WO1998028331A2 - A variant human alpha-7 acetylcholine receptor subunit, and methods of production and use thereof - Google Patents

A variant human alpha-7 acetylcholine receptor subunit, and methods of production and use thereof Download PDF

Info

Publication number
WO1998028331A2
WO1998028331A2 PCT/US1997/023405 US9723405W WO9828331A2 WO 1998028331 A2 WO1998028331 A2 WO 1998028331A2 US 9723405 W US9723405 W US 9723405W WO 9828331 A2 WO9828331 A2 WO 9828331A2
Authority
WO
WIPO (PCT)
Prior art keywords
human
nachr
variant
subunit
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1997/023405
Other languages
French (fr)
Other versions
WO1998028331A3 (en
Inventor
Clark A. Briggs
Murali Gopalakrishnan
David G. Mckenna
Lisa M. Monteggia
Jean-Marc Roch
James P. Sullivan
Edward Touma
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Abbott Laboratories
Original Assignee
Abbott Laboratories
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Abbott Laboratories filed Critical Abbott Laboratories
Priority to JP52893398A priority Critical patent/JP2001506135A/en
Priority to EP97954155A priority patent/EP0946726A2/en
Priority to CA002275180A priority patent/CA2275180A1/en
Publication of WO1998028331A2 publication Critical patent/WO1998028331A2/en
Publication of WO1998028331A3 publication Critical patent/WO1998028331A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70571Receptors; Cell surface antigens; Cell surface determinants for neuromediators, e.g. serotonin receptor, dopamine receptor
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the invention relates generally to receptor proteins and to DNA and RNA molecules encoding therefor.
  • the invention relates to a variant human ⁇ 7 subunit in which there is a substitution of the valine-274 position of the wild-type human ⁇ 7 subunit.
  • the invention also relates to DNA and RNA molecules that encode the variant human 7 subunit, as well as to methods of using the variant subunit to identify compounds that interact with it.
  • nAChR nicotinic acetylcholine receptor
  • the nAChR is comprised of transmembrane polypeptide subunits that form a cation-selective ion channel gated by acetylcholine (ACh) and other ligands.
  • ACh acetylcholine
  • TM-2 hydrophobic transmembrane M2
  • nAChRs Two of the more prominent nAChRs in brain are those containing ⁇ 4 subunits and those containing ⁇ 7 subunits (Sargent (1993) Annu. Rev. Neurosci. 16:403-443; Court et al.
  • a splice variant involving the TM-2 region of the ⁇ 7 subunit has been detected in bovine chromaffin cells (Garcia-Guzman et al. (1995) Eur. J. Neurosci. 7:647-655), and a naturally-occurring mutation of a protein homologous to the ⁇ 7 subunit found in Caenorhabditis elegans, leads to neurodegeneration (Treinin et al. (1995) Neuron 14:871-877).
  • the latter is a single amino acid mutation in the TM-2 region similar to the chick ⁇ 7 valine-251 to threonine ("c- ⁇ 7V251T") mutation, one of several mutations artificially introduced into the chick ⁇ 7 subunit to facilitate the study of ⁇ 7 nAChR structure and subunit function (Bertrand et al. (1995) Sem. Neurosci. 7:75-90).
  • c- ⁇ 7V251T (also referred to as ⁇ 7-4) retained high calcium permeability but desensitized slowly, and was 180-fold more 5 sensitive to ACh.
  • c- ⁇ 7V251T nAChR responded to dihydro- ⁇ -erythroidine ("DH ⁇ E"), normally an nAChR antagonist at ⁇ 7 and other wild-type nAChR, as if it were an agonist (Galzi et al. (1992) Nature 359:500-505; Bertrand et al. (1993) Proc. Natl. Acad. Sci. USA 90:6971-6975).
  • DH ⁇ E dihydro- ⁇ -erythroidine
  • chick ⁇ 7 nAChR is pharmacologically similar to the mammalian cc7 5 nAChR, there are significant differences.
  • DMPP l,l-dimethyl-4-phenylpiperazinium
  • DMPP is a very weak partial agonist in the chick ⁇ 7 nAChR, but is a highly efficacious agonist at the human ⁇ 7 nAChR (Peng et al. (1994) Mol. Pharmacol. 45:546-554).
  • the present invention relates to a variant human ⁇ 7 subunit in which valine-274 has been changed in analogy with the corresponding chick receptor variant.
  • This variant is 5 analogous to the chick ⁇ 7V25 IT variant with regard to the relative position of the amino acid substitution in the TM-2 region.
  • the variant human ⁇ 7 subunit exhibits unexpectedly different pharmacological and electrophysiological characteristics.
  • the ⁇ 7 subunit combines with itself and may combine with other subunits to create various nicotinic acetylcholine receptors.
  • a DNA molecule is provided, wherein the DNA molecule encodes a variant human ⁇ 7 subunit in which the valine-274 has been replaced.
  • a recombinant vector comprising such a DNA molecule is 5 provided.
  • the subject invention is directed to a human ⁇ 7 subunit variant in which the valine-274 has been replaced.
  • the invention is directed to messenger RNA encoded by the DNA, recombinant host cells transformed or transfected with vectors comprising the DNA or 5 fragments thereof and methods of producing recombinant polypeptides for the treatment of neurodegenerative processes, enzymatic function, affective disorders and immunofunction, using such cells.
  • compounds such as antagonists are provided, as well as antisense polynucleotides, which are useful in treating conditions such as neurodegenerative 0 processes, enzymatic disfunction, affective disorders and immunofunction. Methods of treating individuals using these compounds and antisense polynucleotides also are provided.
  • methods and reagents are provided for detecting the ⁇ 7 variant.
  • the invention is directed to a method of expressing the 5 human ⁇ 7 subunit variant in a cell to produce the resultant ⁇ 7 variant.
  • the invention is directed to a method of identifying compounds that modulate the subunit or receptors containing the subunit and to a method of identifying cytoprotective compounds using such cells.
  • Figure 1 depicts the strategy for generating the human ⁇ 7V274T AChR mutant DNA using polymerase chain reaction.
  • Figures 2A-2C show the nucleotide sequence (SEQ ID NO: 1 ) of the human ⁇ 7 cDNA containing the V274T mutation. The threonine mutation is shown in bold and the restriction sites EcoRV and Kpnl are shown underlined. Also shown is the deduced amino acid sequence (SEQ ID NO: 2) of the human ⁇ 7V274T subunit variant derived from the cDNA. The V274T alteration is underlined.
  • Figure 3 graphically compares the concentration-response relationships for ACh
  • Figure 4 graphically depicts the activation by ACh and decay rate of the human 5 ⁇ 7 V274T response compared to that of the human ⁇ 7 WT nAChR.
  • Figure 5 graphically depicts the responses of human ⁇ 7V274T to nAChR antagonists wherein MEC is mecamylamine (10 M), MLA is methyllycaconitine (10 nM), and DH ⁇ E is dihydro- ⁇ -erythroidine (10 M).
  • MEC mecamylamine
  • MLA is methyllycaconitine
  • DH ⁇ E dihydro- ⁇ -erythroidine
  • Figure 6 graphically depicts the current versus voltage relationship of responses to 10 ⁇ M ACh of the human ⁇ 7V274T expressed in Xenopus laevis oocytes, wherein the circles represent responses measured in modified Barth's solution containing 10 mM Ba 2+ (90 mM NaCI, 1 mM KC1, 0.66 mM NaNO 3 , 10 mM BaCl 2 , 2.4 mM NaHCO 3 , 2.5 mM sodium 0 pyruvate, and 10 mM Na-HEPES buffer, final pH 7.55) to prevent activation of
  • Figure 7 graphically depicts the specific binding of [ 125 I] ⁇ -Bungarotoxin, an al nAChR-selective ligand, to an HEK-293 clone transfected with variant human ⁇ 7V274T.
  • AChR intends a receptor for the neurotransmitter acetylcholine (“ACh”).
  • AChRs are broadly subclassified as nicotinic or muscarinic. These types differ in their pharmacology, structures, and signal transduction mechanisms.
  • nAChR intends a nicotinic acetylcholine receptor. Although nAChRs of various subunit structures are best known in muscle cells, neurons, and chromaffin cells, they are not necessarily excluded from other cells types (for example, glial cells, mast cells, blood 0 cells, fibroblasts, etc.).
  • nAChR subunit intends a proteinaceous molecule which can combine with other such molecules in the formation of a nAChR.
  • the muscle nAChR is believed to be a pentamer comprised of four types of transmembrane subunit: two ⁇ l subunits, one ⁇ l subunit, one ⁇ subunit and one ⁇ or ⁇ subunit depending upon the nAChR 5 form.
  • Neuronal nAChR analogously are also thought to be pentameric and comprised of related but different subunits. At present, eight neuronal ⁇ subunits ( ⁇ 2- ⁇ 9) and three neuronal ⁇ subunits ( ⁇ 2- ⁇ 4) have been isolated.
  • nAChR neuronal nAChR appear to require at least one ⁇ subunit and at least one ⁇ subunit for a functional complex (i.e., ion channel response to ACh or other agonists). Some subunits, however, may self-assemble to form o "homooligomeric" nAChR, as in the case of ⁇ 7 nAChR in Xenopus oocytes and in transfected mammalian cells. Although the combination of nAChR subunits with subunits related to other types of receptor (for example, other classes of ligand-gated ion channel) has not been demonstrated, it is within the scope of the present invention that such combinations are possible.
  • wild-type intends the typical, usual or most common form as it occurs in nature.
  • the human wild-type ⁇ 7 nAChR as used herein was described in Doucette-Stamm et al. (1993) Drug Dev. Res. 30: 252-256.
  • An abbreviation of the form “ ⁇ 7XnnnO” intends an ⁇ 7 subunit in which the amino acid X, located at position nnn relative to the wild-type sequence, has been replaced by amino acid O.
  • the chick cx7V251T o nAChR indicates the chick ⁇ 7 nAChR in which the valine located at position 251 in the wild- type receptor has been replaced by a threonine.
  • a “nicotinic cholinergic agonist” is a compound that binds to and activates a nicotinic acetylcholine receptor. By “activates” is intended the elicitation of one or more pharmacological, physiological, or electrophysiological responses. Such a response includes, 5 but is not limited to, cell membrane depolarization and increased permeability to Ca 2+ and other cations.
  • a “nicotinic cholinergic antagonist” is a substance that binds to a nicotinic acetylcholine receptor and prevents agonists from activating the receptor. Pure antagonists do not activate the receptor, but some substances may have mixed agonist and antagonist properties.
  • Nicotinic cholinergic channel blockers block the ability of agonists to elicit current flow through the 5 nicotinic acetylcholine receptor channel, but do so by blocking the channel rather than by preventing agonists from binding to and activating the receptor.
  • a “nicotinic cholinergic modulator” is a substance that influence the activity of the nicotinic acetylcholine receptor through interaction at one or more sites other than the classic agonist binding site.
  • the modulator may itself increase or decrease receptor activity, or may o influence agonist activity (for example, potentiating responses) without itself eliciting an overt change in channel current.
  • a single substance can have different properties at different nicotinic acetylcholine receptor subtypes, for example being an agonist at one receptor and antagonist at another, or an antagonist at one and a channel blocker at another.
  • nAChR regulator is intended a substance that may act as an agonist, antagonist, 5 channel blocker or modulator.
  • polynucleotide as used herein means a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. Thus, the term includes double- and single-stranded DNA, as well as double- and single-stranded RNA. It also includes modifications, such as by methylation o and/or by capping, and unmodified forms of the polynucleotide.
  • variant is used to refer to an oligonucleotide sequence which is differs from the related wild-type sequence in one or more nucleotides.
  • a variant oligonucleotide is expressed as a protein variant which, as used herein, indicates a polypeptide sequence that differs from the wild-type polypeptide in the substitution, insertion or deletion of one or more 5 amino acids.
  • the variant polypeptide differs in primary structure (amino acid sequence), but may or may not differ significantly in secondary or tertiary structure or in function relative to the wild-type.
  • mutant generally refers to an organism or a cell displaying a new genetic character or phenotype as the result of change in its gene or chromosome. In some instances, o however, “mutant” may be used in reference to a variant protein or oligonucleotide and
  • mutation may refer to the change underlying the variant.
  • Polypeptide and “protein” are used interchangeably herein and indicate a molecular chain of amino acids linked through peptide bonds. The terms do not refer to a specific length of the product. Thus, peptides, oligopeptides, and proteins are included within the definition 5 of polypeptide. The terms include post-translational modifications of the polypeptide, for example, glycosylations, acetylations, phosphorylations and the like. In addition, protein fragments, analogs, mutated or variant proteins, fusion proteins and the like are included within the meaning of polypeptide.
  • a “functionally conservative mutation” as used herein intends a change in a polynucleotide encoding a derivative polypeptide in which the activity is not substantially 5 altered compared to that of the polypeptide from which the derivative is made.
  • Such derivatives may have, for example, amino acid insertions, deletions, or substitutions in the relevant molecule that do not substantially affect its properties.
  • the derivative can include conservative amino acid substitutions, such as substitutions which preserve the general charge, hydrophobicity/hydrophilicity, side chain moiety, and/or stearic bulk of the amino acid 0 substituted, for example, Gly/Ala, Val/Ile/Leu, Asp/Glu, Lys/Arg, Asn/Gln, Thr/Ser, and Phe Trp/Tyr.
  • conservative amino acid substitutions such as substitutions which preserve the general charge, hydrophobicity/hydrophilicity, side chain moiety, and/or stearic bulk of the amino acid 0 substituted, for example, Gly/Ala, Val/Ile/Leu, Asp/Glu, Lys/Arg, Asn/Gln, Thr/Ser, and Phe Trp/Tyr.
  • structural conservative mutant a polynucleotide containing changes in the nucleic acid sequence but encoding a polypeptide having the same amino acid sequence as the polypeptide encoded by the polynucleotide from which the degenerate variant 5 is derived. This can occur because a specific amino acid may be encoded by more than one "codon,” or sequence of three nucleotides, within the polynucleotide.
  • Recombinant host cells refer to cells which can be, or have been, used as recipients for recombinant vectors or o other transfer DNA, immaterial of the method by which the DNA is introduced into the cell or the subsequent disposition of the cell.
  • the terms include the progeny of the original cell which has been transfected. Cells in primary culture as well as cells such as oocytes also can be used as recipients.
  • a "vector” is a replicon in which another polynucleotide segment is attached, such as to 5 bring about the replication and/or expression of the attached segment.
  • the term includes expression vectors, cloning vectors, and the like.
  • a "coding sequence” is a polynucleotide sequence that is transcribed into rr RNA and/or translated into a polypeptide. The boundaries of the coding sequence are determined by a translation start codon at the 5'-terminus and a translation stop codon at the 3'-terminus.
  • a o coding sequence can include, but is not limited to, mRNA, cDNA, and recombinant polynucleotide sequences. Variants or analogs may be prepared by the deletion of a portion of the coding sequence, by insertion of a sequence, and/or by substitution of one or more nucleotides within the sequence.
  • operably linked refers to a situation wherein the components described are in a relationship permitting them to function in their intended manner.
  • a control sequence "operably linked" to a coding sequence is ligated in such a manner that expression of the coding sequence is achieved under conditions compatible with the control sequences.
  • a 5 coding sequence may be operably linked to control sequences that direct the transcription of the polynucleotide whereby said polynucleotide is expressed in a host cell.
  • transfection refers to the insertion of an exogenous polynucleotide into a host cell, irrespective of the method used for the insertion, or the molecular form of the polynucleotide that is inserted.
  • the insertion of a polynucleotide per se and the insertion of a o plasmid or vector comprised of the exogenous polynucleotide are included.
  • the exogenous polynucleotide may be directly transcribed and translated by the cell, maintained as a nonintegrated vector, for example, a plasmid, or alternatively, may be stably integrated into the host genome.
  • Transfection generally is used in reference to a eukaryotic cell while the term “transformation” is used to refer to the insertion of a polynucleotide into a prokaryotic cell. 5 "Transformation" of a eukaryotic cell also may refer to the formation of a cancerous or tumorigenic state.
  • isolated when referring to a polynucleotide or a polypeptide, intends that the indicated molecule is present in the substantial absence of other similar biological macromolecules.
  • isolated as used herein means that at least 75 wt.%, more o preferably at least 85 wt.%, more preferably still at least 95 wt.%, and most preferably at least
  • 98 wt.% of a composition is the isolated polynucleotide or polypeptide.
  • An "isolated polynucleotide” that encodes a particular polypeptide refers to a polynucleotide that is substantially free of other nucleic acid molecules that do not encode the subject polypeptide; however, the molecule may include functionally and/or structurally conservative mutations as 5 defined herein.
  • a variant human ⁇ 7 subunit, a polynucleotide encoding the variant subunit, and methods of making the variant subunit are provided herein.
  • the invention includes not only 5 the variant subunit but also methods for screening compounds using the variant subunit, cells expressing the variant subunit.
  • the polynucleotide encodes a human ⁇ 7 subunit variant in which the valine-274 of the wild-type ⁇ 7 subunit has been replaced.
  • the polynucleotide encodes a human ⁇ 7 subunit in which the valine-274 has been replaced by a o threonine, or a conservative substitution for the threonine, for example, serine.
  • the human ⁇ 7 variant nAChR exhibits both similar and unexpectedly different properties relative to other structurally related nAChRs.
  • the human ⁇ 7V274T responses to cholinergic agonists decay slowly compared to the human wild-type ⁇ 7 nAChR responses.
  • human ⁇ 7V274T is 5 about two orders of magnitude more sensitive to chohnergic receptor agonists such as nicotine and ACh compared to the wild-type.
  • human and chick receptor variants differ pharmacologically, for example, in that human ⁇ 7V274T is weakly activated by dihydro- ⁇ -erythroidene (DH ⁇ E) while chick cx7V251T is strongly activated ( Figure 5 and Galzi et al. (1992). Mutations in the channel o domain of a neuronal nicotinic receptor convert ion selectivity from cationic to anionic. Nature
  • d-tubocurarine is a potent antagonist of human ⁇ 7V274T compared to an activator of the related chick ⁇ 7L247T mutant (Bertrand et al. (1992) Unconventional pharmacology of a neuronal nicotinic receptor mutated in the channel domain. Proc. Natl. Acad. Sci. (U.S. A.) 89: 1261-1265).
  • the human and chick ⁇ 7 receptor variants 5 are electrophysiologically different as well.
  • the chick ⁇ 7V25 IT nAChR does not exhibit inward current rectification (Galzi et al.
  • PCR polymerase chain reaction
  • PCR employs short oligonucleotide primers (generally 10-20 nucleotides in length) that match opposite ends of a desired sequence within the wild- type DNA molecule.
  • the sequence between the primers need not be known.
  • the initial template can be either RNA or DNA. If RNA is used, it is first reverse transcribed to cDNA. The cDNA is then denatured, using well known techniques such as heat, and appropriate oligonucleotide primers are added in molar excess.
  • Primers bearing the mutation will hybridize to the wild-type polynucleotide at a temperature slightly below that of the wild-type primer-polynucleotide duplex.
  • the primer can be made specific by keeping primer length and base composition within relatively narrow limits, and by keeping the mutant base or bases centrally located (Zoler et al. (1983) Meth. Enzymol. 100:468).
  • Primer extension is effected using DNA polymerase in the presence of deoxynucleotide triphosphates or nucleotide analogs.
  • the resulting product includes the respective primers at their 5'-termini, covalently linked to the newly synthesized complements of the original strands.
  • the replicated molecule is again denatured, hybridized with primers, and so on, until the product is sufficiently amplified.
  • PCR methods are described in for example, U.S. Patent Nos. 4,965,188; 4,800,159; 4,683,202; 4,683,195; incorporated herein by reference in their entireties.
  • the product of the PCR is cloned and the clones containing the mutated DNA, derived by segregation of the primer extended strand, selected. Selection can be accomplished using the mutant primer as a hybridization probe.
  • the wild-type DNA may be obtained from an appropriate DNA library.
  • DNA libraries may be probed using the procedure described by Grunstein et al. (1975) Proc. Natl. Acad. Sci. USA 73:3961.
  • the ⁇ 7V274T variant could be generated using an RT-PCR (reverse transcriptase-polymerase chain reaction) approach starting with human RNA.
  • RT-PCR reverse transcriptase-polymerase chain reaction
  • single- stranded cDNA is synthesized from human RNA (approx. 1.5 g) as the template using standard reverse transcriptase procedures.
  • the cDNA is amplified in two segments and the mutation is introduced using PCR and two pairs of primers.
  • the internal primers are designed to carry the codon for threonine (T) or other desired change in place of the wild-type valine (V) at position 274 (see also Example 1 p. 28 and Figure 1).
  • T threonine
  • V wild-type valine
  • PCR reactions are combined using the 3 and 5 end primers to re-amplify the full length coding sequence of ⁇ 7V274T. This is but one example of the generation of a7V274T from a human brain template.
  • Synthetic oligonucleotides may be prepared using an automated oligonucleotide synthesizer such as that described by Warner (1984) DNA 3:401. If desired, the synthetic strands may be labelled with 32 P by treatment with polynucleotide kinase in the presence of 2 P-ATP, using standard conditions for the reaction. DNA sequences including those isolated from genomic or cDNA libraries, may be modified by known methods which include site- directed mutagenesis as described by Zoller (1982) Nucleic Acids Res. 10:6487.
  • the DNA to be modified is packaged into phage as a single stranded sequence, and converted to a 5 double stranded DNA with DNA polymerase using, as a primer, a synthetic oligonucleotide complementary to the portion of the DNA to be modified, and having the desired modification included in its own sequence.
  • Culture of the transformed bacteria, which contain replications of each strand of the phage are plated in agar to obtain plaques. Theoretically, 50% of the new plaques contain phage having the mutated sequence, and the remaining 50% have the original l o sequence.
  • Rephcates of the plaques are hybridized to labelled synthetic probe at temperatures and conditions suitable for hybridization with the correct strand, but not with the unmodified sequence.
  • the sequences which have been identified by hybridization are recovered and cloned. Alternatively, it may be necessary to identify clones by sequence analysis if there is difficulty in distinguishing the small difference variant from wild-type by hybridization. In any combination of the transformed bacteria, which contain
  • the DNA may then be incorporated into a cloning vector or an expression vector for replication in a suitable host cell.
  • Vector construction employs methods known in the art. Generally, site-specific DNA cleavage is performed by treating with suitable restriction enzymes under conditions which generally are specified by the manufacturer of these 0 commercially available enzymes. After incubation with the restriction enzyme, protein is removed by extraction and the DNA recovered by precipitation. The cleaved fragments may be separated using, for example, polyacrylamide or agarose gel electrophoresis methods, according to methods known by those of skill in the art.
  • Sticky end cleavage fragments may be blunt ended using E. coli DNA polymerase 1 5 (Klenow) in the presence of the appropriate deoxynucleotide triphosphates (dNTPs) present in the mixture. Treatment with SI nuclease also may be used, resulting in the hydrolysis of any single stranded DNA portions.
  • E. coli DNA polymerase 1 5 Klenow
  • dNTPs deoxynucleotide triphosphates
  • Ligations are performed using standard buffer and temperature conditions using T4 DNA ligase and ATP. Alternatively, restriction enzyme digestion of unwanted fragments can 0 be used to prevent ligation.
  • Standard vector constructions generally include specific antibiotic resistance elements. Ligation mixtures are transformed into a suitable host, and successful transformants selected by antibiotic resistance or other markers. Plasmids from the transformants can then be prepared according to methods known to those in the art usually following a chloramphenicol 5 amplification as reported by Clewell et al. ( 1972) J. Bacteriol. 110:667 may be added. The DNA is isolated and analyzed usually by restriction enzyme analysis and/or sequencing. Sequencing may be by the well-known dideoxy method of Sanger et al. (1977) Proc. Natl. Acad. Sci. USA 74:5463) as further described by Messing et al. (1981) Nucleic Acid Res.
  • Host cells are genetically engineered with the vectors of this invention which may be a cloning vector or an expression vector.
  • the vector may be in the form of a plasmid, a viral particle, a phage, etc.
  • the engineered host cells can be cultured in conventional nutrient media 0 modified as appropriate for activating promoters, selecting transformants/transfectants or amplifying the subunit-encoding polynucleotide.
  • the culture conditions such as temperature, pH and the like, generally are similar to those previously used with the host cell selected for expression, and will be apparent to those of skill in the art.
  • Both prokaryotic and eukaryotic host cells may be used for expression of desired 5 coding sequences when appropriate control sequences that are compatible with the designated host are used.
  • appropriate control sequences that are compatible with the designated host are used.
  • Escherichia coli is frequently used.
  • expression control sequences for prokaryotes include but are not limited to promoters, optionally containing operator portions, and ribosome binding sites.
  • Transfer vectors compatible with prokaryotic hosts can be derived from, for example, the plasmid o pBR322 that contains operons conferring ampiciUin and tetracycline resistance, and the various pUC vectors, that also contain sequences conferring antibiotic resistance markers. These markers may be used to obtain successful transformants by selection.
  • prokaryotic control sequences include but are not limited to the lactose operon system (Chang et al. (1977) Nature 198:1056), the tryptophan operon system (reported by Goeddel et al. 5 (1980) Nucleic Acid Res. 8:4057) and the lambda-derived PI promoter and N gene ribosome binding site (Shimatake et al. (1981) Nature 292:128) and the hybrid Tac promoter (De Boer et al. (1983) Proc. Natl. Acad. Sci. USA 292: 128) derived from sequences of the trp and lac UV5 promoters.
  • lactose operon system Chang et al. (1977) Nature 198:1056
  • tryptophan operon system Reported by Goeddel et al. 5 (1980) Nucleic Acid Res. 8:4057
  • the lambda-derived PI promoter and N gene ribosome binding site Shi
  • coli prokaryotic hosts
  • other prokaryotic hosts such as strains of Bacillus or Pseudomonas may be used if desired.
  • o Eukaryotic hosts include yeast and mammalian cells in culture systems. Pichia pastoris, Saccharomyces cerevisiae and S. carlsbergensis are commonly used yeast hosts.
  • Yeast-compatible vectors carry markers that permit selection of successful transformants by conferring protrophy to auxotrophic mutants or resistance to heavy metals on wild-type strains.
  • Yeast compatible vectors may employ the 2- ⁇ origin of replication (Broach et al. (1983) Meth. 5 Enzymol.
  • control sequences for yeast vectors are known in the art and include but are not hmited to promoters for the synthesis of glycolytic enzymes, including the promoter for 3-phosphoglycerate kinase. See, for example, Hess et al. (1968) J. Adv. Enzyme Reg. 7:149, Holland et al. (1978) Biochemistry 17:4900 and Hitzeman (1980) J. Biol. Chem. 255:2073. 5
  • some useful control systems are those that comprise the glyceraldehyde-
  • GAPDH 3-phosphate dehydrogenase
  • ADH alcohol dehydrogenase
  • terminators also derived from GAPDH
  • leader sequences from yeast alpha factor.
  • the transcriptional regulatory region and the transcriptional initiation region which are operably linked may be such that they are not 0 naturally associated in the wild-type organism.
  • Mammahan cell Unes avaUable as hosts for expression are known in the art and are available from depositories such as the American Type Culture CoUection. These include but are not limited to HeLa cells, human embryonic kidney (HEK) ceUs, Chinese hamster ovary (CHO) cells, baby hamster kidney (BHK) cells, and others. Suitable promoters for 5 mammalian ceUs also are known in the art and include viral promoters such as that from Simian Virus 40 (SV40), Rous sarcoma virus (RSV), adenovirus (ADV), bovine pap loma virus (BPV), cytomegalovirus (CMV).
  • Simian Virus 40 SV40
  • Rous sarcoma virus RSV
  • ADV adenovirus
  • BCV bovine pap loma virus
  • CMV cytomegalovirus
  • Mammatian cells also may require terminator sequences and poly A addition sequences; enhancer sequences which increase expression also may be included, and sequences which cause amplification of the gene also may be desirable. These o sequences are known in the art.
  • Vectors suitable for replication in mammalian cells may include viral replicons, or sequences which ensure integration of the appropriate sequences encoding the variant ⁇ 7 nAChR subunit into the host genome.
  • An example of a mammalian expression system for nAChRs is described in Gopalakrishnan et al. (1995) Stable expression and pharmacological properties of the human ⁇ 7 nicotinic acetylcholine receptor. Eur. J. 5 Pharmacol. -Mol. Pharmacol. 290: 237-246.
  • eukaryotic systems are also known, as are methods for introducing polynucleotides into such systems, such as amphibian cells using methods described in Briggs et al. (1995) Neuropharmacol. 34:583-590, insect cells using methods described in Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987), and the like.
  • the baculovirus expression system can be used to generate high levels of recombinant proteins in insect host cells. This system allows for high level of protein expression, while post-translationally processing the protein in a manner similar to mammalian cells.
  • These expression systems use viral promoters that are activated following baculovirus infection to drive expression of cloned genes in the insect cells (O'Reilly et al.
  • Transfection may be by any known method for introducing polynucleotides into a host cell, including packaging the polynucleotide in a virus and transducing a host cell with the virus, by direct uptake of the polynucleotide by the host cell, and the like, which methods are known to those skilled in the art.
  • the transfection procedures selected depend upon the host to 5 be transfected and are determined by the rountineer.
  • the expression of the variant receptor subunit may be detected by use of a radioligand selective for the receptor.
  • a radioligand selective for the receptor for example, for the nicotinic cholinergic receptor, such a ligand may be [ 125 I] ⁇ -bungarotoxin.
  • any radioligand binding technique known in the art may be used to detect the receptor subunit (see, for example, Winzor et al. (1995) Quantitative o Characterization of Ligand Binding, Wiley-Liss, Inc., NY).
  • the variant nAChR polypeptide is recovered and purified from recombinant host cell cultures expressing the same by known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, hydroxyapatite chromatography or 5 lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
  • HPLC high performance liquid chromatography
  • the human ⁇ 7 variant polypeptide, or fragments thereof, of the present invention may also be synthesized by conventional techniques known in the art, for example, by chemical o synthesis such as solid phase peptide synthesis. In general, these methods employ either solid or solution phase synthesis methods. See, for example, J. M. Stewart and J. D. Young, Solid Phase Peptide Synthesis, 2nd Ed., Pierce Chemical Co., Rockford, IL (1984) and G. Barany and R. B. Merrifield, The Peptides: Analysis, Synthesis, Biology, editors E. Gross and J. Meienhofer, Vol. 2, Academic Press, New York, (1980), pp. 3-254, for solid phase peptide 5 synthesis techniques; and M. Bodansky, Principles of Peptide Synthesis, Springer- Verlag,
  • either the DNA or the RNA derived therefrom, both of which encode the desired variant human ⁇ 7 nAChR subunit may be expressed by direct injection into 0 a cell, such as zXenopus laevis oocyte.
  • a cell such as zXenopus laevis oocyte.
  • the functionality of the human ⁇ 7 nAChR subunit variant encoded by the DNA or the inRNA can be evaluated as follows (see Dascal (1987) CRC Crit. Rev. Biochem. 22:317-387).
  • a variant-encoding polynucleotide is injected into an oocyte for translation into a functional receptor subunit.
  • the function of the expressed variant human ⁇ 7 nAChR can be assessed in the oocyte by a variety of 5 electrophysiological techniques including intracellular voltage recording, two-electrode voltage clamp, patch clamp methods, and the like.
  • the cation-conducting channel intrinsic to the nAChR opens in response to ACh or other nicotinic cholinergic agonists, permitting the flow of transmembrane current. This current can be monitored directly by voltage clamp techniques or indirectly by intracellular voltage recording, wherein changes in membrane potential due to the induced current are measured.
  • 5 Receptors expressed in a recombinant host cell may be used to identify compounds that modulate nAChR activity.
  • the specificity of the binding of a compound showing affinity for the receptor is demonstrated by measuring the affinity of the compound for cells expressing the receptor or membranes from these cells. This may be done by measuring specific binding of labeled (for example, radioactive) compound to the cells, cell o membranes or isolated receptor, or by measuring the ability of the compound to displace the specific binding of a standard labeled ligand.
  • labeled for example, radioactive
  • Expression of variant receptors and screening for compounds that bind to, or inhibits the binding of labeled ligand to these cells or membranes provides a method for rapid selection of compounds with high affinity for the receptor. These compounds may be agonists or antagonists for the receptor.
  • Expressed receptors may also be used to screen for compounds that modulate nicotinic acetylcholine receptor activity, i.e, nicotinic cholinergic agonists or antagonists.
  • One method for identifying compounds that modulate nAChR activity comprises providing a cell that expresses a variant human ⁇ 7 nicotinic acetylcholine receptor (nAChR) polypeptide having an amino acid substitution at position valine-274 of the wild-type human ⁇ 7 nAChR polypeptide, o combining a test compound with the cell and measuring the effect of the test compound on the variant receptor activity.
  • nAChR nicotinic acetylcholine receptor
  • the cell may be a bacterial cell, a mammalian cell, a yeast cell, an amphibian cell or any other cell expressing the receptor.
  • the cell is a mammalian cell or an amphibian cell.
  • a test compound is evaluated for its ability to elicit an appropriate response, for example, the stimulation of transmembrane current flow, or 5 for its ability to inhibit the response to a cholinergic agonist.
  • expressed receptors may be used to screen compounds that exhibit a cytoprotective effect.
  • Abnormal activation of membrane channels is a potential cause of neurodegenerative disease.
  • a number of inherited human disorders are accompanied by neuronal degeneration (Adams et al. (1989) Degenerative Disease of the 0 Nervous System, in Principles of Neurology, McGraw-Hill, NY, pp. 921-967).
  • Many model systems have been used to study the causes of these diseases. For example, mutations in proteins that have extensive sequence similarity to proteins that contribute to the amiloride- sensitive sodium ion channel have been associated with vacuolated neurodegeneration in the nematode C. elegans (Canessa et al.
  • a so-called "gain-of-function" mutation in the deg-3 protein of C. elegans causes vacuolated degeneration of a small set of neurons (Treinin et al. (1995), supra). Studies of this mutation suggested to these investigators that mutation in neuronal acetylcholine receptors may lead to death of specific neuronal populations.
  • the ⁇ 7 variant can be used to screen for compounds useful in treating 5 disorders such as alterations in sensory gating, immunofunction and neuropathic pain, for example, pain associated with cancerous conditions, post herpatic neuralgia, diabetic neuropathy and oseoarthritis. Further, the ⁇ 7 vaiant could be used to treat or to kill cancerous cells.
  • nicotinic drugs are considered potential therapeutic agents in several 0 neurodegenerative disorders including, without limitation, Alzheimer's disease, Down's syndrome, kuru, Parkinson's disease, multiple system atrophy, neuropathic pain and the like, in which they may be useful in slowing cell death.
  • Activation of the wild type ⁇ 7 nAChR appears to elicit cytoprotective properties (for example, reduced cell lysis, see Donnelly- Roberts et al. (1996) In vitro neuroprotective properties of the novel cholinergic channel 5 activator (ChCA), ABT-418. Brain Res. 719: 36-44).
  • a full agonist or partial agonist is preferable, nor, if the latter, what type of partial agonist is best (for example, one that stabilizes the open and desensitized states or one that stabilizes the open and resting states of the receptor).
  • This variant ⁇ 7 nAChR can be used to evaluate these questions, and to select among ligands for specific types of partial agonists or o specific types of antagonists. That is because this variant ⁇ 7 nAChR conducts current in the desensitized as well as the open states, unlike the wild type receptor that conducts only in the open state (see Bertrand and Changeux (1995) Nicotinic receptor: An allosteric protein specialized for intercellular communication.
  • ⁇ 7 nAChR ligand pharmacology can be defined in novel ways through the use of the human variant nAChR subunit.
  • Substances could be antagonists at the wild type ⁇ 7 nAChR due to their ability to stabilize the non-conducting desensitized state, or due to other mechanisms such as stabilizing the resting state or blocking the ion channel. Similar mechanisms could contribute to partial agonism at the wild type ⁇ 7 nAChR.
  • the ability of a 5 ligand to stabihze the desensitized state could be evaluated by comparing the ligand s potency and efficacy at the variant ⁇ 7 nAChR (for example, human ⁇ 7V274T) to its potency and efficacy at the wild-type ⁇ 7 nAChR.
  • variant ⁇ 7 nAChR for example, human ⁇ 7V274T
  • the interaction of compounds with the nAChR can be identified using several methods, including, but not limited to, electrophysiologic measurement of transmembrane current flow or electrical potential, measurement of the fluorescence of potential- or ion-sensitive dyes, or measurement of radioactive ion flux (for example ⁇ Na + 0 r 5 "Rb + ) and a variety of ⁇ 7 nAChR expression systems, for example transfected mammalian cells in culture or injected amphibian cells.
  • This novel definition of ⁇ 7 nAChR pharmacology coupled with measures of ⁇ 7 ligand effect on cell or animal functioning could be critical to the development of novel therapeutics.
  • a ligand that stabilizes the desensitized state of the ⁇ 7 nAChR subunit (partial agonist or antagonist) is o preferable for cytoprotection.
  • the type of ligand more or less useful in other nicotinic applications such as cognition, memory, anxiety, attention, sensory gating (psychoses and schizophrenia), etc. could be evaluated using variant 7 nAChR subunits alone or in combination with other receptor subunits.
  • the expressed variant ⁇ 7 subunit may be used 5 to investigate mechanisms of cytotoxicity and cytoprotection.
  • the evidence that activation of ⁇ 7 nAChR is cytoprotective comes from the finding that nAChR agonists elicit cytoprotection in cells expressing the 7 nAChR subunit and that this cytoprotection is inhibited by selective ⁇ 7 antagonists (for example see Donnelly-Roberts et al., supra).
  • the mechanism is unknown but may involve the stimulation of Ca 2+ influx. If so, then the increased Ca 2+ influx mediated o by the variant ⁇ 7 nAChR, due to maintained Ca 2+ permeability with prolonged current activation, may augment the cytoprotection.
  • the ⁇ 7 nAChR subunit may also function 5 through mechanisms dependent upon a change in receptor state (for example, from resting to desensitized conformation), which may influence its interaction with other proteins, but not necessarily dependent upon a change in ion flux or electrical potential.
  • the variant ⁇ 7 nAChR subunit would be critical in determining such mechanisms as it would allow one to identify ligands that favor different receptor states, and as it provides a tool for manipulating nAChR o channel current independently from nAChR conformation and ligand binding.
  • Cytoprotective or cytotoxic compounds that interact with the variant nAChR may be identified using several methods.
  • One such method comprises providing a cell that expresses a variant human ⁇ 7 nAChR subunit having an amino acid substitution at position valine-274 of the wild-type human ⁇ 7 nAChR polypeptide, combining a test compound with the cell, and 5 monitoring the cell for an indicator of cytotoxicity. If it is necessary to control spontaneous action of the variant nAChR subunit, it may be stably expressed in a recombinant mammalian cell line under the control of an inducible promoter, for example, the LacSwitch system which is inducible by isopropylthiogalactoside ("LPTG").
  • LPTG lacSwitch system which is inducible by isopropylthiogalactoside
  • ⁇ 7 nAChR subunit Expression of the variant ⁇ 7 nAChR subunit would be maintained at a low level until induction by the addition of IPTG.
  • the transfected cells could be cultured in the presence of an ⁇ 7 nAChR blocker, such as methyllycaconitine ("MLA”) or mecamylamine, that would prevent or reduce cytotoxic action.
  • MVA methyllycaconitine
  • mecamylamine methyllycaconitine
  • Both blockers are reversible, permitting one to measure the effect of test compound on al nAChR function after the blocker is washed out. Cytoprotective compounds can be identified by their ability to reduce cell death while cytotoxic compounds can be identified by their ability to promote cell death.
  • ⁇ 7 nAChR subunit, variant or wild type can be identified by the ability of an al nAChR blocker to prevent the effect.
  • Cell death, or cytotoxicity can be monitored by a variety of techniques including but not limited to measurement of cell number or density in the culture, of cell growth rate (for example incorporation of labeled nucleotide or amino acid), or of cell integrity for example by uptake of a dye (for example trypan blue is excluded by healthy cells) or by the release of a cytoplasmic constituent such as lactate dehydrogenase (LDH).
  • LDH lactate dehydrogenase
  • Cytoprotective agents may also be screened for their ability to antagonize a variant nAChR to a greater extent than a wild-type nAChR, or for their ability to augment the decay rate of variant nAChR compared to the wild-type nAChR, using methods described in the examples provided below.
  • the DNA, or RNA derived therefrom can be used to design oligonucleotide probes for nAChR DNAs that express variant subunits.
  • the term "probe” refers to a structure comprised of a polynucleotide, as defined above, which contains a nucleic acid sequence complementary to a nucleic acid sequence present in a target polynucleotide.
  • the polynucleotide regions of probes may be composed of DNA, and/or RNA, and/or synthetic nucleotide analogs.
  • Such probes could be useful in in vitro hybridization assays to distinguish al variant from wild-type message, with the proviso that it may be difficult to design a method capable of making such a distinction given the small difference in coding between variant and wild-type.
  • a PCR-based assay could be used to amplify the sample RNA or DNA for sequence analysis.
  • the variant nAChR subunit can be used to prepare polyclonal or monoclonal antibodies using techniques that are well known in the art.
  • the variant nAChR subunit or relevant fragments can be obtained using the recombinant technology outlined below, i.e., a recombinant cell that expresses the subunit or fragments can be cultured to produce quantities of the subunit or fragment that can be recovered and isolated.
  • the variant nAChR subunit or fragment thereof can be synthesized using conventional polypeptide synthetic techniques as provided below.
  • Monoclonal antibodies that display specificity and selectivity for the variant nAChR subunit can be labeled with a measurable and detectable moiety, for example, a fluorescent moiety, radiolabels, enzymes, chemiluminscent labels and the like, and used in in vitro, or in situ immunofluorescent assays, or the like.
  • the antibodies can be used to identify variant nAChR subunit for immunodiagnostic purposes.
  • Tables below are examples of specific embodiments for carrying out the present invention. The examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way. In preparing the examples, efforts have been made to ensure accuracy with respect to numbers used (for example, amounts, temperatures, etc.), but some experimental error and deviation should, of course, be allowed for.
  • Acetylcholine chloride (“ACh”), collagenase Type 1A, d-tubocurarine chloride (“dTC”), gentamicin and mecamylamine hydrochloride (“MEC”), were obtained from Sigma Chemical Company (St. Louis, Missouri, U.S.A.).
  • Dihydro- ⁇ -erythroidine hydrobromide (“DHBE”), and methyllycaconitine citrate (“MLA”) were obtained from Research Biochemicals International (Natick, Massachusetts, U.S.A.).
  • Tricaine (3-aminobenzoic acid ethyl ester methanesulfonate; Finquel) was obtained from Argent Chemical Laboratories (Fisheries Chemical Division, Redmond, Washington, U.S.A.).
  • This oligonucleotide contains an Xho I restriction site (italics) and an ATG initiation codon (bold) followed by the next 28 codons of the human al nAChR subunit cDNA sequence. It encodes the complete signal peptide and extends to the Hind III site (underlined) present in the al nAChR subunit cDNA. The Xho I and Hind HI sites were flanked with additional nucleotides to make them internal within the molecule. Additionally, the reverse complement of this oligonucleotide was synthesized.
  • the oligonucleotides were annealed together, digested with Xho I and Hind III, and then ligated into a pBluescript vector containing the human al subunit cDNA previously digested with Xho I and Hind III. This created a new cDNA encoding a full length human al nAChR subunit. The sequence of the new cDNA was confirmed by dideoxy sequencing.
  • the cDNA was excised from pBluescript with Xho I and Not I, the 5' overhangs were filled-in with Klenow polymerase, linked with Bst XI adapters, digested with Bst XI, and ligated into the Bst XI site of the pRcCMV vector (Invitrogen).
  • the orientation of the insert in the expression vector was determined by restriction analysis with enzymes cutting the al nAChR subunit cDNA at asymmetrical positions.
  • Oocytes were maintained at 17-18°C in normal Barth's solution (90 mM NaCI, 1 mM KCl, 0.66 mM NaNO 3 , 0.74 mM CaCl 2 , 0.82 mM MgCl 2 , 2.4 mM NaHCO 3 , 2.5 mM sodium pyruvate, and 10 mM Na N-(2-hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid) ("HEPES”) buffer, final pH 7.55) containing 100 g/ml gentamicin. Responses were measured at a holding potential of -60 mV in modified Barth's solution containing 10 mM BaCl 2 and lacking CaCl 2 and MgCl 2 .
  • HEPES mM Na N-(2-hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid)
  • Human ⁇ 7V274T responses unlike human ⁇ 7WT responses, tended to increase significantly during the experiments. Therefore, experimental trials were bracketed, before and after, by control applications of 10 M ACh in the same oocyte. All responses were normalized to the 10 M ACh responses in order to account for changes in sensitivity within the experiment and for variability in receptor expression among oocytes.
  • Example 1 Preparation of Human ⁇ 7V274T cDNA
  • the wild-type al nAChR 5 subunit gene was digested with EcoR V and Kpn I restriction enzymes and the digested segment was replaced with a mutant PCR product by ligation using the procedures described below.
  • the strategy diagrammed in Figure 1, used two PCR steps followed by digesting with restriction enzymes to produce a mutated fragment of the wild-type al nAChR subunit cDNA o and subcloning the mutated fragment into the wild-type human al cDNA.
  • A two DNA fragments carrying the desired mutation were generated by PCR using appropriate primers.
  • the mutated nucleotide was incorporated in the reverse primer (X-3') for the longer fragment and in the forward primer (Y-5') for the shorter fragment.
  • the two external primers (X-5' and Y-3') were chosen so that the final PCR product would contain EcoRV and Kpnl 5 restriction sites.
  • the longer 5' fragment was generated using the forward external primer 5'-GTTTGGGTCCTGGTCTTACG-3' (SEQ ID NO:5) and the reverse internal primer 5'-GCAGCATGAAGGTGGTAAGAGAG-3' (SEQ ID NO:6) bearing the mutation.
  • the shorter 3' fragment was generated using the forward internal primer o 5'-CTCTCTTACCACCTTCATGCTGC-3' (SEQ ID NO:7), also bearing the mutation, and the reverse external primer 5'-GTACTGCAGCACGATCACCG-3' (SEQ ID NO:8).
  • the conditions for PCR consisted of 100 ng input al DNA, 2X Pfu buffer, 100 ng of each primer pair and 0.625 U Pfu enzyme (Stratagene, La Jolla, CA). Reactions were carried out in a Perkin-Elmer 9600 for 20 cycles at 95°C for 24 seconds, 60°C for 22 seconds then 72°C for 78 5 seconds.
  • step (C) the product of step (B) was digested with Kpnl and EcoRV, o gel-purified, and ligated into the wild-type human al cDNA previously digested with Kpnl and EcoRV. Dideoxy sequencing of the final cDNA showed the presence of the desired mutation and that no other mutation had been introduced during the PCR process.
  • Figures 2A-2C shows the nucleotide sequence (SEQ ID NO:l) of the human ⁇ 7V274T cDNA mutant.
  • the amino acid sequence of the human ⁇ 7V274T variant (SEQ ID NO:2) is 5 also shown in Figures 2A-2C.
  • GTS-21 was a full agonist at the human ⁇ 7V274T nAChR with an EC 50 value of 4.3 ⁇ 0.3 ⁇ M and a Hill coefficient of 1.5 ⁇ 0.1, in stark contrast to its weak partial agonist effect at the human al wild type nAChR.
  • ABT-089 also was more potent and efficacious at the human 0C7V274T nAChR, with an EC 50 values of 28 ⁇ 3 ⁇ M and a Hill coefficient of 2.3 ⁇ 0.4, but it was a partial agonist with an efficacy of 40 ⁇ 1%.
  • Human ⁇ 7V274T and human ⁇ 7WT responses to EC50 concentrations of ACh were matched for similar amplitude and are shown synchronized to the beginning of ACh application and adjusted for equivalent baseline holding current (see Figure 4).
  • ACh was applied to human ⁇ 7V274T for 10 sec and to human ⁇ 7WT for 2.5 sec. Brief spike-like tics near the beginning and end of the human ⁇ 7WT trace are electrical artifacts marking the opening and closing of the agonist-application valve.
  • Human ⁇ 7V274T responses activated and decayed slowly compared to the human ⁇ 7WT responses.
  • the analogous chick mutant nAChR activated and decayed more slowly in response to ACh (Galzi et al. (1992), supra).
  • nAChR antagonists such as dihydro- ⁇ -erythroidine (DH ⁇ E), rf-tubocurarine and hexamethonium, have been found to activate responses at chick al TM-2 nAChR variants when these compounds were applied as agonists (Bertrand et al. (1992), supra).
  • This together with data from single-channel recording, has suggested (a) that the variants nAChRs conduct in the receptor-desensitized state and (b) that wild-type nAChR antagonists act by stabilizing the desensitized state (Bertrand et al. (1995), supra).
  • DH ⁇ E 10 ⁇ M also activated agonist-like inward current responses (see Figure 5). However, these responses were small, ranging from 2.8% to 6.9% of the response to 10 ⁇ M ACh (Table 1) unlike the homologous chick ⁇ 7V251T nAChR where 10 ⁇ M DHbE elicited a response 66% as large as the ACh response (Bertrand et al. (1993) Mutations at two distinct sites within the channel domain M2 alter calcium permeability of neuronal a7 nicotinic receptor. Proc. Natl. Acad. Sci (U.S ⁇ .) 90:6971-6975).
  • DH ⁇ E dihydro- ⁇ -erythroidine
  • d-TC rf-tubocurarine
  • MLA methyllycaconitine
  • MEC mecamylamine
  • ATROP atropine
  • d-Tubocurarine (1 ⁇ M) also did not elicit agonist-like inward currents, but did elicit small outward currents (3-5% of the maximal inward current response to ACh) in two of four human al V274T oocytes.
  • the outward current responses may be due to stabilization of the resting (closed) state or to channel blockade of spontaneously open nAChR.
  • MLA (10 nM) mecamylamine (10 ⁇ M) nor d-tubocurarine (1 ⁇ M) elicited any significant inward or outward current response (Table 1).
  • the muscarinic antagonist atropine (2 ⁇ M) alone had little effect at either nAChR.
  • the above compounds also were evaluated as antagonists of the response to ACh at both human CX7V274T and human ⁇ 7WT nAChRs.
  • two concentrations of ACh were used: one near the EC 50 value (1 ⁇ M for ⁇ 7V274T and 200 ⁇ M for ⁇ 7WT) and one near the maximal response level (10 ⁇ M for ⁇ 7V274T and 10 mM for ⁇ 7WT).
  • Data are shown in Table 1.
  • DH ⁇ E (10 ⁇ M), d-tubocurarine (1 ⁇ M), MLA (10 nM), and mecamylamine (10 ⁇ M) acted as antagonists at both nAChRs.
  • the al selective antagonist MLA was particularly potent, as expected, blocking human ⁇ 7V274T as well as human ⁇ 7WT at a concentration of 10 nM.
  • mecamylamine (10 ⁇ M), DH ⁇ E (10 ⁇ M) and ⁇ f-tubocurarine (1 ⁇ M) each appeared to inhibit human ⁇ 7V274T more than human ⁇ 7WT.
  • Atropine (2 ⁇ M) inhibited the human ⁇ 7V274T response to 1 ⁇ M ACh by 28%, but had little effect on the human ⁇ 7WT response to 200 ⁇ M ACh.
  • Some oocytes have endogenous muscarinic receptors activated by low-micromolar concentrations of ACh (Kusano etal.
  • ACh responses at both human ⁇ 7V274T and human ⁇ 7WT (see Table 1). Mecamylamine (10 ⁇ M) also inhibited the maximal ACh response less strongly than the EC50 ACh response at the human ⁇ 7V274T nAChR, but not at the human ⁇ 7WT nAChR where mecamylamine inhibited both concentrations of ACh similarly. The lesser inhibitions at the higher concentrations of ACh may reflect competitive antagonist-agonist interactions.
  • the human variant 7V274T nAChR is similar to the analogous chick ⁇ 7V251T nAChR in its increased sensitivity to agonist activation and apparent slower rate of activation and desensitization.
  • the receptors differ, however, in that DH ⁇ E (10 ⁇ M) activated the human cx7V274T inward current only weakly, compared to a 66% agonist-like effect at chick ⁇ 7V251T, and in that d-tubocurarine did not activate inward currents at the h- ⁇ 7V274T compared to the full response at chick ⁇ 7L247T nAChR (Galzi et al. (1992), supra; Bertrand et al. (1993), supra).
  • DH ⁇ E (10 ⁇ M) activated the human cx7V274T inward current only weakly, compared to a 66% agonist-like effect at chick ⁇ 7V251T
  • the human al wild-type (WT) and ⁇ 7V274T mutant nAChR are transfected into the human embryonic kidney cell line, HEK-293 using the eukaryotic expression vector, pRc/CMV (Invitrogen, San Diego, CA) which contains the promoter sequences from the human cytomegalovirus for high level constitutive expression and contains the neomycin resistance gene for selection of geneticin-resistant stable cell lines.
  • the cDNAs are transfected using lipofectamine (GIBCO) as described in (Gopalakrishnan et al. (1995) Eur. J. Pharmacol.
  • elegans deg-3 spontaneous mutation which appears to be cytotoxic through a mechanism that is inhibited by nicotinic antagonists (Treinin and Chalfie (1995) A mutated acetylcholine receptor subunit causes neuronal degeneration in C. elegans. Neuron 14: 871-877).
  • the human ⁇ 7V274T 5 variant nAChR response is longer lasting than wild-type responses ( Figure 4) but, like chick ⁇ 7V251T variant nAChR, probably has high Ca 2+ permeability so that activation of the receptor may, under some conditions, lead to excessive Ca 2+ influx and thereby cell death.
  • human ⁇ 7V274T variant nAChR may be prone to prolonged spontaneous opening because oocytes that have expressed ⁇ 7V274T for 3 days or 0 longer were 10-100 fold leakier electrically than were oocytes expressing human al wild-type nAChR.
  • human ⁇ 7V274T and related variant nAChR may be cytotoxic in the presence and even in the absence of agonist. Spontaneous expression of such a variant could interfere with normal al nAChR function, induce premature cell death, or interfere with synapse formation. Such effects could underlie some forms of neurodegenerative diseases or other 5 disorders involving derangement of chohnergic function.
  • Cytotoxicity clearly could limit the ability of cells to express the ⁇ 7V274T variant at high levels.
  • transfected cells are grown in the presence of a reversible nicotinic antagonist or channel blocker, such as methyllycaconitine or mecamylamine. Such substances would prevent cytotoxicity by blocking the receptor or channel, but could be o removed shortly before using the cells in further experiments.
  • the human al wild type or variant is transfected using an inducible expression system such that expression of the al subunit is repressed until an inducer is added.
  • an inducible system is that it can eliminate the cytotoxic effects of the expressed protein, for example the human ⁇ 7V274T variant, that is observed when a 5 constitutive expression system such as the pRcCMV is employed.
  • LacS witch system (Stratagene) that uses the elements of lactose operon to control gene expression.
  • LacS witch system basal expression is very low in the repressed state and once stably transfected in cell lines, this system permits rapid induction within 4-8 hours in presence of the inducing agent, IPTG.
  • the o system employs a eukaryotic Lac-repressor-expressing vector (p3'SS) and a eukaryotic lac- operator containing vector (pOPRSVI-CAT) into which the ⁇ 7 subunit construct will be inserted by cloning.
  • Antibiotic selection is attained via the hygromycin-resistance gene in p3'SS and via the neomycin-resistance gene in pOPRSVI-CAT vector.
  • the selection of stable cell lines is achieved by the presence of both 5 hygromycin and geneticin.
  • expression of the al subunit will be caused by the addition of the inducing agent, IPTG.
  • IPTG in the absence of IPTG, transcription is blocked by the binding of the Lac repressor protein to the operator in pOPRSVI-CAT vector.
  • LPTG decreases the binding affinity of the Lac repressor protein to the operator thereby triggering transcription and expression of the inserted al subunit gene.
  • the choice of such a system permits the direct evaluation of the role of the mutant al nAChR in mediating cell death in vitro.
  • cell damage can be assessed following transient expression of the cDNA in HEK-293 cells by a number of methods, for example: (i) staining the cells with Trypan blue (4%) for 5 minutes and assessing the ability of viable cells to exclude the dye; (ii) measuring the levels of the cytosolic enzyme lactate dehydrogenase
  • LDH low-density hypothalamic hormone
  • uptake of neutral red dye or uptake and conversion of the tetrazolium MTT as an index of viability for example, Little et al. (1996) Br. J. Dermatol. 134: 199-207; D Souza et al. (1996) J. Neurosci. Res. 43: 289-298; Malcolm et al. (1996) J. Neurochem. 66: 2350-2360
  • uptake and binding of propidium iodide to nucleic acids for example, Wrobel et al. (1996) J.
  • RNA reverse tran scri tase-PCR
  • RT-PCR reverse tran scri tase-PCR
  • the external primers used in the synthesis of the al variant would allow one to amplify the region of interest.
  • the primers would be chosen to generate a distinct size fragment encompassing the sequence transmembrane segment 2, in which the V274T substitution takes place.
  • the nucleotide sequence of the message is determined.
  • the presence of the variant can be an indication of cellular disease, such as neurodegeneration or other forms of cytotoxicity.
  • a method of detecting target polynucleotides of human variant al subunit in a test sample comprises (a) contacting a target polynucleotide of human variant al subunit with at least one human variant al subunit-specific polynucleotide probe or complement thereof; and (b) detecting the presence of the target polynucleotide and probe complex in the test 5 sample.
  • Another method for detecting cDNA of human al subunit mRNA in a test sample comprises (a) performing reverse transcription in order to product cDNA; (b) amplifying the cDNA obtained from step (a); and (c) detecting the presence of the human variant al subunit in the test sample.
  • sampled DNA or cDNA prepared fom RNA by RT-PCR can be amplified using appropriate primers (for example, X-5' and Y-3') to allow detection of the o variant by nucleotide sequence analysis.
  • the detection step (c) comprises utilizing a detectable moiety capable of generating a measurable signal.
  • a purified polynucleotide or fragment thereof derived from human variant al subunit capable of selectively hybridizing to the nucleic acid of human variant al subunit can be utilized in these methods, wherein said polynucleotide has a sequence comprising SEQ ID 5 NO: 1 or a portion thereof.
  • the purified polynucleotide can be produced by recombinant techniques.
  • a polypeptide encoded by human variant al subunit also is useful for diagnostic applications.
  • the polypeptide which has an amino acid sequence comprising SEQ ID NO:2 or a portion thereof, can be produced by recombinant or synthetic techniques.
  • a monoclonal antibody which specifically binds to human variant al subunit can also be utilized in these methods.
  • the human variant al subunit comprises the amino acid sequence of SEQ ID NO: 2 or a portion thereof.
  • a method for detecting human variant al subunit in a test sample can comprise (a) contacting said test sample with an antibody or fragment thereof which specifically binds to 5 human variant ⁇ 7 subunit for a time and under conditions sufficient for the formation of resultant complexes; and (b) detecting said resultant complexes containing said antibody, wherein said antibody specifically binds to human variant al subunit of SEQ ID NO:2 or a fragment thereof.
  • Treatment application Spontaneous mutation of human al valine-274 to threonine and o related mutation could result in or hasten death of those cells expressing the protein.
  • At least two types of treatment could be undertaken: (i) administration of a selective al antagonist such as methyllycaconitine or another compound with improved blood-brain barrier penetration; or, (ii) antisense oligonucleotide therapy to block the synthesis of the protein (for example, see Albert and Morris (1994), Antisense knockouts: molecular scalpels for the dissection of signal 5 transduction. Trends in Pharmacological Sciences 15: 250-254); or (iii) as a reagent to kill cells such as cancer cells.
  • the antisense oligonucleotide 5'-GGCTACACCTCATGGGCTCG (SEQ ID NO:9) may be used.
  • this oligonucleotide or others would block synthesis of any al subunit protein, including wild type, but still would be of use where the variant and not the wild type is expressed, or where knockout of the wild-type is less detrimental than continued expression of the variant.
  • the efficacy of this anti- 5 sense would be demonstrated in vitro and, further, the antisense would be valuable as a research tool eo evaluat al subunit function.
  • Antisense technology can be used to reduce gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA.
  • the 5' coding portion of the polynucleotide 0 sequence which encodes for the polypeptide of the present invention, is used to design an antisense RNA ohgonucleotide of from 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and the production of the human variant al subunit polypeptide.
  • the antisense RNA ohgonucleotide hybridizes to the mRNA in vivo and blocks translation of an 5 mRNA molecule into the human variant al subunit polypeptide.
  • Antisense ohgonucleotides act with greater efficacy when modified to contain artificial internucleotide linkages which render the molecule resistant to nucleolytic cleavage.
  • Such artificial internucleotide linkages include, but are not limited to, methylphosphate, phosphorothiolate and phosphoroamydate internucleotide linkages.
  • Antisense oligonucleotides also would be of value in determining al wild-type and V274T functions, and mechanisms of cytotoxicity in general.
  • one method of evaluating the contribution of ⁇ 7V274T to cytotoxicity, cytoprotection, or other cellular processes would be to determine whether specific blockade of its synthesis blocks process. This differs in approach from the use of a receptor antagonist, 5 which may or may not block all effects of the protein. AdditionaUy, in drug discovery this approach could be useful in evaluating whether the effect of the drug is mediated by the ⁇ 7V274T variant. A similar approach could be used to evaluate the contribution of other variants or the wild-type subunit itself.
  • the corresponding al sense and missense ohgonucleotides 5'-CGAGCCCATGAGGTGTAGCC (SEQ ID NO: 10) and o 5'-CCAGGCATTCGGAGCTTGCC (SEQ ID NO: 1 1), respectively, are used.
  • the missense oligonucleotide is a randomized sequence maintaining the proportion of GC content in the antisense oligonucleotide, and did not match known sequences in the GenBank database.
  • polynucleotides that encode novel subunit and their antisense variants of the human ⁇ 7 nAChR can be used in a variety of ways as detailed herein.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Neurology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Cell Biology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

A variant human α7 nicotinic acetylcholine receptor (nAChR) polypeptide is provided wherein the variant contains an amino acid substitution at the valine-274 position of the wild-type human α7 nAChR. Nucleic acid molecules encoding the variant human α7 nAChR, vectors and host cells containing such nucleic acid molecules are also provided. In addition, methods are provided for producing the variant as are methods of using such variants for screening compounds for activity at the nAChR.

Description

A VARIANT HUMAN ALPHA-7 ACETYLCHOLINE RECEPTOR SUBUNIT. AND METHODS OF PRODUCTION AND USE THEREOF
Technical Field
The invention relates generally to receptor proteins and to DNA and RNA molecules encoding therefor. In particular, the invention relates to a variant human α7 subunit in which there is a substitution of the valine-274 position of the wild-type human α7 subunit. The invention also relates to DNA and RNA molecules that encode the variant human 7 subunit, as well as to methods of using the variant subunit to identify compounds that interact with it.
Background of the Invention
This background considers the α7 subunit as it relates to the nicotinic acetylcholine receptor (nAChR). The nAChR is comprised of transmembrane polypeptide subunits that form a cation-selective ion channel gated by acetylcholine (ACh) and other ligands. The hydrophobic transmembrane M2 ("TM-2") region from each subunit is believed to form the wall of the ion channel.
Two of the more prominent nAChRs in brain are those containing α4 subunits and those containing α7 subunits (Sargent (1993) Annu. Rev. Neurosci. 16:403-443; Court et al.
( 1995) Alzheimer Disease and Associated Disorders 9:6- 14). Mutations of the 4 and α7 subunits may underlie some diseases of the nervous system. For example, mutations of the α4 subunit have been associated with some forms of epilepsy (Beck et al. (1994) Neurobiol. Disease 1 :95-99; Steinlein et al. (\995) Nature Genetics 11:201-203). Additionally, α7-containing nAChR may be involved in sensory processing related to schizophrenia (Freedman et al. (1995) Biol. Psych. 38:22-33; Rollins et al. (1995) Schizophr. Res. 15:183; Stevens et al. (1995) Psychopharmacol. 119:163-170), cytoprotection (Donnelly-Roberts et al.
( 1996) Brain Res. 719:36-44; Akaike et al. ( 1994) Brain Res. 644: 181 - 187; Martin et al. (1994) Drug Dev. Res. 31:135-141; Quik et al. (1994) Brain Res. 655:161-167), and neurite growth and innervation (Chan et al. (1993) Neurosci. 56:441-451; Pugh et al. (1994) 7. Neurosci. 14:889-896; Freeman (1917) Nature 269:218-222; Bτoide etal. (1995) Neurosci. 67:83-94).
A splice variant involving the TM-2 region of the α7 subunit has been detected in bovine chromaffin cells (Garcia-Guzman et al. (1995) Eur. J. Neurosci. 7:647-655), and a naturally-occurring mutation of a protein homologous to the α7 subunit found in Caenorhabditis elegans, leads to neurodegeneration (Treinin et al. (1995) Neuron 14:871-877). The latter is a single amino acid mutation in the TM-2 region similar to the chick α7 valine-251 to threonine ("c-α7V251T") mutation, one of several mutations artificially introduced into the chick α7 subunit to facilitate the study of α7 nAChR structure and subunit function (Bertrand et al. (1995) Sem. Neurosci. 7:75-90).
Compared to the chick α7 wild-type ("c-α7WT") nAChR, c-α7V251T (also referred to as α7-4) retained high calcium permeability but desensitized slowly, and was 180-fold more 5 sensitive to ACh. In addition, the c-α7V251T nAChR responded to dihydro-β-erythroidine ("DHβE"), normally an nAChR antagonist at α7 and other wild-type nAChR, as if it were an agonist (Galzi et al. (1992) Nature 359:500-505; Bertrand et al. (1993) Proc. Natl. Acad. Sci. USA 90:6971-6975). These studies have led to a model delineating the structure of the pore- lining TM-2 region, and the hypothesis that specific mutations within the TM-2 region can o generate ligand-gated ion channels that conduct current in the receptor-desensitized state in addition to the normal receptor-activated state (Bertrand et al. (1995), supra; Bertrand et al. (1992) Proc. Natl. Acad. Sci. USA 89: 1261-1265; Galzi et al. (1995) Neuropharmacol. 34:563-582).
Although the chick α7 nAChR is pharmacologically similar to the mammalian cc7 5 nAChR, there are significant differences. For example, l,l-dimethyl-4-phenylpiperazinium ("DMPP") is a very weak partial agonist in the chick α7 nAChR, but is a highly efficacious agonist at the human α7 nAChR (Peng et al. (1994) Mol. Pharmacol. 45:546-554). Despite these differences, it would be expected that amino acid changes in the human α7 nAChR that are analogous to those in the chick α7 nAChR, particularly in critical TM-2 amino acids, would o result in similar pharmacological and electrophysiological changes.
SUMMARY OF THE INVENTION
The present invention relates to a variant human α7 subunit in which valine-274 has been changed in analogy with the corresponding chick receptor variant. This variant is 5 analogous to the chick α7V25 IT variant with regard to the relative position of the amino acid substitution in the TM-2 region. However, the variant human α7 subunit exhibits unexpectedly different pharmacological and electrophysiological characteristics.
The α7 subunit combines with itself and may combine with other subunits to create various nicotinic acetylcholine receptors. The possibility of combination with yet other o proteins, which may or may not be identified as components of other classes of receptor, is not necessarily excluded.
Accordingly, in one embodiment, a DNA molecule is provided, wherein the DNA molecule encodes a variant human α7 subunit in which the valine-274 has been replaced.
In another embodiment, a recombinant vector comprising such a DNA molecule is 5 provided. In another embodiment, the subject invention is directed to a human α7 subunit variant in which the valine-274 has been replaced.
In still other embodiments, the invention is directed to messenger RNA encoded by the DNA, recombinant host cells transformed or transfected with vectors comprising the DNA or 5 fragments thereof and methods of producing recombinant polypeptides for the treatment of neurodegenerative processes, enzymatic function, affective disorders and immunofunction, using such cells.
In another embodiment, compounds such as antagonists are provided, as well as antisense polynucleotides, which are useful in treating conditions such as neurodegenerative 0 processes, enzymatic disfunction, affective disorders and immunofunction. Methods of treating individuals using these compounds and antisense polynucleotides also are provided.
In yet another embodiment, methods and reagents are provided for detecting the α7 variant.
In yet another embodiment, the invention is directed to a method of expressing the 5 human α7 subunit variant in a cell to produce the resultant α7 variant.
In a further embodiment, the invention is directed to a method of identifying compounds that modulate the subunit or receptors containing the subunit and to a method of identifying cytoprotective compounds using such cells.
These and other embodiments of the present invention will readily occur to those of o ordinary skill in the art in view of the disclosure herein.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 depicts the strategy for generating the human α7V274T AChR mutant DNA using polymerase chain reaction. 5 Figures 2A-2C show the nucleotide sequence (SEQ ID NO: 1 ) of the human α7 cDNA containing the V274T mutation. The threonine mutation is shown in bold and the restriction sites EcoRV and Kpnl are shown underlined. Also shown is the deduced amino acid sequence (SEQ ID NO: 2) of the human α7V274T subunit variant derived from the cDNA. The V274T alteration is underlined. o Figure 3 graphically compares the concentration-response relationships for ACh
(diamonds), (-)-nicotine (circles), GTS-21 (triangles pointing up) and ABT-089 (triangles pointing down) at human α7V274T nAChR (solid symbols) and human α7 wild-type nAChR (open symbols) expressed in Xenopus oocytes.
Figure 4 graphically depicts the activation by ACh and decay rate of the human 5 α7 V274T response compared to that of the human α7 WT nAChR. Figure 5 graphically depicts the responses of human α7V274T to nAChR antagonists wherein MEC is mecamylamine (10 M), MLA is methyllycaconitine (10 nM), and DHβE is dihydro-β-erythroidine (10 M). The 0-agonist control was bathing solution without drug and was applied for 20 seconds. The small 0-agonist control responses were measured in each 5 human α7V274T oocyte and subtracted from agonist responses when data were tabulated.
Figure 6 graphically depicts the current versus voltage relationship of responses to 10 μM ACh of the human α7V274T expressed in Xenopus laevis oocytes, wherein the circles represent responses measured in modified Barth's solution containing 10 mM Ba2+ (90 mM NaCI, 1 mM KC1, 0.66 mM NaNO3, 10 mM BaCl2, 2.4 mM NaHCO3, 2.5 mM sodium 0 pyruvate, and 10 mM Na-HEPES buffer, final pH 7.55) to prevent activation of
Ca2+-dependent secondary responses (see Briggs et al. (1995) Neuropharmacol. 34:583-590) and the triangles represent responses measured in "OR2" solution with atropine (82.5 mM NaCI, 2.5 mM KC1, 2.5 mM CaCl2, 1 mM MgCl2, 0.5 M atropine, and 5 mM Na-HEPES buffer, final pH 7.4) to replicate the conditions of Galzi et al. (1992) Nature 359:500-505. 5 Figure 7 graphically depicts the specific binding of [125I]α-Bungarotoxin, an al nAChR-selective ligand, to an HEK-293 clone transfected with variant human α7V274T.
DETAILED DESCRIPTION OF THE INVENTION
The practice of the present invention will employ, unless otherwise indicated, o conventional techniques of molecular biology, microbiology, recombinant DNA technology, electrophysiology, and pharmacology, that are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition (1989); DNA Cloning, Vols. I and II (D.N. Glover ed. 1985); Perbal, B., A Practical Guide to Molecular Cloning (1984); the series, 5 Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.);
Transcription and Translation (Hames et al. eds. 1984); Gene Transfer Vectors For Mammalian Cells (J. H. Miller et al. eds. (1987) Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.); Scopes, Protein Purification: Principles and Practice (2nd ed., Springer- Verlag); and PCR: A Practical Approach (McPherson et al. eds. (1991) IRL Press). o All patents, patent applications and publications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety.
As used in this specification and the appended claims, the singular forms "a," "an" and "the" include plural references unless the content clearly dictates otherwise. Thus, for example, reference to "an amplification primer" includes two or more such primers, reference 5 to "a receptor subunit" includes more than one such subunit, and the like. A. Definitions
In describing the present invention, the following terms will be employed, and are intended to be defined as indicated below.
The term "AChR" intends a receptor for the neurotransmitter acetylcholine ("ACh"). 5 AChRs are broadly subclassified as nicotinic or muscarinic. These types differ in their pharmacology, structures, and signal transduction mechanisms.
The term "nAChR" intends a nicotinic acetylcholine receptor. Although nAChRs of various subunit structures are best known in muscle cells, neurons, and chromaffin cells, they are not necessarily excluded from other cells types (for example, glial cells, mast cells, blood 0 cells, fibroblasts, etc.).
The term "nAChR subunit" intends a proteinaceous molecule which can combine with other such molecules in the formation of a nAChR. For example, the muscle nAChR is believed to be a pentamer comprised of four types of transmembrane subunit: two αl subunits, one βl subunit, one δ subunit and one γ or ε subunit depending upon the nAChR 5 form. Neuronal nAChR analogously are also thought to be pentameric and comprised of related but different subunits. At present, eight neuronal α subunits (α2-α9) and three neuronal β subunits (β2-β4) have been isolated. Some neuronal nAChR appear to require at least one α subunit and at least one β subunit for a functional complex (i.e., ion channel response to ACh or other agonists). Some subunits, however, may self-assemble to form o "homooligomeric" nAChR, as in the case of α7 nAChR in Xenopus oocytes and in transfected mammalian cells. Although the combination of nAChR subunits with subunits related to other types of receptor (for example, other classes of ligand-gated ion channel) has not been demonstrated, it is within the scope of the present invention that such combinations are possible. 5 The term "wild-type" (abbreviated "WT") intends the typical, usual or most common form as it occurs in nature. The human wild-type α7 nAChR as used herein was described in Doucette-Stamm et al. (1993) Drug Dev. Res. 30: 252-256. An abbreviation of the form "α7XnnnO" intends an α7 subunit in which the amino acid X, located at position nnn relative to the wild-type sequence, has been replaced by amino acid O. Thus, the chick cx7V251T o nAChR indicates the chick α7 nAChR in which the valine located at position 251 in the wild- type receptor has been replaced by a threonine.
A "nicotinic cholinergic agonist" is a compound that binds to and activates a nicotinic acetylcholine receptor. By "activates" is intended the elicitation of one or more pharmacological, physiological, or electrophysiological responses. Such a response includes, 5 but is not limited to, cell membrane depolarization and increased permeability to Ca2+ and other cations. A "nicotinic cholinergic antagonist" is a substance that binds to a nicotinic acetylcholine receptor and prevents agonists from activating the receptor. Pure antagonists do not activate the receptor, but some substances may have mixed agonist and antagonist properties. Nicotinic cholinergic channel blockers block the ability of agonists to elicit current flow through the 5 nicotinic acetylcholine receptor channel, but do so by blocking the channel rather than by preventing agonists from binding to and activating the receptor.
A "nicotinic cholinergic modulator" is a substance that influence the activity of the nicotinic acetylcholine receptor through interaction at one or more sites other than the classic agonist binding site. The modulator may itself increase or decrease receptor activity, or may o influence agonist activity (for example, potentiating responses) without itself eliciting an overt change in channel current. A single substance can have different properties at different nicotinic acetylcholine receptor subtypes, for example being an agonist at one receptor and antagonist at another, or an antagonist at one and a channel blocker at another.
By "nAChR regulator" is intended a substance that may act as an agonist, antagonist, 5 channel blocker or modulator.
The term "polynucleotide" as used herein means a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. Thus, the term includes double- and single-stranded DNA, as well as double- and single-stranded RNA. It also includes modifications, such as by methylation o and/or by capping, and unmodified forms of the polynucleotide.
The term "variant" is used to refer to an oligonucleotide sequence which is differs from the related wild-type sequence in one or more nucleotides. Such a variant oligonucleotide is expressed as a protein variant which, as used herein, indicates a polypeptide sequence that differs from the wild-type polypeptide in the substitution, insertion or deletion of one or more 5 amino acids. The variant polypeptide differs in primary structure (amino acid sequence), but may or may not differ significantly in secondary or tertiary structure or in function relative to the wild-type.
The term "mutant" generally refers to an organism or a cell displaying a new genetic character or phenotype as the result of change in its gene or chromosome. In some instances, o however, "mutant" may be used in reference to a variant protein or oligonucleotide and
"mutation" may refer to the change underlying the variant.
"Polypeptide" and "protein" are used interchangeably herein and indicate a molecular chain of amino acids linked through peptide bonds. The terms do not refer to a specific length of the product. Thus, peptides, oligopeptides, and proteins are included within the definition 5 of polypeptide. The terms include post-translational modifications of the polypeptide, for example, glycosylations, acetylations, phosphorylations and the like. In addition, protein fragments, analogs, mutated or variant proteins, fusion proteins and the like are included within the meaning of polypeptide.
A "functionally conservative mutation" as used herein intends a change in a polynucleotide encoding a derivative polypeptide in which the activity is not substantially 5 altered compared to that of the polypeptide from which the derivative is made. Such derivatives may have, for example, amino acid insertions, deletions, or substitutions in the relevant molecule that do not substantially affect its properties. For example, the derivative can include conservative amino acid substitutions, such as substitutions which preserve the general charge, hydrophobicity/hydrophilicity, side chain moiety, and/or stearic bulk of the amino acid 0 substituted, for example, Gly/Ala, Val/Ile/Leu, Asp/Glu, Lys/Arg, Asn/Gln, Thr/Ser, and Phe Trp/Tyr.
By the term "structurally conservative mutant" is intended a polynucleotide containing changes in the nucleic acid sequence but encoding a polypeptide having the same amino acid sequence as the polypeptide encoded by the polynucleotide from which the degenerate variant 5 is derived. This can occur because a specific amino acid may be encoded by more than one "codon," or sequence of three nucleotides, within the polynucleotide.
"Recombinant host cells," "host cells," "cells," "cell lines," "cell cultures," and other such terms denoting microorganisms or higher eukaryotic cell lines cultured as unicellular entities refer to cells which can be, or have been, used as recipients for recombinant vectors or o other transfer DNA, immaterial of the method by which the DNA is introduced into the cell or the subsequent disposition of the cell. The terms include the progeny of the original cell which has been transfected. Cells in primary culture as well as cells such as oocytes also can be used as recipients.
A "vector" is a replicon in which another polynucleotide segment is attached, such as to 5 bring about the replication and/or expression of the attached segment. The term includes expression vectors, cloning vectors, and the like.
A "coding sequence" is a polynucleotide sequence that is transcribed into rr RNA and/or translated into a polypeptide. The boundaries of the coding sequence are determined by a translation start codon at the 5'-terminus and a translation stop codon at the 3'-terminus. A o coding sequence can include, but is not limited to, mRNA, cDNA, and recombinant polynucleotide sequences. Variants or analogs may be prepared by the deletion of a portion of the coding sequence, by insertion of a sequence, and/or by substitution of one or more nucleotides within the sequence. Techniques for modifying nucleotide sequences, such as site- directed mutagenesis, are well known to those skilled in the art. See, for example, Sambrook 5 et al., supra; DNA Cloning, Vols. I and II, supra; Nucleic Acid Hybridization, supra. "Operably linked" refers to a situation wherein the components described are in a relationship permitting them to function in their intended manner. Thus, for example, a control sequence "operably linked" to a coding sequence is ligated in such a manner that expression of the coding sequence is achieved under conditions compatible with the control sequences. A 5 coding sequence may be operably linked to control sequences that direct the transcription of the polynucleotide whereby said polynucleotide is expressed in a host cell.
The term "transfection" refers to the insertion of an exogenous polynucleotide into a host cell, irrespective of the method used for the insertion, or the molecular form of the polynucleotide that is inserted. The insertion of a polynucleotide per se and the insertion of a o plasmid or vector comprised of the exogenous polynucleotide are included. The exogenous polynucleotide may be directly transcribed and translated by the cell, maintained as a nonintegrated vector, for example, a plasmid, or alternatively, may be stably integrated into the host genome. "Transfection" generally is used in reference to a eukaryotic cell while the term "transformation" is used to refer to the insertion of a polynucleotide into a prokaryotic cell. 5 "Transformation" of a eukaryotic cell also may refer to the formation of a cancerous or tumorigenic state.
The term "isolated," when referring to a polynucleotide or a polypeptide, intends that the indicated molecule is present in the substantial absence of other similar biological macromolecules. The term "isolated" as used herein means that at least 75 wt.%, more o preferably at least 85 wt.%, more preferably still at least 95 wt.%, and most preferably at least
98 wt.% of a composition is the isolated polynucleotide or polypeptide. An "isolated polynucleotide" that encodes a particular polypeptide refers to a polynucleotide that is substantially free of other nucleic acid molecules that do not encode the subject polypeptide; however, the molecule may include functionally and/or structurally conservative mutations as 5 defined herein.
The following single-letter amino acid abbreviations are used throughout the text:
Alanine A Arginine R
Asparagine N Aspartic acid D
Cysteine C Glutamine Q 0 Glutamic acid E Glycine G
Histidine H Isoleucine I
Leucine L Lysine K
MetWonine M Phenylalanine F
Proline P Serine S
Threonine T Tryptophan w
Tyro sine Y Valine V B. General Methods
A variant human α7 subunit, a polynucleotide encoding the variant subunit, and methods of making the variant subunit are provided herein. The invention includes not only 5 the variant subunit but also methods for screening compounds using the variant subunit, cells expressing the variant subunit.
In one preferred embodiment, the polynucleotide encodes a human α7 subunit variant in which the valine-274 of the wild-type α7 subunit has been replaced. Preferably, the polynucleotide encodes a human α7 subunit in which the valine-274 has been replaced by a o threonine, or a conservative substitution for the threonine, for example, serine.
The human α7 variant nAChR exhibits both similar and unexpectedly different properties relative to other structurally related nAChRs. For example, as with the chick α7 V251T variant, the human α7V274T, responses to cholinergic agonists decay slowly compared to the human wild-type α7 nAChR responses. In addition, human α7V274T is 5 about two orders of magnitude more sensitive to chohnergic receptor agonists such as nicotine and ACh compared to the wild-type.
The human and chick receptor variants differ pharmacologically, for example, in that human α7V274T is weakly activated by dihydro-β-erythroidene (DHβE) while chick cx7V251T is strongly activated (Figure 5 and Galzi et al. (1992). Mutations in the channel o domain of a neuronal nicotinic receptor convert ion selectivity from cationic to anionic. Nature
359: 500-505). In addition, d-tubocurarine is a potent antagonist of human α7V274T compared to an activator of the related chick α7L247T mutant (Bertrand et al. (1992) Unconventional pharmacology of a neuronal nicotinic receptor mutated in the channel domain. Proc. Natl. Acad. Sci. (U.S. A.) 89: 1261-1265). The human and chick α7 receptor variants 5 are electrophysiologically different as well. For example, the chick α7V25 IT nAChR does not exhibit inward current rectification (Galzi et al. (1992), unlike both chick and human α7 wild- type nAChR which exhibit strong inward rectification (Galzi et al. (1992), supra, and Briggs et al. (1995) Neuropharmacol. 34: 583-590). The human 7V274T nAChR, in contrast to the chick α7V251T nAChR, rectifies above 0 mV similarly to the wild-type receptor (Figure 6). o DNA encoding the human variant 7 nAChR subunit can be derived from genomic or cDNA, prepared by synthesis, or by a combination of techniques. The DNA can then be used to express the human variant α7 nAChR subunit or as a template for the preparation of RNA using methods well known in the art (see, Sambrook et al, supra)
One method for obtaining the desired DNA involves isolating cDNA encoding the wild- 5 type human α7 nAChR subunit as described by Doucette-Stamm et al. (1993), supra. The wild-type cDNA thus obtained is then modified and amplified using the polymerase chain reaction ("PCR") and mutated primer sequences to obtain the DNA encoding the human variant α7 nAChR subunit. More particularly, PCR employs short oligonucleotide primers (generally 10-20 nucleotides in length) that match opposite ends of a desired sequence within the wild- type DNA molecule. The sequence between the primers need not be known. The initial template can be either RNA or DNA. If RNA is used, it is first reverse transcribed to cDNA. The cDNA is then denatured, using well known techniques such as heat, and appropriate oligonucleotide primers are added in molar excess.
Primers bearing the mutation will hybridize to the wild-type polynucleotide at a temperature slightly below that of the wild-type primer-polynucleotide duplex. The primer can be made specific by keeping primer length and base composition within relatively narrow limits, and by keeping the mutant base or bases centrally located (Zoler et al. (1983) Meth. Enzymol. 100:468). Primer extension is effected using DNA polymerase in the presence of deoxynucleotide triphosphates or nucleotide analogs. The resulting product includes the respective primers at their 5'-termini, covalently linked to the newly synthesized complements of the original strands. The replicated molecule is again denatured, hybridized with primers, and so on, until the product is sufficiently amplified. Such PCR methods are described in for example, U.S. Patent Nos. 4,965,188; 4,800,159; 4,683,202; 4,683,195; incorporated herein by reference in their entireties. The product of the PCR is cloned and the clones containing the mutated DNA, derived by segregation of the primer extended strand, selected. Selection can be accomplished using the mutant primer as a hybridization probe.
Alternatively, the wild-type DNA may be obtained from an appropriate DNA library. DNA libraries may be probed using the procedure described by Grunstein et al. (1975) Proc. Natl. Acad. Sci. USA 73:3961.
Alternatively still, the α7V274T variant could be generated using an RT-PCR (reverse transcriptase-polymerase chain reaction) approach starting with human RNA. For example, single- stranded cDNA is synthesized from human RNA (approx. 1.5 g) as the template using standard reverse transcriptase procedures. Next, the cDNA is amplified in two segments and the mutation is introduced using PCR and two pairs of primers. The internal primers are designed to carry the codon for threonine (T) or other desired change in place of the wild-type valine (V) at position 274 (see also Example 1 p. 28 and Figure 1). The products of the two
PCR reactions are combined using the 3 and 5 end primers to re-amplify the full length coding sequence of α7V274T. This is but one example of the generation of a7V274T from a human brain template.
Synthetic oligonucleotides may be prepared using an automated oligonucleotide synthesizer such as that described by Warner (1984) DNA 3:401. If desired, the synthetic strands may be labelled with 32P by treatment with polynucleotide kinase in the presence of 2P-ATP, using standard conditions for the reaction. DNA sequences including those isolated from genomic or cDNA libraries, may be modified by known methods which include site- directed mutagenesis as described by Zoller (1982) Nucleic Acids Res. 10:6487. Briefly, the DNA to be modified is packaged into phage as a single stranded sequence, and converted to a 5 double stranded DNA with DNA polymerase using, as a primer, a synthetic oligonucleotide complementary to the portion of the DNA to be modified, and having the desired modification included in its own sequence. Culture of the transformed bacteria, which contain replications of each strand of the phage, are plated in agar to obtain plaques. Theoretically, 50% of the new plaques contain phage having the mutated sequence, and the remaining 50% have the original l o sequence. Rephcates of the plaques are hybridized to labelled synthetic probe at temperatures and conditions suitable for hybridization with the correct strand, but not with the unmodified sequence. The sequences which have been identified by hybridization are recovered and cloned. Alternatively, it may be necessary to identify clones by sequence analysis if there is difficulty in distinguishing the small difference variant from wild-type by hybridization. In any
15 case, the DNA would be sequence-confirmed.
Once produced, the DNA may then be incorporated into a cloning vector or an expression vector for replication in a suitable host cell. Vector construction employs methods known in the art. Generally, site-specific DNA cleavage is performed by treating with suitable restriction enzymes under conditions which generally are specified by the manufacturer of these 0 commercially available enzymes. After incubation with the restriction enzyme, protein is removed by extraction and the DNA recovered by precipitation. The cleaved fragments may be separated using, for example, polyacrylamide or agarose gel electrophoresis methods, according to methods known by those of skill in the art.
Sticky end cleavage fragments may be blunt ended using E. coli DNA polymerase 1 5 (Klenow) in the presence of the appropriate deoxynucleotide triphosphates (dNTPs) present in the mixture. Treatment with SI nuclease also may be used, resulting in the hydrolysis of any single stranded DNA portions.
Ligations are performed using standard buffer and temperature conditions using T4 DNA ligase and ATP. Alternatively, restriction enzyme digestion of unwanted fragments can 0 be used to prevent ligation.
Standard vector constructions generally include specific antibiotic resistance elements. Ligation mixtures are transformed into a suitable host, and successful transformants selected by antibiotic resistance or other markers. Plasmids from the transformants can then be prepared according to methods known to those in the art usually following a chloramphenicol 5 amplification as reported by Clewell et al. ( 1972) J. Bacteriol. 110:667 may be added. The DNA is isolated and analyzed usually by restriction enzyme analysis and/or sequencing. Sequencing may be by the well-known dideoxy method of Sanger et al. (1977) Proc. Natl. Acad. Sci. USA 74:5463) as further described by Messing et al. (1981) Nucleic Acid Res. 9:309, or by the method reported by Maxam et al. (1980) Meth. Enzymol. 65:499. Problems with band compression, which are sometimes observed in GC rich regions, are overcome by 5 use of, for example, T-deazoguanosine or inosine, according to the method reported by Barr et al. (1986) Biotechniques 4:428.
Host cells are genetically engineered with the vectors of this invention which may be a cloning vector or an expression vector. The vector may be in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media 0 modified as appropriate for activating promoters, selecting transformants/transfectants or amplifying the subunit-encoding polynucleotide. The culture conditions, such as temperature, pH and the like, generally are similar to those previously used with the host cell selected for expression, and will be apparent to those of skill in the art.
Both prokaryotic and eukaryotic host cells may be used for expression of desired 5 coding sequences when appropriate control sequences that are compatible with the designated host are used. For example, among prokaryotic hosts, Escherichia coli is frequently used. Also, for example, expression control sequences for prokaryotes include but are not limited to promoters, optionally containing operator portions, and ribosome binding sites. Transfer vectors compatible with prokaryotic hosts can be derived from, for example, the plasmid o pBR322 that contains operons conferring ampiciUin and tetracycline resistance, and the various pUC vectors, that also contain sequences conferring antibiotic resistance markers. These markers may be used to obtain successful transformants by selection. Commonly used prokaryotic control sequences include but are not limited to the lactose operon system (Chang et al. (1977) Nature 198:1056), the tryptophan operon system (reported by Goeddel et al. 5 (1980) Nucleic Acid Res. 8:4057) and the lambda-derived PI promoter and N gene ribosome binding site (Shimatake et al. (1981) Nature 292:128) and the hybrid Tac promoter (De Boer et al. (1983) Proc. Natl. Acad. Sci. USA 292: 128) derived from sequences of the trp and lac UV5 promoters. The foregoing systems are particularly compatible with E. coli; however, other prokaryotic hosts such as strains of Bacillus or Pseudomonas may be used if desired. o Eukaryotic hosts include yeast and mammalian cells in culture systems. Pichia pastoris, Saccharomyces cerevisiae and S. carlsbergensis are commonly used yeast hosts. Yeast-compatible vectors carry markers that permit selection of successful transformants by conferring protrophy to auxotrophic mutants or resistance to heavy metals on wild-type strains. Yeast compatible vectors may employ the 2-μ origin of replication (Broach et al. (1983) Meth. 5 Enzymol. 101:307), the combination of CEN3 and ARS1 or other means for assuring replication, such as sequences that will result in incorporation of an appropriate fragment into the host cell genome. Control sequences for yeast vectors are known in the art and include but are not hmited to promoters for the synthesis of glycolytic enzymes, including the promoter for 3-phosphoglycerate kinase. See, for example, Hess et al. (1968) J. Adv. Enzyme Reg. 7:149, Holland et al. (1978) Biochemistry 17:4900 and Hitzeman (1980) J. Biol. Chem. 255:2073. 5 For example, some useful control systems are those that comprise the glyceraldehyde-
3-phosphate dehydrogenase (GAPDH) promoter or alcohol dehydrogenase (ADH) regulatable promoter, terminators also derived from GAPDH, and, if secretion is desired, leader sequences from yeast alpha factor. In addition, the transcriptional regulatory region and the transcriptional initiation region which are operably linked may be such that they are not 0 naturally associated in the wild-type organism.
Mammahan cell Unes avaUable as hosts for expression are known in the art and are available from depositories such as the American Type Culture CoUection. These include but are not limited to HeLa cells, human embryonic kidney (HEK) ceUs, Chinese hamster ovary (CHO) cells, baby hamster kidney (BHK) cells, and others. Suitable promoters for 5 mammalian ceUs also are known in the art and include viral promoters such as that from Simian Virus 40 (SV40), Rous sarcoma virus (RSV), adenovirus (ADV), bovine pap loma virus (BPV), cytomegalovirus (CMV). Mammatian cells also may require terminator sequences and poly A addition sequences; enhancer sequences which increase expression also may be included, and sequences which cause amplification of the gene also may be desirable. These o sequences are known in the art. Vectors suitable for replication in mammalian cells may include viral replicons, or sequences which ensure integration of the appropriate sequences encoding the variant α7 nAChR subunit into the host genome. An example of a mammalian expression system for nAChRs is described in Gopalakrishnan et al. (1995) Stable expression and pharmacological properties of the human α7 nicotinic acetylcholine receptor. Eur. J. 5 Pharmacol. -Mol. Pharmacol. 290: 237-246.
Other eukaryotic systems are also known, as are methods for introducing polynucleotides into such systems, such as amphibian cells using methods described in Briggs et al. (1995) Neuropharmacol. 34:583-590, insect cells using methods described in Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987), and the like. o The baculovirus expression system can be used to generate high levels of recombinant proteins in insect host cells. This system allows for high level of protein expression, while post-translationally processing the protein in a manner similar to mammalian cells. These expression systems use viral promoters that are activated following baculovirus infection to drive expression of cloned genes in the insect cells (O'Reilly et al. (1992), Baculovirus 5 Expression Vectors: A Laboratory Manual, IRL/Oxford University Press). Transfection may be by any known method for introducing polynucleotides into a host cell, including packaging the polynucleotide in a virus and transducing a host cell with the virus, by direct uptake of the polynucleotide by the host cell, and the like, which methods are known to those skilled in the art. The transfection procedures selected depend upon the host to 5 be transfected and are determined by the rountineer.
The expression of the variant receptor subunit may be detected by use of a radioligand selective for the receptor. For example, for the nicotinic cholinergic receptor, such a ligand may be [125I]α-bungarotoxin. However, any radioligand binding technique known in the art may be used to detect the receptor subunit (see, for example, Winzor et al. (1995) Quantitative o Characterization of Ligand Binding, Wiley-Liss, Inc., NY).
The variant nAChR polypeptide is recovered and purified from recombinant host cell cultures expressing the same by known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, hydroxyapatite chromatography or 5 lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
The human α7 variant polypeptide, or fragments thereof, of the present invention may also be synthesized by conventional techniques known in the art, for example, by chemical o synthesis such as solid phase peptide synthesis. In general, these methods employ either solid or solution phase synthesis methods. See, for example, J. M. Stewart and J. D. Young, Solid Phase Peptide Synthesis, 2nd Ed., Pierce Chemical Co., Rockford, IL (1984) and G. Barany and R. B. Merrifield, The Peptides: Analysis, Synthesis, Biology, editors E. Gross and J. Meienhofer, Vol. 2, Academic Press, New York, (1980), pp. 3-254, for solid phase peptide 5 synthesis techniques; and M. Bodansky, Principles of Peptide Synthesis, Springer- Verlag,
Berlin (1984) and E. Gross and J. Meienhofer, Eds., The Peptides: Analysis, Synthesis, Biology, supra, Vol. 1 , for classical solution synthesis.
In one preferred system, either the DNA or the RNA derived therefrom, both of which encode the desired variant human α7 nAChR subunit, may be expressed by direct injection into 0 a cell, such as zXenopus laevis oocyte. Using this method, the functionality of the human α7 nAChR subunit variant encoded by the DNA or the inRNA can be evaluated as follows (see Dascal (1987) CRC Crit. Rev. Biochem. 22:317-387). A variant-encoding polynucleotide is injected into an oocyte for translation into a functional receptor subunit. The function of the expressed variant human α7 nAChR can be assessed in the oocyte by a variety of 5 electrophysiological techniques including intracellular voltage recording, two-electrode voltage clamp, patch clamp methods, and the like. The cation-conducting channel intrinsic to the nAChR opens in response to ACh or other nicotinic cholinergic agonists, permitting the flow of transmembrane current. This current can be monitored directly by voltage clamp techniques or indirectly by intracellular voltage recording, wherein changes in membrane potential due to the induced current are measured. 5 Receptors expressed in a recombinant host cell may be used to identify compounds that modulate nAChR activity. In this regard, the specificity of the binding of a compound showing affinity for the receptor is demonstrated by measuring the affinity of the compound for cells expressing the receptor or membranes from these cells. This may be done by measuring specific binding of labeled (for example, radioactive) compound to the cells, cell o membranes or isolated receptor, or by measuring the ability of the compound to displace the specific binding of a standard labeled ligand. Expression of variant receptors and screening for compounds that bind to, or inhibits the binding of labeled ligand to these cells or membranes provides a method for rapid selection of compounds with high affinity for the receptor. These compounds may be agonists or antagonists for the receptor. 5 Expressed receptors may also be used to screen for compounds that modulate nicotinic acetylcholine receptor activity, i.e, nicotinic cholinergic agonists or antagonists. One method for identifying compounds that modulate nAChR activity, comprises providing a cell that expresses a variant human α7 nicotinic acetylcholine receptor (nAChR) polypeptide having an amino acid substitution at position valine-274 of the wild-type human α7 nAChR polypeptide, o combining a test compound with the cell and measuring the effect of the test compound on the variant receptor activity. The cell may be a bacterial cell, a mammalian cell, a yeast cell, an amphibian cell or any other cell expressing the receptor. Preferably, the cell is a mammalian cell or an amphibian cell. Thus, for example, a test compound is evaluated for its ability to elicit an appropriate response, for example, the stimulation of transmembrane current flow, or 5 for its ability to inhibit the response to a cholinergic agonist.
In addition, expressed receptors may be used to screen compounds that exhibit a cytoprotective effect. Abnormal activation of membrane channels is a potential cause of neurodegenerative disease. In this regard, a number of inherited human disorders are accompanied by neuronal degeneration (Adams et al. (1989) Degenerative Disease of the 0 Nervous System, in Principles of Neurology, McGraw-Hill, NY, pp. 921-967). Many model systems have been used to study the causes of these diseases. For example, mutations in proteins that have extensive sequence similarity to proteins that contribute to the amiloride- sensitive sodium ion channel have been associated with vacuolated neurodegeneration in the nematode C. elegans (Canessa et al. (1993) Nature,361:467-470; Canessa et al. (1994) Nature, 5 367:463-467; Lingueglia et al. (1993) FEBSLett. 318:95-99; and Voilley et al. (1994) Proc. Natl. Acad. Sci. USA 91:247-251). A so-called "gain-of-function" mutation in the deg-3 protein of C. elegans, causes vacuolated degeneration of a small set of neurons (Treinin et al. (1995), supra). Studies of this mutation suggested to these investigators that mutation in neuronal acetylcholine receptors may lead to death of specific neuronal populations.
Additionally, the α7 variant can be used to screen for compounds useful in treating 5 disorders such as alterations in sensory gating, immunofunction and neuropathic pain, for example, pain associated with cancerous conditions, post herpatic neuralgia, diabetic neuropathy and oseoarthritis. Further, the α7 vaiant could be used to treat or to kill cancerous cells.
Accordingly, nicotinic drugs are considered potential therapeutic agents in several 0 neurodegenerative disorders including, without limitation, Alzheimer's disease, Down's syndrome, kuru, Parkinson's disease, multiple system atrophy, neuropathic pain and the like, in which they may be useful in slowing cell death. Activation of the wild type α7 nAChR appears to elicit cytoprotective properties (for example, reduced cell lysis, see Donnelly- Roberts et al. (1996) In vitro neuroprotective properties of the novel cholinergic channel 5 activator (ChCA), ABT-418. Brain Res. 719: 36-44). However, it is not yet finally established whether a full agonist or partial agonist is preferable, nor, if the latter, what type of partial agonist is best (for example, one that stabilizes the open and desensitized states or one that stabilizes the open and resting states of the receptor). This variant α7 nAChR can be used to evaluate these questions, and to select among ligands for specific types of partial agonists or o specific types of antagonists. That is because this variant α7 nAChR conducts current in the desensitized as well as the open states, unlike the wild type receptor that conducts only in the open state (see Bertrand and Changeux (1995) Nicotinic receptor: An allosteric protein specialized for intercellular communication. Sem.Neurosci. 7: 75-90). Thus, with the human variant nAChR subunit agonist potency is shifted two orders of magnitude to a level consistent 5 with agonist affinity for the desensitized state. Furthermore, ligands that are partial agonists at the wild type α7 nAChR subunit because of their ability to stabilize desensitized as well as open states would be expected to have increased efficacy at the variant nAChR subunit due to its ability to conduct in the desensitized state. Examples of such potency and efficacy shifts are shown for the human 7V274T nAChR in Figure 3. o Thus, α7 nAChR ligand pharmacology can be defined in novel ways through the use of the human variant nAChR subunit. Substances could be antagonists at the wild type α7 nAChR due to their ability to stabilize the non-conducting desensitized state, or due to other mechanisms such as stabilizing the resting state or blocking the ion channel. Similar mechanisms could contribute to partial agonism at the wild type α7 nAChR. The ability of a 5 ligand to stabihze the desensitized state could be evaluated by comparing the ligand s potency and efficacy at the variant α7 nAChR (for example, human α7V274T) to its potency and efficacy at the wild-type α7 nAChR. The interaction of compounds with the nAChR can be identified using several methods, including, but not limited to, electrophysiologic measurement of transmembrane current flow or electrical potential, measurement of the fluorescence of potential- or ion-sensitive dyes, or measurement of radioactive ion flux (for example ^Na+ 0r 5 "Rb+) and a variety of α7 nAChR expression systems, for example transfected mammalian cells in culture or injected amphibian cells. This novel definition of α7 nAChR pharmacology coupled with measures of α7 ligand effect on cell or animal functioning could be critical to the development of novel therapeutics. For example, it could be determined whether a ligand that stabilizes the desensitized state of the α7 nAChR subunit (partial agonist or antagonist) is o preferable for cytoprotection. Likewise, the type of ligand more or less useful in other nicotinic applications, such as cognition, memory, anxiety, attention, sensory gating (psychoses and schizophrenia), etc. could be evaluated using variant 7 nAChR subunits alone or in combination with other receptor subunits.
In addition to screening test compounds, the expressed variant α7 subunit may be used 5 to investigate mechanisms of cytotoxicity and cytoprotection. The evidence that activation of α7 nAChR is cytoprotective comes from the finding that nAChR agonists elicit cytoprotection in cells expressing the 7 nAChR subunit and that this cytoprotection is inhibited by selective α7 antagonists (for example see Donnelly-Roberts et al., supra). The mechanism is unknown but may involve the stimulation of Ca2+ influx. If so, then the increased Ca2+ influx mediated o by the variant α7 nAChR, due to maintained Ca2+ permeability with prolonged current activation, may augment the cytoprotection. On the other hand, as excessive intracellular Ca2+ is known to be cytotoxic, excessive expression or stimulation of the variant α7 nAChR could cause cell death, perhaps as observed in C. elegans carrying the endogenous mutation in deg3 analogous to the α7 variant. Alternatively still, the α7 nAChR subunit may also function 5 through mechanisms dependent upon a change in receptor state (for example, from resting to desensitized conformation), which may influence its interaction with other proteins, but not necessarily dependent upon a change in ion flux or electrical potential. The variant α7 nAChR subunit would be critical in determining such mechanisms as it would allow one to identify ligands that favor different receptor states, and as it provides a tool for manipulating nAChR o channel current independently from nAChR conformation and ligand binding.
Cytoprotective or cytotoxic compounds that interact with the variant nAChR may be identified using several methods. One such method comprises providing a cell that expresses a variant human α7 nAChR subunit having an amino acid substitution at position valine-274 of the wild-type human α7 nAChR polypeptide, combining a test compound with the cell, and 5 monitoring the cell for an indicator of cytotoxicity. If it is necessary to control spontaneous action of the variant nAChR subunit, it may be stably expressed in a recombinant mammalian cell line under the control of an inducible promoter, for example, the LacSwitch system which is inducible by isopropylthiogalactoside ("LPTG"). Expression of the variant α7 nAChR subunit would be maintained at a low level until induction by the addition of IPTG. Alternatively, with or without an inducible promoter, the transfected cells could be cultured in the presence of an α7 nAChR blocker, such as methyllycaconitine ("MLA") or mecamylamine, that would prevent or reduce cytotoxic action. Both blockers are reversible, permitting one to measure the effect of test compound on al nAChR function after the blocker is washed out. Cytoprotective compounds can be identified by their ability to reduce cell death while cytotoxic compounds can be identified by their ability to promote cell death. That these effects are mediated by the α7 nAChR subunit, variant or wild type, can be identified by the ability of an al nAChR blocker to prevent the effect. Cell death, or cytotoxicity, can be monitored by a variety of techniques including but not limited to measurement of cell number or density in the culture, of cell growth rate (for example incorporation of labeled nucleotide or amino acid), or of cell integrity for example by uptake of a dye (for example trypan blue is excluded by healthy cells) or by the release of a cytoplasmic constituent such as lactate dehydrogenase (LDH).
Cytoprotective agents may also be screened for their ability to antagonize a variant nAChR to a greater extent than a wild-type nAChR, or for their ability to augment the decay rate of variant nAChR compared to the wild-type nAChR, using methods described in the examples provided below. In addition, the DNA, or RNA derived therefrom, can be used to design oligonucleotide probes for nAChR DNAs that express variant subunits. As used herein, the term "probe" refers to a structure comprised of a polynucleotide, as defined above, which contains a nucleic acid sequence complementary to a nucleic acid sequence present in a target polynucleotide. The polynucleotide regions of probes may be composed of DNA, and/or RNA, and/or synthetic nucleotide analogs. Such probes could be useful in in vitro hybridization assays to distinguish al variant from wild-type message, with the proviso that it may be difficult to design a method capable of making such a distinction given the small difference in coding between variant and wild-type. Alternatively, a PCR-based assay could be used to amplify the sample RNA or DNA for sequence analysis. Furthermore, the variant nAChR subunit can be used to prepare polyclonal or monoclonal antibodies using techniques that are well known in the art. The variant nAChR subunit or relevant fragments can be obtained using the recombinant technology outlined below, i.e., a recombinant cell that expresses the subunit or fragments can be cultured to produce quantities of the subunit or fragment that can be recovered and isolated. Alternatively, the variant nAChR subunit or fragment thereof can be synthesized using conventional polypeptide synthetic techniques as provided below. Monoclonal antibodies that display specificity and selectivity for the variant nAChR subunit can be labeled with a measurable and detectable moiety, for example, a fluorescent moiety, radiolabels, enzymes, chemiluminscent labels and the like, and used in in vitro, or in situ immunofluorescent assays, or the like. The antibodies can be used to identify variant nAChR subunit for immunodiagnostic purposes. Below are examples of specific embodiments for carrying out the present invention. The examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way. In preparing the examples, efforts have been made to ensure accuracy with respect to numbers used (for example, amounts, temperatures, etc.), but some experimental error and deviation should, of course, be allowed for.
Materials
Acetylcholine chloride ("ACh"), collagenase Type 1A, d-tubocurarine chloride ("dTC"), gentamicin and mecamylamine hydrochloride ("MEC"), were obtained from Sigma Chemical Company (St. Louis, Missouri, U.S.A.). Dihydro-β-erythroidine hydrobromide ("DHBE"), and methyllycaconitine citrate ("MLA") were obtained from Research Biochemicals International (Natick, Massachusetts, U.S.A.). Tricaine (3-aminobenzoic acid ethyl ester methanesulfonate; Finquel) was obtained from Argent Chemical Laboratories (Fisheries Chemical Division, Redmond, Washington, U.S.A.).
Preparation of Human al Wild-Type cDNA
The human al nAChR subunit cDNA reported by Doucette-Stamm et al. (1993), supra, was modified to include the complete human signal peptide
(MRCSPGGVWLALAASLLHVSLQGEF (SEQ ID NO:3)) reported by Elliott et al. (1993) Soc. Neurosci. Abstr. 19:69. The following oligonucleotide was synthesized: 5'-GGGGGCAGCAC7CGAGCCCATGAGGTGTAGCCCCGGAGGAGTGTGGCTGGCA
CTGGCAGCATCTCTCCTGCACGTGTCCCTGCAAGGCGAGTTCCAGAGGAAGCTTTA CAAGGAGGGG-3' (SEQ ID NO:4). This oligonucleotide contains an Xho I restriction site (italics) and an ATG initiation codon (bold) followed by the next 28 codons of the human al nAChR subunit cDNA sequence. It encodes the complete signal peptide and extends to the Hind III site (underlined) present in the al nAChR subunit cDNA. The Xho I and Hind HI sites were flanked with additional nucleotides to make them internal within the molecule. Additionally, the reverse complement of this oligonucleotide was synthesized. The oligonucleotides were annealed together, digested with Xho I and Hind III, and then ligated into a pBluescript vector containing the human al subunit cDNA previously digested with Xho I and Hind III. This created a new cDNA encoding a full length human al nAChR subunit. The sequence of the new cDNA was confirmed by dideoxy sequencing. The cDNA was excised from pBluescript with Xho I and Not I, the 5' overhangs were filled-in with Klenow polymerase, linked with Bst XI adapters, digested with Bst XI, and ligated into the Bst XI site of the pRcCMV vector (Invitrogen). The orientation of the insert in the expression vector was determined by restriction analysis with enzymes cutting the al nAChR subunit cDNA at asymmetrical positions.
Expression of al nAChR in Xenopus laevis Oocytes and Measurement of Functional Characteristics
The preparation of Xenopus laevis oocytes, injection with receptor RNA or DNA, and measurement of al nAChR responses using two-electrode voltage-clamp followed procedures described previously for the wild-type human al nAChR (Briggs et al. (1995), supra) except that atropine was not routinely present in the bathing solution. Oocytes were maintained at 17-18°C in normal Barth's solution (90 mM NaCI, 1 mM KCl, 0.66 mM NaNO3, 0.74 mM CaCl2, 0.82 mM MgCl2, 2.4 mM NaHCO3, 2.5 mM sodium pyruvate, and 10 mM Na N-(2-hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid) ("HEPES") buffer, final pH 7.55) containing 100 g/ml gentamicin. Responses were measured at a holding potential of -60 mV in modified Barth's solution containing 10 mM BaCl2 and lacking CaCl2 and MgCl2.
However, in some experiments (Figure 6) the cell potential was intentionally varied in order to determine the response current-voltage relationship and OR2 plus atropine (82.5 mM NaCI, 2.5 mM KCl, 2.5 mM CaCl2, 1 mM MgCl2, 5 mM Na-HEPES (pH 7.4) and 0.5 M atropine sulfate) was used to replicate conditions used by Galzi et al. (1992), supra, to study chick al nAChR. Agonist was applied briefly using a computer-controlled solenoid valve and a push/pull applicator positioned to within 200-400 m from the oocyte. Responses were recorded by computer in synchrony with agonist application. Antagonists were included with agonist in the push/pull applicator and were applied to the bath by superfusion for at least 3 minutes before application of agonist. Responses were quantified by measuring the peak amplitude.
Human α7V274T responses, unlike human α7WT responses, tended to increase significantly during the experiments. Therefore, experimental trials were bracketed, before and after, by control applications of 10 M ACh in the same oocyte. All responses were normalized to the 10 M ACh responses in order to account for changes in sensitivity within the experiment and for variability in receptor expression among oocytes. Example 1 Preparation of Human α7V274T cDNA
To generate the variant α7V274T in an expression vector, the wild-type al nAChR 5 subunit gene was digested with EcoR V and Kpn I restriction enzymes and the digested segment was replaced with a mutant PCR product by ligation using the procedures described below.
The strategy, diagrammed in Figure 1, used two PCR steps followed by digesting with restriction enzymes to produce a mutated fragment of the wild-type al nAChR subunit cDNA o and subcloning the mutated fragment into the wild-type human al cDNA. In the first step (A), two DNA fragments carrying the desired mutation were generated by PCR using appropriate primers. The mutated nucleotide was incorporated in the reverse primer (X-3') for the longer fragment and in the forward primer (Y-5') for the shorter fragment. The two external primers (X-5' and Y-3') were chosen so that the final PCR product would contain EcoRV and Kpnl 5 restriction sites.
The longer 5' fragment was generated using the forward external primer 5'-GTTTGGGTCCTGGTCTTACG-3' (SEQ ID NO:5) and the reverse internal primer 5'-GCAGCATGAAGGTGGTAAGAGAG-3' (SEQ ID NO:6) bearing the mutation. The shorter 3' fragment was generated using the forward internal primer o 5'-CTCTCTTACCACCTTCATGCTGC-3' (SEQ ID NO:7), also bearing the mutation, and the reverse external primer 5'-GTACTGCAGCACGATCACCG-3' (SEQ ID NO:8). The conditions for PCR consisted of 100 ng input al DNA, 2X Pfu buffer, 100 ng of each primer pair and 0.625 U Pfu enzyme (Stratagene, La Jolla, CA). Reactions were carried out in a Perkin-Elmer 9600 for 20 cycles at 95°C for 24 seconds, 60°C for 22 seconds then 72°C for 78 5 seconds.
In the second PCR step (B), these two fragments were reassembled using the external primers. The sequence was reamplified and a longer DNA fragment bearing the desired mutation was generated.
In the next step (C), the product of step (B) was digested with Kpnl and EcoRV, o gel-purified, and ligated into the wild-type human al cDNA previously digested with Kpnl and EcoRV. Dideoxy sequencing of the final cDNA showed the presence of the desired mutation and that no other mutation had been introduced during the PCR process.
Figures 2A-2C shows the nucleotide sequence (SEQ ID NO:l) of the human α7V274T cDNA mutant. The amino acid sequence of the human α7V274T variant (SEQ ID NO:2) is 5 also shown in Figures 2A-2C. Example 2
Concentration-Response Relationships for Agonists in Human 7V274T and Wild-Type nAChR
Responses to various agonist concentrations were measured using human α7V274T nAChR subunits expressed from the DNA prepared in Example 1 that was injected into Xenopus laevis oocytes as described above. The responses were measured at peak amplitude and were normalized to the response to 10 M ACh. Data points (Figure 3) show the mean ± s.e.m. of the normalized responses (n=4 to 10 for ACh, n=3 to 4 for (-)-nicotine n=3 to 5 for GTS-21, and n=2 to 5 for ABT-089). The curves depicted in Figure 3 show the Hill equation fitted to the data (Sigmaplot software, Jandel Scientific, San Rafael, California, U.S.A.) with the exceptio of the small responses to GTS-21 and ABT-089 at the al wild-type. At the human al wild type nAChR, ACh and (-)-nicotine had EC50 values of 156 ± 20 μM and 83 ±
10 μM, respectively, and with Hill coefficients of 0.94 ± 0.09 and 1.2 ± 0.2, respectively. GTS-21 and ABT-089 were partial agonists whose EC5Q values could not be estimated because the responses were so weak. There was a clear shift in potency and efficacy at the human 7V274T nAChR. At the human α7V274T nAChR, ACh and (-)-nicotine were two orders of magnitude more potent, with EC50 values of 1.02 ± 0.04 μM and 0.94 ± 0.12 μM, respectively, and Hill coefficients of 1.8 ± 0.2 and 1.3 ± 0.2, respectively. More remarkably, GTS-21 was a full agonist at the human α7V274T nAChR with an EC50 value of 4.3 ± 0.3 μM and a Hill coefficient of 1.5 ± 0.1, in stark contrast to its weak partial agonist effect at the human al wild type nAChR. ABT-089 also was more potent and efficacious at the human 0C7V274T nAChR, with an EC50 values of 28 ± 3 μM and a Hill coefficient of 2.3 ± 0.4, but it was a partial agonist with an efficacy of 40 ± 1%. These results with the human nAChR subunits correlate with the 1 0-fold increase in ACh observed with chick 7V251T compared to chick al wild type nAChR (Galzi et al. (1992), supra). However, this is the first demonstration that the potency of (-)-nicotine also is shifted, and the first demonstration that the potency and efficacy of a partial agonists are shifted in this variant.
Example 3
Activation and Decay Rate of Human al V274T Compared to Wild-Type Human α7WT nAChR
Human α7V274T and human α7WT responses to EC50 concentrations of ACh (1 μM and 200 μM, respectively) were matched for similar amplitude and are shown synchronized to the beginning of ACh application and adjusted for equivalent baseline holding current (see Figure 4). ACh was applied to human α7V274T for 10 sec and to human α7WT for 2.5 sec. Brief spike-like tics near the beginning and end of the human α7WT trace are electrical artifacts marking the opening and closing of the agonist-application valve. Human α7V274T responses activated and decayed slowly compared to the human α7WT responses. Similarly, the analogous chick mutant nAChR activated and decayed more slowly in response to ACh (Galzi et al. (1992), supra).
Example 4 Evaluation of nAChR Antagonists for
Agonist Activity at the Human α7V274T nAChR
nAChR antagonists such as dihydro-β-erythroidine (DHβE), rf-tubocurarine and hexamethonium, have been found to activate responses at chick al TM-2 nAChR variants when these compounds were applied as agonists (Bertrand et al. (1992), supra). This, together with data from single-channel recording, has suggested (a) that the variants nAChRs conduct in the receptor-desensitized state and (b) that wild-type nAChR antagonists act by stabilizing the desensitized state (Bertrand et al. (1995), supra).
At the human 7V274T nAChR, DHβE (10 μM) also activated agonist-like inward current responses (see Figure 5). However, these responses were small, ranging from 2.8% to 6.9% of the response to 10 μM ACh (Table 1) unlike the homologous chick α7V251T nAChR where 10 μM DHbE elicited a response 66% as large as the ACh response (Bertrand et al. (1993) Mutations at two distinct sites within the channel domain M2 alter calcium permeability of neuronal a7 nicotinic receptor. Proc. Natl. Acad. Sci (U.SΛ.) 90:6971-6975). Furthermore, at human α7V274T this was not a general property of nAChR antagonists. Both the α7-selective antagonist MLA (10 nM) and the nonselective nAChR antagonist mecamylamine (10 μM) elicited the opposite effect, small inverse agonist-like outward currents ranging in amplitude from 0.9% to 12.4% of the maximal inward current response to ACh, as shown in Figure 5 and Table 1. The traces shown in Figure 5, all from a single oocyte, compare responses to mecamylamine (MEC, 10 μM), methyllycaconitine (MLA,
10 nM), dihydro-β-erythroidine (DHβE, 10 μM) and bathing solution (0-agonist control) applied for 20 sec each. The small 0-agonist control responses were measured in each human α7V274T oocyte and subtracted from agonist responses when data were tabulated. Cahbration lines in Figure 5 represent 10 nA and 2 sec for all traces. Table 1 Effects of Cholinergic Antagonists at the Human α7V274T Mutant and al Wild-type nAChR
Figure imgf000026_0001
Abbreviations: DHβE (dihydro-β-erythroidine); d-TC (rf-tubocurarine); MLA (methyllycaconitine); MEC (mecamylamine); ATROP (atropine). p < 0.05 compared to 0 (Student's two-tailed t-test) t p < 0.005 compared to 0 (Student's two-tailed t-test) + compared to activation by 10 μM § % inhibition of the response to ACh
d-Tubocurarine (1 μM) also did not elicit agonist-like inward currents, but did elicit small outward currents (3-5% of the maximal inward current response to ACh) in two of four human al V274T oocytes. The outward current responses may be due to stabilization of the resting (closed) state or to channel blockade of spontaneously open nAChR. At the human cx7WT nAChR under similar conditions, neither DHβE (10 μM), MLA (10 nM), mecamylamine (10 μM) nor d-tubocurarine (1 μM) elicited any significant inward or outward current response (Table 1). The muscarinic antagonist atropine (2 μM) alone had little effect at either nAChR. Example 5
Evaluation of nAChR Antagonists for
Agonist Activity at the Human α7V274T nAChR
The above compounds also were evaluated as antagonists of the response to ACh at both human CX7V274T and human α7WT nAChRs. For each nAChR, two concentrations of ACh were used: one near the EC50 value (1 μM for α7V274T and 200 μM for α7WT) and one near the maximal response level (10 μM for α7V274T and 10 mM for α7WT). Data are shown in Table 1. DHβE (10 μM), d-tubocurarine (1 μM), MLA (10 nM), and mecamylamine (10 μM) acted as antagonists at both nAChRs. The al selective antagonist MLA was particularly potent, as expected, blocking human α7V274T as well as human α7WT at a concentration of 10 nM. Interestingly, mecamylamine (10 μM), DHβE (10 μM) and ύf-tubocurarine (1 μM) each appeared to inhibit human α7V274T more than human α7WT. Atropine (2 μM) inhibited the human α7V274T response to 1 μM ACh by 28%, but had little effect on the human α7WT response to 200 μM ACh. Some oocytes have endogenous muscarinic receptors activated by low-micromolar concentrations of ACh (Kusano etal. (1982) J. Physiol. (London) 328:143-170; Davidson et al. (1991) FEBS Lett. 284:252-256; and Dascal et al. (1980) Life Sci. 27:1423-1428). However, this does not appear to explain the effect of atropine on human α7V274T because the nAChR antagonist mecamylamine (10 μM) completely blocked the response to 1 μM ACh in three of the five h-α7V274T oocytes inhibited by atropine (the other two were not exposed to mecamylamine).
DHβE (10 μM) inhibited maximal ACh responses less strongly than it inhibited ECCQ
ACh responses at both human α7V274T and human α7WT (see Table 1). Mecamylamine (10 μM) also inhibited the maximal ACh response less strongly than the EC50 ACh response at the human α7V274T nAChR, but not at the human α7WT nAChR where mecamylamine inhibited both concentrations of ACh similarly. The lesser inhibitions at the higher concentrations of ACh may reflect competitive antagonist-agonist interactions.
Thus, the human variant 7V274T nAChR is similar to the analogous chick α7V251T nAChR in its increased sensitivity to agonist activation and apparent slower rate of activation and desensitization. The receptors differ, however, in that DHβE (10 μM) activated the human cx7V274T inward current only weakly, compared to a 66% agonist-like effect at chick α7V251T, and in that d-tubocurarine did not activate inward currents at the h-α7V274T compared to the full response at chick α7L247T nAChR (Galzi et al. (1992), supra; Bertrand et al. (1993), supra). Thus, there may be a species difference in the effects of these sequence modifications on al nAChR function which difference is unexpected in view of the information known regarding chick α7V274T.
Example 6 Human α7V274T Rectification
The current versus voltage relationship of human α7V274T variant nAChR responses to 10 μM ACh was measured in oocytes under two-electrode voltage clamp as described by Briggs et al. (1995) Neuropharmacol. 34:583-590. This was done under two conditions: (a) four oocytes in modified Barth's solution containing Ba2+ to prevent secondary activation of Ca2+-dependent Cl" currents (90 mM NaCI, 1 mM KCl, 0.66 mM NaNO3, 10 mM BaCl2, 2.5 mM sodium pyruvate, and 10 mM Na-HEPES buffer, pH 7.55) as described by Briggs et al. (1995), supra, and (b) three oocytes in OR2 solution made to replicate that used by Galzi et al. (1992) Nature 359: 500-505, in their study of chick al variants (82.5 mM NaCI, 2.5 mM KCl, 2.5 mM CaCl2, 1 mM MgCl2, 0.5 μM atropine, and 5 mM Na-HEPES buffer, pH 7.4).
Under both conditions, clear inward rectification of the ACh response was observed in that there was little current response at cell potentials above 0 mV compared to the current response at negative cell potentials. Similarly, human al wild-type nAChR (Briggs et al. (1995), supra) and chick al wild-type nAChR (Galzi et al. (1992), supra) show inward rectification, but the chick cx7V25 IT variant did not show such rectification (Galzi et al. (1992), supra).
Example 7 Expression Studies in Mammalian Cell lines
The human al wild-type (WT) and α7V274T mutant nAChR are transfected into the human embryonic kidney cell line, HEK-293 using the eukaryotic expression vector, pRc/CMV (Invitrogen, San Diego, CA) which contains the promoter sequences from the human cytomegalovirus for high level constitutive expression and contains the neomycin resistance gene for selection of geneticin-resistant stable cell lines. The cDNAs are transfected using lipofectamine (GIBCO) as described in (Gopalakrishnan et al. (1995) Eur. J. Pharmacol.
(Mol. Pharm.) 290:237-246). Using this approach stable cell lines expressing the human 7WT nAChR have been generated, exhibiting clear [125I] -bungarotoxin binding, acetylcholine-evoked current and Ca2+ influx responses (Gopalakrishnan et al. (1995), supra; Delbono et al. (1996) J. Pharmacol. Exp. Ther. (in press)). Additionally, initial data depicted in Figure 7 demonstrate the feasibility of transfection of the al variant into mammalian cells. The human α7V274T variant bears homology to the C. elegans deg-3 (u662) spontaneous mutation which appears to be cytotoxic through a mechanism that is inhibited by nicotinic antagonists (Treinin and Chalfie (1995) A mutated acetylcholine receptor subunit causes neuronal degeneration in C. elegans. Neuron 14: 871-877). The human α7V274T 5 variant nAChR response is longer lasting than wild-type responses (Figure 4) but, like chick α7V251T variant nAChR, probably has high Ca2+ permeability so that activation of the receptor may, under some conditions, lead to excessive Ca2+ influx and thereby cell death. Further, there is some evidence that the human α7V274T variant nAChR may be prone to prolonged spontaneous opening because oocytes that have expressed α7V274T for 3 days or 0 longer were 10-100 fold leakier electrically than were oocytes expressing human al wild-type nAChR. Thus, human α7V274T and related variant nAChR may be cytotoxic in the presence and even in the absence of agonist. Spontaneous expression of such a variant could interfere with normal al nAChR function, induce premature cell death, or interfere with synapse formation. Such effects could underlie some forms of neurodegenerative diseases or other 5 disorders involving derangement of chohnergic function.
Cytotoxicity clearly could limit the ability of cells to express the α7V274T variant at high levels. To circumvent this, transfected cells are grown in the presence of a reversible nicotinic antagonist or channel blocker, such as methyllycaconitine or mecamylamine. Such substances would prevent cytotoxicity by blocking the receptor or channel, but could be o removed shortly before using the cells in further experiments.
Alternatively, the human al wild type or variant is transfected using an inducible expression system such that expression of the al subunit is repressed until an inducer is added. The advantage of an inducible system is that it can eliminate the cytotoxic effects of the expressed protein, for example the human α7V274T variant, that is observed when a 5 constitutive expression system such as the pRcCMV is employed.
One of the expression vectors that is used is the LacS witch system (Stratagene) that uses the elements of lactose operon to control gene expression. With the LacS witch system, basal expression is very low in the repressed state and once stably transfected in cell lines, this system permits rapid induction within 4-8 hours in presence of the inducing agent, IPTG. The o system employs a eukaryotic Lac-repressor-expressing vector (p3'SS) and a eukaryotic lac- operator containing vector (pOPRSVI-CAT) into which the α7 subunit construct will be inserted by cloning. Antibiotic selection is attained via the hygromycin-resistance gene in p3'SS and via the neomycin-resistance gene in pOPRSVI-CAT vector. After transfection of HEK-293 or other cells, the selection of stable cell lines is achieved by the presence of both 5 hygromycin and geneticin. Once stable cell lines are isolated, expression of the al subunit will be caused by the addition of the inducing agent, IPTG. In the absence of IPTG, transcription is blocked by the binding of the Lac repressor protein to the operator in pOPRSVI-CAT vector. LPTG decreases the binding affinity of the Lac repressor protein to the operator thereby triggering transcription and expression of the inserted al subunit gene. The choice of such a system permits the direct evaluation of the role of the mutant al nAChR in mediating cell death in vitro.
In Vitro Assessment of Cytotoxicity in Mammahan Cell Lines: To determine whether the human α7V274T variant mediates cytotoxicity, cell damage can be assessed following transient expression of the cDNA in HEK-293 cells by a number of methods, for example: (i) staining the cells with Trypan blue (4%) for 5 minutes and assessing the ability of viable cells to exclude the dye; (ii) measuring the levels of the cytosolic enzyme lactate dehydrogenase
(LDH) released into the medium, as an index of cell lysis (for example, Donnelly-Roberts et al. (1996) Brain Res. 719: 36-44); (iii) uptake of neutral red dye or uptake and conversion of the tetrazolium MTT as an index of viability (for example, Little et al. (1996) Br. J. Dermatol. 134: 199-207; D Souza et al. (1996) J. Neurosci. Res. 43: 289-298; Malcolm et al. (1996) J. Neurochem. 66: 2350-2360); (iv) uptake and binding of propidium iodide to nucleic acids (for example, Wrobel et al. (1996) J. Immunol. Methods 189: 243-249) or other techniques that are sensitive to a loss of plasma membrane integrity or cellular metabolic function. Additional techniques may be used to assess changes in nucleotide incorporation, DNA structure or integrity (for example, Alison and Sarraf (1995) Hum. Exp. Toxicol. 14: 234-247; Didier et al. (1996) J. Neurosci. 16: 2238-2250). These techniques are known to those of ordinary skill in the art. These studies are carried out in nontransfected or mock-transfected cells (controls), cells that are transfected with human al wild-type, and cells that are transfected with human α7V274T variant. Confirmation that human α7V274T variant expression leads to cytotoxicity would suggest a role in triggering neurodegenerative processes in vivo. Diagnostic application: The presence of the oc7V274T variant in humans could be determined in a non-invasive manner, for example using the polymerase chain reaction (PCR) and genomic DNA isolated from blood samples following standard methodology. Alternatively, if RNA is isolated, then reverse tran scri tase-PCR ("RT-PCR") can be utilized to detect the al variant. The PCR reaction, for example, could use 100 ng of the DNA in a standard 50 μl PCR reaction with the appropriate synthetic primers. The external primers used in the synthesis of the al variant (X-5' and Y-3') would allow one to amplify the region of interest. The primers would be chosen to generate a distinct size fragment encompassing the sequence transmembrane segment 2, in which the V274T substitution takes place. Following amplification, the nucleotide sequence of the message is determined. The presence of the variant can be an indication of cellular disease, such as neurodegeneration or other forms of cytotoxicity. Thus, a method of detecting target polynucleotides of human variant al subunit in a test sample comprises (a) contacting a target polynucleotide of human variant al subunit with at least one human variant al subunit-specific polynucleotide probe or complement thereof; and (b) detecting the presence of the target polynucleotide and probe complex in the test 5 sample. Another method for detecting cDNA of human al subunit mRNA in a test sample comprises (a) performing reverse transcription in order to product cDNA; (b) amplifying the cDNA obtained from step (a); and (c) detecting the presence of the human variant al subunit in the test sample. Alternatively, sampled DNA or cDNA prepared fom RNA by RT-PCR can be amplified using appropriate primers (for example, X-5' and Y-3') to allow detection of the o variant by nucleotide sequence analysis. The detection step (c) comprises utilizing a detectable moiety capable of generating a measurable signal.
A purified polynucleotide or fragment thereof derived from human variant al subunit capable of selectively hybridizing to the nucleic acid of human variant al subunit can be utilized in these methods, wherein said polynucleotide has a sequence comprising SEQ ID 5 NO: 1 or a portion thereof. The purified polynucleotide can be produced by recombinant techniques.
A polypeptide encoded by human variant al subunit also is useful for diagnostic applications. The polypeptide, which has an amino acid sequence comprising SEQ ID NO:2 or a portion thereof, can be produced by recombinant or synthetic techniques. 0 A monoclonal antibody which specifically binds to human variant al subunit can also be utilized in these methods. The human variant al subunit comprises the amino acid sequence of SEQ ID NO: 2 or a portion thereof.
A method for detecting human variant al subunit in a test sample can comprise (a) contacting said test sample with an antibody or fragment thereof which specifically binds to 5 human variant α7 subunit for a time and under conditions sufficient for the formation of resultant complexes; and (b) detecting said resultant complexes containing said antibody, wherein said antibody specifically binds to human variant al subunit of SEQ ID NO:2 or a fragment thereof.
Treatment application: Spontaneous mutation of human al valine-274 to threonine and o related mutation could result in or hasten death of those cells expressing the protein. At least two types of treatment could be undertaken: (i) administration of a selective al antagonist such as methyllycaconitine or another compound with improved blood-brain barrier penetration; or, (ii) antisense oligonucleotide therapy to block the synthesis of the protein (for example, see Albert and Morris (1994), Antisense knockouts: molecular scalpels for the dissection of signal 5 transduction. Trends in Pharmacological Sciences 15: 250-254); or (iii) as a reagent to kill cells such as cancer cells. For example, the antisense oligonucleotide 5'-GGCTACACCTCATGGGCTCG (SEQ ID NO:9) may be used. Thus, this oligonucleotide or others would block synthesis of any al subunit protein, including wild type, but still would be of use where the variant and not the wild type is expressed, or where knockout of the wild-type is less detrimental than continued expression of the variant. The efficacy of this anti- 5 sense would be demonstrated in vitro and, further, the antisense would be valuable as a research tool eo evaluat al subunit function.
Antisense technology can be used to reduce gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA. For example, the 5' coding portion of the polynucleotide 0 sequence, which encodes for the polypeptide of the present invention, is used to design an antisense RNA ohgonucleotide of from 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and the production of the human variant al subunit polypeptide. The antisense RNA ohgonucleotide hybridizes to the mRNA in vivo and blocks translation of an 5 mRNA molecule into the human variant al subunit polypeptide. Antisense ohgonucleotides act with greater efficacy when modified to contain artificial internucleotide linkages which render the molecule resistant to nucleolytic cleavage. Such artificial internucleotide linkages include, but are not limited to, methylphosphate, phosphorothiolate and phosphoroamydate internucleotide linkages. o Research and drug discovery application: Antisense oligonucleotides also would be of value in determining al wild-type and V274T functions, and mechanisms of cytotoxicity in general. For example, one method of evaluating the contribution of α7V274T to cytotoxicity, cytoprotection, or other cellular processes would be to determine whether specific blockade of its synthesis blocks process. This differs in approach from the use of a receptor antagonist, 5 which may or may not block all effects of the protein. AdditionaUy, in drug discovery this approach could be useful in evaluating whether the effect of the drug is mediated by the α7V274T variant. A similar approach could be used to evaluate the contribution of other variants or the wild-type subunit itself. In control experiments, the corresponding al sense and missense ohgonucleotides 5'-CGAGCCCATGAGGTGTAGCC (SEQ ID NO: 10) and o 5'-CCAGGCATTCGGAGCTTGCC (SEQ ID NO: 1 1), respectively, are used. The missense oligonucleotide is a randomized sequence maintaining the proportion of GC content in the antisense oligonucleotide, and did not match known sequences in the GenBank database. Thus, polynucleotides that encode novel subunit and their antisense variants of the human α7 nAChR can be used in a variety of ways as detailed herein. Although preferred embodiments of the subject invention have been described in some detail, it is understood that obvious variations can be made without departing from the spirit and the scope of the invention as defined by the appended claims.

Claims

What is claimed is:
1 . A polynucleotide encoding a variant of a wild-type human al nicotinic acetylcholine receptor (nAChR) subunit, wherein the polynucleotide encodes a polypeptide having an amino acid substitution at position vahne-274 of the wild-type human al nAChR subunit polypeptide, and degenerate variants thereof.
2. The polynucleotide of Claim 1 , wherein the substitution is a threonine for valine-274.
3. A host cell comprising the polynucleotide of Claim 1.
4. The host cell of Claim 3, wherein said cell is selected from the group consisting of a bacterial cell, a mammalian cell, a yeast cell, an amphibian cell and a starfish cell.
5. An expression vector comprising the polynucleotide of Claim 1 operably linked to control sequences that direct the transcription of the polynucleotide whereby said polynucleotide is expressed in a host cell.
6. The expression vector of Claim 5, wherein the variant human al nAChR is human α5V274T nAChR.
7. A host cell comprising the expression vector of Claims 5 or 6.
. The host cell of Claim 7, wherein the cell is selected from the group consisting of a bacterial cell, a mammalian cell, a yeast cell and an amphibian cell.
9. An isolated and purified variant human al nicotinic acetylcholine receptor (nAChR) subunit, wherein the variant human al nAChR subunit comprises an amino acid substitution at position valine-274 of the wild-type human al nAChR polypeptide.
10. The variant human al receptor of Claim 9, wherein the substitution is a threonine for valine-274.
1 1. A method for identifying compounds that modulate nicotinic acetylcholine receptor (nAChR) activity, comprising:
(a) providing a cell that expresses a variant human al nAChR polypeptide having an amino acid substitution at position valine-274 of the wild-type human al nAChR polypeptide;
(b) mixing a test compound with the cell; and
(c) measuring either
(i) the effect of the test compound on the variant al receptor or the cell expressing said subunit, or
(ii) the binding of the test compound to the cell or the receptor.
12. A method for identifying a cytoprotective compound, comprising:
(a) providing a cell that expresses a variant human α7 subunit polypeptide or fragment thereof having an amino acid substitution at position valine-274 of the wild-type human al subunit polypeptide;
(b) combining a test compound with the cell; and
(c) monitoring the cell or cellular function for an indication of cytotoxicity.
13. A method of detecting target polynucleotides of human variant al subunit in a test sample, comprising:
(a) contacting a target polynucleotide of human variant al subunit with at least one human variant al subunit-specific polynucleotide probe or complement thereof; and
(b) detecting the presence of the target polynucleotide and probe complex in the test sample.
14. A purified polynucleotide or fragment thereof derived from human variant α7 subunit capable of selectively hybridizing to the nucleic acid of human variant al subunit wherein the sequence of said polynucleotide comprises SEQ ID NO:l or a portion thereof, said polynucleotide being produced by recombinant techniques.
15. A polypeptide encoded by human variant al subunit polynucleotide wherein the sequence of said polypeptide comprises SEQ ID NO:2 or a portion thereof, said polypeptide being produced by recombinant or synthetic techniques.
16. A monoclonal antibody which specifically binds to human variant al subunit having the amino acid sequence of SEQ ID NO:2 or a portion thereof.
PCT/US1997/023405 1996-12-20 1997-12-22 A variant human alpha-7 acetylcholine receptor subunit, and methods of production and use thereof Ceased WO1998028331A2 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP52893398A JP2001506135A (en) 1996-12-20 1997-12-22 Mutated human α7 acetylcholine receptor subunit, and method for producing and using the same
EP97954155A EP0946726A2 (en) 1996-12-20 1997-12-22 A variant human alpha-7 acetylcholine receptor subunit, and methods of production and use thereof
CA002275180A CA2275180A1 (en) 1996-12-20 1997-12-22 A variant human alpha-7 acetylcholine receptor subunit, and methods of production and use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US08/771,737 1996-12-20
US08/771,737 US6323000B2 (en) 1996-12-20 1996-12-20 Variant human α7 acetylcholine receptor subunit, and methods of production and uses thereof

Publications (2)

Publication Number Publication Date
WO1998028331A2 true WO1998028331A2 (en) 1998-07-02
WO1998028331A3 WO1998028331A3 (en) 1998-11-05

Family

ID=25092816

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1997/023405 Ceased WO1998028331A2 (en) 1996-12-20 1997-12-22 A variant human alpha-7 acetylcholine receptor subunit, and methods of production and use thereof

Country Status (5)

Country Link
US (2) US6323000B2 (en)
EP (1) EP0946726A2 (en)
JP (1) JP2001506135A (en)
CA (1) CA2275180A1 (en)
WO (1) WO1998028331A2 (en)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000073431A3 (en) * 1999-05-27 2001-05-03 Upjohn Co Methods and compositions for measuring ion channel conductance
WO2002014351A3 (en) * 2000-08-14 2003-08-14 Ortho Mcneil Pharm Inc α7 NICOTINIC RECEPTOR PEPTIDES AS LIGANDS FOR β AMYLOID P EPTIDES
US6693172B1 (en) 1999-05-27 2004-02-17 Pharmacia And Upjohn Company Double mutant alpha-7 nicotinic acetylcholine receptor
WO2004074245A3 (en) * 2003-02-14 2004-10-14 Memory Pharm Corp Monkey alpha-7 nicotinic acetylcholine receptor and methods of use thereof
US7358057B2 (en) 2002-05-09 2008-04-15 Memory Pharmaceuticals Corporation QM-7 and QT-6 cells transfected with mutant cell surface expressed channel receptors and assays using the transfected cells
US7696325B2 (en) 1999-03-10 2010-04-13 Chugai Seiyaku Kabushiki Kaisha Polypeptide inducing apoptosis
US8034903B2 (en) 2000-10-20 2011-10-11 Chugai Seiyaku Kabushiki Kaisha Degraded TPO agonist antibody
US9670269B2 (en) 2006-03-31 2017-06-06 Chugai Seiyaku Kabushiki Kaisha Methods of modifying antibodies for purification of bispecific antibodies
US9777066B2 (en) 2005-06-10 2017-10-03 Chugai Seiyaku Kabushiki Kaisha Pharmaceutical compositions containing sc(Fv)2
US10011858B2 (en) 2005-03-31 2018-07-03 Chugai Seiyaku Kabushiki Kaisha Methods for producing polypeptides by regulating polypeptide association
US11124576B2 (en) 2013-09-27 2021-09-21 Chungai Seiyaku Kabushiki Kaisha Method for producing polypeptide heteromultimer
US11649262B2 (en) 2015-12-28 2023-05-16 Chugai Seiyaku Kabushiki Kaisha Method for promoting efficiency of purification of Fc region-containing polypeptide

Families Citing this family (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040242847A1 (en) * 2000-10-20 2004-12-02 Naoshi Fukushima Degraded agonist antibody
AU2003271175A1 (en) * 2002-10-11 2004-05-04 Masahiro Abe Cell death-inducing agent
US7238715B2 (en) * 2002-12-06 2007-07-03 The Feinstein Institute For Medical Research Treatment of pancreatitis using alpha 7 receptor-binding cholinergic agonists
JP4750421B2 (en) * 2002-12-06 2011-08-17 ノース ショア−ロング アイランド ジュ−イッシュ リサ−チ インスティチュ−ト Inhibition of inflammation using α7 receptor binding cholinergic agonists
JP2004279086A (en) * 2003-03-13 2004-10-07 Konica Minolta Holdings Inc Radiation image conversion panel and method for manufacturing it
WO2004081048A1 (en) * 2003-03-13 2004-09-23 Chugai Seiyaku Kabushiki Kaisha Ligand having agonistic activity to mutated receptor
EP1609803A4 (en) * 2003-03-31 2006-05-24 Chugai Pharmaceutical Co Ltd MODIFIED ANTIBODY AGAINST CD22 AND ITS USE
JP4794301B2 (en) * 2003-06-11 2011-10-19 中外製薬株式会社 Antibody production method
US20070281327A1 (en) * 2003-12-12 2007-12-06 Kiyotaka Nakano Methods of Screening for Modified Antibodies With Agonistic Activities
TW200530269A (en) * 2003-12-12 2005-09-16 Chugai Pharmaceutical Co Ltd Anti-Mpl antibodies
US20070280951A1 (en) * 2003-12-12 2007-12-06 Naoki Kimura Cell Death Inducing Agents
US20050170360A1 (en) * 2004-01-30 2005-08-04 Papke Roger L. Variant neuronal nicotinic alpha-7 receptor and methods of use
EP1757686A4 (en) * 2004-04-09 2008-03-12 Chugai Pharmaceutical Co Ltd INDUCER OF CELL DEATH
JP5057967B2 (en) 2005-03-31 2012-10-24 中外製薬株式会社 sc (Fv) 2 structural isomer
US20090022687A1 (en) * 2005-05-18 2009-01-22 Chugai Seiyaku Kabushiki Kaisha Novel Pharmaceuticals That Use Anti-HLA Antibodies
JP5224580B2 (en) * 2005-06-10 2013-07-03 中外製薬株式会社 sc (Fv) 2 site-specific mutant
KR101367544B1 (en) * 2005-06-10 2014-02-26 추가이 세이야쿠 가부시키가이샤 Stabilizer for protein preparation comprising meglumine and use thereof
US7879913B2 (en) * 2005-06-28 2011-02-01 Catholic Healthcare West Iptakalim hydrochloride for decreasing nicotine use
US8316104B2 (en) 2005-11-15 2012-11-20 California Institute Of Technology Method and apparatus for collaborative system
WO2007145227A1 (en) * 2006-06-14 2007-12-21 Chugai Seiyaku Kabushiki Kaisha Hematopoietic stem cell proliferation promoter
US20100150927A1 (en) * 2006-07-13 2010-06-17 Chugai Seiyaku Kabushiki Kaisha Cell death inducer
CL2008000719A1 (en) * 2007-03-12 2008-09-05 Univ Tokushima Chugai Seiyaku THERAPEUTIC AGENT FOR CANCER RESISTANT TO CHEMOTHERAPEUTIC AGENTS THAT UNDERSTAND AN ANTIBODY THAT RECOGNIZES IT CLASS I AS ACTIVE INGREDIENT; PHARMACEUTICAL COMPOSITION THAT INCLUDES SUCH ANTIBODY; AND METHOD TO TREAT CANCER RESISTANT TO
EP2344636B1 (en) * 2008-10-09 2017-12-06 Howard Hughes Medical Institute Novel chimeric ligand-gated ion channels and methods of use thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991006648A1 (en) * 1989-10-27 1991-05-16 The Salk Institute For Biological Studies Glutamate receptor compositions and methods
DE69434067T2 (en) * 1993-03-08 2006-03-02 Merck & Co., Inc. HUMAN NEURONAL NICOTIN ACETYLCHOLINE RECEPTOR COMPOUNDS AND METHODS OF ITS USE

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7696325B2 (en) 1999-03-10 2010-04-13 Chugai Seiyaku Kabushiki Kaisha Polypeptide inducing apoptosis
US6693172B1 (en) 1999-05-27 2004-02-17 Pharmacia And Upjohn Company Double mutant alpha-7 nicotinic acetylcholine receptor
WO2000073431A3 (en) * 1999-05-27 2001-05-03 Upjohn Co Methods and compositions for measuring ion channel conductance
US7247706B2 (en) 1999-05-27 2007-07-24 Pharmacia & Upjohn Company Double mutant alpha-7 nicotinic acetylcholine receptors
WO2002014351A3 (en) * 2000-08-14 2003-08-14 Ortho Mcneil Pharm Inc α7 NICOTINIC RECEPTOR PEPTIDES AS LIGANDS FOR β AMYLOID P EPTIDES
US8586039B2 (en) 2000-10-20 2013-11-19 Chugai Seiyaku Kabushiki Kaisha Degraded TPO agonist antibody
US8034903B2 (en) 2000-10-20 2011-10-11 Chugai Seiyaku Kabushiki Kaisha Degraded TPO agonist antibody
US7358057B2 (en) 2002-05-09 2008-04-15 Memory Pharmaceuticals Corporation QM-7 and QT-6 cells transfected with mutant cell surface expressed channel receptors and assays using the transfected cells
WO2004074245A3 (en) * 2003-02-14 2004-10-14 Memory Pharm Corp Monkey alpha-7 nicotinic acetylcholine receptor and methods of use thereof
US10011858B2 (en) 2005-03-31 2018-07-03 Chugai Seiyaku Kabushiki Kaisha Methods for producing polypeptides by regulating polypeptide association
US11168344B2 (en) 2005-03-31 2021-11-09 Chugai Seiyaku Kabushiki Kaisha Methods for producing polypeptides by regulating polypeptide association
US9777066B2 (en) 2005-06-10 2017-10-03 Chugai Seiyaku Kabushiki Kaisha Pharmaceutical compositions containing sc(Fv)2
US9670269B2 (en) 2006-03-31 2017-06-06 Chugai Seiyaku Kabushiki Kaisha Methods of modifying antibodies for purification of bispecific antibodies
US10934344B2 (en) 2006-03-31 2021-03-02 Chugai Seiyaku Kabushiki Kaisha Methods of modifying antibodies for purification of bispecific antibodies
US11124576B2 (en) 2013-09-27 2021-09-21 Chungai Seiyaku Kabushiki Kaisha Method for producing polypeptide heteromultimer
US11649262B2 (en) 2015-12-28 2023-05-16 Chugai Seiyaku Kabushiki Kaisha Method for promoting efficiency of purification of Fc region-containing polypeptide

Also Published As

Publication number Publication date
US6323000B2 (en) 2001-11-27
US6683157B2 (en) 2004-01-27
US20010006796A1 (en) 2001-07-05
WO1998028331A3 (en) 1998-11-05
EP0946726A2 (en) 1999-10-06
CA2275180A1 (en) 1998-07-02
JP2001506135A (en) 2001-05-15
US20030073161A1 (en) 2003-04-17

Similar Documents

Publication Publication Date Title
US6683157B2 (en) Variant human α7 acetylcholine receptor subunit, and methods of production and use thereof
US5910582A (en) Human neuronal nicotinic acetylcholine receptor compositions and methods employing same
US6100046A (en) Methods of identifying modulators of alpha9, a novel acetylcholine-gated ion channel receptor subunit
WO1994028131A1 (en) Dna encoding inward rectifier, g-protein activated, mammalian, potassium kga channel and uses thereof
Werkman et al. Charybdotoxin, dendrotoxin and mast cell degranulating peptide block the voltage-activated K+ current of fibroblast cells stably transfected with NGK1 (Kvl. 2) K+ channel complementary DNA
AU704927B2 (en) Human neuronal nicotinic acetylcholine receptor compositions and methods employing same
US6096513A (en) Polynucleotides encoding KAPPA opiod receptors
US6391561B1 (en) Protein that enhances expression of potassium channels on cell surfaces and nucleic acids that encode the same
US6130058A (en) Human NMDA R2A receptor subunit and isoforms of the human NMDA-R1 receptor subunit and encoding cDNAs
US7229779B2 (en) Variant human α7 acetylcholine receptor subunit, and methods of production and use thereof
US6242216B1 (en) Nucleic acids encoding a functional human purinoreceptor P2X2 and P2X4, and methods of production and use thereof
US6214581B1 (en) Nucleic acids encoding a functional human purinoreceptor P2X3 and P2X6, and methods of production and use thereof
WO1999055901A2 (en) Screening assay for identifying human purinoreceptor ligands
EP1268545B1 (en) Potassium channel protein kcnq5, a target for diseases of central nervous system and cardiovascular system
MXPA99005856A (en) A variant human alpha-7 acetylcholine receptor subunit, and methods of production and use thereof
US7563595B2 (en) Nucleic acids encoding functional splice variants of the α7 nicotinic acetylcholine receptor subunit and methods for producing the encoded proteins
US20050170360A1 (en) Variant neuronal nicotinic alpha-7 receptor and methods of use
Vazquez et al. Identification of a new amino acid residue capable of modulating agonist efficacy at the homomeric nicotinic acetylcholine receptor, α7
CA2339871A1 (en) Nucleic acids encoding a functional human purinoreceptor p2x2 and methods of producing and use thereof
WO1999036539A1 (en) Nucleic acids encoding a functional human purinoreceptor p2x3 and methods of production and use thereof
WO1999011784A1 (en) Proton gated ion channel proteins
WO2004009775A2 (en) Methods and compositions relating to chimeric nicotinic receptor subunits
Cohen Allosteric regulation of adenosine receptors
MXPA00006974A (en) Nucleic acids encoding a functional human purinoreceptor p2x3
MXPA01001855A (en) Nucleic acids encoding a functional human purinoreceptor p2x2

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): CA JP MX

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref document number: 2275180

Country of ref document: CA

Ref country code: CA

Ref document number: 2275180

Kind code of ref document: A

Format of ref document f/p: F

ENP Entry into the national phase

Ref country code: JP

Ref document number: 1998 528933

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: PA/a/1999/005856

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 1997954155

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1997954155

Country of ref document: EP