WO1998028417A1 - Nucleic acid constructs and uses thereof for direct nucleic acid incorporation into cells - Google Patents
Nucleic acid constructs and uses thereof for direct nucleic acid incorporation into cells Download PDFInfo
- Publication number
- WO1998028417A1 WO1998028417A1 PCT/US1997/024236 US9724236W WO9828417A1 WO 1998028417 A1 WO1998028417 A1 WO 1998028417A1 US 9724236 W US9724236 W US 9724236W WO 9828417 A1 WO9828417 A1 WO 9828417A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- cells
- cell
- protein
- integration
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
- A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
- A61K47/645—Polycationic or polyanionic oligopeptides, polypeptides or polyamino acids, e.g. polylysine, polyarginine, polyglutamic acid or peptide TAT
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
Definitions
- the present invention relates to the technical field of nucleic acid incorporation into cells.
- the invention further relates to the technical field of gene therapy, as techniques described herein may be employed as part of a gene therapy protocol, wherein a number of genetic defects related to particular gene defects may be corrected and/or treated.
- Hematopoietic stem cell gene therapy offers significant promise for treatment of various diseases. At least three requirements must be satisfied for long-term efficacy of stem cell gene therapy: 1) direct genetic modification of hematopoietic stem cells, 2) maintenance of transgene sequences in stem cells and their progeny, and 3) long-term transgene expression in the appropriate cells.
- the stem cell compartment likely to be heterogeneous, consists of rare, long-lived, predominantly quiescent cells that are capable of both long-term reconstitution of the complete hematopoietic system in transplanted hosts and some degree of self-renewal [Ogawa, 1993]. Since stem cells require several months to establish hematopoiesis following transplantation, they must be supplemented with a larger number of short-term reconstituting cells for rapid engraftment [Jones et al, 1995]. For most gene therapy applications, it will likely be sufficient to modify only the stem cells - rapid reconstitution of progenitor-derived unmarked cells would be followed by long term engraftment with genetically marked stem- derived cells.
- the introduced therapeutic gene(s) must be successfully transmitted from the stem cell to progeny cells requiring the genetic correction. Since currently available episomal plasmids generally demonstrate only a moderate level of persistence in the absence of selective pressure and artificial human chromosomes await further development [Harrington et al., 1997], chromosomal integration is presently the most viable option for gene maintenance. Correction of genetic deficiencies will require that the therapeutic gene be expressed in the appropriate cells for the life of the patient. Genetic therapy for the lysosomal storage diseases, irrespective of whether they involve soluble or membrane-bound enzymes, will require life-long production of sufficient levels of the correct enzyme in monocyte/macrophages. Production of insufficient amounts of enzyme will generally lead to redevelopment of disease.
- lentivirus-based vectors may be capable of transducing some non-cycling cells [Naldini et al, 1996]
- the failure of HIV- 1 to infect quiescent primary CD4 + T-lymphocytes [Zack et al, 1990] i.e. generating only a partial, labile reverse transcript
- AAV Adeno-associated virus
- locus control region LCR- like elements [Kollias and Grosveld, 1992; Caterina et al, 1994; Talbot et al, 1990] and perhaps additional elements to shield the integrated sequences from the effects of neighboring chromatin, and b) sufficient intron/exon structure and sequences for high level expression [Brinster et al, 1988].
- LCR locus control region
- Electroporation and liposome-mediated transfection technologies have been reported for gene delivery to hematopoietic cells. However, these methods are associated with inherent features that raise questions regarding their appropriateness for stem cell gene therapy. These features include a) the inability of either method to transfect a significant percentage of enriched primary primitive hematopoietic cells of mouse and man [Toneguzzo and Keating, 1986; Harrison et al.
- HIV-1 based vectors have been reported to be capable of establishing a stable transduction intermediate in quiescent Rat 208F fibroblasts [Naldini et al, 1996]. Cells recruited from quiescence even 8 days after original infection had stable transduction frequencies equal to 50% of those infected while in a cycling state.
- the present invention in one aspect relates to the delivery of transgenes, or transgenes complexed with integration enzymes, directly to the nuclei of cells. Such has resulted in the increased incorporation of the transgene into the chromosomal DNA of the cell. In some embodiments, delivery is targeted to primitive cord blood stem cells. This technology will overcome the obstacles to transduction encountered by retroviruses and AAV vectors.
- the present invention proposes the use of Integrase-mediated integration of appropriately LTR-flanked transgenes in quiescent cells. When considered together with the propensity of retroviral DNAs to integrate into the chromatin of active genes, this indicates to the present inventor that integration is enhanced in the presence of open transcriptionally active chromatin.
- the present invention in some aspects provides for a method of introducing nucleic acid into the chromosomal nucleic acid of a cell employing a particularly defined composition that includes a protein and a transgene construct.
- the transgene construct may be further defined as comprising a nucleic acid sequence of interest flanked by a terminal fragment of a long terminal repeat sequence (LTR), such as a retroviral LTR.
- LTR long terminal repeat sequence
- the terminal fragment may include a length of about 10 to about 300 nucleotides, or between about 10 to abut 250 nucleotides, or in even further defined embodiments, between about 20 to about 200 nucleotides, in length.
- the protein is defined as an enzyme, such as a retroviral integrase.
- the protein in other embodiments of the invention may be further defined as a fusion protein, such as an enzyme fused to a nucleic acid binding protein.
- delivery is particularly targeted to primitive cord blood stem cells. The ability to deliver larger regions of DNA (containing required regulatory elements and significant intron/exon structure) than those packageable in retrovirus or AAV virions will avert the dysregulated expression and silencing frequently observed in the progeny of transduced stem/progenitor cells.
- the present invention provides improved compositions containing integrase for delivery of genetic material to cells.
- the cells are hematopoietic stem cells.
- Microinjection has only rarely been used for primary hematopoietic cells 13 . This has largely been due to the inability to effectively immobilize hematopoietic cells for microinjection, as well as the significant damage caused by standard microinjection needles to the much smaller hematopoietic cells.
- the present invention reduces both these technical difficulties.
- the invention in one aspect, provides a novel method for temporary immobilization of primitive hematopoietic cells (CD34 + , CD347CD38 " , CD347CD387Thy-l'°) allowing cells to be rapidly microinjected and then released for subsequent culture and/or transplantation.
- Fine micropipets with 0.05 - 0.5 micron tip diameter, or 0.12 - 0.2 micron tip outer diameter (O.D.), capable of controllable minimal flow rates, and causing minimal injury to microinjected cells (6-8 micron diameter) are employed in some embodiments of the invention employing the nucleic acid injection preparation described herein.
- One advantage of the herein described method is that microinjection of minute quantities of either DNA and/or proteins suffice for injection of numerous cells.
- stem cell modification due to inadequate characterization of the human stem cell phenotype.
- stem cells e.g. CD3471in7Thy-l'° 14 , CD347CD45Ra- /l 7CD7r /l 7Thy-l 1 ° 15 , CD34 CD38 ' 16 , CD347c-kit'° 17 , CD347CD38VCD337CD197CD45RaVc-kit +18
- the number of cells requiring genetic modification has reached a point where gene modification at a single cell level may be a viable alternative.
- This innovative approach focused on modifying one cell at a time as well as multiple cell injection, including the automated injection techniques, provides an economically feasible approach to current cell modification and gene therapy approaches.
- Primitive cord blood stem cells will be more efficient than delivery of same with retroviruses and AAV vectors. It is further contemplated that larger regions of DNA, such as those containing required regulatory elements and significant intron/exon structure, than those deliverable by retroviruses or AAV virions will be deliverable by the present microinjection method and will avert the dysregulated expression and silencing frequently observed in the progeny of transduced stem cells.
- the methods include the use of one or more integrases as the particular protein enzyme.
- these integrases include AAV Rep 78 or retroviral integrases such as M-MuLV, HIV-1, SIV, FeLV, RSV, AMV, or EIAV.
- retroviral integrases such as M-MuLV, HIV-1, SIV, FeLV, RSV, AMV, or EIAV.
- These integrases may be in the form of expressed recombinant proteins (expressed either in bacteria, insect cells, or eukaryotic cells) and be either wild-type integrase protein or modified in their amino acid sequence. Modification of the amino acid sequences may occur via several techniques, such as: a) by fusion with additional amino acids to facilitate purification (e.g.
- GST Glutathione S-Transferase
- MBP Maltose Binding Protein
- ⁇ LTR H ⁇ V - I sequences and Integrase HIV may also be used to even further increase the efficiency of the incorporation and integration. Increased integration efficiency may therefore be achieved by inclusion of such cellular proteins in the DNA/Integrase mixture to be delivered to cells.
- the present invention further provides for the co-delivery with the transgene construct and retrovial integrase other viral proteins that are normally present in the retroviral pre-integration complex. For example, M-MuLV gag proteins are present in the M-MuLV pre-integration complex, potentially increasing the efficiency of the integration reaction.
- FIG. 1 Introduction of transgenes into cells together with specific enzymes designed to facilitate integration. Constructs flanked by the termini of retroviral long terminal repeats (LTR) will be co-delivered with retroviral integrase. This approach could apply to any retrovirus (e.g. a lenti-virus such as Human Immunodeficiency Virus type 1 or a type C retrovirus such as Moloney Murine Leukemia Virus). Constructs flanked by the AAV inverted terminal repeats (ITR) will be co-delivered with AAV Rep 78 .
- retrovirus e.g. a lenti-virus such as Human Immunodeficiency Virus type 1 or a type C retrovirus such as Moloney Murine Leukemia Virus.
- ITR AAV inverted terminal repeats
- both transgene construct and the integration enzyme could potentially be delivered by other means, such as electroporation, liposome-mediated gene transfer, or particle-mediated bombardment.
- the integration enzyme would not need be delivered as protein. Rather, it could be co-delivered as a DNA expression construct together with the transgene targeted for integration. If only the transgene, and not the integration enzyme expression construct, was flanked with LTR or ITR sequences, this would facilitate integration of only the desired transgene.
- FIG. 2 Strategies for integration. Simple introduction of the transgene and regulatory elements into the cell, when resulting in integration, should result in integration at random sites, with possible head-to-tail concatamers. Simple addition of the AAV ITR sequences are expected to provide increased rates of integration. High frequencies of integration have been observed for rep " AAV vectors, which like this construct, only contain ITR sequences and no Rep 78 . The precise structure of the rep " AAV DNA prior to integration may either exist as a linear duplex flanked by ITRs, or be circularized in the nucleus prior to integration. Hence, the present invention proposes that increased rates of integration may result from circularization of the 2 ITR-containing construct.
- the integrants In the absence of the rep gene products the integrants generally show no specificity for the AAVS 1 region of Chromosome 19. Addition of Rep 78 protein (shown in the next construct) is expected to increase the preference of integration for Chromosome 19, since Rep 78 recognizes DNA sequences both in the AAV ITR and the Chromosome 19 AAVSI region.
- the gene construct is flanked by sequences derived from a retroviral LTR.
- the only M-MuLV LTR sequences required for in vitro integration reactions are the extreme 10-12bp LTR termini.
- the M-MuLV viral enzyme Integrase interacts with these sequences to facilitate integration in vitro and in vivo.
- FIG. 3 Diagramed are the two fusion proteins expressed and purified in our laboratory to facilitate integration of microinjected DNA sequences. Shown above is a fusion between the maltose binding protein and the Rep 78 protein of AAV. This was expressed from an MBP-Rep 78 expression construct (Batchu et al, 1995). The MBP-Rep 78 fusion protein, purified in the identical manner, was reported to exhibit in vitro binding to the AAV ITRs, endonuclease activity, and helicase activity. Should the MBP sequences interfere with integration activity (in the cell), they may be removed from Rep 78 by cleavage with factor Xa (a factor Xa cleavage site is present at the site of fusion between MBP and Rep 78 ).
- MBP-MuLV integrase gene Shown below is a similar fusion between MBP and the integrase gene of M-MuLV.
- the M-MuLV integrase gene was cloned from a construct described in Jonsson et al, (1993) - and cloned into the pMALc2 vector used for expression of MBP-Rep 78 .
- the strategy described is not limited to MBP-fusion proteins in the practice of the present invention. It could equally well employ any expression and purification strategy - for example, GST-fusions, histidine-tagged expression and purification, baculovirus expression vs. E. coli expression, and expression in eukaryotic cells.
- FIG. 4A and FIG. 4B Purification of MBP-Rep 78 fusion protein.
- FIG. 4A bacterial lysates from pMAL-Rep 78 transformed bacteria - grown either in the absence of IPTG, or the presence of IPTG (to induce MBP-Rep 78 expression).
- FIG.4B A new band of approximately 120 kD is present in the +IPTG lane. Bacteria grown in the presence of IPTG were sonicated, and the supernatant passed twice over an amylose column. MBP-Rep 78 was eluted from the column by addition of maltose. There is an additional co-purifying band, running at a somewhat lower molecular weight.
- this may be a product of a favored proteolytic cleavage of the full length MBP-Rep 78 or due to a favored early termination product.
- the purity of this preparation is estimated to be 90-95%.
- FIG.5. Purification of MBP-Integrase fusion protein.
- An expression construct fusing the MBP sequences with the M-MuLV Integrase gene [Johnson et al, 1993] was prepared. Sequencing of the expression construct confirmed the appropriate in-frame fusion.
- the MBP-Integrase protein expressed and purified similarly to that described in FIG. 4 above for MBP-Rep 78 . Bacteria grown in the presence of IPTG were sonicated, and the supernatant passed once over an amylose column. A strong band running slightly slower than the 85 kD molecular weight marker is consistent with the estimated 88 kD fusion protein. The purity of this preparation is estimated to be in the range of 70-80%o.
- prsGFP-MGMT contains both the humanized red shifted Green Fluorescent Protein gene (GFP; from Gibco BRL, pGREEN) and the human O 6 -methylguanine DNA methvltransferase gene. All transgenes in this and the following constructs are driven by the phosphoglycerate kinase (pgk) promoter sequences. This particular construct is flanked by rare enzyme sites (Fse 1, Pac 1, Asc 1, Sfi 1) to readily permit removal of bacterial plasmid sequences to obtain linearized transgene sequences only (by restriction enzyme digestion and, if necessary, eluting the correctly sized fragment from a preparative agarose gel).
- Fse 1, Pac 1, Asc 1, Sfi 1 rare enzyme sites
- prsGFP- MGMT/ITR contains the AAV2 ITR sequences flanking the prsGFP-MGMT sequences. Again, linear sequences absent of bacterial plasmid sequences will be obtained by digestion with Fse I and Sfi I enzymes. It is also possible to obtain this construct in a circularized form by converting the Sfi I site to an Fse I site, digesting with Fse 1, and religating to form a 2- ITR containing circle. Since this may be the appropriate substrate for AAV integration, this circularized construct may integrate more easily than the linearized, either in the absence or presence of Rep 78 .
- the last construct consists of linearized rsGFP-MGMT/ ⁇ LTR obtained by PCR amplification with primers containing, at their 5' ends, 20 bases of sequence corresponding to HIV-1 LTR termini. PCR amplification was used to generate double stranded linear constructs flanked by the appropriate HIV-1 termini. If the 20 bp of sequence are not sufficient for efficient integration, the strategy may be modified to include additional LTR sequences.
- FIG 7. Generation of pgk-tk/ ⁇ LTR H rv.). Shown is the construct containing the herpesvirus type 1 thymidine kinase (tk) gene, together with the phosphoglycerate kinase (pgk) promoter. Also shown are SV40 splice donor/acceptor and polyadenylation sequences. PCR primers were designed to generate a 2.74 kbp linear fragment containing the pgk and tk sequences, spanned by the terminal sequences of the HIV-1 LTR.
- tk herpesvirus type 1 thymidine kinase
- pgk phosphoglycerate kinase
- PCR primers were designed to generate a 2.74 kbp linear fragment containing the pgk and tk sequences, spanned by the terminal sequences of the HIV-1 LTR.
- the primer (HIVU3; 36 bases) employed upstream of the Fse I site included 20 bases corresponding to the terminus of the U3 region (underlined) and 16 bases corresponding to sequences in the original pCMV ⁇ vector (5' ACTGGAAGGGCTAATTCACTGTTGGGAAGGGCGATC 3') (SEQ ID NO: 1).
- the primer (HIVU5; 35 bases) employed downstream of the Sfi site included 20 bases corresponding to the terminus of the U5 region (underlined) and 15 bases c o r r e s p o n d i n g t o s e q u e n c e s i n p C M V ⁇ ( 5 ' ACTGCTAGAGATTTTCCACACAGGAAACAGCTATG 3') (SEQ ID NO: 2). Amplified linear double stranded DNA was obtained after 30 cycles of PCR amplification employing Vent DNA polymerase (New England Biolabs).
- the PCR product was extracted with chloroform, precipitated with sodium acetate and alcohol, resuspended in TE, subjected to electrophoresis in a 1% agarose gel, gel purified using a Geneclean kit (Bio 101), precipitated with sodium acetate and alcohol, resuspended in water, filtered through a 0.1 micron filter, and stored at -20 deg C until use.
- FIG 8. pgk-tk/ITR. Shown is the pgk-tk construct, flanked by AAV ITRs to generate pgk-tk ITR. Linearized ITR-flanked pgk-tk sequences are obtained by digestion with Fse I and Sfi I, and then gel purified to eliminate bacterial plasmid sequences, since bacterial plasmid sequences have been shown to interfere with gene expression in transgenic mice.
- FIG 9. Generation of covalently closed circles for facilitating integration.
- MGMT/ITR will be employed as a circular double-stranded DNA in some aspects of the present invention.
- a plasmid backbone containing the AAV ITRs has been constructed, and the rsGFP-MGMT sequences inserted between the Pac I and Asc I sites to generate prsGFP- MGMT/ITR.
- Linearized ITR-flanked rsGFP-MGMT sequences have been obtained as described above by digestion with Fse I and Sfi I.
- Circularized rsGFP-MGMT/ITR sequences, absent the plasmid backbone, will be generated as diagramed in Fig. 9.
- the Sfi I site was converted in prsGFP-MGMT/ITR to create a second Fse I site. This will be linearized and the backbone plasmid sequences removed via Fse I digestion, religate to circularize at the Fse I site, and purified for circular molecules on an agarose gel prior to microinjection.
- the present invention in some embodiments provides a method for the transduction of hematopoietic stem cells (HSCs) and thus an alternative strategy for their direct genetic modification by: 1) direct delivery of DNA sequences into the nuclei of HSCs by microinjection; 2) integration of microinjected transgene sequences in the chromatin of HSCs and persistence of those sequences in the progeny of said HSCs; and 3) microinjection of sufficiently large (15-25 Kb) transgenic DNA constructs containing regulatory elements, such as promoters, enhancers and LCRs, and intron/exon structure necessary for appropriate long- term, cell type-specific expression of the introduced transgenes; and 4) microinjection of DN A/protein mixtures with the protein(s) included in the injection sample having gene targeting activities.
- HSCs hematopoietic stem cells
- Genetically modified HSCs prepared according to the methods of the present invention can be employed for gene therapy applications once said modified HSCs have been delivered to humans for long-term reconstitution.
- hematopoietic stem cells that have been modified by microinjection of foreign material can be used to treat a variety of physiological disorders such as, by way of example and without limitation, AIDS, thalassemia, sickle cell anemia, and adenosine deaminase deficiency.
- physiological disorders contemplated within the invention will be responsive to gene therapy.
- responsive to gene therapy is meant that a patient suffering from such disorder will enjoy a therapeutic or clinical benefit such as improved symptomatology or prognosis.
- modified HSCs as cellular vehicles for gene transfer.
- the genes, or transgenes can be any gene having clinical usefulness, for example, therapeutic or marker genes or genes correcting gene defects (e.g. mutant hemoglobin genes in thalassemia or sickle cell anemia) in blood cells.
- the primary human cells are blood cells.
- blood cells as used herein is meant to include all forms of blood cells as well as progenitors and precursors thereof, as hereinabove described.
- the invention is directed to a method of enhancing the therapeutic effects of HSCs, comprising: (i) microinjecting into the HSCs of a patient a DNA segment encoding a product that enhances the therapeutic effects of the human primary cells; and (ii) introducing the genetically modified HSCs resulting from step (i) into the patient.
- the DNA produces the agent in the patient's body, and, in accordance with such embodiment, the agent is expressed at the tissue site itself.
- HSCs which are genetically engineered need not be targeted to a specific site and, in accordance with the invention, such engineered HSCs and their progeny function as a systemic therapeutic; e.g., a desired therapeutic agent can be expressed and secreted from the cells systemically.
- a method of enhancing the therapeutic effects of HSCs, that are infused in a patient comprising: (i) microinjecting into the HSCs of a patient a DNA segment encoding a product that enhances the therapeutic effects of the blood cells; and (ii) introducing cells resulting from step (i) into the patient.
- the primary human blood cells which are the progeny of modified HSCs and which can be used in the present invention include, by way of example, leukocytes, granulocytes, monocytes, macrophages, lymphocytes, and erythroblasts.
- leukocytes granulocytes
- monocytes macrophages
- lymphocytes erythroblasts
- stem cells from thalassemic or sickle cell anemia clients that are genetically modified with the appropriate hemoglobin gene may give rise to genetically corrected red blood cells.
- the DNA carried by the HSCs can be any DNA having clinical usefulness, for example, any DNA that directly or indirectly enhances the therapeutic effects of the cells.
- the DNA carried by the HSCs can be any DNA that allows the HSCs to exert a therapeutic effect that the HSCs would not normally exert.
- suitable DNA which can be used for genetically engineering, for example, blood cells, include those that encode cytokines such as tumor necrosis factor (TNF), interleukins (for example, interleukins 1-12), globin genes, DNA-repair genes, drug-resistance genes and HIV (Human Immunodeficiency Virus) resistance genes.
- TNF tumor necrosis factor
- interleukins for example, interleukins 1-12
- globin genes DNA-repair genes
- drug-resistance genes Human Immunodeficiency Virus resistance genes.
- the DNA which is used for transducing the human cells can be one whose expression product is secreted from the cells.
- the human cells can also be genetically engineered with DNA which functions as a marker, as hereinafter described in more detail.
- the inserted genes are marker genes which permit determination of the traffic and survival of the transformed cells in vivo. Examples of such marker genes include the neomycin resistance (neoR) gene, multi-drug resistant gene, thymidine kinase gene, ⁇ - galactosidase, dihydrofolate reductase (DHFR) and chloramphenicol acetyl transferase.
- the HSCs are genetically engineered in vitro.
- cells may be removed from a patient and stem cells isolated; genetically engineered in vitro with DNA encoding the therapeutic agent, with such genetically engineered HSCs being readministered along with a pharmaceutically acceptable carrier to the patient.
- a treating procedure is sometimes referred to as an ex vivo treatment.
- the progeny of the modified HSCs provide a population of primary human cells that express the product of the genetic foreign material microinjected into the parent HSCs.
- the pharmaceutically acceptable carrier may be a liquid carrier (for example, a saline solution) or a solid carrier; e.g., an implant.
- a liquid carrier for example, a saline solution
- the engineered cells may be introduced parenterally, e.g., intravenously, sub-cutaneously, intramuscularly, intraperitoneally, or intralesionaly.
- pCMV- ⁇ DNA plasmid expressing the ⁇ -gal reporter gene under control of the cytomegalovirus (CMV) promoter/enhancer sequences.
- CD34 + antigen present on approximately 0.5- 1.0% of mononuclear bone marrow and umbilical cord blood cells, marks measurable human hematopoietic stem and progenitor cells.
- Umbilical cord blood cells were obtained from normal human fetal deliveries, and mononuclear cells were purified by centrifugation over Ficoll-hypaque.
- CD34 + cells were isolated by immunomagnetic selection with the Miltenyi MiniMACS CD34 Multisort Isolation Kit (involves (1) incubation of cells with anti-CD34 antibody coupled via dextran to immunomagnetic particles, (2) isolation of magnetically-labeled cells by passing through a column attached to a magnet, (3) release of cells from magnetic particles by cleavages with dextranase, (4) separation of cells from magnetic particles by passing through column attached to a magnet). Subsequent FACS analysis, with another anti-CD34 antibody recognizing a different CD34 epitope, demonstrated that the cells were 90% pure for CD34 expressing cells.
- Purified cells were maintained overnight (18 hrs) in serum free medium (Iscoves Modified Dulbecco's Medium (IMDM, Gibco) supplemented with bovine serum albumin (2%, StemCell Technology), insulin (10 micrograms/ml,), transferrin (200 microgram/ml, ICN), 2-mercaptoethanol (0.05 mM, Sigma), low-density lipoprotein (40 microgram/ml, Sigma), and pen-strep (100 units and 50 microgram/ml, respectively) containing 20 ng/ml human Flt-3 ligand (Peprotech), 20 ng/ml human Interleukin-3 (IL-3, Peprotech), and 20 ng/ml human Stem Cell Factor (SCF, Peprotech) [IMDM/F-3-S] at 37° C with 5% CO 2 .
- IMDM Iscoves Modified Dulbecco's Medium
- Gibco bovine serum albumin
- insulin 10 micrograms/ml
- transferrin 200
- a 6 mm glass cloning ring was attached via vaseline to a 35 mm tissue culture dish (Corning).
- the dish surface enclosed by the cloning ring was coated with fibronectin by adding 30-50 microliters of a 50 microgram/ml fibronectin solution (Boehringer Mannheim, #1051-407) in phosphate buffered saline (PBS, Sigma), and incubating overnight at 4 °C (alternatively, can be for 45 min. at room temperature). Excess fibronectin-containing solution was removed from the cloning ring immediately prior to addition of cells. Attachment of CD34 + Cells to Fibronectin-Coated Dish
- IMDM/F-3-S IMDM/F-3-S.
- This cell-containing media 25 microliters containing approximately 2000 cells
- IMDM media
- ATCC #HB-243 which produces antibody reactive with Integrin beta, -human CD29.
- the 50 microliters of cell/antibody mixture was placed into a 6 mm glass cloning ring enclosing the fibronectin-coated surface. Cells, in the presence of antibody, were allowed to attach to fibronectin for greater than 30 min. at 37 °C in the presence of 5% CO 2 .
- IMDM/F-3-S was added outside the cloning ring, and the 35 mm plate containing cells and cloning ring was spun at 600 rpm for 5 min (Beckman low-speed GS-6R centrifuge, swinging bucket rotor, brake off).
- Fine glass microinjection needles were prepared from thin-walled borosilicate glass capillaries (Sutter, 1.2 mm O.D., 0.94 mm I.D.) with an automated pipet puller (Sutter, P-87, 3 mm box filament). Scanning Electron Transmission (SE) microscopy was used to determine the outer diameter of microinjection needles pulled with the identical program; O.D.s between 0.17 and .22 micron were obtained.
- SE Scanning Electron Transmission
- FITC -dextran (150,000 M.W., Sigma) at a concentration of 0.25% (weight per volume) in 50 mM Hepes (pH 7.2/100 mM KC1/5 mM NaH 2 PO 4 ) was passed through a 0.02 micron filter (World Precision Instruments) and centrifuged at high speed (10,000 rpm, IEC Centra-4b) before loading via an Eppendorf microloader into microinjection needles. Microinjections were performed manually with a Narishige micromanipulator mounted on an Olympus OMT-2 inverted microscope (with heated stage) with a 40x phase dry objective. Pressure for fluid delivery was provided by an SAS 10/2 Screw Actuated Air micro-injection/aspiration syringe.
- the cloning ring was removed immediately before microinjection. After flow of fluid from the needle was confirmed, 60 cells (in approximately 30-45 minutes) were microinjected with approximately 2-10 femtoliters of FITC-dextran. Although delivery of material was targeted for the nucleus, some material was delivered to the cytoplasm.
- FITC-dextran was monitored by fluorescence microscopy with a Nikon Diaphot 300 inverted microscope with fluorescence attachment (FITC). Both bright-field and fluorescence images can be captured and saved with a Hamamatsu chilled CCD camera and controller, Sony Trinitron monitor, frame grabber, and networked Gateway 486-25.
- FITC-positive cells out of 60 total; 58-67%>
- a significant number of the cells clearly showed nuclear localization of fluorescence; some showed both nuclear and cytoplasmic localization, and a small number showed only cytoplasmic fluorescence. Twenty-four hours post microinjection, 19 fluorescent cells (32%) were still visible; seventy-two hours post microinjection, 16 fluorescent cells (32%) were visible.
- EXAMPLE 2 TRANSGENE CONSTRUCT
- the present example is provided to demonstrate the utility of the present invention for providing transgene constructs that include a nucleic acid sequence encoding a gene of interest, such as a therapeutic gene, and the successful stable incorporation and expression of the therapeutic gene, in a cell.
- the gene may be any mammalian gene, or pharmacologically active fragment thereof, and particularly a human gene.
- the present example describes a number of transgene constructs that express both the red shifted Green Fluorescent Protein (rsGFP) reporter gene and the human O 6 - methylguanine DNA methyltransferase (MGMT) gene.
- rsGFP red shifted Green Fluorescent Protein
- MGMT human O 6 - methylguanine DNA methyltransferase
- the MGMT gene is one that would provide chemotherapeutic agent resistance to cells, and hence would provide a desired and useful treatment for a patient exposed to chemotherapeutic agents.
- chemotherapeutic agents For example, such may include patients with cancer/tumors undergoing chemotherapy as part of an anti-cancer regimen.
- the rsGFP reporter permits rapid and sensitive assessment of expression, it will permit a rapid determination of nuclear-specific gene deliver and transgene persistence.
- the human MGMT gene was chosen because MGMT transgene expression in mouse stem cells is sufficient to protect them from the toxic effects of alkylating agents such as BCNU.
- the present invention provides methods for targeted expression of MGMT in human stem cells, and further demonstrates the utility of the invention for in vivo enrichment of transduced stem cells.
- the invention provides a method for the stable transduction of primitive cord blood cells, and the preparation of immature cord blood populations enriched in SRC activity. Improved methods for stable integration frequency in cell co- injected with constructs flanked by HIV-1 LTR or AAV ITR sequences together with HIV-1 Integrase or AAV Rep 78 are also provided.
- the present example demonstrates the utility of the present invention for providing a gene therapy treatment for humans.
- the number of stem cells that need be delivered to humans for long term reconstitution may be extrapolated from mouse, large animal, and human studies to permit a reasonable estimate. Since the genetic therapies under consideration will frequently be directed to children, these estimates are based on their smaller body weight. Although a significant number of unmarked, short-term reconstituting cells may be co-delivered to better facilitate rapid engraftment and survival, the focus here is on the much smaller number of gene-modified, long-term reconstituting stem cells, a) Three independent mouse studies have reported long-term reconstitution with as few as 20 marrow cells [Halbert et al, 1995], 10 marrow cells [Russell et al, 1994], or even 1 marrow cell (20% of mice reconstituting [Akkina et al, 1994]).
- the present hematopoietic stem cell-oriented work has been with manual microinjection (100-200 injected cells/hr), the presently disclosed methods are expected to easily accommodate the higher-speed (300-600 cells/hr) automated injection.
- the automated microinjection system may well be adequate for clinical gene therapy applications.
- Computer automated systems capable of 1500 cell injections per hour [Pepperkok et al, 1988], may be employed to microinject a sufficient number of stem cells for transplantation (i.e. 1000-10,000 cells depending on the stable transduction frequency). Any significant in vitro or in vivo expansion of stem cells [Emerson, 1996], as well as together with selection for marked cells, would further decrease the number of microinjected stem cells required for engraftment.
- a significant fraction of corrected stem cells present in vivo may be accomplished by in vitro selection for marked stem cells prior to engraftment (so that only the successfully transduced cells are transplanted into the patient) and/or by subsequent in vivo selection for marked stem cells (to enrich for gene marked stem cells at the expense of endogenous, unmarked stem cells).
- This will generally require transduction of stem cells with two independently regulated genes present on the same DNA construct: the selectable gene targeted for expression in stem/progenitor cells and the therapeutic gene (e.g. ADA or globin)
- transduced stem cells include rsGFP or truncated nerve growth factor receptor (tNGF-R).
- rsGFP truncated nerve growth factor receptor
- tNGF-R truncated nerve growth factor receptor
- Transduction of stem cells with the human O 6 -methylguanine DNA methvltransferase (MGMT) gene will enable in vivo selection of surviving, marked stem cells by briefly treating patients with alkylating agents of the nitrosourea class (e.g. 1,3-bis (2- chloroethyl)-l-nitrosourea; BCNU).
- alkylating agents of the nitrosourea class e.g. 1,3-bis (2- chloroethyl)-l-nitrosourea; BCNU.
- Taxol are toxic to cycling hematopoietic progenitors, sparing the quiescent hematopoietic stem cells, nitrosoureas, such as BCNU, also exert their DNA-damaging and toxic effects directly on the stem cells.
- MGMT which removes O 6 -alkylguanine induced in DNA by various alkylating agents, is normally expressed at very low levels in hematopoietic stern/progenitor cells. However, when exogenously expressed in cells, MGMT confers cell resistance to BCNU, CCNU, dacarbazine, N-methyl-N' -nitro-N-nitrosoguanidine, temozolomide, and streptozotocin.
- mice expressing MGMT in their stem cells were resistant to BCNU-induced hematosuppression [Maze et al. , 1996].
- the human multiple drug resistance gene (MDR-1) has been proposed for in vivo selection of transduced stem cells. Human stem cells already constitutively express MDR-1 [Chudhary and Roninson, 1991].
- MDR-1 resistant drugs e.g. taxol
- the enrichment for transduced cells by MDR-1 resistant drugs e.g. taxol
- any proposed in vivo selection e.g. BCNU, taxol
- MGMT transgene expression by itself, is expected to confer resistance in hematopoietic cells to agents such as BCNU employed in high-dose or repetitive chemotherapy for breast and other cancers [Maze et al, 1996].
- gene therapeutic applications of stem cell microinjection may include the following elements: Approximately 1-10 x 10 3 highly enriched stem cells will be obtained from cord blood, and will be temporarily immobilized. Microinjection of these cells will deliver a reproducible volume — containing DNA, and in some embodiments, also include integration enzyme(s) — such that 1-3 copies of the DNA are successfully integrated per cell. Microinjected DNAs of 15-25 kb in size, containing two independently regulated transgenes, will be integrated without rearrangement. One transgene, targeted for expression in stem cells, will provide for in vitro (e.g. rsGFP, or truncated nerve growth factor receptor; tNGF- R) or in vivo (e.g.
- MGMT MGMT selection of transduced stem cells.
- the therapeutic transgene e.g. ADA for ADA SCID, globin for hemoglobinopathies, MDR-1 for chemoresistance
- ADA ADA SCID
- MDR-1 chemoresistance
- Microinjection would also be an appropriate method for eventual nuclear delivery of artificial human chromosomes and/or episomal plasmids capable of persistent maintenance.
- cell viabilities greater than 80%) post microinjection and stable transduction frequencies greater than 25% are expected to be provided.
- CD34 + , CD347CD38-, and CD347CD387Thy-l'° populations of cord blood cells are provided.
- CD34 + hematopoietic cells representing approximately 0.5 - 1.0% of nucleated umbilical cord blood and bone marrow cells, comprise all measurable human stem/progenitor activity.
- the CD347CD38 " phenotype (approximately 5-10% of CD34 + cord blood cells) characterizes an even more primitive subpopulation.
- CD347CD38 cord blood cells are highly enriched in the primitive CD347CD45Ra ' lo /CD7r l0 phenotype identified by Mayani et al. [Mayani et al, 1993].
- Protocols to purify and functionally assay these particular cell populations — to permit the microinjection and stable transduction assays — are thus to also be provided.
- Umbilical cord blood cells were obtained on a weekly basis (2-4 samples per week; total of 100-250 mis) from normal deliveries at UTMB, and pooled mononuclear cells are isolated by centrifugation over Ficoll-hypaque.
- CD34 + cells are isolated by immunomagnetic selection with the Miltenyi MiniMACS CD34 Multisort Isolation Kit. Isolated cells are obtained free of attached magnetized particles (by cleaving the dextran antibody-particle linker with dextranase). Recovery was typically 70-90% of the expected CD34 cell number (100 mis of cord blood typically yields 1-2 x 10 8 mononuclear cells, with CD34 isolation giving 1-2 x IO 6 cells with 90-95% viability and 80-95% CD34 positivity).
- Fluorescence activated cell sorting with a Becton-Dickinson FACS Vantage instrument is then employed to isolate specific CD34 + cell subpopulations.
- Cells satisfying the sort criteria are either bulk sorted into tubes or a pre-specified number are deposited into individual wells of a 96 well plate via an Automated cell deposition unit (ACDU).
- ACDU Automated cell deposition unit
- the enriched CD34 + cells are stained with PerCP-CD34 and PE-CD38 antibodies, and cells satisfying both the CD347CD38 ' and low side and forward scatter criteria are isolated.
- CD347CD38 ' cells typically comprise approximately 5-10% of the total CD34" cells; with an actual sort recovery rate of 50%, we yield approximately 2 - 5 x IO 4 CD347CD38 " cells per sort. Excellent purity of the sorted CD347CD38 " cells was obtained.
- the primitive nature of the sorted CD347CD38 " cells was substantiated by the vast majority of them exhibiting the CD45Ra "/l 7CD7r”° phenotype.
- the CD347CD38 " population may in some instances subdivide into Thy-1'° (approximately 10-25% of the CD347CD38 " cells) and Thy-1 " (approximately 75-90% of CD347CD38 " cells) subsets.
- CD347CD387Thy-l'° enriched cells can be typically recovered in such sorts.
- Such provides a method for enhancing a population of cells for primitive (CD347CD38 " , CD347CD387Thy-l'°) populations of cord blood cells to be used in the microinjection and functional assays.
- Transient reporter gene expression in cells microinjected with DNA is demonstrated in the present example.
- the rsGFP reporter is the represented DNA employed. It permits rapid assessment of gene expression, without the need for additional antibody labeling or enzymatic assays.
- Cells are isolated and attached to fibronectin.
- Cells are generally microinjected with about 100 to about 250 ng/microliter solution, in microinjection buffer, of plasmid DNA expressing the humanized rsGFP protein under control of the cytomegalovirus (CMV) promoter/enhancer.
- CMV cytomegalovirus
- Microinjection needles of 0.2 +/- 0.02 micron O.D. are presently employed.
- rsGFP expression is monitored by fluorescence microscopy using a filter set optimized for rsGFP detection. rsGFP expression in 10-15% of injected cells, 5-24 hours post injection was generally observed.
- AAV Rep 78 or M-MuLV Integrase are proteins that by interacting with these sequences, which by interacting with these sequences, will enhance and/or facilitate their integration.
- a fusion protein consisting of the maltose binding protein (MBP) fused to AAV Rep 78 has been expressed in bacteria. It has been purified to approximately 90-95%> homogeneity by double passage over an amylose column (MBP-Rep 78 120 kD, total protein obtained ⁇ 1 mg; Figure 4).
- the MBP- Rep 78 expression construct used is described in Batchu et al. (1995).
- the present investigators purified material exhibits binding to the AAV ITR sequences. Additional experiments confirm that the binding of MBP-Rep 78 to AAV ITR sequences is sequence specific (i.e. minimal binding to control, irrelevant DNA sequences) and results in the expected endonucleolytic cleavage of the ITR hairpin structure.
- the fusion protein has already been over-expressed in bacteria and has already been purified to -70-80% homogeneity by single passage over amylose (Fig. 5; MBP-Integrase 88 kD). Similar GST- and histidine-Integrase fusions have previously been shown to function in in vitro integration reactions. Again if MBP interferes with Integrase activity, MBP will be released by factor Xa cleavage. Alternatively, the GST- Integrase fusion protein will be expressed and purified [Dotan et al, 1995]).
- constructs will be employed that are capable of expressing both the red shifted Green Fluorescent Protein (rsGFP) reporter gene and the human MGMT gene.
- the rsGFP reporter gene in microinjection has been employed by the present investigators. It permits rapid assessment of transgene expression, without the need for additional antibody labeling or enzymatic assays. In addition, it may be employed for in vitro selection of successfully transduced stem cells prior to transplantation into humans.
- the human MGMT transgene will be employed because its expression in stem cells is sufficient to protect them from the toxic effects of specific alkylating agents (e.g.
- MGMT a selectable marker gene
- a therapeutic gene e.g. glucocerebrosidase
- rsGFP and human MGMT will be employed from the rsGFP-MGMT family of constructs (Fig. 6; all of these constructs have already been generated).
- the phosphoglycerate kinase (pgk) promoter highly active in immature and mature hematopoietic cells, as well as in fibroblasts, will be used to drive expression of both rsGFP and MGMT genes.
- pgk phosphoglycerate kinase
- the second is to deliver the DNA (perhaps together with integration enzymes) to the quiescent cell and establish a stable transduction intermediate, which can later be integrated when the cell is returned to its in vivo environment and undergoes a self-renewing cell division (denoted 'integration- quiescent/cycling').
- AAV vectors [Russell et al, 1994] and HIV-1 based vectors [Naldini et al. , 1996]
- a plasmid backbone containing the AAV ITRs has been completed, and the rsGFP- MGMT sequences inserted between the Pac I and Asc I sites to generate prsGFP- MGMT/ITR.
- Linearized ITR-flanked rsGFP-MGMT sequences will obtained by digestion with Fse I and Sfi I.
- Circularized rsGFP-MGMT/ITR sequences, absent the plasmid backbone, will be generated as diagramed in Figure 9.
- the Sfi I site has been converted in prsGFP-MGMT/TTR to create a second Fse I site.
- the construct will be linearized and backbone plasmid sequences removed via Fse I digestion, religated to circularize at the Fse I site, and circular molecules purified on an agarose gel prior to microinjection.
- retroviruses both lentiviruses (e.g. HIV- 1 ) and type C retroviruses
- AAV e.g. M-MuLV
- wild-type AAV is the ability to incorporate gene sequences, with high efficiency, into the chromosomal DNA of the target cell. Provided that the multiplicity of infection is sufficiently high, a significant fraction, if not all, of the target cells may acquire an integrated proviral copy.
- the only retroviral LTR sequences required for in vitro integration reactions are the extreme 10-12 bp LTR termini [Goff, 1992; Goodarzi et al, 1995; Reicin et al, 1995; LaFemina et al, 1991].
- the retroviral Integrase enzyme interacts with these sequences to facilitate integration in vitro and in vivo [Goff, 1992; Goodarzi et al, 1995; Reicin et al, 1995; LaFemina et al, 1991].
- retroviral vectors There appears to be no site specificity for integration of retroviral vectors, although there is a preference for integration into the chromatin of transcriptionally active genes [Vijaya et al. , 1986; Withers- Ward et al. , 1994] and a preference with respect to nucleosomal conformation [Pruss et al, 1994].
- Wild-type AAV is unique in its preferential integration into a specific region of the human genome.
- AAV Rep 78 is required for chromosome 19 specific integration, since rep " AAV vectors do not have the same pattern of site-specific integration as rep + AAV vectors [Muzyczka, 1992].
- the Rep 78 protein is believed to play several essential roles in chromosome 19 specific AAV integration — mediating the formation of a complex between a 12 nucleotide sequence within the ITRs and a similar sequence on chromosome 19 (the AAVS1 region) prior to integration, and also introducing a strand-specific break within AAVS1 [Linden et al, 1996].
- Providing the purified Integrase or Rep 78 protein together with the delivered DNA, possibly as a preformed DNA7 protein complex, may have advantages over producing the integration proteins in cells from an expression construct.
- Already delivering an ⁇ LTR/Integrase or ITR/Rep 78 DNA/protein complex will eliminate the need for the expressed proteins to translocate from the cytoplasm to the nucleus, and then to find and form complexes with the ⁇ LTR or ITR sequences.
- HIV-1 is capable of delivering proviral DNA to nuclei of quiescent cells and stably transducing quiescent macrophages [Wenberg et al, 1991; Lewis et al, 1992]. Although it has not yet been conclusively demonstrated that HIV-1 based vectors can integrate in G 0 cells, they are capable of establishing a stable transduction intermediate in quiescent Rat 208F fibroblasts ('integration-quiescent/cycling') [Naldini et al, 1996]. Cells recruited from quiescence even 8 days after original infection had stable transduction frequencies equal to 50% of those infected while in a cycling state. We have chosen to initially examine HIV-1 Integrase (rather than M-MuLV Integrase) will be examined for its ability to facilitate integration.
- HIV-1 is known to be capable of the 'full-site' integration events in vitro [Goodarzi et al, 1995] and to stably transduce quiescent cells. Whether M-MuLV Integrase is also capable of accomplishing integration in quiescent cells is unknown, since pre- integration complexes of wild-type M-MuLV and M-MuLV vectors are incapable of transport into the nuclei of quiescent cells [Miller et al, 1990]. However, previous studies have indicated that the actual integration of M-MuLV sequences need not occur during mitosis [Roe et al, 1993].
- AAV vector DNA integrates into cellular DNA as one to several tandem copies joined to chromosomal DNA through the ITR termini [Flotte and Carter, 1995]. When linked to other transgene sequences, the ITRs alone are sufficient to confer increased rates of integration [Philip et al. , 1994].
- AAV vectors to directly transduce non-cycling cells [Podsakoff et al, 1994; Russell et al , 1994]. Although AAV- vectors prefer cycling cells for transduction, they either directly integrate at low frequency in non-cycling cells ('integration-quiescent') [Podsakoff et al. , 1994] or exist as single stranded episomes in non-cycling cells and subsequently integrate as double stranded DNA when the cells go through S-phase ('integration- quiescent/cycling') [Russell et al, 1994]. The ability of Integrase to facilitate integration of linearized ⁇ LTR-flanked rsGFP- MGMT sequences.
- the rsGFP-MGMT sequences will be flanked by the most terminal 20 bp HIV-1 LTR sequences to generate rsGFP-MGMT/ ⁇ LTR.
- This linear construct will be generated by PCR employing primers 35 bases in length - 15 bases corresponding to the extreme rsGFP-MGMT sequences and 20 bases identical to HIV-1 LTR termini.
- Cells will be microinjected with either PCR-generated linear molecules of rsGFP-MGMT/ ⁇ LTR pre- incubated with Integrase, or with PCR-generated linear molecules of rsGFP-MGMT/ ⁇ LTR alone. Since 20-30 kb sequences can be generated by PCR amplification using optimized protocols, this approach should be generally applicable to larger transgene constructs.
- cells will be microinjected either with linearized rsGFP- MGMT/TTR pre-incubated with Rep 78 , or linearized rsGFP-MGMT/ITR alone.
- Circular double-stranded proviral DNA may be the relevant substrate for normal AAV integration. This will be evaluated by employing cir-rsGFP-MGMT/ITR.
- DNA and proteins will be incubated together prior to microinjection into a cell.
- optimization of integration frequency will likely require varying the following experimental parameters: a) # of DNA molecules delivered per cell, b) # of Integrase or Rep 78 molecules per DNA molecule, and c) conditions for preloading of DNA with Integrase or Rep 78 .
- the present example demonstrates the utility of the present invention for increased frequency of stable transduction with co-delivery of Integrase ⁇ . ! together with transgene constructs flanked by ⁇ LTR HIV _, sequences.
- the ability of Integrase ⁇ . i to facilitate integration of linearized ⁇ LTRmv., -flanked pgk-tk sequences is also further identified.
- the pgk-tk sequences were flanked by the most terminal 20 bp HIV-1 LTR U3/U5 sequences to generate pgk-tk/ ⁇ LTR HIV _ ⁇ ( Figure 7).
- This linear construct was generated by PCR employing primers 35-36 bases in length, with 15-16 bases corresponding to the extreme pgk-tk sequences and 20 bases identical to LTR HIV . ! U3/U5 termini.
- Rat-2tk(-) cells were microinjected with either PCR-generated linear molecules of pgk-tk/ ⁇ LTR H ⁇ y .1 pre-incubated with Integrase HrV - ⁇ , or with PCR-generated linear molecules of pgk-tk/ ⁇ LTR H , v. , alone. Since 20-30 kb sequences can be generated by PCR amplification using optimized protocols, this approach should be generally applicable to larger transgene constructs.
- the HIV- 1 ⁇ 4 The HIV- 1 ⁇ 4 .
- Integrase enzyme was utilized. This integrase enzyme has been modified at two amino acids to make it more soluble, without affecting its in vitro integration ability. This general technique is known to those of skill in the art, and is described in Jenkins et al, 1996. The expression construct pINSD.His.Sol may be used to express and purify additional enzyme, as needed.
- Rat-2(tk-) cells were grown in Dulbecco's Modified Eagles Medium (DMEM) containing 10% Fetal Bovine Serum (FBS), 100 units/ml penicillin, 100 microgram/ml streptomycin, and 2 mM glutamine. On the day prior to injection, cells were plated at 20,000 cells per 35 mm dishes that previously had 0.4 mm rectangular grids etched into the tissue culture surface. DNA or DNA + protein were delivered into the nuclei of cells using borosilicate microinjection needles having a tip outer diameter of approximately 0.3 - 0.45 micron.
- DMEM Dulbecco's Modified Eagles Medium
- FBS Fetal Bovine Serum
- penicillin 100 units/ml
- streptomycin 100 microgram/ml
- 2 mM glutamine 2 mM glutamine
- Solutions of DNA alone contained approximately 42 ng/microliter of pgk- tk/ ⁇ LTR Hrv . ⁇ (23 nM) in lx microinjection buffer (50 mM Hepes [pH 7.2], 100 mM KC1, 5 mM NaH 2 PO 4 ) containing 10 mM MgCl 2 . Injection of 5-10 femtoliters is estimated to deliver approximately 70-140 DNA molecules per cell. Solutions of DNA and protein contained the same concentration of DNA together with 17 ng/microliter Integrase HIV . ! (445 nM). This value was chosen to yield approximately 20 molecules of injected protein per molecule of injected DNA. The DNA solution was passed through a 0.1 micron filer to remove any aggregates including crystals believed to be MgPO 4 .
- the present example is provided to demonstrate the use of the present invention for use in conjunction with proteins.
- the protein used in the present study was an enzyme, Rep 78 .
- Rep 78 an enzyme
- the present example demonstrates the utility of the present invention for providing increased frequency of stable transduction with co-delivery of Rep 78 together with transgene constructs flanked by AAV ITR sequences.
- ITR/Rep 78 strategy cells were microinjected either with linearized pgk-tk/ITR co-delivered with Rep 78 , or linearized pgk-tk/ITR alone. Linearized ITR-flanked pgk-tk sequences were obtained by digestion with Fse I and Sfi I, and then gel purified to eliminate bacterial plasmid sequences. The purified MBP-Rep 78 protein described in Figure 4 was used.
- MBP-Rep 78 has been previously observed by the inventors to be active in in vitro ITR binding and endonuclease reactions. These studies were performed as described in Example 11 except that the DNA solution contained pgk-tk/ITR at a concentration of 50 ng/microliter (23 nM), the DNA/protein solution contained pgk-tk/ITR at 50 ng/microliter and MBP-Rep 78 at 56 ng/microliter (475 nM), and the MgCl 2 concentration was 2 mM. These values were chosen to yield approximately 20 molecules of injected protein per molecule of injected DNA. Although the exact volume delivered per cell was not known, injection of 5-10 femtoliters would deliver approximately 70-140 DNA molecules per cell.
- the present example demonstrates the utility of the present invention for the generation of covalently closed circles for facilitating integration.
- circular double- stranded proviral DNA may be the relevant substrate for normal AAV integration, and possibly for retroviral integration, it may be useful to first circularize the transgene constructs.
- One such circularized construct is shown for cir-rsGFP-MGMTTTR in Figure 9.
- a plasmid backbone containing the AAV ITRs has been constructed, and the rsGFP-MGMT sequences inserted between the Pac I and Asc I sites to generate prsGFP-MGMT/ITR.
- Linearized ITR-flanked rsGFP-MGMT sequences have been obtained as described above by digestion with Fse I and Sfi I.
- the Sfi I site (the backbone plasmid sequences) in prs GFP-
- MGMT/ITR was converted to create a second Fse I site.
- the molecule will be linearized and removed via Fse I digestion.
- the molecule will then be religated to circularize at the Fse I site.
- the circular molecules will then be purified on an agarose gel prior to microinjection.
- the above strategy may also be used to facilitate retroviral Integrase-mediated integration of transgene constructs.
- constructs shown in Figure 6 containing ⁇ LTR sequences are all linear, it is possible that presenting the transgene flanked by ⁇ LTR or LTR sequences on a circular construct would lead to increased frequencies of integration.
- substrate for retroviral provirus integration is believed to be a linear molecule flanked by LTRs, it is conceivable that the circular proviral molecules (containing either one or two LTRs) present in the nucleus of retro virally infected cells are also potential substrates for integration.
- the LTRs, or LTR terminal sequences included in such circular constructs may be either in juxtaposition to each other, or separated by some distance.
- this distance may be defined by a number of nucleic acid bases.
- the number of nucleic acid bases separating the first and the second LTR terminal sequences could be between 2 to about 200 nucleotide bases.
- the LTR terminal fragments are separated by about 10 to about 20 nucleotide bases.
- AAV Rep 78 is required for chromosome 19 specific integration, since rep " AAV vectors do not have the same pattern of site-specific integration as rep + AAV vectors [Muzyczka, 1992].
- the Rep 78 protein is believed to play several essential roles in chromosome 19 specific AAV integration ⁇ mediating the formation of a complex between a 12 nucleotide sequence within the ITRs and a similar sequence on chromosome 19 (the AAVS 1 region) prior to integration, and also introducing a strand-specific break within AAVSl [Linden et al, 1996].
- Rep 78 may itself be described as a protein having both a binding activity for specific DNA sequences, and an integrase activity.
- transgenes to the globin locus by fusing retroviral integrase to the DNA binding domains of GAT A- 1 or NF- E2 erythroid specific transcription factors
- Another potential example would be targeting the integration to chromatin known to be 'open' in monocyte/macrophages may facilitate long-term expression of therapeutic genes for lysosomal storage diseases.
- this invention provides for the co-delivery to a cell of a first and a second DNA sequence.
- This first and second nucleic acid sequence may be created as two separate constructs, one containing the transgene(s) of interest flanked by appropriate LTR or ITR sequences, and the other being an expression construct encoding a protein, particularly an enzyme capable of facilitating the incorporation of the transgene sequence into the cellular chromosomal DNA (i.e. retroviral integrase or Rep 78 ).
- Microinjection would be capable of co-delivering both the transgene construct and integrase-expression construct to the nucleus of cells to be genetically modified.
- Emerson SG "Ex vivo expansion of hematopoietic precursors, progenitors, and stem cells: the next generation of cellular therapeutics," Blood, 87:3082, 1996.
- Toneguzzo, F Keating, A, "Stable expression of selectable genes introduced into human hematopoietic stem cells by electric field-mediated DNA transfer," Proc. Natl. Acad. Sci. USA, 83:3496, 1986.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Immobilizing And Processing Of Enzymes And Microorganisms (AREA)
Abstract
Description
Claims
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP52911798A JP2001507230A (en) | 1996-12-23 | 1997-12-20 | Nucleic acid constructs and their use for direct nucleic acid integration into cells |
CA002275892A CA2275892A1 (en) | 1996-12-23 | 1997-12-20 | Nucleic acid constructs and uses thereof for direct nucleic acid incorporation into cells |
EP97954318A EP0946718A1 (en) | 1996-12-23 | 1997-12-20 | Nucleic acid constructs and uses thereof for direct nucleic acid incorporation into cells |
AU58121/98A AU733715B2 (en) | 1996-12-23 | 1997-12-20 | Nucleic acid constructs and uses thereof for direct nucleic acid incorporation into cells |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US3381696P | 1996-12-23 | 1996-12-23 | |
US60/033,816 | 1996-12-23 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1998028417A1 true WO1998028417A1 (en) | 1998-07-02 |
Family
ID=21872610
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1997/024236 WO1998028417A1 (en) | 1996-12-23 | 1997-12-20 | Nucleic acid constructs and uses thereof for direct nucleic acid incorporation into cells |
Country Status (5)
Country | Link |
---|---|
EP (1) | EP0946718A1 (en) |
JP (1) | JP2001507230A (en) |
AU (1) | AU733715B2 (en) |
CA (1) | CA2275892A1 (en) |
WO (1) | WO1998028417A1 (en) |
Cited By (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2002024916A1 (en) * | 2000-09-20 | 2002-03-28 | Takara Bio Inc. | Complex |
WO2006022249A1 (en) * | 2004-08-24 | 2006-03-02 | Kyoto University | Target nucleic acid of retrovirus integration |
JP2006345867A (en) * | 1999-01-08 | 2006-12-28 | Amaxa Gmbh | Use of cell transport system for transferring nucleic acid across nuclear membrane |
US10610606B2 (en) | 2018-02-01 | 2020-04-07 | Homology Medicines, Inc. | Adeno-associated virus compositions for PAH gene transfer and methods of use thereof |
US11306329B2 (en) | 2018-02-19 | 2022-04-19 | City Of Hope | Adeno-associated virus compositions for restoring F8 gene function and methods of use thereof |
US11952585B2 (en) | 2020-01-13 | 2024-04-09 | Homology Medicines, Inc. | Methods of treating phenylketonuria |
US12076420B2 (en) | 2020-05-27 | 2024-09-03 | Homology Medicines, Inc. | Adeno-associated virus compositions for restoring PAH gene function and methods of use thereof |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1995032225A1 (en) * | 1994-05-23 | 1995-11-30 | The Salk Institute For Biological Studies | Method for site-specific integration of nucleic acids and related products |
WO1996018727A1 (en) * | 1994-12-16 | 1996-06-20 | Avigen Incorporated | Adeno-associated derived vector systems for gene delivery and integration into target cells |
-
1997
- 1997-12-20 WO PCT/US1997/024236 patent/WO1998028417A1/en not_active Application Discontinuation
- 1997-12-20 JP JP52911798A patent/JP2001507230A/en active Pending
- 1997-12-20 EP EP97954318A patent/EP0946718A1/en not_active Withdrawn
- 1997-12-20 AU AU58121/98A patent/AU733715B2/en not_active Ceased
- 1997-12-20 CA CA002275892A patent/CA2275892A1/en not_active Abandoned
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1995032225A1 (en) * | 1994-05-23 | 1995-11-30 | The Salk Institute For Biological Studies | Method for site-specific integration of nucleic acids and related products |
WO1996018727A1 (en) * | 1994-12-16 | 1996-06-20 | Avigen Incorporated | Adeno-associated derived vector systems for gene delivery and integration into target cells |
Non-Patent Citations (4)
Title |
---|
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, 30 September 1994, Vol. 203, No. 3, SHOJI-TANAKA et al., "Gene Transfer Using Purified Retroviral Integrase", pages 1756-1764. * |
PROC. NATL. ACAD. SCI. U.S.A., December 1993, Vol. 90, ANDREWS et al., "The Ubiquitous Subunit of Erythyroid Transcription Factor NF-E2 is a Small Basic-Leucine Zipper Protein Related to the V-Maf Oncogene", pages 11488-11492. * |
PROC. NATL. ACAD. SCI. U.S.A., October 1994, Vol. 91, MILLER et al., "Recombinant Adeno-Associated Virus (rAAV)-Mediated Expression of a Human Y-Globin Gene in Human Progenitor-Derived Erythroid Cells", pages 10183-10187. * |
THE EMBO JOURNAL, 15 December 1993, Vol. 12, No. 13, WHYATT et al., "The Two Zinc Finger-Like Domains of GATA-1 have Different DNA Binding Specificities", pages 4993-5005. * |
Cited By (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2006345867A (en) * | 1999-01-08 | 2006-12-28 | Amaxa Gmbh | Use of cell transport system for transferring nucleic acid across nuclear membrane |
WO2002024916A1 (en) * | 2000-09-20 | 2002-03-28 | Takara Bio Inc. | Complex |
KR100801873B1 (en) | 2000-09-20 | 2008-02-11 | 다카라 바이오 가부시키가이샤 | Complex |
WO2006022249A1 (en) * | 2004-08-24 | 2006-03-02 | Kyoto University | Target nucleic acid of retrovirus integration |
US10610606B2 (en) | 2018-02-01 | 2020-04-07 | Homology Medicines, Inc. | Adeno-associated virus compositions for PAH gene transfer and methods of use thereof |
US11951183B2 (en) | 2018-02-01 | 2024-04-09 | Homology Medicines, Inc. | Adeno-associated virus compositions for PAH gene transfer and methods of use thereof |
US12064486B2 (en) | 2018-02-01 | 2024-08-20 | Homology Medicines, Inc. | Adeno-associated virus compositions for PAH gene transfer and methods of use thereof |
US11306329B2 (en) | 2018-02-19 | 2022-04-19 | City Of Hope | Adeno-associated virus compositions for restoring F8 gene function and methods of use thereof |
US11891619B2 (en) | 2018-02-19 | 2024-02-06 | City Of Hope | Adeno-associated virus compositions for restoring F8 gene function and methods of use thereof |
US11952585B2 (en) | 2020-01-13 | 2024-04-09 | Homology Medicines, Inc. | Methods of treating phenylketonuria |
US12076420B2 (en) | 2020-05-27 | 2024-09-03 | Homology Medicines, Inc. | Adeno-associated virus compositions for restoring PAH gene function and methods of use thereof |
Also Published As
Publication number | Publication date |
---|---|
AU733715B2 (en) | 2001-05-24 |
JP2001507230A (en) | 2001-06-05 |
AU5812198A (en) | 1998-07-17 |
EP0946718A1 (en) | 1999-10-06 |
CA2275892A1 (en) | 1998-07-02 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Miller | Human gene therapy comes of age | |
EP0918874B1 (en) | Self-replicating episomal expression vectors conferring tissue-specific gene expression | |
US7312324B2 (en) | Regulatory elements for delivery to the liver | |
WO1994012629A9 (en) | Episomal vectors for gene therapy | |
Van Tendeloo et al. | Gene therapy: principles and applications to hematopoietic cells | |
JP2001512689A (en) | Methods for genetically modifying T cells | |
US20220025403A1 (en) | Reduced and minimal manipulation manufacturing of genetically-modified cells | |
US5661022A (en) | Purification of retroviral vectors | |
US6472212B1 (en) | Methods and compositions for genetically modifying primate bone marrow cells | |
US20220056477A1 (en) | Foamy viral vector compositions and methods for the manufacture of same | |
AU733715B2 (en) | Nucleic acid constructs and uses thereof for direct nucleic acid incorporation into cells | |
US7759467B2 (en) | Enhanced mediated DNA transfer | |
US20030157070A1 (en) | High efficiency ex vivo transduction of cells by high titer recombinant retroviral preparations | |
US5837536A (en) | Expression of human multidrug resistance genes and improved selection of cells transduced with such genes | |
EP0821740A1 (en) | High efficiency ex vivo transduction of hematopoietic stem cells by recombinant retroviral preparations | |
EP0948594A1 (en) | Method and device for microinjection of macromolecules into non-adherent cells | |
WO2023178292A1 (en) | Genetically engineered t cell for cell therapy | |
AU4528096A (en) | Viral vector complexes having adapters of predefined valence | |
WO1996033282A2 (en) | High efficiency ex vivo transduction of cells by high titer recombinant retroviral preparations | |
US6797494B1 (en) | Self-replicating episomal expression vectors conferring tissue-specific gene expression | |
Moore et al. | Optimizing conditions for gene transfer into human hematopoietic cells | |
CA2283641A1 (en) | Methods and compositions for genetically modifying primate bone marrow cells | |
Coles et al. | Retroviral gene transduction of circulating progenitor cells in patients with metastatic breast cancer | |
CA2115291A1 (en) | Mdr1 retroviral plasmid |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BB BG BR BY CA CH CN CZ DE DK EE ES FI GB GE HU IS JP KE KG KP KR KZ LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG US UZ VN AM AZ BY KG KZ MD RU TJ TM |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SZ UG ZW AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
ENP | Entry into the national phase |
Ref document number: 2275892 Country of ref document: CA Ref country code: CA Ref document number: 2275892 Kind code of ref document: A Format of ref document f/p: F |
|
ENP | Entry into the national phase |
Ref country code: JP Ref document number: 1998 529117 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1997954318 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 58121/98 Country of ref document: AU |
|
WWP | Wipo information: published in national office |
Ref document number: 1997954318 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWG | Wipo information: grant in national office |
Ref document number: 58121/98 Country of ref document: AU |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1997954318 Country of ref document: EP |