obsessive compulsive disorder. Psychiatric Clinics of North America 15, 743-758 (1992)
7. Karoum, F., Chrapusta, S.J. & Egan, M.F. .3 -Methoxy tyramine is the major metabolite of released dopamine in the rat frontal cortex: of the effects of antipsychotics on the dynamics of dopamine release and metabolism in the frontal cortex, nucleus accumbens, and striatum by a simple two pool model. J Neurochem 63, 972-979 (1994).
8. Napolitano, A., Cesura, A.M. & Da Prada, M. The role of monoamine oxidase and catechol-O-methyltransferase in dopaminergic neurotransmission. J Neural Transm 45 (suppl.), 35-45 (1995). 9. Karayiorgou, M., Morris, M.A., Morrow, B., Shprintzen, R.J., Goldberg, R., Borrow, J., Gos, A., Nestadt, G., Wolyniec, P.S., Lasseter, V.K., Eisen, H., Childs, B., Kazazian, H.H., Kucheriapati, R., Antonarakis, S.E., Pulver, A.E. & Housman, D.E. Schizophrenia susceptibility associated with interstitial deletions of chromosome 22ql l. Proc Natl Acad Sci USA 92, 7612-7616 (1995).
10. Pulver, A.E. et al. Psychotic illness in patients diagnosed with velo-cardio-facial syndrome and their relatives. /. Nerv. Mental Disease 182, 476-478 (1994).
11. Jacobsen, L.K., Yan, W.L., Guan, X.Y., Krasnewich, D., Kumra, S., Long, R.T., Sidransky, E., Ginns, E.I. & Rapoport, J.L. Interstitial deletions of chromosome 22ql 1 in very early onset schizophrenia. Am J Hum Genet 59 (suppl.), A120 (1996).
12. Papolos, D.F., Faedda, G.L., Veit, S., Goldberg, R., Morrow, B., Kucheriapati, R. & Shprintzen, R.J. Bipolar spectrum disorders in patients diagnosed with velo-cardio-facial syndrome: does a hemizygous deletion of chromosome 22ql 1 result in bipolar affective disorder? Am J Psychiatry 153, 1541-1547 (1996).
13. Karayiorgou, M. et al. Genotype and Phenotype Analysis at the 22ql l
Schizophrenia Susceptibility Locus, (in press, Cold Spring Harbor Symposia on Quantitative Biology, Vol. LXI).
14. Karayiorgou, M., Gogos. J.A., Galke, B.L., Wolyniec, P.S., estadt, G., Antonarakis, S.E., Kazazian, H.H., Housman. D.E. & Pulver, A.E. Identification of sequence variants and analysis of the role of the COMT gene in schizophrenia susceptibility. Biol Psychiatry, in press (1998).
15. Lachman, H.M., Papolos, D.F., Saito, T., Yu, Y-M, Szumlanski, CL. & Weinshilboum, R.M. Human catechol- -methyltransferase pharmacogenetics: description of a functional polymorphism and its potential application to neuropsychiatric disorders. Pharmacogenetics 6, 243-250 (1996).
16. Balthazart, J., Foidart, A., Absil, P. & Harada, N. Effects of testosterone and its metabolites on aromatase-immunoreactive cells in the quail brain: relationship with the activation of male reproductive behavior. J. Steroid Biochem. Mol. Biol. 56, 185-200 (1996).
17. Ladosky, W. & Schneider, H.T. Changes in hypothalamic catechol-O-methyltransferase during sexual differentiation of the brain. Br. J. Med. Biol. Res. 14, 409-413 (1981).
18. Conn, C.K. & Axelrod, J. The effect of estradiol on catechol-O-methyltransferase activity in rat liver. Life Sci. 10, 1351-1354 (1971).
19. Terwilliger, J. & Ott, J., A haplotype-based "haplotype relative risk" approach to detecting allelic associations. Hum. Hered. (1992), 42:337-346.
20. Spielman, R.s. eet al. Transmission test for linkage disequilibirium: the insulin gene region and insulin-dependent diabetes mellitus (IDDM). Am. J. Hum. Genet. (1993), 53:506-516.
21. Weinshilboum, R.M. and Raymond, F.A., Inheritance of Row Erythrocyte Catechol-O-Methyltransferase Activity in Man. Am. J. Hum. Genet. 29, 125-135 (1977).
22. Kaakkola, S. & Wurtman, R.J. Effects of catechol- -methyltransferase inhibitors and L-3,4-dihydroxyphenylalanine with or without carbidopa on extracellular dopamine in rat striatum. J Neurochem 60(1), 137-144 (1993). 23. Perry, W. & Braff, D.L. Information-processing deficits and thought disorder in schizophrenia. Am J Psychiatry 151(3), 363-367 (1994).
24. Swerdlow, N.R., Braff, D.L., Taaid, N. & Geyer, M.A. Assessing the validity of an animal model of deficient sensorimotor gating in schizophrenic patients. Arch Gen
Psychiatry 51(2), 139-154 (1994).
25. Paylor, R. & Crawley, J.N. Inbred strain differences in prepulse inhibition of the mouse startle response. Psychopharmacology 132, 169-180 (1997).
26. Crusio, W.E., Schwegler, H. & van Abeelen, J.H. Behavioral responses to novelty and structural variation of the hippocampus in mice. I. Quantitative-genetic analysis of behavior in the open-field. Behav Brain Res 32(1), 75-80 (1989).
27. Crawley, J. & Goodwin, F.K. Preliminary report of a simple animal behavior model for the anxiolytic effects of benzodiazepines. Pharmacol Biochem Behav 13(2), 167-170 (1980).
28. Mathis, C, Paul, S.M. & Crawley, J.N. Characterization of benzodiazepine-sensitive behaviors in the A/J and C57BL/6J inbred strains of mice. Behav Genet 24(2), 171-180
(1994).
29. Griebel, G., Sanger, D.J. & Perrault, G. Further evidence for differences between non-selective and BZ-1 (omega 1) selective, benzodiazepine receptor ligands in murine models of "state" and "trait" anxiety. Neuropharmacology 35(8), 1081-1091 (1996).
30. Ellenbroek, B.A., Budd, S. & Cools, A.R. Prepulse inhibition and latent inhibition: the role of dopamine in the medial prefrontal cortex. Neuroscience 75(2), 535-542 (1996) 31. Mathis, C, Neumann, P.E., Gershenfeld, H., Paul, S.M. & Crawley, J.N. Genetic analysis of anxiety-related behaviors and responses to benzodiazepine-related drugs in AXB and BXA recombinant inbred mouse strains. Behav Genet 25(6), 557-568 (1995).
32. Belzung, C, Pineau, N., Beuzen, A. & Misslin, R. PD135158, a CCK-B antagonist, reduces "state," but not "trait" anxiety in mice. Pharmacol Biochem Behav 49(2), 433-436 (1994).
33. Davis, M., Rainnie, D. & Cassell, M. Neurotransmission in the rat amygdala related to fear and anxiety. Trends N eur osci 17(5), 208-214 (1994).
34. Coco, M.L., Kuhn, CM., Ely, T.D. & Kilts, CD. Selective activation of mesoamygdaloid dopamine neurons by conditioned stress: attenuation by diazepam. Brain Res 590, 39-47 (1992).
35. Claustre, Y., Rivy, J.P., Dennis, T. & Scatton, B. Pharmacological studies on stress-induced increase in frontal cortical dopamine metabolism in the rat. J Pharmacol & Experim Therapeutics 238, 693-700 (1986).
36. Cases, O., Seif, I., Grimsby, J., Gaspar, P., Chen, K., Pournin, S., Muller, U., Aguet, M., Babinet, C, Shih, J.C. et al. Aggressive behavior and altered amounts of brain serotonin and norepinephrine in mice lacking MAOA. Science 268, 1763-1766 (1995).
37. Chen, C, Rainnie, D.G., Greene, R.G. & Tonegawa, S. Abnormal fear response and aggressive behavior in mice deficient for a-calcium-calmodulin kinase II. Science 266,
291-294 (1994).
38. Renner, K.J. & Luine, V.N. Determination of monoamines in brain nuclei by high performance liquid chromatography with electrochemical detection: Young vs. middle aged rats. Life Sciences 34, 2193-2199 (1984). While the invention has been described and illustrated herein by references to various specific material, procedures and examples, it is understood that the invention is not restricted to the particular material combinations of material, and procedures selected for that purpose. Numerous variations of such details can be implied as will be appreciated by those skilled in the art.
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Karayiorgou, Maria Gogos, Joseph A.
(ii) TITLE OF INVENTION: GENE BASED ASSAY FOR AGENTS WITH POTENTIAL THERAPEUTIC EFFICACY IN THE TREATMENT OF OBSESSIVE COMPULSIVE DISORDER AND DISORDERS RELATED THERETO
(iii) NUMBER OF SEQUENCES: 10
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE : Klauber & Jackson
(B) STREET: 411 Hackensack Avenue, 4th Floor
(C) CITY: Hackensack
(D) STATE: New Jersey
(E) COUNTRY: USA
(F) ZIP: 07601
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Patentin Release #1.0, Version #1.30
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: US
(B) FILING DATE:
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Jackson Esq., David A.
(B) REGISTRATION NUMBER: 26,742 (C) REFERENCE/DOCKET NUMBER: 600-189 PCT
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 201-487-5800
(B) TELEFAX: 201-343-1684
(C) TELEX: 133521
(2) INFORMATION FOR SEQ ID NO : 1 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3651 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 1 :
AGTATTGCTG TTCAGATAGC CTTTATTTGG GTATATATTC TACACTGTTT TTAAATATGG 60
AGAGTAACCA AAATGGCCCA TTATCTGACC ACACAAATAC TAGTAGTCAT TATAGATAAA 120
CCATAGCAGA TAAATAATAG TAAACAAAGC AACAGGCTGT GTCATTGGAA ATCCCCACCA 180
TGAAGAAAGG AGCAAGGTGA AAACTTCTGG CTGCTTCAGG TCATGCATGG TCCCTCTCCA 240
CCATCGTTCC CCCTGTCATC TTCCTGCCAG AATAAGGACC CTGGTACCTT AGGGAAGCAC 300
CATCTCTTGT TTTTTCCCCA CGAGCCCTGT GGGTCATGGC ACGTCCTGCC CCGCTGGGAA 360 AACACAGTGG GCCACGGGTT TCCCTGCAGG CCTGGACCCT TCCCAAGGGT AGCAGCAGAA 420
GGCAGCACGA TTCCCACTCC TGCAGCTGTG ACAGGGCACC CCCACTGTCA CTGAGCCCTG 480
CACCGGGTTC CATCACCTGC TCGGGGCTCT GCCTTTGGCC TTTTCCTGTG AACTGCATGT 540
TGGCCACTGT ACCTATCTGT CTCTCATCTT TTTTTCTTAC GGGTTTGGGT ATGTTCTTGG 600
TAAACCAGCC CTTGGTCTTA CACATCATTT CCAAGGTACT AAGGACTCTT CAGGGGAAAT 660
ACAACTTGAG CAGAGTGGTT CCCTCCTCTT GTGGTTCACA AGGTGCAGGT GCACACACAC 720
ATACCACAGG GCAGTGTGAC AGGACCAGAG ACTGCCCCTG GGGTCCCTGG CTGGGGGACA 780
CTAGTAGGGA TGTCCCTTGC CTCTCTGAGG CCTTCTGCTG TCTCTTCTGA GGCCGGAAAG 840
GCGAAGCACT GCCCTCGCCC TGCTAGGGAA GGCTCAGGCC AGGCTGGCCC TATCCGGGGA 900
AGGGGCTCAG GTATCTGGAC CTTGGTCATC GCCAGGTTAG GGTTTATGTT GATGATTATC 960
CAAAGGCAAA ATTGATTTCC ACAGAAATAA CATCTGCTTT GCTGCCGAGC CAGAGGAGAC 1020
CCCAGACCCC TCCCGCAGCC AGAGGGCTGG AGCCTGCTCA GAGGTGCTTT GAAGGTGAGT 1080
TGGCCAACGG AAGCCGGGGC AGTGCCAGGG TGGGACAGAA GAGGCACACA CCTGCTCTGT 1140
CTACCCGAGG GCACCAGAGG GCACGAGAAG GCTGGCTCCC TGGCGCTGAC ACGTCAGGCA 1200
ACTGAGGCAC AAGGCTGGCA TTTCTGAACC TTGCCCCTCT GCGAACACAA GGGGGCGATG 1260
GTGGCACTCC AAGCAAAGGG GCGTGTGGGT GCTGCAGGAG GAGCACAGAG CACTGGCGCC 1320
CCTCCCCTCC CGCCCTGCAG ATGCCGGAGG CCCCGCCTCT GCTGTTGGCA GCTGTGTTGC 1380
TGGGCCTGGT GCTGCTGGTG GTGCTGCTGC TGCTTCTGAG GCACTGGGGC TGGGGCCTGT 1440
GCCTTATCGG CTGGAACGAG TTCATCCTGC AGCCCATCCA CAACCTGCTC ATGGGTGACA 1500 CCAAGGAGCA GCGCATCCTG AACCACGTGC TGCAGCATGC GGAGCCCGGG AACGCACAGA 1560
GCGTGCTGGA GGCCATTGAC ACCTACTGCG AGCAGAAGGA GTGGGCCATG AACGTGGGCG 1620
ACAAGAAAGG TTGGGGTTCC GGGCCAGCAG GTGCTCAGCT CTGGGACAGG GACCCAGGAC 1680
CAGGCATCAA ATCCCGTGCC TGGGGATCCA AGTTCCCCTC TCTCCACCTG TGCTCACCTC 1740
TCCTCCGTCC CCAACCCTGC ACAGGCAAGA TCGTGGACGC CGTGATTCAG GAGCACCAGC 1800
CCTCCGTGCT GCTGGAGCTG GGGGCCTACT GTGGCTACTC AGCTGTGCGC ATGGCCCGCC 1860
TGCTGTCACC AGGGGCGAGG CTCATCACCA TCGAGATCAA CCCCGACTGT GCCGCCATCA 1920
CCCAGCGGAT GGTGGATTTC GCTGGCGTGA AGGACAAGGT GTGCATGCCT GACCCGTTGT 1980
CAGACCTGGA AAAAGGGCCG GCTGTGGGCA GGGCGGGCAT GCGCACTTTG ATCCTCCCCA 2040
CCAGGTGTTC ACACCACGTT CACTGAAAAC CCACTATCAC CAGGGTCATC CCAGAACCCT 2100
AAAGAAAACT GATGAATGCT TGTATGGGTG TGTAAAGATG GCCTCCTGTC TGTGTGGGCG 2160
TGGGCACTGA CAGGCGCTGT TGTATAGGTG TGTAGGGATG GCCTCCTGTC TGTGAGGACG 2220
TGGGCACTGA CAGGCGCTGT TCCAGGTCAC CCTTGTGGTT GGAGCGTCCC AGGACATCAT 2280
CCCCCAGCTG AAGAAGAAGT ATGATGTGGA CACACTGGAC ATGGTCTTCC TCGACCACTG 2340
GAAGGACCGG TACCTGCCGG ACACGCTTCT CTTGGAGGTG AGCCCCAACC AGGATGGCAT 2400
CCGTGCCAGC TGCTGCCCAG AGCCCATTCA GTCAGCCTCA GCCTCTCCAA AGAGCCAGGC 2460
ATTCCAGTAG AGCCCTGTGT GGACACAGCT CGCTCTGGAG GCACCACCTG AGGTCTGGGA 2520
GTGTGGGGGA CTGAGGAGGC CCTGTGGTGG GTGGAGATGG GTGGGGAGCT GGGCCAGGGG 2580
CTGGCTGGGT GGCCTGTTGG GAACTGGGGA GCCAAGCGGT CCCTGTCCTC ACGGGGCCCA 2640 TGTTCTGAAG GTGGCACCCA AGTCTTGTAC AGTCCTTTCC TGCAGGAGTC ACGCTGGGCA 2700
GGAAGTGGAA ACCTGGCCCC AGGGGCTAGG CACAGGCAGT GGTGCCGTGG CCTAGTGAGG 2760
AGCACCCATC CTGGTTTGGG GCAGGTTCTC TGGGCACCTC TGACCTCTCA CCTCCCCCAC 2820
CCCCCGGTCT GTTTGCAGGA ATGTGGCCTG CTGCGGAAGG GGACAGTGCT ACTGGCTGAC 2880
AACGTGATCT GCCCAGGTGC GCCAGACTTC CTAGCACACG TGCGCGGGAG CAGCTGCTTT 2940
GAGTGCACAC ACTACCAATC GTTCCTGGAA TACAGGGAGG TGGTGGACGG CCTGGAGAAG 3000
GCCATCTACA AGGGCCCAGG CAGCGAAGCA GGGCCCTGAC TGCCCCCCCG GCCCCCCTCT 3060
CGGGCTCTCT CACCCAGCCT GGTACTGAAG GTGCCAGACG TGCTCCTGCT GACCTTCTGC 3120
GGCTCCGGGC TGTGTCCTAA ATGCAAAGCA CACCTCGGCC GAGGCCTGCG CCCTGACATG 3180
CTAACCTCTC TGAACTGCAA CACTGGATTG TTCTTTTTTA AGACTCAATC ATGACTTCTT 3240
TACTAACACT GGCTAGCTAT ATTATCTTAT ATACTAATAT CATGTTTTAA AAATATAAAA 3300
TAGAAATTAA GAATCTAAAT ATTTAGATAT AACTCGACTT AGTACATCCT TCTCAACTGC 3360
CATTCCCCTG CTGCCCTTGA CTTGGGCACC AAACATTCAA AGCTCCCCTT GACGGACGCT 3420
AACGCTAAGG GCGGGGCCCT AGCTGGCTGG GTTCTGGGTG GCACGCCTGG CCCACTGGCC 3480
TCCCAGCCAC AGTGGTGCAG AGGTCAGCCC TCCTGCAGCT AGGCCAGGGG CACCTGTTAG 3540
CCCCATGGGG ACGACTGCCG GCCTGGGAAA CGAAGAGGAG TCAGCCAAGC ATTCACACCT 3600
TTCTGACCAA GCAGGCGCTG GGGACAGGTG GACCCGCAGC AGCACCAGCC C 3651
(2) INFORMATION FOR SEQ ID NO : 2 :
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1931 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 2 :
GAATTCCTGA CACGCTCCTG GGTCGTAGGC ACAGGAGTGG GGGCCAAAGC ATGGAGAATC 60
AAGAGAAGGC GAGTATCGCG GGCCACATGT TCGACGTAGT CGTGATCGGA GGTGGCATTT 120
CAGGACTATC TGCTGCCAAA CTCTTGACTG AATATGGCGT TAGTGTTTTG GTTTTAGAAG 180
CTCGGGACAG GGTTGGAGGA AGAACATATA CTATAAGGAA TGAGCATGTT GATTACGTAG 240
ATGTTGGTGG AGCTTATGTG GGACCAACCC AAAACAGAAT CTTACGCTTG TCTAAGGAGC 300
TGGGCATAGA GACTTACAAA GTGAATGTCA GTGAGCGTCT CGTTCAATAT GTCAAGGGGA 360
AAACATATCC ATTTCGGGGC GCCTTTCCAC CAGTATGGAA TCCCATTGCA TATTTGGATT 420
ACAATAATCT GTGGAGGACA ATAGATAACA TGGGGAAGGA GATTCCAACT GATGCACCCT 480
GGGAGGCTCA ACATGCTGAC AAATGGGACA AAATGACCAT GAAAGAGCTC ATTGACAAAA 540
TCTGCTGGAC AAAGACTGCT AGGCGGTTTG CTTATCTTTT TGTGAATATC AATGTGACCT 600
CTGAGCCTCA CGAAGTGTCT GCCCTGTGGT TCTTGTGGTA TGTGAAGCAG TGCGGGGGCA 660
CCACTCGGAT ATTCTCTGTC ACCAATGGTG GCCAGGAACG GAAGTTTGTA GGTGGATCTG 720 GTCAAGTGAG CGAACGGATA ATGGACCTCC TCGGAGACCA AGTGAAGCTG AACCATCCTG 780
TCACTCACGT TGACCAGTCA AGTGACAACA TCATCATAGA GACGCTGAAC CATGAACATT 840
ATGAGTGCAA ATACGTAATT AATGCGATCC CTCCGACCTT GACTGCCAAG ATTCACTTCA 900
GACCAGAGCT TCCAGCAGAG AGAAACCAGT TAATTCAGCG TCTTCCAATG GGAGCTGTCA 960
TTAAGTGCAT GATGTATTAC AAGGAGGCCT TCTGGAAGAA GAAGGATTAC TGTGGCTGCA 1020
TGATCATTGA AGATGAAGAT GCTCCAATTT CAATAACCTT GGATGACACC AAGCCAGATG 1080
GGTCACTGCC TGCCATCATG GGCTTCATTC TTGCCCGGAA AGCTGATCGA CTTGCTAAGC 1140
TACATAAGGA AATAAGGAAG AAGAAAATCT GTGAGCTCTA TGCCAAAGTG CTGGGATCCC 1200
AAGAAGCTTT ACATCCAGTG CATTATGAAG AGAAGAACTG GTGTGAGGAG CAGTACTCTG 1260
GGGGCTGCTA CACGGCCTAC TTCCCTCCTG GGATCATGAC TCAATATGGA AGGGTGATTC 1320
GTCAACCCGT GGGCAGGATT TTCTTTGCGG GCACAGAGAC TGCCACAAAG TGGAGCGGCT 1380
ACATGGAAGG GGCAGTTGAG GCTGGAGAAC GAGCAGCTAG GGAGGTCTTA AATGGTCTCG 1440
GGAAGGTGAC CGAGAAAGAC ATCTGGGTAC AAGAACCTGA ATCAAAGGAC GTTCCAGCGG 1500
TAGAAATCAC CCACACCTTC TGGGAAAGGA ACCTGCCCTC TGTTTCTGGC CTGCTGAAGA 1560
TCATTGGATT TTCCACATCA GTAACTGCCC TGGGGTTTGT GCTGTACAAA TACAAGCTCC 1620
TGCCACGGTC TTGAAGTTCT GTTCTTATGC TCTCTGCTCA CTGGTTTTCA ATACCACCAA 1680
GAGGAAAATA TTGACAAGTT TAAAGGCTGT GTCATTGGGC CATGTTTAAG TGTACTGGAT 1740
TTAACTACCT TTGGCTTAAT TCCAATCATT GTTAAAGTAA AAACAATTCA AAGAATCACC 1800
TAATTAATTT CAGTAAGATC AAGCTCCATC TTATTTGTCA GTGTAGATCA ACTCATGTTA 1860 ATTGATAGAA TAAAGCCTTG TGATCACTTT CTGAAATTCA CAAAGTTAAA CGTGATGTGC 1920
TCATCAGAAA C 1931
(2) INFORMATION FOR SEQ ID NO : 3 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 271 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(iii) HYPOTHETICAL: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 3 :
Met Pro Glu Ala Pro Pro Leu Leu Leu Ala Ala Val Leu Leu Gly Leu 1 5 10 15
Val Leu Leu Val Val Leu Leu Leu Leu Leu Arg His Trp Gly Trp Gly 20 25 30
Leu Cys Leu lie Gly Trp Asn Glu Phe He Leu Gin Pro He His Asn 35 40 45
Leu Leu Met Gly Asp Thr Lys Glu Gin Arg He Leu Asn His Val Leu 50 55 60
Gin His Ala Glu Pro Gly Asn Ala Gin Ser Val Leu Glu Ala He Asp 65 70 75 80
Thr Tyr Cys Glu Gin Lys Glu Trp Ala Met Asn Val Gly Asp Lys Lys 85 90 95
Gly Lys He Val Asp Ala Val He Gin Glu His Gin Pro Ser Val Leu 100 105 110
Leu Glu Leu Gly Ala Tyr Cys Gly Tyr Ser Ala Val Arg Met Ala Arg 115 120 125
Leu Leu Ser Pro Gly Ala Arg Leu He Thr He Glu He Asn Pro Asp 130 135 140
Cys Ala Ala He Thr Gin Arg Met Val Asp Phe Ala Gly Xaa Lys Asp 145 150 155 160
Lys Val Thr Leu Val Val Gly Ala Ser Gin Asp He He Pro Gin Leu 165 170 175
Lys Lys Lys Tyr Asp Val Asp Thr Leu Asp Met Val Phe Leu Asp His 180 185 190
Trp Lys Asp Arg Tyr Leu Pro Asp Thr Leu Leu Leu Glu Glu Cys Gly 195 200 205
Leu Leu Arg Lys Gly Thr Val Leu Leu Ala Asp Asn Val He Cys Pro 210 215 220
Gly Ala Pro Asp Phe Leu Ala His Val Arg Gly Ser Ser Cys Phe Glu 225 230 235 240
Cys Thr His Tyr Gin Ser Phe Leu Glu Tyr Arg Glu Val Val Asp Gly 245 250 255
Leu Glu Lys Ala He Tyr Lys Gly Pro Gly Ser Glu Ala Gly Pro 260 265 270
(2) INFORMATION FOR SEQ ID NO : 4 : (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 603 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 4 :
GGAATTCAGA TCTTGAATTG ATGTTACCCT CATAAAGCAC GTGGCCTCTT ATCGAGAAAG 60
AAATTACCGT CGCTCGTGAT TTGTTTGCAA AAAGAACAAA ACTGAAAAAA CCCAGACACG 120
CTCGACTTCC TGTCTTCCTA TTGATTGCAG CTTCCAATTT CGTCACACAA CAAGGTCCTA 180
GCGACGGCTC ACAGGTTTTG TAACAAGCAA TCGAAGGTTC TGGAATGGCG GGAAAGGGTT 240
TAGTACCACA TGCTATGATG CCCACTGTGA TCTCCAGAGC AAAGTTCGTT CGATCGTACT 300
GTTACTCTCT CTCTTTCAAA CAGAATTGTC CGAATCGTGT GACAACAACA GCCTGTTCTC 360
ACACACTCTT TTCTTCTAAC CAAGGGGGTG GTTTAGTTTA GTAGAACCTC GTGAAACTTA 420
CATTTACATA TATATAAACT TGCATAAATT GGTCAATGCA AGAAATACAT ATTTGGTCTT 480
TTCTAATTCG TAGTTTTTCA AGTTCTTAGA TGCTTTCTTT TTCTCTTTTT TACAGATCAT 540
CAAGGAAGTA ATTATCTACT TTTTACAACA AATATAAAAC AATGCGCAGC AGGTAAGCTT 600
GGG 603 (2) INFORMATION FOR SEQ ID NO : 5 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 265 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(iii) HYPOTHETICAL: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 5 :
Met Leu Leu Ala Ala Val Ser Leu Gly Leu Leu Leu Leu Ala Phe Leu
1 5 10 15
Leu Leu Leu Arg His Leu Gly Trp Gly Leu Val Ala He Gly Trp Phe
20 25 30
Glu Phe Val Gin Gin Pro Val His Asn Leu Leu Met Gly Gly Thr Lys 35 40 45
Glu Gin Arg He Leu Arg His Val Gin Gin His Ala Lys Pro Gly Asp 50 55 60
Pro Gin Ser Val Leu Glu Ala He Asp Thr Tyr Cys Ser Glu Lys Glu 65 70 75 80
Trp Ala Met Asn Val Gly Asp Ala Lys Gly Gin He Met Asp Ala Val
85 90 95
He Arg Glu Tyr Arg Pro Ser Leu Val Leu Glu Leu Gly Ala Tyr Cys
100 105 110 Gly Tyr Ser Ala Val Arg Met Ala Arg Leu Leu Pro Pro Gly Ala Arg 115 120 125
Leu Leu Thr Met Glu He Asn Pro Asp Tyr Ala Ala He Thr Gin Gin 130 135 140
Met Leu Asp Phe Ala Gly Leu Gin Asp Lys Val Ser He Leu He Gly 145 150 155 160
Ala Pro Gin Asp Leu He Pro Gin Leu Lys Lys Lys Tyr Asp Val Asp 165 170 175
Thr Leu Asp Met Val Phe Leu Asp His Trp Lys Asp Arg Tyr Leu Pro 180 185 190
Asp Thr Leu Leu Leu Glu Glu Cys Gly Leu Leu Arg Lys Gly Thr Val 195 200 205
Leu Leu Ala Asp Asn Val He Val Pro Gly Thr Pro Asp Phe Leu Ala 210 215 220
Tyr Val Arg Gly Ser Ser Ser Phe Glu Cys Thr His Tyr Ser Ser Tyr 225 230 235 240
Leu Glu Tyr Met Lys Val Val Asp Gly Leu Glu Lys Ala Val Tyr Gin 245 250 255
Gly Pro Gly Ser Ser Pro Val Lys Ser 260 265
(2) INFORMATION FOR SEQ ID NO: 6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "PRIMER"
(iii) HYPOTHETICAL: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 6 :
TCACCATCGA GATCAACCCC 20
(2) INFORMATION FOR SEQ ID NO : 7 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "PRIMER"
(iii) HYPOTHETICAL: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 7 :
ACAACGGGTC AGGCATGCA 19
(2) INFORMATION FOR SEQ ID NO : 8 :
(i) SEQUENCE CHARACTERISTICS: (A)- LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "PRIMER"
(iii) HYPOTHETICAL: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 8 :
GACCTTGACT GCCAAGAT 18
(2) INFORMATION FOR SEQ ID NO : 9 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "PRIMER"
(iii) HYPOTHETICAL: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 9 :
CTTCTTCTTC CAGAAGGCC 19
(2) INFORMATION FOR SEQ ID NO: 10: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1280 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:
CGCGGCGCCC GCGCCGCCAG CTCGGCGGGG CGGACCCGGA CCCGGCCGCC GAGGTCCTCG 60
CCGCCGACCG GGAGGCGTCG GCCTCGCCGC CGAAGACCGC CGTCCTGCTG CGGCTCACGG 120
AGGCGTACCT CTCGCCCTGC GCGCGGGCCT TCGACCCCGC CGGGACCTCC GGCACCGGGC 180
CCGCGGGCGA CGCCGGGCGC ACCGGGTCCA CCGGCGCCCC CCCACCCCGC ACAGAATGTC 240
CGAAACCCCT ACGGGCCCCG ACGAAAGGCG CGGAACGGCG TCTCCGCCTC TGCCATGATG 300
CCGCCCATGG ACGACAGCAC GTTGCGCCGG AAGTACCCGC ACCACGAGTG GCACGCAGTG 360
AACGAAGGAG ACTCGGGCGC CTTCGTCTAC CAGCTCACCG GCGGCCCCGA GCCCCAGCCC 420
GAGCTCTACG CGAAGATCGC CCCCCGCGCC CCCGAGAACT CCGCCTTCGA CCTGTCCGGC 480
GAGGCCGACC GGCTGGAGTG GCTCCACCGC CACGGGATCC CCGTCCCCCG CGTCGTCGAG 540
CGCGGTGCCG ACGACACCGC CGCGTGGCTC GTCACGGAGG CCGTCCCCGG CGTCGCGGCG 600
GCCGAGGAGT GGCCCGAGCA CCAGCGGTTC GCCGTGGTCG AGGCGATGGC GGAGCTGGCC 660 CGCGCCCTCC ACGAGCTGCC CGTGGAGGAC TGCCCCTCCG ACCGGCGCCT CGACGCGGCG 720
GTCGCCGAGG CCCGGCGGAA CGTCGCCGAG GGCTTGGTGG ACCTCGACGA CCTGCAGGAG 780
GAGCGGGCCG GGTGGACCGG CGACCAGCTC CTGGCGGAGC TCGACCGCAC CCGTCCCGAG 840
AAGGAGGACC TGGTCGTCTG CCATGGCGAC CTGTGCCCCA ACAACGTCCT GCTCGACCCC 900
GGGACCTGCC GGGTCACCGG CGTGATCGAC GTCGGCCGCC TCGGGGTCGC CGACCGCCAC 960
GCCGACATCG CCTTGGCCGC CCGCGAGCTG GAGATCGACG AGGACCCCTG GTTCGGCCCC 1020
GCCTACGCCG AGCGGTTCCT GGAGCGGTAC GGCGCCCACC GCGTCGACAA GGAGAAGCTG 1080
GCCTTCTACC AGCTTCTCGA CGAGTTCTTC TAGAGCCGCC CCGCAGGGCG CTCCGCAGGC 1140
CGCTTCCGGA CCACTCCGGA AGCGGCCGTG CGGTCGGAGG NACCCGGCCG CCTTGGAGAC 1200
CGGCGCCCGG CCCCCGCTTT CCGCGGCNTG GCCGGAGCCG TCAGAGGCCG TGGTACGGGT 1260
TGGCGGCGAG GTACCGGGCT 1280

Claims

WHAT IS CLAIMED IS:
1. A method for detecting a susceptibility to, or the presence of, obsessive- compulsive disorder (OCD) or disorders related thereto, which comprises measurement of the levels of activity of an enzyme involved in the metabolic degradation of dopamine (DA), norepinepherine (NE) or epinepherine, and comparison of said levels to a standard, whereby modulated levels indicate the susceptibility to, or the presence of, obsessive-compulsive disorder, or disorders related thereto.
2. The method for detecting a susceptibility as set forth in Claim 1 , wherein disorders related to OCD comprise major depression, dysthymia, bipolar disorder, anxiety disorders such as panic disorder, panic disorder with agoraphobia, social phobia, attention deficit hyperactivity disorder, eating disorders or Tourette's Syndrome.
3. The method for detecting a susceptibility as set forth in Claim 1 , wherein said enzyme is catechol-O-methyltransferase (COMT) and reduced levels of COMT as compared to a standard indicates the susceptibility to, or the presence of OCD, or disorders related thereto.
4. The method for detecting a susceptibility as set forth in Claim 3, further comprising detecting the single base substitution at codon 158 of a gene that encodes catechol-O-methyltransferase comprising a DNA sequence as set forth in SEQ ID NO: l , wherein the substitution determines high and low activity of the enzyme catechol-O-methyltransferase, whereby reduced levels indicate the susceptibility to, or the presence of, obsessive-compulsive disorder.
5. A method of identifying a patient susceptible to therapy by dopamine antagonists which comprises:
A. measuring the levels of COMT in a body fluid or tissue; and B. comparing said levels to a standard; whereby reduced levels indicate the probable efficacy of dopamine antagonist therapy.
6. An assay system for screening drags and other agents for ability to treat obsessive-compulsive disorder and disorders related thereto, comprising:
A. culturing an observable cellular test colony inoculated with a drug or agent;
B. harvesting a cellular extract from said cellular test colony; and
C. examining said extract for the presence of said COMT; wherein an increase or a decrease in a level or activity of said COMT indicates the ability of a drug to modulate the production, stability, degradation or activity of said COMT.
7. A test kit to facilitate diagnosis and treatment of obsessive compulsive disorder and disorders related thereto in a eukaryotic cellular sample, comprising:
A. a predetermined amount of a detectably labelled specific binding partner of a COMT;
B. other reagents; and
C. directions for use of said kit.
8. The test kit of Claim 7 wherein said labeled immunochemically reactive component is selected from the group consisting of polyclonal antibodies to the COMT, monoclonal antibodies to the COMT, fragments thereof, and mixtures thereof.
9. A test kit to facilitate diagnosis and treatment of obsessive compulsive disorder and disorders related thereto in a eukaryotic cellular sample, comprising:
A. PCR oligonucleotide primers suitable for COMT detection;
B. other reagents; and
C. directions for use of said kit.
10. A test kit for demonstrating the presence of a COMT in a eukaryotic cellular sample, comprising:
A. a predetermined amount of a COMT;
B. a predetermined amount of a specific binding partner of said COMT;
C. other reagents; and
D. directions for use of said kit; wherein either said COMT or said specific binding partner are detectably labelled.
11. The test kit of Claim 10, wherein said labeled immunochemically reactive component is selected from the group consisting of polyclonal antibodies to the COMT, monoclonal antibodies to the COMT, fragments thereof, and mixtures thereof.
12. A method of treating the symptoms of obsessive-compulsive disorder and disorders related thereto, comprising administering to a mammal a therapeutically effective amount of a material selected from the group consisting of a COMT, a molecule produced or acting under the control of COMT, a molecule or agent capable of promoting the production, activity and/or stability of said COMT, an agent capable of mimicking the activity of said COMT, and mixtures thereof, or a specific binding partner thereto.
13. The method of Claim 12 wherein said COMT is administered to modulate the course of therapy where COMT is being administered as the primary therapeutic agent.
14. The method of Claim 12 wherein said COMT is administered to modulate the course of therapy where COMT is being co-administered with one or more additional therapeutic agents.
15. A method of determining the obsessive-compulsive disorder-related pharmacological activity of a compound comprising: administering the compound to a mammal; determining the level of COMT proteins present; and comparing the level of COMT to a standard.
16. The method for detecting a susceptibility as set forth in Claim 1 , wherein said enzyme is monoamine oxidase-A (MAO-A).
17. The method for detecting a susceptibility as set forth in Claim 16, further comprising detecting a G to T substitution at the third base of codon 941 a nucleic acid comprising a DNA sequence as set forth in SEQ ID NO: 2, which results in a Fnu4H\ RFLP site.
18. An assay system for screening drugs and other agents for ability to treat obsessive-compulsive disorder (OCD) and disorders related thereto, comprising: A. culturing an observable cellular test colony inoculated with a drug or agent;
B. harvesting a cellular extract from said cellular test colony; and
C. examining said extract for the presence of monoamine oxidase-A (MAO-A), wherein a modulation in levels of activity of said MAO-A indicates the ability of a drag to modulate the production, stability, degradation or activity of said MAO-A, and said agent has a possible ability to treat OCD, and disorders related thereto.
19. A test kit to facilitate diagnosis and treatment of obsessive compulsive disorder or disorders related thereto, in a eukaryotic cellular sample, comprising:
A. a predetermined amount of a detectably labelled specific binding partner of a monoamine oxidase-A (MAO-A);
B. other reagents; and
C. directions for use of said kit.
20. The test kit of Claim 19 wherein said labeled immunochemically reactive component is selected from the group consisting of polyclonal antibodies to the MAO- A, monoclonal antibodies to the MAO-A, fragments thereof, and mixtures thereof.
21. A test kit to facilitate diagnosis and treatment of obsessive compulsive disorder or disorders related thereto in a eukaryotic cellular sample, comprising:
A. PCR oligonucleotide primers suitable for monoamine oxidase-A (MAO- A) detection;
B. other reagents; and
C. directions for use of said kit.
22. A test kit for demonstrating the presence of a monoamine oxidase-A (MAO-A) in a eukaryotic cellular sample, comprising:
A. a predetermined amount of a MAO-A;
B. a predetermined amount of a specific binding partner of said MAO-A;
C. other reagents; and
D. directions for use of said kit; wherein either said MAO-A or said specific binding partner are detectably labelled.
23. The test kit of Claim 22 wherein said labeled immunochemically reactive component is selected from the group consisting of polyclonal antibodies to the MAO- A, monoclonal antibodies to the MAO-A, fragments thereof, and mixtures thereof.
24. A method of treating the symptoms of obsessive-compulsive disorder or disorders related thereto, comprising administering to a mammal a therapeutically effective amount of a material selected from the group consisting of a monoamine oxidase-A (MAO-A), a molecule produced or acting under the control of MAO-A, a molecule or agent capable of promoting the production, activity and/or stability of said MAO-A, a molecule or agent capable of inhibiting the production of said MAO-A, an agent capable of mimicking the activity of said MAO-A, and mixtures thereof, or a specific binding partner thereto.
25. The method of Claim 24 wherein said MAO-A is administered to modulate the course of therapy where MAO-A is being administered as the primary therapeutic agent.
26. The method of Claim 25 wherein said MAO-A is administered to modulate the course of therapy where MAO-A is being co-administered with one or more additional therapeutic agents.
27. A method of determining the obsessive-compulsive disorder-related pharmacological activity of a compound comprising: administering the compound to a mammal; determining the level of MAO-A proteins present; and comparing the level of MAO-A to a standard.
28. A knockout mouse useful for determining the obsessive-compulsive disorder- related pharmacological activity of a compound with a phenotype that comprises a complete or diminished ability to express COMT.
29. The knockout mouse of Claim 28, comprising a first and second allele capable of expressing functional COMT, wherein:
(a) said first allele comprises a defect; and
(b) said defect prevents said first allele from expressing functional COMT.
30. The knockout mouse of Claim 29, wherein said second allele comprises a defect, and said defect prevents said second allele from expressing functional COMT, so that said knockout mouse is unable to express functional COMT.
31. The knockout mouse of either of Claims 29 or 30, wherein said defect comprises a substitution, insertion, and/or deletion of one or more nucleotides in said first and/or second allele.
32. The knockout mouse of Claim 31, wherein said defect comprises a substitution of a portion of a fragment of said allele comprising the entire set of coding exons of
COMT with a DNA sequence comprising a neo gene under the control of a PGK promoter.
33. A male knockout mouse of Claim 30 having a phenotype comprising: (a) decreased levels of functional COMT as determined in situ, relative to levels of functional COMT in a wild type male mouse;
(b) increased levels of dopamine in the frontal cortex of the brain as determined in situ, relative to levels of dopamine in the frontal cortex of a wild type male mouse, as determined in situ; (c) decreased levels of dopamine in the amygdala relative to levels of dopamine in the amygdala of a wild type male mouse, as determined in situ; and
(d) increased levels of norepinepherine in the hypothalamus as determined in situ, relative of levels of norepinepherine in the hypothalamus of a wild type male mouse, as determined in situ.
34. A knockout male mouse as set forth in Claim 29, comprising a phenotype that exhibits an increase in the frequency of aggressive behavior and a shorter latency to initial aggression, as determined in situ, relative to the frequency of aggressive behavior and latency to initial aggression exhibited in a wild type male mouse, as determined in situ.
35. A knockout female mouse of Claim 30 having a phenotype comprising:
(a) decreased levels of functional COMT as determined in situ, relative to levels of function COMT in a wild type female mouse; (b) decreased levels of dopamine in the frontal cortex of the brain as determined in situ, relative to levels of dopamine in the frontal cortex of the brain of a wild type female mouse, as determined in situ;
(c) decreased levels of dopamine in the amygdala as determined in situ, relative to levels of dopamine in the amygdala of a wild type female mouse; (d) decreased levels of norepinepherine in the hypothalamus as determined in situ, relative to levels of norepinepherine in the hypothalamus of a wild type female mouse, as determined in situ; and
(e) an increase in any anxiety-like behaviors relative to any anxiety-like behaviors in a wild type female mouse.
36. A method for making a knockout mouse comprising a first and second allele capable of expressing functional COMT, wherein said first allele comprises a defect, and said defect prevents said first allele from expressing functional COMT, comprising the steps of: (a) determining the DNA sequence of genomic DNA encoding COMT;
(b) providing a vector comprising the DNA sequence of step (a), and a selector gene contained therein;
(c) providing embryonic stem cells;
(d) inserting the vector into the embryonic stem cells; (e) selecting an embryonic stem cell which has integrated the vector into its genome such that the DNA sequence containing the selector gene there replaces the genomic DNA encoding COMT;
(f) injecting the embryonic stem cell which has integrated the vector into its genome into a blastocyte; and (g) inserting the blastocyte into a pseudopregnant female mouse so that the pseudopregnant mouse gives birth to a knockout mouse comprising a first and second allele capable of expressing functional COMT; wherein said first allele comprises a defect, and said defect prevents said first allele from expressing functional COMT.
37. The method for making a knockout mouse as set forth in Claim 36, wherein the selector gene of step (b) is a neo gene under the control of a PGK promoter.
38. The method for making a knockout mouse as set forth in Claim 36, wherein the embryonic stem cells are A7ES cells.
39. The method for making a knockout mouse as set forth in Claim 36, wherein the step of inserting the vector into the embryonic stem cell comprises electroporating the embryonic stem cell in the presence of the vector.
40. The method for making a knockout mouse as set forth in Claim 36. wherein the blastocyte is a C57B6 blastocyte.
41. A method for making a knockout mouse comprising a first and second allele capable of expressing functional COMT, wherein said first allele comprises a defect, and said second allele comprises a defect so that said knockout mouse is unable to express functional COMT, wherein said method comprises the steps of:
(a) crossing a first knockout mouse of Claim 29 with a second knockout mouse of Claim 29; and (b) selecting an offspring of the crossing of step (a) which is homozygous in that the first and second allele comprise a defect and are incapable of expressing functional COMT.
42. A method for selecting a therapeutic agent for possible use in the treatment of obsessive compulsive disorder (OCD) or disorders related thereto, comprising the steps of:
(a) administering a potential therapeutic agent to a knockout mouse of either of Claims 29 or 30;
(b) measuring levels of dopamine in the frontal cortex of the knockout mouse; and (c) comparing the measurement of step (b) with levels of dopamine in the frontal cortex of a control knockout mouse, wherein a statistically significant difference between the levels of dopamine in the frontal cortext of the knockout mouse to which the agent was administered, and levels dopamine in the frontal cortex of the control knockout mouse indicates the therapeutic agent is useful in the treatment of obsessive compulsive disorder.
43. A method for selecting a therapeutic agent for possible use in the treatment of compulsive disorder (OCD) or disorders related thereto, comprising the steps of:
(a) administering a potential therapeutic agent to a knockout mouse of either of Claims 29 or 30;
(b) measuring the ratio of homovanillic acid (HVA) to DOPAC in a region of the brain of the knockout mouse; and
(c) comparing the measurement of step (b) with the ratio of HVA to DOPAC in the same region of the brain of a control knockout mouse, wherein a statistically significant difference between the ratio of HVA to DOPAC in the region of the brain of the knockout mouse to which the agent was administered, and the ratio of FIVA to DOPAC in the region of the brain of the control knockout mouse indicates the therapeutic agent has a possible use in the treatment of obsessive compulsive disorder or disorders related thereto.
44. The method for selecting a therapeutic agent as set forth in Claim 43, wherein the region of the brain comprises the striatum, .the frontal cotex, the amygdala, or the hypothalamus.
45. A method for selecting a therapeutic agent for possible use in the treatment of compulsive disorder (OCD) or disorders related thereto, comprising the steps of:
(a) administering a potential therapeutic agent to a knockout mouse of either of Claims 29 or 30;
(b) measuring the levels of norepinepherine in the hypothalamus of the knockout mouse; and (c) comparing the measurement of step (b) with the with levels of norepinepherine in the hypothalamus of a control knockout mouse, wherein a statistically significant difference between levels of norepinepherine in the hypothalamus of the knockout mouse to which the agent was administered, and levels of norepinepherine in the hypothalamus of the control knockout mouse indicates the therapeutic agent has a possible use in the treatment of obsessive compulsive disorder or disorders related thereto.
46. A method for selecting a therapeutic agent for possible use in the treatment of compulsive disorder (OCD) or disorders related thereto, comprising the steps of:
(a) administering a potential therapeutic agent to a knockout male mouse of Claim 29;
(b) measuring the frequency of aggressive behavior and latency to initial aggression in said knockout mouse; (c) comparing the measurement of step (b) with the frequency of aggressive behavior and latency to initial aggression to a control knockout mouse of Claim 29; wherein a statistically significant difference between the frequency of aggressive behavior and latency to initiatl aggression of the knockout mouse to which the agent was administered, and the frequency of aggressive behavior and latency to initial aggression of the control knockout mouse indicates the therapeutic agent has a possible use in the treatment of obsessive compulsive disorder or disorders related thereto.
47. A method for selecting a therapeutic agent for possible use in the treatment of compulsive disorder (OCD) or disorders related thereto, comprising the steps of: (a) administering a potential therapeutic agent to a knockout male mouse of
Claim 29;
(b) measuring the frequency of aggressive behavior and latency to initial aggression in said knockout mouse; and
(c) comparing the measurement of step (b) with the frequency of aggressive behavior and latency to initial aggression to a control knockout male mouse of Claim 29; wherein a statistically significant difference between the frequency of aggressive behavior and latency to initial aggression of the l╬▒iockout male mouse to which the agent was administered, and the frequency of aggressive behavior and latency to initial aggression of the control knockout male mouse indicates the therapeutic agent has a possible use in the treatment of obsessive compulsive disorder or disorders related thereto.
48. A method for selecting a therapeutic agent for possible use in the treatment of compulsive disorder (OCD) or disorders related thereto, comprising the steps of: (a) administering a potential therapeutic agent to a knockout female mouse of Claim 30;
(b) measuring any anxiety-like behaviors exhibited by said knockout female mouse
(c) comparing the measurement of step (b) with any anxiety-like behaviors exhibited by a control knockout female mouse of Claim 30, wherein a statistically significant difference between the measurement of any anxiety-like behaviors exhibited by said female l╬▒iockout mouse to which the agent was administered, and measurement of any anxiety-like behaviors exhibited by the control knockout female mouse indicates the therapeutic agent has a possible use in the treatment of obsessive compulsive disorder or disorders related thereto.
PCT/US1998/000644 1997-01-28 1998-01-28 Gene based assay for agents with potential therapeutic efficacy in the treatment of obsessive compulsive disorder and disorders related thereto WO1998032878A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU62405/98A AU6240598A (en) 1997-01-28 1998-01-28 Gene based assay for agents with potential therapeutic efficacy in the treatmentof obsessive compulsive disorder and disorders related thereto

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US08/790,374 US5863734A (en) 1997-01-28 1997-01-28 Method of treatment for obsessive-compulsive disorder
US08/790,374 1997-01-28

Publications (1)

Publication Number Publication Date
WO1998032878A1 true WO1998032878A1 (en) 1998-07-30

Family

ID=25150500

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1998/000644 WO1998032878A1 (en) 1997-01-28 1998-01-28 Gene based assay for agents with potential therapeutic efficacy in the treatment of obsessive compulsive disorder and disorders related thereto

Country Status (3)

Country Link
US (1) US5863734A (en)
AU (1) AU6240598A (en)
WO (1) WO1998032878A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7033790B2 (en) 2001-04-03 2006-04-25 Curagen Corporation Proteins and nucleic acids encoding same

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6664055B2 (en) 2001-05-11 2003-12-16 The Salk Institute Kainate receptor subunit GLUR7 polymorphisms for determining predispositions to recurrent unipolar and bipolar II depressive disorders
US8927225B2 (en) * 2008-09-26 2015-01-06 The University Of Hong Kong Human catechol-O-methyltransferase (COMT) assay
WO2017083739A1 (en) * 2015-11-13 2017-05-18 The Trustees Of Columbia University In The City Of New York A method for predicting a subject's response to valproic acid therapy

Non-Patent Citations (14)

* Cited by examiner, † Cited by third party
Title
CAPECCHI M R: "ALTERING THE GENOME BY HOMOLOGOUS RECOMBINATION", SCIENCE, vol. 244, no. 4910, 16 June 1989 (1989-06-16), pages 1288 - 1292, XP000051938 *
CASES O ET AL.: "Aggressive behaviour and altered amounts of brain serotonin and norepinephrine in mice lacking MAOA.", SCIENCE, vol. 268, 1995, pages 1763 - 1766, XP002066749 *
GUTIERREZ B ET AL.: "Association analysis of the catechol-O-methyltransferase gene and bipolar affective disorder", AMERICAN JOURNAL OF PSYCHIATRY, vol. 154, no. 1, 1997, pages 113 - 115, XP002066741 *
HOTAMISLIGIL G S ET AL: "HUMAN MONOAMINE OXIDASE A GENE DETERMINES LEVELS OF ENZYME ACTIVITY", AMERICAN JOURNAL OF HUMAN GENETICS, vol. 49, no. 2, August 1991 (1991-08-01), pages 383 - 392, XP000619877 *
HSU Y-P P ET AL.: "Structural features of human monamine oxidase A elucidated from cDNA and peptide sequences", JOURNAL OF NEUROCHEMISTRY, vol. 51, no. 4, 1988, pages 1321 - 1324, XP002066748 *
KAAKKOLA S ET AL.: "Effects of catechol-O-methyltransferase inhibitors and L-3,4-dihydroxyphenylalanine with or without carpidopa on extracellular dopamine in rat striatum", JOURNAL OF NEUROCHEMISTRY, vol. 60, no. 1, 1993, pages 137 - 144, XP002066746 *
KARAYIORGOU M ET AL.: "Genotype and phenotype analysis at the 22q11 schizophrenia susceptibility locus", COLD SPRING HARBOUR SYMPOSIA ON QUANTITATIVE BIOLOGY, vol. LXI, 1996, pages 835 - 843, XP002066742 *
KARAYIORGOU M ET AL.: "Genotype determining low catechol-O-methytransferase activity as a risk factor for obsessive-compulsive disorder", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES USA, vol. 94, 1997, pages 4572 - 4575, XP002066750 *
KAREGE F ET AL.: "The decrease of erythrocyte catechol-O-methyltransferase activityin depressed patients and its diagnostic significance", ACTA PSYCHIATRICA SCANDINAVIA, vol. 76, 1987, pages 303 - 308, XP002066740 *
LACHMAN H M ET AL.: "Association of codon 108/158 catechol-O-methyltransferase gene polymorphism with the psychiatric manifestations of Velo-Cardio-Facial-Syndrome", AMERICAN JOURNAL OF MEDICAL GENETICS (NEUROPSYCHIATRIC GENETICS), vol. 67, 1996, pages 468 - 472, XP002066743 *
LACHMAN H M ET AL.: "Human catechol-O-methyltransferase pharmacogenetics: Description of a functional polymorphism and its potential application to neuropsychiatric disorders", PHARMACOGENETICS, vol. 6, 1996, pages 243 - 250, XP002066739 *
NORMAN T R ET AL.: "New pharmacological approaches to the management of depression: From theory to clinical practice", AUSTRALIAN AND NEW ZEALAND JOURNAL OF PSYCHIATRY, vol. 26, 1992, pages 73 - 81, XP002066745 *
SHAPIRO A K ETAL.: "Enzyme acitivity in Tourette's syndrome", ARCHIVES IN NEUROLOGY, vol. 41, 1984, pages 282 - 285, XP002066744 *
TENHUNEN J ET AL.: "Genomic organization of the human catechol O-methyltransferase gene and its expression from two distinct promotors", EUROPEAN JOURNAL OF BIOCHEMISTRY, vol. 223, 1994, pages 1049 - 1059, XP002066747 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7033790B2 (en) 2001-04-03 2006-04-25 Curagen Corporation Proteins and nucleic acids encoding same

Also Published As

Publication number Publication date
AU6240598A (en) 1998-08-18
US5863734A (en) 1999-01-26

Similar Documents

Publication Publication Date Title
EP2037948B1 (en) Detecting and treating dementia
EP1891237B1 (en) Enpp1 (pc-1) gene haplotype associated with the risk of obesity and type 2 diabetes and their applications
EP0879286B1 (en) Db, the receptor for leptin, nucleic acids encoding the receptor, and uses thereof
US20070174924A1 (en) Transgenic mice containing TRP gene disruptions
JP2019533987A (en) Compositions and methods for diagnosis and treatment of lymphatic diseases
US20050031605A1 (en) Compositions and methods of treating diabetes
US20060172322A1 (en) Mutations in the C7orf11 (TTDN1) gene causative of non-photosensitive trichothiodystrophy
EP2687223B1 (en) Detecting and treating dementia
JP2011501672A (en) Novel therapeutic targets in bowel disease
WO1998032878A1 (en) Gene based assay for agents with potential therapeutic efficacy in the treatment of obsessive compulsive disorder and disorders related thereto
US20070224648A1 (en) Methods and compositions for the diagnosis of treatment of type 2 diabetes
JP2001503631A (en) Glaucoma-associated proteins and corresponding nucleic acids and their use in therapy and diagnosis
JP4062638B2 (en) Nucleotide sequences encoding flavin monooxygenases, corresponding proteins and their use in diagnostic and therapeutic areas
US20070166230A1 (en) Ion channel
WO2007058986A2 (en) Methods for diagnosing and identifying effective therapeutics for major depressive disorder
JP2003512852A (en) Congenic animal model of non-insulin dependent diabetes
JP2007505617A (en) Receptor
US20090048200A1 (en) GPR 26 G-Protein Coupled Receptor
US7812137B2 (en) Db, the receptor for leptin, nucleic acids encoding the receptor, and uses thereof
AU2476301A (en) DB the receptor for leptin nucleic acids encoding the receptor, and uses thereof
WO2004033723A2 (en) Neurodegenerative disease-associated gene
US20090180959A1 (en) VDCC Gamma-8 Ion Channel
WO2008042762A2 (en) Single nucleotide polymorphisms associated with cardiovascular disease
Schürmann Endogenous opioid peptides in drug addiction
US20150245597A1 (en) Heterozygous mouse with an inactivated brd1 allele and uses in psychiatry

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP MX

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 1998532024

Format of ref document f/p: F

NENP Non-entry into the national phase

Ref country code: CA

122 Ep: pct application non-entry in european phase