MXPA99005856A - A variant human alpha-7 acetylcholine receptor subunit, and methods of production and use thereof - Google Patents

Abstract

A varianthuman&agr;7 nicotinic acetylcholine receptor (nAChR) polypeptide is provided wherein the variant contains an amino acid substitution at the valine-274 position of the wild-type human&agr;7 nAChR. Nucleic acid molecules encoding the variant human&agr;7 nAChR, vectors and host cells containing such nucleic acid molecules are also provided. In addition, methods are provided for producing the variant as are methods of using such variants for screening compounds for activity at the nAChR.

Description

ONE YOUR BUNI DAD OF ACETILCOLIN RECEPTOR ALFA-7 HUMANA VARIANT AND METHODS OF PRODUCTION AND USE OF THE SAME TECHNICAL FIELD The invention relates generally to receptor proteins and to DNA and RNA molecules that encode them. In particular, the inention refers to a subunit a7 human vairante, in which there is a substitution of the position 274 of valine of the human a7 subunit of wild type. The invention also relates to DNA and RNA molecules encoding the variant human a7 subunit, as well as methods for using the variant subunit to identify compounds that interact with it.

BACKGROUND OF THE INVENTION These antecedents consider the subunit to be as it relates to the nicotinic acetylcholine receptor (nAChR). The nAChR is comprised of transmembrane polypeptide subunits that form a selective ion channel-cation regulated by acetylcholine (ACh) and other ligands. It is believed that the hydrophobic transmembrane region M2 ("TM-2") of each subunit forms the wall of the ion channel. Two of the most prominent nAChRs in the brain are those that contain a4 subunits and those that contain a7 subunits (Sargent (1993) Annu Rev. Neurosci 16: 403-443; Court et al. (1995) Alzheimer Disease and Associated Disorders 9: 6-14). Mutations of subunits a4 and a7 may be the reason for some diseases of the nervous system. For example, mutations of the a4 unit have been associated with some forms of epilepsy (Beck et al. (1 994) Neurobiol Disease 1: 95-99; Steinlein et al (1995) Nature Genetics 1 1: 201 -203) . Additionally, nAChR containing a7 may be involved in sensory processing related to schizophrenia (Freedman et al. (1995) Biol. Psych. 38: 22-33; Rollins et al. (1995) Schizophr Res. 15: 183 Stevens et al. (1995) Psychopharmacol.1 19: 163-170), cytoprotection (Donnelly-roberts et al. (1 996) Brain Res. 719: 36-44; Akaike et al. (1 994) Brain Res. 644: 1 81-187; Martin et al. (1994) Drug Dev. Res. 31: 135-141; Quik et al. (1994) Brain Res. 655: 161-167), and neurite growth and innervation (Chan e., (1993) Neurosci 56: 441 -451; Pugh et al. (1 994) J. Neurosci 14: 889-896; Freeman (1977) Nature 269: 21 8-222; Broide et al. (1995) ) Neurosci 67: 83-94). A splice variant involving the TM-2 region of subunit a.7 has been detected in bovine chromaffin cells (García-Guzmán et al. (1995) Eur. J. Neurosci. 7: 647-655), and a naturally occurring mutation of a protein homologous to the a7 subunit found in Caenorhabditis elegans leads to neurodegeneration (Treinin et al. (1 995) neuron 1 7: 871-877). The latter is a simple amino acid mutation in the TM-2 region similar to the mutation of a7 valine-251 to chicken threonine ("c-a7V251 T"), one of several mutations artificially introduced into chicken subunit a7 for facilitate the study of the structure of nAChR a7 and the function of the subunit (Bertrand et al. (1995) Sem. Neurosci. 7: 75-90).

Compared with the chicken-type a7 nAChR of chicken ("c-a7WT"), c-a7V251 T (also referred to as a7-4) retained a high calcium permeability but was slowly desensitized, and was 1 80 times more sensitive to ACh . In addition, the nAChR of c-a7V251 T responded to dihydro-ß-erythroidine ("DHßE"), typically a nAChR antagonist in a7 and another wild-type nAChR, as if it were an agonist (Galzi et al. (1992) Nature 359: 500-505; Bertrand et al. (1993) Proc. Natl. Acad. Sci. USA 90: 6071-6975). These studies have led to a model that delineates the structure of the TM-2 pore-coating region, and the hypothesis that specific mutations within the TM-2 region can generate ion channels regulated by ligands that conduct current in the receptor-desensitized state in addition to the normal receptor-activated state (Bertrand et al. (1995) supra; Bertrand et al. (1 992) Proc. Natl. Acad. Sci. USA 89: 1261 -1265; Galzi et al. (1995) Neuropharmacol. 34: 563-582). Although the chicken aAChR a7 is pharmacologically similar to the mammalian a7 nAChR, there are significant differences. For example, 1, 1 -dimethyl-4-phenylpiperazinium ("DMPP") is a very weak partial agonist in the chicken nAChR a7, but it is a highly effective agonist in human a7 nAChR (Peng et al. (1994) Mol Pharmacol 45: 546-554). Despite these differences, it would be expected that changes in amino acids in the human aAChR a7 that are analogous to those in chicken aAC nRaR7, particularly in critical TM-2 amino acids, would result in similar pharmacological and electrophysiological changes.BRIEF DESCRIPTION OF THE INVENTION The present invention relates to a variant human subunit a.7, in which the valine-274 has been changed in analogy with the corresponding chicken receptor variant. This variant is analogous to the chicken variant a7V251 T with respect to the relative position of the amino acid substitution in the TM-2 region. However, the variant human a7 subunit unexpectedly exhibits different pharmacological and electrophysiological characteristics. The α subunit combines with itself and can be combined with other subunits to create several nicotinic acetylcholine receptors.

The possibility of combining still with other proteins, which may or may not be identified as components of other classes of receptor, is not necessarily excluded. According to this, in one embodiment, a DNA molecule is provided, wherein the DNA molecule encodes a variant human a7 subunit, in which the valine-274 has been replaced. In another embodiment, a recombinant vector comprising such a DNA molecule is provided. In another embodiment, the present invention is directed to a variant of human a7 subunit, in which valine-274 has been replaced. In still other embodiments, the invention is directed to messenger RNA encoded by the DNA, recombinant host cells transformed or transfected with vectors comprising the DNA or fragments thereof, and methods for producing recombinant polypeptides for the treatment of neurodegenerative processes, enzymatic function, affective disorders and immunofunction, using such cells. In another embodiment, compounds are provided such as antagonists, as well as antisense polynucleotides, which are useful for treating conditions, such as neurodegenerative processes, enzymatic dysfunction, affective disorders and immunofunction. Methods for treating individuals using these antisense polynucleotides and compounds are also provided. In yet another embodiment, methods and reagents are provided to detect variant a7. In still another embodiment, the invention is directed to a method for expressing the human a7 subunit variant in a cell, to produce the resulting variant a7. In a further embodiment, the invention is directed to a method for identifying compounds that modulate the subunit or receptors that contain the subunit and to a method for identifying cytoprotective compounds using such cells. These and other embodiments of the present invention will readily occur to those of ordinary skill in the art in view of the description herein.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the strategy for generating mutant human AchR a7V274T DNA using a polymerase chain reaction.

Figures 2A-2C show the nucleotide sequence (SEQ I D NO: 1) of the human a7 cDNA containing the V274T mutation. The threonine mutation is shown in bold and the EcoRV and Kpnl restriction sites are underlined. Also shown is the deduced amino acid sequence (SEQ I D NO: 2) of the human a7V274T subunit variant derived from the cDNA. The V274T alteration is underlined. Figure 3 graphically compares the concentration-response relationships for ACh (diamonds), (-) - nicotine (circles), GTS-21 (triangles pointing upwards) and ABT-089 (triangles pointing downwards) in nAChR a7V274T human (symbols fillings) and nAChR to the natural type (hollow symbols) expressed in Xenopus oocytes. Figure 4 graphically shows activation by ACh and rate of deterioration of the human a7V274-T response compared to that of the human a7WT nAChR. Figure 5 graphically shows the responses of human a7V274T to nAChR antagonists, wherein MEC is mecamylamine (10O M), MLA is methillicaconitin (10O nM), and DHßE is dihydro-β-erythroidin (10O M). The agosista-0 control was a bath solution without medication and was applied for 20 seconds. Small agonist-0 control responses were measured in each human a7V274T oocyte and subtracted from agonist responses when the data were tabulated. Figure 6 graphically shows the current versus the voltage ratio of responses to ACh 1 0 μM of the human a7V274T expressed in Xenopus laevis oocytes, wherein the circles represent the responses measured in a modified Barth solution containing 10 mM Ba2 + (90 mM NaCl, 1 mM KCl, 0.66 mM NaNO3, 10 mM BaCl2, 2.4 mM NaHCO3, 2.5 mM sodium pyruvate, and Na- buffer). 1 mM HEPES, final pH 7.55) to prevent the activation of Ca2 + -dependent secondary responses (see Briggs et al (1 995) Neuropharmacol 34: 583-590) and the triangles represent the responses measured in "OR2" solution with atropine (82.5 mM NaCl, 2.5 mM KCl, 2.5 mM CaCl2, 1 mM MgCl2, 0.5 M Atropine and 5 mM Na-HEPES buffer, final pH 7.4), to replicate the conditions of Galzi et al. (1 992) Nature 359: 500-505. Figure 7 graphically shows the specific ligation of [125l] a-Bungarotoxin, a selective ligand of nAChR a7, to a HEK-293 clone transfected with variant human a7V274T.

DETAILED DESCRIPTION OF THE INVENTION The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, recombinant DNA technology, electrophysiology and pharmacology, which are within the skill of The technique. Such techniques are fully explained in the literature. See, for example, Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition (1989); DNA Cloning, Vols. I and I I (D. N. Glover ed. 1 985); Perbal, B., A Practical Guide to Molecular Cloning (1984); the series, Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.); Transcription and Translation (Hames et al., Eds.1984); Gene Transfer Vectors for Mammalian Cells (JM Miller et al., (1987) Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.); Scopes, Protein Purification: Principles and Practice (2nd ed., Springer-Verlag); and PCR: A Practical Approach (McPherson et al., eds. (1 991) I RL Press). All patents, patent applications and publications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety. As used in this specification and the appended claims, the singular forms "a", "an", "the" and "the" include plural references, unless the content clearly dictates otherwise. Thus, for example, the reference to "an amplification primer" includes two or more such primers, the reference to "a receptor subunit" includes more than one such subunit, and the like.

A. Definitions The following terms will be used to describe the present invention, and are intended to be defined as indicated below.

The term "AChR" is intended to be a receptor for the neurotransmitter acetylcholine ("ACh"). AchRs are broadly subclassified as nicotinic or muscarinic. These types differ in their pharmacology, structures and mechanisms of signal transduction. The term "nAChR" is intended to be a nicotinic acetylcholine receptor. Although the nAChRs of several subunit structures are better known in muscle cells, neurons, and chromaffin cells, they are not necessarily excluded from other cell types (eg, gual cells, post cells, blood cells, fibroblasts, etc.). .

The term "nAChR subunit" is intended to be a proteinaceous molecule, which may combine with other such molecules in the formation of a nAChR. For example, it is believed that muscle nAChR is a pentamer comprised of four types of transmembrane subunit: two a1 subunits, a β1 subunit, a subunit d and a subunit? or e, depending on the form nAChR. It is also thought that the neuronal nAChR is analogously pentameric and comprised of different but related subunits. Currently, eight neuronal subunits (a2-a9) and three neuronal β (ß2-ß4) subunits have been isolated. A neuronal nAChR appears to require at least one subunit and at least one β subunit for a functional complex (ie, ion channel response to ACh or other agonists). However, some subunits can self-assemble to form "homooligomeric" nAChR, as in the case of nAChR a7 in Xenopus oocytes and in transfected mammalian cells. Although the combination of nAChR subunits with subunits related to another type of receptor has not been demonstrated (eg, other ligand-regulated cyan sequences), it is within the scope of the present invention that such combinations are possible. The term "natural type" (abbreviated "WT") is intended to be the typical, usual or more common form as occurs in nature. The nAChR a7 human natural type as used herein was described in Doucette-Stamm et al. (1 993) Drug Dev. Res. 30: 252-256. An abbreviation of the form "a7XnnnO" is intended to be a subunit a7, in which amino acid X, located in position nnn in relation to the natural type sequence, has been replaced by amino acid O. Thus, chicken nAChR a7V251 T indicates chicken aAChR a7, in which the valine located at position 251 in the wild type receptor has been replaced by a threonine. A "nicotinic cholinergic agonist" is a compound that binds to, and activates, a nicotinic acetylcholine receptor. By "active" is intended the extraction of one or more pharmacological, physiological or electrophysiological responses. Such a response includes, but is not limited to, cell membrane depolarization and increased permeability to Ca2 + and other cations. A "nicotinic cholinergic antagonist" is a substance that binds to a nicotinic acetylcholine receptor and prevents agonists from activating the receptor. Pure antagonists do not activate the receptor, but some substances may have mixed agonist and antagonist properties. Nicotinic cholinergic channel blockers block the ability of agonists to withdraw current flow through the nicotinic acetylcholine receptor channel, but they do so by blocking the channel rather than preventing agonists from joining and activating the receptor. A "nicotinic cholinergic modulator" is a substance that influences the activity of the nicotinic acetylcholine receptor through interaction at one or more sites different from the classical agonist binding site. The modulator can increase or decrease the activity of the receptor by itself, or it can influence the activity of the agonist (for example, enhance responses) without itself extracting an open channel in the channel current. A simple substance may have different properties in different nicotinic acetylcholine receptor subtypes, for example, being an agonist in one receptor and an antagonist in another, or an antagonist in one and a channel blocker in another. By "nAChR regulator" is intended a substance that can act as an agonist, antagonist, channel blocker or modulator. The term "polynucleotide" as used herein means a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. In this way, the term includes single and double filament DNA, as well as a single and double stranded RNA. It also includes modifications, such as methylation and / or capping, and unmodified forms of the polynucleotide. The term "variant" is used to refer to an oligonucleotide sequence, which differs from the related wild-type sequence in one or more nucleotides. Such variant oligonucleotide is expressed as a variant of protein, which, as used herein, denotes a polypeptide sequence that differs from the wild-type polypeptide in the substitution, insertion or deletion of one or more amino acids. The variant polypeptide differs in primary structure (amino acid sequence), but may or may not differ significantly in secondary or tertiary structure or in function with respect to the wild type. The term "mutant" generally refers to an organism or a cell that exhibits a new genetic character or phenotype as the result of change in its gene or chromosome. However, in some cases, "mutant" can be used in reference to a variant protein or oligonucleotide and "mutation" can refer to the implicit change of the variant. "Polypeptide" and "protein" are used interchangeably herein and denote a molecular chain of amino acids linked through peptide ligations. The terms do not refer to a specific length of the product. In this way, peptides, oligopeptides and proteins are included within the definition of polypeptide. The terms include post-translational modifications of the polypeptide, for example, glycosylations, acetylations, phosphorylations and the like. In addition, fragments of proteins, analogues are included, proteins with mutation or variants, fusion proteins and the like within the meaning of polypeptide. A "functionally conservative mutation" as used herein, is intended to be a change in a polynucleotide that encodes a derived polypeptide, in which the activity is not substantially altered compared to that of the polypeptide from which the derivative is made. Such derivatives can have, for example, insertions, deletions or substitutions of amino acids in the relevant molecule that do not substantially affect their properties. For example, the derivative may include conservative amino acid substitutions, such as substitutions that retain the general charge, hydrophobicity / hydrophilicity, side chain portion, and / or stearic volume of the substituted amino acid, eg, Gly / Ala, Val / Ile / Leu, Asp / Glu, Lys / Arg, Asn / Gln, Thr / Ser and Phe / Trp / Tyr.

By the term "structurally conservative mutant" is meant a polynucleotide containing changes in the nucleic acid sequence, but encoding a polypeptide having the same amino acid sequence as the polypeptide encoded by the polynucleotide, from which the variant is derived degenerate. This can occur because a specific amino acid can be encoded by more than one "codon", or sequence of three nucleotides, within the polynucleotide. "Recombinant host cells", "host cells", "cells", "cell lines", "cell cultures", and other such terms denoting microorganisms or higher eukaryotic cell lines grown as unicellular entities, refer to cells which may be, or have been, used as receptors for recombinant vectors or other transfer, immaterial DNA of the method by which the DNA is introduced into the cell or the subsequent disposition of the cell. The terms include the progeny of the original cell, which has been transfected. Cells in primary culture, as well as cells such as oocytes, can also be used as receptors. A "vector" is a replicon, in which another segment of polynucleotide is attached, such as to cause replication and / or expression of the attached segment. The term includes expression vectors, cloning vectors, and the like. A "coding sequence" is a polynucleotide sequence that is transcribed into mRNA and / or translated into a polypeptide. The limits of the coding sequence are determined by a translation initiation codon at the 5 'end and a translation stop codon at the 3' end. A coding sequence can include, but is not limited to, mRNA, cDNA, and recombinant polynucleotide sequences. Variants or analogs can be prepared by deleting a portion of the coding sequence, by inserting a sequence, and / or by substituting one or more nucleotides within the sequence. Techniques for modifying nucleotide sequences, such as site directed mutagenesis, are well known to those skilled in the art. See, for example, Sambrook et al., Supra; DNA Cloning, Vols. I and I I, supra; Nucleic Acid Hybridization, supra. "Operably linked" refers to a situation where the described components are in a relationship that allows them to function in their intended manner. Thus, for example, a control sequence "operably linked" to a coding sequence is linked in such a manner that expression of the coding sequence is achieved under conditions compatible with the control sequences. A coding sequence can be operably linked to control sequences that direct the transcription of the polynucleotide, whereby said polynucleotide is expressed in a host cell. The term "transfection" refers to the insertion of an exogenous polynucleotide into a host cell, irrespective of the method used for insertion, or the molecular form of the polynucleotide that is inserted. Included are the insertion of a polynucleotide per se and the insertion of a plasmid or vector comprised of the exogenous polynucleotide. The exogenous polynucleotide can be transcribed and translated directly by the cell, maintained as a non-integrated vector, eg, a plasmid, or alternatively, they can be stably integrated into the host genome. "Transfection" is used generally in reference to a eukaryotic cell, while the term "transformation" is used to refer to the insertion of a polynucleotide into a prokaryotic cell. "Transformation" of a eukaryotic cell can also refer to the formation of a cancerous or tumorigenic state. The term "isolated" when referring to a polynucleotide or a polypeptide, intends that the indicated molecule be present in the substantial absence of other similar biological macromolecules. The term "isolated" as used herein means that at least 75% by weight, more preferably 85% by weight, still more preferably at least 95% by weight and most preferably at least 98% by weight of a composition is the polypeptide or polynucleotide isolated. A "isolated polynucleotide" that encodes a particular polypeptide refers to a polynucleotide that is substantially free of other nucleic acid molecules, which does not encode the target polypeptide; however, the molecule can include functionally and / or structurally conservative mutations, as defined herein. The following abbreviations of a single letter of amino acids are used throughout the text: Alanine A Arginine R Asparagine N Aspartic acid D Cysteine C Glutamine Q Glutamic acid E Glycine G Histidine H Isoleucine 1 Leucine L Lysine K Methionine M Phenylalanine F Proline P Se S Threonine T Tryptophan w Tyrosine and Valine V B. General Methods A human variant subunit, a polynucleotide encoding the vairant subunit, and methods for making the variant subunit are provided herein. The invention not only includes the variant subunit but also methods for classifying compounds that use the variant subunit, cells that express the variant subunit. In a preferred embodiment, the polynucleotide encodes a variant of human a7 subunit, in which the valine-274 of the wild type a7 subunit has been replaced. Preferably, the polynucleotide encodes a human a7 subunit, in which valine-274 has been replaced by a threonine, or a conservative substitution by threonine, for example, se. The nAChR variant to human exhibits both similar and unexpectedly different properties relative to other structurally related nAChRs. For example, as with chicken variant a7V251 T, a7V274T, responses to cholinergic agonists decay slowly compared to nAChR a7 human wild type responses.

In addition, human cc7V274T is approximately two orders of magnitude more sensitive to cholinergic receptor agonists, such as nicotine and ACh compared to the wild type. The chicken and human receptor variants differ pharmacologically, for example, in that human a7V274T is weakly activated by dihydro-β-erythroid (DHßE), while chicken a7V251 T is strongly activated (Figure 5 and Galzi et al. 1 992). Mutations in the channel domain of a neuronal nicotinic receptor convert ion selectivity from cationic to anionic (Mutations in the channel domain of a neuronal nicotinic receptor convert the selectivity of cationic to anionic ones) Nature 359: 500-505). In addition, -tubocurarine is a potent antagonist of human a7V274T to an activator of mutant related chicken a7L247T (Bertrand et al., 1992) Unconventional pharmacology of a neuronal nicotinic receptor mutated in the channel domain. a neuronal nicotinic receptor with mutation in the channel domain) Proc. Natl. Acad. Sci. (USA) 89: 1261 -1265). The human and chicken receptor variants are also electrophysiologically different. For example, chicken nAChR a7V251 T does not exhibit inward current rectification (Galzi et al. (1992), unlike nAChR a7 wild-type chicken and human, which exhibit strong inward rectification (Galzi et al. al. (1992), supra, and Briggs et al. (1995) Neuropharmacol., 34: 583-590.) The human a7V274T nAChR, in contrast to chicken nAChR a7V251 T, rectifies above 0 mV similarly to the receptor of natural type (Figure 6).

The DNA encoding the human variant nAChR a7 subunit can be ded from cDNA or genomic, prepared by synthesis, or by a combination of techniques. The DNA can then be used to express the subunit of nAChR a7 human variant or as a template for the preparation of RNA using methods well known in the art (see, Sambrook et al., Supra). One method for obtaining the desired DNA involves isolating cDNA encoding the subunit of wild type human a7 nAChR, as described by Doucette-Stamm et al. (1 993), supra. The wild-type cDNA thus obtained is then modified and amplified using the polymerase chain reaction ("PCR") and primer sequences with mutation to obtain the DNA encoding the human variant nAChR a7 subunit. More particularly, PCR employs short oligonucleotide primers (generally 1 0-20 nucleotides in length) that equalize opposite ends of a desired sequence within the wild-type DNA molecule. The sequence between the initiators does not need to be known. The initial template can be RNA or DNA. If RNA is used, it is first transcribed in reverse to cDNA. The cDNA is then denatured, using well-known techniques, such as heat, and appropriate oligonucleotide primers are added in molar excess. The primers carrying the mutation will hybridize to the wild-type polynucleotide at a temperature slightly below that of the wild-type double initiator-polynucleotide. The initiator can be made specific by keeping the length and base composition of the initiator within relatively narrow limits, and by keeping the mutant base or bases centrally located (Zoler et al. (1 983) Meth. Enzymol 1: 468 ). The extension of the primer is carried out using DNA polymerase in the presence of deoxynucleotide triphosphate or nucleotide analogues. The resulting product includes the respective primers at their 5 'ends, covalently linked to the newly synthesized complements of the original filaments. The replicated molecule is again denatured, hybridized with primers, and so on, until the product is sufficiently amplified. Such PCR methods are described, for example, in U.S. Patent Nos. 4,965, 1 88; 4, 800; 1 59; 4,683,202; 4,683, 1 95; incorporated herein by reference in its entirety. The PCR product is cloned and the clones containing the mutated DNA are derived by segregation of the extended filament from the primer and selected. The selection can be achieved using the mutant primer as a hybridization probe. Alternatively, wild type DNA can be obtained from an appropriate DNA library. DNA libraries can be probed using the procedure described by Grunstein et al. (1975) Proc. Natl. Acad. Sci. USA 73: 3961. Alternatively, the variant a7V274T could be generated using an RT-PCR approach (polymerase-reverse transcriptase chain reaction) starting with human RNA. For example, single-stranded cDNA is synthesized from human RNA (approximately 1.5 g) as the template using standard reverse transcriptase procedures. Next, the cDNA is amplified in two segments and the mutation is introduced using PCR and two pairs of primers. The internal primers are designed to carry the threonine codon (T) or other desired change, instead of the natural type valine (V) at position 274 (see also Example 1 and Figure 1). The products of the two PCR reactions are combined using the 3 and 5 end primers to re-amplify the full-length coding sequence of a7V274T. This is just one example of the generation of a7V274T from a human brain template. Synthetic oligonucleotides can be prepared using an automated oligonucleotide synthesizer, such as that described by Warner (1984) DNA 3: 401. If desired, the synthetic filaments can be labeled with 32 P by treatment with polynucleotide kinase in the presence of 32 P-ATP, using standard conditions for the reaction. DNA sequences including those isolated from cDNA or genomic libraries can be modified by known methods, which include site-directed mutagenesis, as described by Zoller (1982) Nucleic Acids Res. 10: 6487. Briefly, DNA a to be modified is packaged into a phage as a single filament sequence, and converted to a double-stranded DNA with DNA polymerase using, as an initiator, a synthetic oligonucleotide complementary to the portion of the DNA to be modified, and having the desired modification included in its own sequence. The culture of the transformed bacteria, which contain replications of each phage filmaneto, is platinized in agar to obtain plates. Theoretically, 50% of the new plates contain phage having the sequence with mutation, and the remaining 50% has the original sequence. The replicas of the plates are hybridized to a labeled synthetic probe at temperatures and conditions suitable for hybridization with the correct filament, but not with the unmodified sequence. The sequences that have been identified by hybridization are recovered and cloned. Alternatively, it may be necessary to identify clones by sequence analysis if there is difficulty in distinguishing the small difference of wild-type variant by hybridization. In any case, the DNA would be confirmed by sequence. Once produced, the DNA can then be incorporated into a cloning vector or an expression vector for replication in a suitable host cell. The construction of the vector employs methods known in the art. Generally, site-specific DNA cleavage is performed by treating with suitable restriction enzymes under conditions, which are generally specified by the manufacturer of these commercially available enzymes. After incubation with the restriction enzyme, the protein is removed by extraction and the DNA is recovered by precipitation. The cut fragments can be separated using, for example, agarose or polyacrylamide gel electrophoresis methods, according to methods known to those skilled in the art. The sticky end cut fragments can be terminated without tip using E. coli DNA polymerase 1 (Kienow) in the presence of the appropriate deoxynucleotide triphosphates (dNTPs) present in the mixture. The treatment with nuclesas S1 can also be used, resulting in the hydrolysis of any portion of single strand DNA.

The joints are made using standard temperature and buffer conditions using DNA ligase T4 and ATP. Alternatively, restriction enzyme digestion of unwanted fragments can be used to prevent binding. Standard vector constructs generally include specific antibiotic resistance elements. The ligation mixtures are transformed into a suitable host, and the successful transformants are selected by antibiotic resistance or other markers. The plasmids for the transformants can then be prepared according to methods known to those in the art, usually following an amplification of chloramphenicol as reported by Clewell et al. (1972) J. Bacteriol. 1 1 0: 667 can be added. The DNA is isolated and analyzed generally by restriction enzyme analysis and / or sequencing. Sequencing may be by the well-known dideoxy method of Sanger et al. (1 977) Proc. Natl. Acad. Sci. USA 74: 5463) as further described by Messing et al. (1 981) Nucleic Acid Res. 9: 309, or by the method reported by Maxam et al. (1980) Meth. Enzymol. 65: 499. Problems with band compression, which are sometimes observed in regions rich in GC, are overcome by the use of, for example, T-desazoguanosine or inosine, according to the method reported by Barr et al. (1986) Biotechniques 4: 428.

The host cells are genetically engineered with the vectors of this invention, which may be a cloning vector or an expression vector. The vector can be in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate to activate promoters, select transformants / transfectants or amplify the polynucleotide encoding a subunit. The culture conditions, such as temperature, pH and the like, are generally similar to those previously used with the host cell selected for expression, and will be apparent to those of skill in the art. Both prokaryotic and eukaryotic host cells can be used for expression of the desired coding sequences, when the appropriate control sequences that are compatible with the designated host are used. For example, among prokaryotic hosts, Escherichia coli is frequently used. In addition, for example, expression control sequences for prokaryotes include, but are not limited to, promoters, optionally containing operator portions, and ribosome binding sites. Transfer vectors compatible with prokaryotic hosts can be derived from, for example, plasmid pBR322 which contains operon-conferring ampicillin and tetracycline resistance. And the various vectors of pUC, which also contain sequences that confer markers of antibiotic resistance. These markers can be used to obtain successful transformants by selection. Commonly used prokaryotic control sequences include, but are not limited to, a lactose operon system (Chang et al. (1977) Nature 1 98: 1056), the tryptophan operon system (reported by Goeddel et al. (1980) Nucleic Acid Res. 8: 4057) and the lambda-derived P1 promoter and the ribosome binding site of gene N (Shimatake et al. (1981) Nature 292: 128) and the hybrid Tac promoter (De Boer e., (1 983) Proc. Natl. Acad. Sci. USA 292: 128) derived sequences from the UV5 promoters trp and lac. The above systems are particularly compatible with E. coli; however, other prokaryotic hosts, such as Bacillus or Pseudomonas strains can be used if desired. Eukaryotic hosts include yeast and mammalian cells in culture systems. Pichia pastoris, Saccharomyces cerevisiae and S. carlsbergensis are commonly used yeast hosts. The compatible vectors carry markers that allow the selection of successful transformants by conferring protofia to auxotrophic mutants or resistance to heavy metals in wild-type strains. Compatible vectors of yeast can employ the 2-μ origin of replication (Broach et al (1 983) Meth. Enzymol 101: 307), the combination of CEN3 and ARS 1 or other means to ensure replication, such as, sequences that will result in the incorporation of an appropriate fragment into the genome of the host cell. Control sequences for yeast vectors are known in the art and include, but are not limited to, promoters for the synthesis of glycolytic enzymes, including the promoter for 3-phosphoglycerate kinase. See, for example, Hess went to. (1 968) J. Adv. Enzyme Reg. 7: 149, Holland went to. (1 978) Biochemistry 17: 4900 and Hitzeman (1980) J. Biol. Chem. 255: 2073. For example, some useful control systems are those comprising the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter or adjustable alcohol dehydrogenase (ADH) promoter, terminators also derived from GAPDH, and, if desired secretion, leader factor sequences yeast alpha In addition, the transcriptional regulatory region and the transcription initiation region, which are operably linked, may be such that they do not naturally associate in the wild-type organism. Mammalian cell lines available as a host for expression are known in the art and are available from reservoirs such as, American Type Culture Collection. These include, but are not limited to, HeLa cells, human embryonic kidney (HEK) cells, Chinese hamster ovary (CHO) cells, baby hamster kidney (BHK) cells, and others. Suitable promoters for mammalian cells are also known in the art and include viral promoters, such as those of Simian Virus 40 (SV40), Rous sarcoma virus (RSV), adenovirus (ADV), bovine papilloma virus (BPV). , cytomegalovirus (CMV). Mammalian cells may also require terminator sequences and poly A addition sequences; intensifying sequences may also be included, which increase expression, and sequences that elicit the amplification of the gene may also be desirable. These sequences are known in the art. Vectors suitable for replication in mammalian cells may include viral replicons, or sequences which ensure the integration of the appropriate sequences encoding the variant nAChR a7 subunit in the host genome. An example of a mammalian expression system for nAChRs is described in Gopalakrishnan et al. (1 995) Stable expression and pharmacological properties of the human a7 nicotinic acetylcholine receptor. (Stable expression and pharmacological properties of the nicotinic acetylcholine receptor in humans). Eur. J. Pharmacol. -Mol. Pharmacol. 290: 237-246. Other eukaryotic systems are also known, as are methods for introducing polynucleotides into such systems, such as amphibian cells using methods described in Briggs et al. (1995) Neuropharmacol. 34: 583-590, insect cells using methods described in Summers and Smith, Texas Agriculture! Experiment Station Bulletin No. 1555 (1987), and the like. The baculovirus expression system can be used to generate high levels of recombinant proteins in insect host cells. This system allows a high level of protein expression, as well as post-translational processing of the protein in a manner similar to mammalian cells. These expression systems use viral promoters that are activated following baculovirus infection to manage the expression of cloned genes in insect cells (O'Reilly et al. (1992), Baculovirus Expression Vectors: A Laboratory Manual, IRL / Oxford University Press). The transfection can be by any known method for introducing polynucleotides into a host cell, including packaging the polynucleotide in a virus and transducing a host cell with the virus, by direct taking of the polynucleotide by the host cell, and the like, said methods being known for those skilled in the art. The transfection procedures selected depend on the host to be transfected and are determined by the one performing the routine.

The expression of the variant receptor subunit can be detected by the use of a radioligand selective for the receptor. For example, for the nicotinic cholinergic receptor, such a ligand can be [125 I] a-bungarotoxin. However, any radioligand ligation technique known in the art can be used to detect the receptor subunit (see, for example, Winzor et al. (1995) Quantitative Characterization of Ligand Binding, Wiley-Liss, Inc., NY). The variant nAChR polypeptide is recovered and purified from cultures of recombinant host cells expressing the same by known methods, including ammonium sulfate or ethanol precipitation, acid extraction, anion exchange or cation chromatography, phosphocellulose chromatography, chromatography of hydrophobic interaction, phosphocellulose chromatography, hydrophobic interaction chromatography, hydroxyapatite chromatography or lectin chromatography. Protein re-doubler steps may be used, as necessary, to complete the protein configuration. Finally, high performance liquid chromatography (HPLC) can be used for final purification steps. The human variant a7 polypeptide, or fragments thereof, of the present invention can also be synthesized by conventional techniques known in the art, for example, by chemical synthesis, such as solid phase peptide synthesis. In general, these methods employ either solid phase or solution phase synthesis methods. See, for example, J. M. Stewart and J. D. Young, Solid Phase Peptide Synthesis, 2nd Ed., Pierce Chemical Co., Rockford, IL (1988) and G. Barany and R.B. Merrifield, 77? E Peptides: Analysis, synthesis, Biology, editors E. Gross and J. Meienhofer, Vol. 2, Academic Press, New York, (1980), pp 3-254, for solid-phase peptide synthesis techniques; and M. Bodansky, Pricniples of Peptide Synthesis, Springer-Verlag, Berlin (1988) and e. Gross and J. Meienhofer, Eds. , 77? E Peptides: Analysis, Synthesis, Biology, supra, Vol. 1, for synthesis in classical solution. * In a preferred system, either DNA or RNA derived therefrom, both of which encode the desired variant human nAChR a7 subunit, can be expressed by direct injection into a cell, such as a Xenopus laevis oocyte. Using this method, the functionality of the human nAChR7 subunit variant encoded by the DNA or mRNA can be evaluated as follows (see Dascal (1987) CRC Crit. Rev. Biochem. 22: 317-387). A polynucleotide encoding variant is injected into an oocyte for translation into a functional receptor subunit. The function of the nAChR to the human variant expressed can be assessed in the oocyte by a variety of electrophysiological techniques including intracellular voltage recording, two electrode voltage clamp, patch grab methods, and the like. The intrinsic cation conductor channel for nAChr opens in response to ACh or other nicotinic cholinergic agonists, allowing the flow of transmembrane current. This current can be monitored directly by voltage grab techniques or indirectly by intracellular voltage recording, where changes in membrane potential due to induced current are measured.

The receptors expressed in a recombinant host cell can be used to identify compounds that modulate nAChR activity. In this regard, the specificity of ligation of a compound showing affinity for the receptor is demonstrated by measuring the affinity of the compound for cells expressing the receptor or membranes of these cells. This can be done by measuring the specific binding of labeled compound (eg, radioactive) to cells, cell membranes or their isolated receptor, or by measuring the ability of the compound to displace the specific binding of a standard labeled ligand. The expression of variant receptors and classification by compounds that are linked to them, or inhibit ligation of the labeled ligand to these cells or membranes, provides a method for rapid selection of compounds with high affinity for the receptor. These compounds can be agonists or antagonists for the receptor. The expressed receptors can also be used to classify compounds that modulate the activity of the nicotinic acetylcholine receptor, i.e., nicotinic cholinergic agonists or antagonists. A method for identifying compounds that modulate nAChR activity, comprises providing a cell that expresses a nicotinic acetylcholine receptor polypeptide to human variane (nAChR) having an amino acid substitution at the valina-274 position of the human a7 nAChR polypeptide of type natural, combining a test compound with the cell and measuring the effect of the test compound on the variant receptor activity. The cell can be a bacterial cell, a mammalian cell, a yeast cell, an amphibian cell or any other cell that expresses the receptor. Preferably, the cell is a mammalian cell or an amphibian cell. Thus, for example, a test compound is evaluated for its ability to elicit an appropriate response, for example, the stimulation of transmembrane current flow, or for its ability to inhibit the response to a cholinergic agonist. In addition, the expressed receptors can be used to classify compounds that exhibit a cytoprotective effect. The abnormal activation of membrane channels is a potential cause of neurodegenerative disease. In this regard, a number of inherited human disorders are accompanied by neuronal degeneration (Adams et al. (1989) Degenerative Disease of the Nervous System, in Principies of Neurology, McGraw-Hill, NY, pp. 921-967). Many model systems have been used to study the causes of these diseases. For example, mutations in proteins having sequence similarity extensive to proteins that contribute to the amiloride-sensitive sodium ion channel have been associated with vacuolated neurodegeneration in the nematode C. elegans (Canessa et al. (1 993) FEBS Lett. 318: 95-99; and Voilley went to. (1994) Proc. Natl. Acad. Sci. USA 91: 247-251). A so-called "gain-of-function" mutation in the deg-3 protein of C. elegans causes the vacuolated degeneration of a small set of neurons (Treinin et al. (1995), supra). Studies of this mutation suggested to these researchers that mutation in neuronal acetylcholine receptors can lead to the death of specific neuronal populations.

Additionally, variant a7 can be used to classify compounds useful for treating disorders such as alterations in sensory regulation, neuropathic pain and immunofunction, eg, pain associated with cancer conditions, post-herpetic neuralgia, diabetic neuropathy and osteoarthritis. In addition, variant a7 could be used to treat or kill cancer cells. Accordingly, nicotinic drugs are considered potential therapeutic agents in various neurodegenerative disorders including, without limitation, Alzheimer's disease, Dawn's syndrome, kuru, Parkinson's disease, multiple system atrophy, neuropathic pain and the like, in which They can be useful to decrease cell death. The activation of nAChR to the wild type to extract cytoprotective properties (for example, reduced cell lysis, see Donnelly-Roberts et al. (1 996) In vitro neuroprotective properties of the novel cholinergic channel activator (ChCA) (Neuroprotective properties in vitro of the novel cholinergic channel activator (ChCA)), ABT-418. Brain Res. 719: 36-44). However, it is not yet finally established whether a full agonist or partial agonist is preferable, nor whether the latter, which type of partial agonist is better (for example, one that stabilizes the open and desensitized states or one that stabilizes the open and of the receiver's rest). This nAChR a7 variant can be used to evaluate these questions, and to select between ligands for specific types of partial agonists or specific types of antagonists. This is because this nAChR a7 variant conducts current in desensitized states as well as the open one, unlike the wild type receptor that conducts only in the open state (see Bertrand and Changeux (1 995) Nicotinic receptor: An allosteric protein specialized for intercellular communication (Nicotinic receptor: a specialized allosteric protein for intercellular communication) Sem. Neurosci., 7: 75-90). Thus, with the human variant nAChR subunit agonist, the power is changed two orders of magnitude to a level consistent with the affinity of the agonist for the desensitized state. Additionally, ligands that are partial agonists in the subunit of nAChR a7 wild-type due to their ability to stabilize the desensitized as well as the open states would be expected to have increased efficacy in the variant nAChR subunit due to their ability to drive in the desensitized state. Examples of such changes in potency and efficacy are shown by the variant nAChR 7V274T in Figure 3. In this manner, the pharmacology of the nAChR al ligand can be defined in novel ways through the use of the human variant nAChR subunit. The substances could be antagonists in the wild-type aa nAChR due to their ability to stabilize the non-conductive desensitized state, or due to other mechanisms, such as stabilizing the remaining state or blocking the ion channel. Similar mechanisms could contribute to partial agonism in the nAhR a7 of the wild type. The ability of a ligand to stabilize the desensitized state could be evaluated by comparing the efficacy and potency of the ligand in the variant nAChR a7 (e.g., human cc7V274T) with its potency and efficacy in the wild-type a7 nAChR. The interaction of compounds with nAChr can be identified using several methods, including, but not limited to, electrophysiological measurement of transmembrane current or electric potential, measurement of fluorescence of ion-sensitive or potential dyes, or measurement of radioactive ion fluxes. (eg, 22N + or 86Rb +), and a variety of nAChR expression systems to, eg, mammalian cells transfected in culture or amphibian cells injected. This novel definition of nAChR pharmacology coupled with measures of the effect of the ligand on cell or animal functioning could be critical for the development of novel therapeutics. For example, it could be determined whether a ligand that stabilizes the desensitized state of the nAChR subunit to (agonist or partial antagonist) is preferable for cytoprotection. Similarly, the type of ligand more or less useful in other nicotinic applications, such as cognition, memory, anxiety, attention, sensory regulation (psychosis and schizophrenia), etc. , could be evaluated using nAChR subunits to the variant alone or in combination with other receptor subunits. In addition to classifying test compounds, the variant a7 subunit expressed can be used to investigate mechanisms of cytotoxicity and cytoprotection. The evidence that the activation of nAChR is cytoprotective comes from the finding that nAChR agonists have foreign cytoprotection in cells expressing the subunit of nAChR a7 and that this cytoprotection is inhibited by selective antagonists (for example, see Donnelly-Roberts et al. a /., supra). The mechanism is not known, but may involve the stimulation of Ca2 + influx. If so, then the influx of increased Ca2 + mediated by the nAChR to the variant, due to the permeability of Ca2 + maintained with prolonged current activation, may increase cytoprotection. On the other hand, as it is known that excessive intracellular Ca2 + is cytotoxic, excessive expression or stimulation of nAChR to the variant could cause cell death, perhaps as observed in C. elegans carrying the endogenous mutation in the deg3 analogue to the variant . Still alternatively, the subunit of nAChR a7 can also function through mechanisms dependent on a change in the receptor state (eg, from conformation at rest to desensitized), which can influence its interaction with other proteins, but not necessarily dependent on a change in the flow of electric potentials. The subunit of nAChR a7 variant would be critical to determine such mechanisms, since it would allow one to identify ligands that favor different receptor states, and since it provides a tool to manipulate the nAChR channel current independently of the conformation of nAChR and binding of ligand Cytoprotective or cytotoxic compounds that interact with the variant nAChR can be identified using several methods. One such method comprises providing a cell expressing a subunit of nAChR to the human variant having an amino acid substitution at the position of valine-274 of the nAChR polypeptide to the wild-type human, combining a test compound with the cell, and monitor the cell for a cytotoxicity indicator. If it is necessary to control the spontaneous action of the variant nAChR subunit, it can be stably expressed in a recombinant mammalian cell line under the control of an inducible promoter, for example, the LacSwith system, which is inducible by isopropylthiogalactoside (" I PTG "). The expression of the nACHR subunit to the variant would be maintained at a low level until induction by the addition of IPTG. Alternatively, with or without an inducible promoter, the transfected cells could be cultured in the presence of a nAChR al-blocker, such as, methillicaconitin ("MLA") or mecamylamine, which would prevent or reduce the cytotoxic action. Both blockers are reversible, allowing one to measure the effect of the test compound on the nAChR a7 function after the blocker is washed. Cytoprotective compounds can be identified by their ability to reduce cell death while cytotoxic compounds can be identified by their ability to promote cell death. That these effects are mediated by the subunit of nAChR al, variant or natural type, can be identified by the ability of a nAChR blocker to pre-warm the effect. Cell death, or cytotoxicity, can be monitored by a variety of techniques including, but not limiting to, the measurement of cell number or density in the culture, of cell growth rate (e.g., the incorporation of labeled amino acid or nucleotide), or of cellular integrity for example, by taking a dye (e.g. trypan blue is excluded by healthy cells) or by the release of a cytoplasmic constituent, such as lactate dehydrogenase (LDH). The cytoprotective agents can also be classified by their ability to antagonize a variant nAChR to a greater degree than a wild-type nAChR, or by their ability to increase the rate of decrease of the variant nAChR compared to the wild-type nAChR, using methods described in the examples provided later. In addition, the DNA or RNA derived therefrom can be used to design oligonucleotide probes for nAChR DNAs that express variant subunits. As used herein, the term "probe" refers to a structure comprised of a polynucleotide, as defined above, that contains a nucleic acid sequence that complements a nucleic acid sequence present in an objective polynucleotide. The probe polynucleotide regions can be composed of DNA, and / or RNA, and / or synthetic nucleotide analogs. Such probes could be useful in in vitro hybridization assays to distinguish the variant from the wild-type message, with the proviso that it can be difficult to design a method capable of making such a distinction given the small difference in coding between the variant and the natural type. Alternatively, a PCR-based assay could be used to amplify the Rna or DNA sample for sequence analysis. Additionally, the variant nAChR subunit can be used to prepare polyclonal or monoclonal antibodies using techniques that are well known in the art. The variant nAChR subunit or relevant fragments can be obtained using the recombinant technology set forth below, ie, a recombinant cell expressing the subunit or fragments can be cultured to produce quantities of the subunit or fragment that can be recovered and isolated. Alternatively, the varactive nAChR subunit or fragment thereof can be synthesized using conventional synthetic polypeptide techniques, as provided below. Monoclonal antibodies that exhibit specificity and selectivity for the variant nAChR subunit can be labeled with a measurable and detectable moiety, eg, a fluorescent moiety, radiolabels, enzymes, chemiluminescent labels and the like, and are used in immunofluorescent assays in vitro or in situ , or similar. The antibodies can be used to identify the subunit of variant nAChR for inanimate purposes. Below are examples of specific embodiments for carrying out the present invention. The examples are offered for illustrative purposes only, are not intended to limit the scope of the present invention in any way. In preparing the examples, efforts have been made to ensure accuracy with respect to numbers used (eg, quantities, temperatures, etc.), but some deviation and experimental error should be allowed.

Materials Acetylcholine chloride ("ACh"), Type 1 A collagenase, d-tubocurarine chloride ("dTC"), gentamicin and mecamylamine hydrochloride ("MEC"), were obtained from Sigma Chemical Company (St. Louis, Missouri , USES). The dihydro-ß-erythroidine hydrobromide ("DH BE"), and methyllicaconitine citrate ("MLA") were obtained from Research Biochemicals International (Natick, Massachusetts, U.S.A.). Tricaine (3-aminobenzoic acid ethyl ester methanesulfonate; Finquel) was obtained from Argent Chemical Laboratories (Fisheries Chemical Division, Redmond, Washington, U.S.A.).

Preparation of cDNA to the human wild type The nAChR subunit cDNA to the human reported by Doucette-Stamm et al. (1993), supra), was modified to include the complete human signal peptide (MRCSPGGVWLALAASLLHVSLQGEF (SEQ ID NO: 3)) reported by Elliott et al. (1 993) Soc. Neurosci. Abstr. 1 9:69. The following oligonucleotide was synthesized: 5'- GGGGGCAGCACGCG? GCCCATGAGGTGTAGCCCCGGAGGAGTGTGGCTG GCACTGGCAGCATCTCTCCTGCACGTGTCCCTGCAAGGCGAGTTCCAGAG GAAGCTTTACAAGGAGGGG-3 '(SEQ ID NO: 4). This oligonucleotide contains an Xho I restriction site (italics) and an ATG initiation codon (bold) followed by the next 28 codons of the nAChR subunit cDNA sequence to the human. It encodes the entire signal peptide and extends to the Hind l l l (underlined) site present in the nAChR subunit cDNA. The Xho I and Hind l l l sites were flanked with additional nucleotides to make them internal within the molecule. Additionally, the inverse complement of this oligonucleotide was synthesized. The oligonucleotides were buffered together, digested with Xho I and Hind I 1, and then ligated into a pBluescript vector containing the human subunit DNA previously digested with Xho I and Hind I I. This created a new cDNA encoding a full length human nAChR subunit. The sequence of the new cDNA was confirmed by dideoxy sequencing. The cDNA was cut from pBluescript with Xho I and Not I, the 5 'overhangs were filled in with Klenow polymerase, ligated with BsT XI adapters, digested with Bst XI, and ligated into the Bst XI site of the vector pRcCMV (I nvitrogen). The orientation of the insertion in the expression vector was determined by restriction analysis with enzymes by cutting the nAChR subunit cDNA at asymmetric positions.

Expression of nAChR a in Xenopus laevis oocytes and measurement of functional characteristics The preparation of Xenopus laevis oocytes, injection with DNA or receptor RNA, and measurement of nAChR a7 responses using two-electrode voltage clamp following procedures previously described for the nAChR a7 human-type natural (Briggs et al. (1995) supra) except that atropine was not routinely present in the bath solution. The oocytes were maintained at 17-1 8 ° C in normal Barth's solution (90 mM NaCl, 1 mM KCl, 0.66 mM NaN03, 0.74 mM CaCl2, 0.82 mM MgCl2, 2.4 mM NaHCOs, 2.5 mM sodium pyruvate, and Na N- (2-hydroxyethyl) piperazine-N '- (2-ethanesulfonic acid) ("HEPES") 10 mM, final pH pH 7.55) containing 1 00 g / ml of gentamicin. The responses were measured at a holding potential of -60 mV in modified Barth's solution containing 1.0 mM BaCl2 and lacking CaCl2 and MgCl2. However, in some experiments (Figure 6) the cell potential was intentionally varied in order to determine the response to the current-voltage ratio and OR2 plus atropine (82.5 mM NaCl, 2.5 mM KCl, 2.5 mM CaCl2, 1 mM MgCl2, 5 mM Na-HEPEs (pH 7.4) and 0.5 M atropine sulfate) was used to replicate the conditions used by Galzi et al. (1992), supra, to study chicken nAChR a7. Agonist was applied briefly using a computer controlled solenoid valve and a push / pull applicator placed within 200-400 m of the oocyte. The responses were recorded by computer in synchrony with the agonist application. Antagonists with agonist were included in the push / pull applicator and were applied to the bath by superfusion for at least 3 minutes before the application of the agonist. The responses were quantified by measuring the amplitude of the peak. The answers of human a7V274T, unlike the responses of human a7WT, tended to increase significantly during the experiments. Consequently, the experimental trials were pooled, before and after, by control applications of ACh 1 0 M in the same oocyte. All the responses were normalized to the 10 M ACh responses in order to explain the changes in sensitivity within the experiment and by variability in receptor expression between oocytes.

Example 1 Preparation of human a7V274T cDNA To generate variant a7V274T in an expression vector, the subunit gene from nAChR to wild-type was digested with restriction enzymes EcoR V and Kpn I, and the digested segment was replaced with a PCR product. mutant by ligation using the procedures described below. The strategy, diagrammed in Figure 1, used two steps of PCR followed by digestion with restriction enzymes to produce a mutation fragment of nAChR subunit cDNA to wild-type and subcloning the mutation fragment into the human cDNA. natural type. In the first step (A), two DNA fragments carrying the desired mutation were generated by PCR using the appropriate primers. The mutation nucleotide was incorporated in the reverse primer (X-3 ') for the larger fragment and in the forward primer (Y-5') for the shorter fragment. The two external primers (X-5 'and Y-3') were chosen so that the final PCR product would contain EcoRV and Kpn I restriction sites. The longest 5 'fragment was generated using the forward external primer 5'-GTTTGGGTCCTGGTCTTACG-3' (SEQ ID NO: 5) and the reverse internal primer 5'-GCAGCATGAAGGTGGTAAGAGAG-3 '(SEQ ID NO: 6) carrying the mutation. The shorter 3 'fragment was generated using the forward internal primer 5'-CTCTCTTACCACCTTCATGCTGC-3' (SEQ ID NO: 7), also carrying the mutation, and the reverse external primer 5'-GTACTGCAGCACGATCACCG-3 '(SEQ ID NO: 8). The conditions for PCR consisted of 1 00 ng of input DNA a7, buffer 2X Pfue, 100 ng of each pair of primers and 0.625 U of enzyme Pfue (Stratagene, La Jolla, CA). The reactions were performed on a Perkin-Elmer 9600 for 20 cycles at 95 ° C for 24 seconds, 60 ° C for 22 seconds and then 72 ° C for 78 seconds.

In the second step of PCR (B), these two fragments were reassembled using the external primers. The sequence was re-amplified and a longer DNA fragment was generated carrying the desired mutation. In the next step (C), the product from step (B) was digested with Kpnl and EcoRV, gel purified, and ligated into the wild-type human a7 cDNA previously digested with Kpnl and EcoRV. The dideoxy sequencing of the final cDNA showed the presence of the desired mutation and that no other mutation had been introduced during the PCR process.

Figures 2A-2C show the nucleotide sequence (SEQ I D NO: 1) of the human a7V274T cDNA mutant. The amino acid sequence of the human variant a7V274T (SEQ I D NO: 2) is also shown in Figures 2A-2C.

Example 2 Concentration-response ratios for agonists in wild type nAChR and human a7V274T Responses were measured at various concentrations of agonists using human a7V274T nAChR subunits expressed from the DNA prepared in Example 1, which was injected into Xenopus oocytes Laevis as described before. The responses were measured in peak amplitude and normalized to the response to ACh 10 M. The data points (Figure 3) show the average ± s.e.m. of the normalized responses (n = 4 to 1 0 for ACh, n = 3 to 4 for (-) - nicotine, n = 3 to 5 for GTS-21 and n = 2 to 5 for ABT-089). The curves shown in Figure 3 show the Hill equation fitted to the data (Sigmaplot computation program, Jandel Scientific, San Rafael, California, USA) with the exception of the small responses for GTS-21 and ABT-089 in the type natural from In nAChR a7 of human type, ACh and (-) - nicotine had EC50 values of 1 56 ± 20 μM and 83 ± 1 0 μM, respectively, and with Hill coefficients of 0.94 ± 0.09 and 1 .2 ± 0.2, respectively. GTS-21 and ABT-089 were partial agonists, whose EC50 values could not be estimated because the responses were so weak. There is a clear change in potency and efficacy in the human a7V274T nAChR. In human nAChR 7V274T, ACh and (-) - nicotine were two orders of magnitude more powerful, with EC50 values of 1.02 ± 0.04 μM and 0.94 ± 0.12 μM, respectively, and Hill coefficients of 1.8 +/- 0.2 and 1.3 +/- 0.2, respectively. More remarkably, GTS-21 was a full agonist in the human a7V274T nAChR with an EC50 value of 4.3 ± 0.3 μM and a Hill coefficient of 1.5 ± 0.1, in total contrast with its weak partial agonist effect in the nAChR to the human natural type. ABT-089 was also more potent and effective in the human a7V274T nAChR, with EC50 values of 28 ± 3 μM and a Hill coefficient of 2.3 ± 0.4, but it was a partial agonist with an efficacy of 40 + 1%. These results with the human nAChR subunits correlate with the 180-fold increase in ACh observed with chicken a7V251 T compared with nAChR to wild-type chicken (Galzi et al. (1992), supra). However, this is the first demonstration that the potency of (-) - nicotine is also changed, and the first demonstration that the potency and efficacy of partial agonists are changed in this variant.

EXAMPLE 3 Activation and decay rate of human a7V274T compared to nAChR a7WT wild-type human The responses of human a7V274T and human a7WT at EC50 concentrations of ACh (1 μM and 200 μM, respectively) were matched for similar amplitudes, and are synchronized to Start of ACh application and adjust for equivalent line base hold current (see Figure 4). ACh was applied to human a7V274T for 1 0 seconds and to human a7WT for 2.5 seconds. The short ticks as quills near the start and end of the traces of human a7WT are electrical devices marking the opening and closing of the agonist application valve. The responses of human a7V274T were activated and decayed slowly compared to the responses of human a7WT. Similarly, the analogous chicken mutant nAChR was activated and decayed more slowly in response to ACh (Galzi et al. (1992), supra).

EXAMPLE 4 Evaluation of nAChR Antagonists for Agonist Activity in nAChR a7V274T Human nAChR antagonists, such as dihydro-β-erythroidine (DHßE), o'-tubocurarine and hexamethonium, activate responses to nAChR TM- variants 2 a7 of chicken, when these compounds are applied as agonists (Bertrand et al. (1992), supra). This, together with single channel registration data, has suggested (a) that the nAChR variants lead to the receptor-desensitized state, and (b) that the natural-type nAChR antagonists act upon stabilizing the desensitized state (Bertrand et al. al. (1995), supra). In the human a7V274T nAChR, DHße (1 0 μM) also activated current responses inward as an agonist (see Figure 5). However, these responses were small, varying from 2.8% to 6.9% of the response to ACh 1 0 μM (Table 1) unlike the nAChR a7V251 T homologous chicken, where DHßE 1 0 μM extracted a response of 66% as large as the ACh response (Bertrand et al. (1993) Mutations at two distinct sites within the channel domaoin M2 alter calcioum permeability of neural a7 nicotinic receptor (Mutations at two different sites within the M2 channel domain alter the calcium permeability of receptor neuronal a7 nicotinic acid) Proc. Natl. Acad. Sci (USA) 90: 6971-6975). Additionally, to human a7V274T this was not a general property of nAChR antagonists. Both a7-selective (1 0 nM) antagonist MLA and non-selective nAChR antagonist mecamylamine (1.0 μM) extracted the opposite effect, small outward currents as inverse agonists ranging in amplitude from 0.9% to 12.4% of the current response maximum inward for ACh, as shown in Figure 5 and Table 1. The traces shown in Figure 5, all from a single oocyte, compare responses to mecamylamine (MEC 1 0 μM), methylliconitine (MLA, 10 nM), dihydro-β-erythroidine (DHßE, 1.0 μM) and bath solution ( control of agonists-0) applied for 20 seconds each. Small agonist-0 control responses were measured in each human a7V274T oocyte and subtracted from agonist responses when the data were tabulated. The calibration lines in Figure 5 represent 1 0 nA and 2 seconds for all the traces.

Table 1 Effects of cholinergic antagonists in the mutant human a7V274T and nAChR to the wild type Abbreviations: DHßE (dihydro-β-erythroidine); d-TC (cf-tubocurarine); MLA (metillicaconitina); MEC (mecamylamine); ATROP (atropine). * p < 0.05 compared to 0 (two-tailed Student's t test) t p < 0.005 compared to 0 (Studen two-tailed test) * compared to activation by 1.0 μM §% inhibition of ACh response The o ubocurarine (1 μM) also did not produce currents to adento as an agonist, but produced small outward currents (3-5% of the maximum inward current response to ACh) in two out of four human a7V274T oocytes. The outward current responses may be due to stabilization of the resting state (closed) or spontaneously open nAChR channel blocking. In human a7WT nAChR under similar conditions, neither DHßE (10 μM), MLA (1.0 nM), mecamylamine (10 μM) nor cf-tubocurarine (1 μM) produced any significant inward or outward current response (Table 1 ). Muscarinic antagonist atropine (2 μM) only had little effect on any nAChR.

Example 5 Evaluation of nAChR antagonists for agonist activity in the human a7V274T nAChR The above compounds were also evaluated as antagonists of the ACh response to both human a7V274T and human a7WT nAChRs.

For each nAChR, two concentrations of ACh were used: one near the EC50 value (1 μM for a7V274T and 200 μM for a7WT) and one near the maximum response level (10 μM for a7V274T and 1.0 mM for a7WT). The data is shown in Table 1. DHßE (10 μM), -tubocurarine (1 μM), MLA (10 nM), and mecamylamine (10 μM) acted as antagonists in both nAChRs. The MLA selective antagonist was particularly potent, as expected, blocking human a7V27rT as well as human a7WT at a concentration of 10 nM. Interestingly, mecamylamine (10 μM), DHßE (10 μM) and d-tubocurarine (1 μM) each appeared to inhibit human a7V274T rather than human a7WT. Atropine (2 μM) inhibited the response of human a7V274T to 1 μM ACh by 28%, but had little effect on the response of human a7WT to 200 μM ACh.

Some oocytes have endogenous muscarinic receptors activated by low-micromolar concentrations of ACh (Kusano et al. (1982) J. Physiol. (London) 328: 143-1 70; Davidson et al. (1 991) FEBS Lett. 284: 252-256; and Dascal went to. (1 980) Life Sci. 27: 1423-1428). However, this does not seem to explain the effect of atropine on human a7V274T, because nAChR antagonist mecamylamine (10 μM) completely blocked the 1 μM ACh response in three of the five h-a7V274T oocytes inhibited by atropine (the others two were not exposed to mecamylamine). DHßE (1.0 μM) inhibited maximal ACh responses less strongly than it inhibited EC50 ACh responses in both human a7WT and human a7V274T (see Table 1). Mecamylamine (10 μM) also inhibited the maximal ACh response less strongly than the EC50 ACh response in the nAChR a7V274T human, but not in the human a7WT nAChR, where mecamylamine inhibited both ACh concentrations in a similar manner. The lower inhibitions at higher concentrations of ACh may reflect competitive antagonist-agonist interactions. Thus, the nAChR a7V274T human variant is similar to nAChR a7V251 T of chicken analog in its increased sensitivity to agonist activation and lower apparent rate of activation and desensitization. However, the receptors differed in that DHβE (1.0 μM) activated the current into human a7V274T only weakly, compared to a 66% agonist-like effect in chicken a7V251 T, and that d-tubocurarine did not activate currents inward in h-a7V274T compared to the complete response to chicken nAChR a7L247T (Galzi et al. (1992), supra; Bertrand et al. (1993), supra). In this way, there may be a species difference in the effects of these sequence modifications on the nAChR al function, whose difference is unexpected in view of the known information with respect to chicken a7V274T.

Example 6 Human a7V274T Rectification The current versus voltage ratio of nAChR responses variant human a7V274T to ACh 1 0 μM was measured in oocytes under a two electrode voltage clamp, as described by Briggs et al. (1995) Neuropharmacol. 34: 583-590. This was done under two conditions: (a) four oocytes in modified Barth solution containing Ba2 + to prevent secondary activation of CP currents dependent on Ca2 + (90 mM NaCl, 1 mM KCl, 0.66 mM NaN03, 1.0 mM BaCl2, pyruvate of sodium 2.5 mM, and buffer of Na-HEPES 1 0 mM, pH 7.55) as described by Briggs et al. (1995), supra, and (b) three oocytes in OR2 solution made to replicate that was used by Galzi et al. (1992) Nature 359: 500-505, in its study of chicken variants (82.5 mM NaCl, 2.5 mM KCl, 2.5 mM CaCl2, 1 mM MgCl2, 0.5 μM atropine, and 5 mM Na-HEPES buffer, pH 7.4 ). Under both conditions, a clear inward correction of the ACh response was observed since there was a small current response in cellular potentials above 0 mV compared to the current response to negative cell potentials. Similarly, nAChR a7 of the wild type (Briggs et al (1 995), supra) and nAChR a7 of the wild type (Galzi et al. (1992), supra) shows an inward rectification, but variant a7V251 T Chicken did not show such rectification (Galzi et al. (1992), supra).

Example 7 Expression studies in mammalian cell lines The nAChR to wild-type (WT) and human a7V274T are transfected into the human embryonic kidney cell line, HEK-293 using the eukaryotic expression vector, pRc / CMV (Invitrogen , San Diego, CA), which contains the human cytomegalovirus promoter sequences for high level constitutive expression and contains the neomycin resistance gene for the selection of stable cell lines resistant to geneticin. The cDNAs were transfected using lipofectamine (GIBCO) as described in (Gopalaknshnan et al. (1995) Eur. J. Pharmacol. (Mol.Pharm.) 290: 237-246). Using this approach, stable cell lines expressing human nAChR 7WT have been generated, exhibiting clear [125I] a-bungarotoxin ligation, acetylcholine evoked current, and Ca2 + influx responses (Gopalakrishnan et al. (1995), supra; Delbono et al. (1996) J. Pharmacol. Exp. Ther. (In press)). Additionally, the initial data shown in Figure 7 demonstrate the viability of transfection of variant a in mammalian cells. The human variant a7V274T supports homology to the spontaneous mutation of deg-3 of C. elegans (u662), which appears to be cytotoxic through a mechanism that is inhibited by nicotinic antagonists (Treinin and Chalfie (1995) A mutated acetilcholine receptor subunit causes neuronal degeneration ¡n C. elegans. (A subunit of acetylcholine receptor with mutation causes neuronal degeneration in C. elegans) Neuron 14: 871-877). The response of nAChR variant human a7V274T lasts longer than the wild type responses (Figure 4), but, as the nAChR variant chicken a7V251 T, it probably has high Ca2 + permeability, so that receptor activation can, under some conditions, lead to excessive Ca2 + influx, and therefore cell death. In addition, there is some evidence that nAChR variant human a7V274T may be prone to prolonged spontaneous opening, because oocytes that have expressed a7V274T for 3 days or more were 1 0-100 times more electrically filtering than oocytes expressing nAChR to the human natural type. Thus, human a7V274T and the related variant nAChR may be cytotoxic in the presence, and even in the absence of agonist. The spontaneous expression of such variant could interfere with the function of nAChR to normal, induce premature cell death, or interfere with the formation of synapses. Such effects could support some forms of neurodegenerative diseases or other disorders involving derangement of the cholinergic function. Cytotoxicity could clearly limit the ability of cells to express the variant a7V274T at high levels. To circumvent this, transfected cells were grown in the presence of a reversible nicotinic antagonist or channel blocker, such as, methillicaconitin or mecamylamine. Such substances would prevent cytotoxicity by blocking the receptor or channel, but could be removed shortly before using the cells in further experiments. Alternatively, the human-type or variant is transfected using an inducible expression system, such that the expression of the subunit a is repressed until an inducer is added. The advantage of an inducible system is that it can eliminate the cytotoxic effects of the expressed protein, for example, the human variant a7V274T, which is observed when a constitutive expression system, such as pRcCMV, is used. One of the expression vectors that is used is the system LacSwitch (Stratagene) that uses the elements of the lactose operon to control the expression of genes. With the LacSwitch system, basal expression is very low in the repressed state and once stably transfected into cell lines, this system allows rapid induction within 4-8 hours in the presence of the induction agent, IPTG. The system employs a eukaryotic vector expressing Lac repressor (p3'SS) and a eukaryotic vector containing Lac operator (pOPRSVI-CAT) in which the al subunit construct will be inserted by cloning. The antibiotic selection is achieved via the hygromycin resistance gene in p3'SS and via the neomycin resistance gene in the pOPRSVI-CAT vector. After transfection of H EK-293 or other cells, the selection of stable cell lines is achieved by the presence of both hygromycin and geneticin. Once the cell lines are isolated, expression of the subunit a will be caused by the addition of the induction agent, I PTG. In the absence of IPTG, transcription is blocked by ligation of the Lac repressor protein to the operator in the vector pOPRSVI-CAT. I PTG decreases affinity for ligation of the Lac repressor protein to the operator, thereby triggering the transcription and expression of the subunit gene to the insert. The choice of such a system allows the direct evaluation of the nAChR role to the mutant by mediating cell death in vitro. In Vitro Assessment of Cytotoxicity in Mammalian Cell Lines: To determine if the human variant a7V274T mediates cytotoxicity, cell damage can be assessed by following the transient expression of the cDNA in HEK-293 cells by a number of methods, for example: ) stain the cells with trypan blue (4%) for 5 minutes and assess the ability of viable cells to exclude the tincture; (ii) measuring the levels of the cytosolic enzyme lactate dehydrogenase (LDH) released in the medium, as an index of the breakdown of cells (eg, Donnelly-Roberts et al. (1996) Brain Res. 719: 36-44 ); (iii) taking of neutral red dye or taking and conversion of tetrazolium MTT as a viability index (eg, Little et al (1 996) Br. J. Dermatol 1 34: 199-207; D Souza et al. (1996) J. Neurosci Res 43: 289-298; Malcolm et al. (1996) J. Neurochem 66: 2350-2360); (iv) taking and ligation of propidium iodide to nucleic acids (eg, Wrobel et al (1996) J. Immunol, Methods 189: 243-249) or other techniques that are sensitive to loss of plasma membrane integrity or cellular metabolic function. Additional techniques can be used to assess changes in nucleotide incorporation, DNA structure or integrity (eg, Alison and Sarraf (1995) Hum. Exp. Toxicol 14: 234-247; Didier et al. (1 996) J. Neurosci 16: 2238-2250). These techniques are known to those of ordinary skill in the art. These studies were performed on non-transfected cells or mock transfection (controls), cells that are transfected with the wild-type human, and cells that are transfected with human variant a7V274T. Confirmation that the expression of human variant a7V274T leads to cytotoxicity would suggest a role for triggering neurodegenerative processes in vivo. Diagnostic application: The presence of the variant a7V274T in humans could be determined in a non-invasive manner, for example, using the polymerase chain reaction (PCR) and genomic DNA isolated from blood samples following standard methodology. Alternatively, if RNA is isolated, then reverse transcriptase-PCR ("RT-PCR") can be used to detect variant al. The PCR reaction, for example, could use 1 00 ng of the DNA in a standard 50 μl PCR reaction with the appropriate synthetic primers. The external primers used in the synthesis of variant a7 (X-5 'and Y-3') would allow one to amplify the region of interest. The primers would be chosen to generate a fragment of different size spanning the transmembrane segment of sequence 2, in which the V274T substitution takes place. Following the amplification, the nucleotide sequence of the message is determined. The presence of the variant may be an indication of cellular disease, such as neurodegeneration or other forms of cytotoxicity. Thus, a method for detecting subunit target polynucleotides to the human variant in a test sample comprises, (a) contacting a subunit target polynucleotide to the human variant with at least one subunit-specific polynucleotide probe to the human variant or complement of the same; and (b) detecting the presence of the target polynucleotide complex and probe in the test sample.

Another method for detecting human subunit mRNA cDNA in a test sample comprises, (a) performing reverse transcription in order to produce cDNA; (b) amplifying the cDNA obtained from step (a); and (c) detecting the presence of the subunit to the human variant in the test sample. Alternatively, the DNA shown or the cDNA prepared from RNA by RT-PCR can be amplified using appropriate primers (e.g., X-5 'and Y-3') to allow detection of the variant by nucleotide sequence analysis . The detection step (c) comprises using a detectable portion capable of generating a measurable signal. A purified polynucleotide or fragment thereof derived from the human variant a7 subunit capable of selectively hybridizing to the nucleic acid of the subunit to the human variant can be used in these methods, wherein said polynucleotide has a sequence comprising SEQ ID NO: 1 or a portion thereof. The purified polynucleotide can be produced by recombinant techniques. A polypeptide encoded by subunit to the human variant is also useful for diagnostic applications. The polypeptide, which has an amino acid sequence comprising SEQ I D NO: 2 or a portion thereof, can be produced by recombinant or synthetic techniques. A monoclonal antibody, which binds specifically to the subunit to the human variant can also be used in these methods. The subunit to the human variant comprises the amino acid sequence of SEQ I D NO: 2 or a portion thereof.

A method for detecting the human variant a7 subunit in a test sample may comprise, (a) contacting said test sample with an antibody or fragment thereof, which is specifically linked to the human variant subunit a7. time and under sufficient conditions for the formation of resulting complexes; and (b) detecting said resulting complexes containing said antibody, wherein said antibody is specifically linked to the a7 human variant subunit of SEQ I D NO: 2 or a fragment thereof. Application of treatment: The spontaneous mutation of valine-274 from human to threonine and related mutation could result in, or hasten, the death of those cells expressing the protein. At least two types of treatment could be attempted: (i) the administration of a selective a7 antagonist, such as, methillicaconitin or another compound with improved brain-blood barrier penetration; or, (ii) antisense oligonucleotide therapy to block protein synthesis (for example, see Albert and Morris (1994), Antisense knockouts: molecular scalpels for the dissection of signal transduction. Trends in Pharmacological Sciences 1 5: 250-254 ); or (iii) as a reagent to kill cells, such as cancer cells. For example, the antisense oligonucleotide 5'-GGCTACACCTCATGGGCTCG (SEQ I D NO: 9) can be used. In this way, this or other oligonucleotides would block the synthesis of any subunit protein, including the wild type, but would still be of use where the variant is expressed and not the wild type, or where the knockout of the wild type is less harmful than the continued expression of the variant. The efficacy of this antisense would be demonstrated in vitro and, in addition, the antisense would be valuable as a research tool and evaluate the function of the subunit. Antisense technology can be used to reduce gene expression through RNA or antisense DNA or triple helix formation, both methods based on the ligation of a polynucleotide for DNA or RNA. For example, the 5 'coding portion of the polynucleotide sequence, which encodes the polypeptide of the present invention, is used to design an antisense RNA oligonucleotide from 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription, thereby preventing transcription and production of the subunit polypeptide to the human variant. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks the translation of a mRNA molecule in the subunit polypeptide to the human variant. Antisense oligonucleotides act most effectively when they are modified to contain artificial internucleotide bonds, which make the molecule resistant to nucleolytic cleavage. Such artificial internucleotide linkages include, but are not limited to, internucleotide linkages of methyl phosphate, phosphorothiolate and phosphoroamidate. Research and application of drug discovery: Antisense oligonucleotides would also be of value in determining the functions of the V274T and wild-type, and cytotoxicity mechanisms in general. For example, a method to evaluate the contribution of a7V274T to cytotoxicity, cytoprotection or other cellular processes, would be to determine if the specific blocking of its synthesis blocks the process.

This differs in approximation from the use of a receptor antagonist, which may or may not block all the effects of the protein. Additionally, in the drug discovery, this approach could be useful to evaluate if the effect of the drug is mediated by the variant a7V274T. A similar approach could be used to evaluate the contribution of other variants or the wild type subunit by itself. In control experiments, the corresponding sense oligonucleotides and corresponding nonsense oligonucleotides 5'-CGAGCCCATGAGGTGTAGCC (SEQ ID NO.1 0) and 5'-CCAGGCATTCGGAGCTTGCC (SEQ I D NO.1 1), respectively, are used. The nonsense oligonucleotide is a random sequence that maintains the proportion of the GC content in the antisense oligonucleotide, and does not match the known sequences in the GenBank database. In this manner, the polynucleotides encoding the novel subunit and its nAChR antisense variants to the human can be used in a variety of manner as detailed herein. Although the preferred embodiments of the present invention have been set forth in some detail, it is understood that obvious variations can be made without departing from the spirit and scope of the invention, as defined by the appended claims.

SEQUENCE LISTING (1) GENERAL INFORMATION: (i) APPLICANT: Abbott Laboratories (ii) TITLE OF THE I NVENTION: A subunit of variant human alpha-7 acetylcholine receptor and methods of production and use thereof (iii) NUMBER OF SEQUENCES: 1 1 (iv) ADDRESS FOR CORRESPONDENCE: (A) DESTINY: Abbott Laboratories (B) STREET: 100 Abbott Park Road (C) CITY: Abbott Park (D) STATE: IL (E) COUNTRY: EU (F) POSTAL CODE: 60064-3500 (v) LEGI BLE COMPUTER FORM: (A) IT PO OF MEDIUM: 8.89 cm DISC (B) COMPUTER: PC-compatible (C) OPERATING SYSTEM: PC-DOS / MS -DOS / Windows 95 (D) PACKAGING: Microsoft word 1997 (saved as ASCII text) (vi) CURRENT REQUEST DATA: (A) APPLICATION NUMBER: PCT / US97 / 23405 (B) SUBMISSION DATE: December 22, 1997 (C) CLASI FICATION: (viii) LAWYER / AGENT INFORMATION: (A) NAME: Danckers, Andreas M. (B) REGISTRATION NUMBER: 32,652 (C) REFERENCE NUMBER / CASE: 6017. PC.01 (ix) I NFORMATION OF TELECOMUN ICATIONS: (A) TELEPHONE: 847-937-6369 (B) TELEFAX: 847-938-2623 (2) INFORMATION FOR SEQ ID NO: 1: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 1 591 base pairs (B) TYPE: nucleic acid (C) FI LAMENT: simple (D) TOPOLOGY: linear ( I) TI PO OF MOLECULE: genomic DNA (xi) DESCRITION OF SEQUENCE: SEQ ID NO: 1 CTCGAGCCC ATG AGG TGT AGC CCC GGA GGA GTG TGG CTG GCA CTG GCA 48 GCA TCT CTC CTG CAC GTG TCC CTG CAA GGC GAG TTC CAG AGG AAG CTT 96 TAC AAG GAG CTG GTC AAG AAC TAC AAT CCC TTG GAG AGG CCC GTG GCC 144 AAT GAC TCG CAA CCA CTC ACC GTC TAC TTC TCC CTG AGC CTC CTG CAG 192 ATC ATG GAC GTG GAT GAG AAG AAC CAA GTT TTA ACC ACC AAC ATT TGG 240 CTG CAA ATG TCT TGG ACÁ GAT CAC TAT TTA CAG TGG AAT GTG TCA GAA 288 TAT CCA GGG GTG AAG ACT GTT CGT TTC CCA GAT GGC CAG ATT TGG AAA 336 CCA GAC ATT CTT CTC TAT AAC AGT GCT GAT GAG CGC TTT GAC GCC ACÁ 384 TTC CAC ACT AAC GTG TTG GTG AAT TCT TCT GGG CAT TGC CAG TAC CTG 432 CCT CCA GGC ATA TTC AAG AGT TCC TGC TAC ATC GAT GTA CGC TGG TTT 480 CCC TTT GAT GTG CAG CAC TGC AAA CTG AAG TTT GGG TCC TGG TCT TAC 528 GGA GGC TGG TCC TTG GAT CTG CAG ATG CAG GAG GCA GAT ATC AGT GGC 576 TAT ATC CCC AAT GGA GAA TGG GAC CTA GTG GGA ATC CCC GGC AAG AGG 524 AGT GAA AGG TTC TAG GAG TGC TGC AAA GAG CCC TAC CCC GAT GTC ACC 672 TTC AC GTG ACC ATG CGC CGC AGG ACÁ CTC TAC TAT GGC CTC AAC CTG 720 CTG ATC CCC TGT GTG CTC ATC TCC GCC CTC GCC CTG CTG GTG TTC CTG 768 CTT CCT GCA GAT TCC GGG GAG AAG ATT TCC CTG GGG ATA AC GTC TTA 816 CTC TCT CTT ACC ACC TTC ATG CTG CTC GTG GCT GAG ATC ATG CCC GCA 864 ACA TCC GAT TCG GTA CCA TTG ATA GCC CAG TAC TTC GCC AGC ACC ATG 912 ATC ATC GTG GGC CTC TCG GTG GTG GTG ACG GTG ATC GTG CTG CAG TAC 960 CAC CAC CAC GAC CCC GAC GGC GGC AAG ATG CCC AAG TGG ACC AGA GTC 1008 ATC CTT CTG AAC TGG TGC GCG TGG TTC CTG CGA ATG AAG AGG CCC GGG 1056 GAG GAC AAG GTG CGC CCG GCC TGC CAG CAC AAG CAG CGG CGC TGC AGC 1104 CTG GCC AGT GTG GAG ATG AGC GCC GTG GCG CCG CCG CCC GCC AGC AAC 1152 GGG AAC CTG CTG TAC ATC GGC TTC CGC GGC CTG GAC GGC GTG CAC TGT 1200 GTC CCG ACC CCC GAC TCT GGG GTA GTG TGT GGC CGC ATG GCC TGC TCC 1248 CCC ACG CAC GAT GAG CAC CTC CTG CAC GGC GGG CAA CCC CCC GAG GGG 1296 GAC CCG GAC TTG GCC AAG ATC CTG GAG GAG GTC CGC TAC ATT GCC AAC 1344 CGC TTC CGC TGC CAG GAC GAA AGC GAG GCG GTC TGC AGC GAG TGG AAG 1392 TTC GCC GCC TGT GTG GTG GAC CGC CTG TGC CTC ATG GCC TTC TCG GTC 1440 TTC ACC ATC ATC TGC ACC ATC GGC ATC CTG ATG TCG GCT CCC AAC TTC 1488 GTG GAG GCC GTG TCC AAA GAC TTT GCG TAACCACGCC TGGTTCTGTA 1535 CATGTGGAAA ACTCACAGAT GGGCAAGCGC TTTGGCTTGG CGAGATTCGG CCGGAA 1591 (2) I NFORMATION FOR S EQ ID NO: 2: (i) CHARACTERISTICS OF THE SECU ENCIA: (A) LONG ITU D: 502 amino acids (B) TI PO: am inoacid (D) ) TOPOLOGY: linear (ii) TI PO DE MOLÉCU LA: protein (xi) DESCRI SEQUENCE PCI: SEQ ID NO: 2 Met Arg Cys Ser Pro Gly Gly Val Trp Leu Ala Leu Ala Wing Ser Leu 16 Leu His Val Ser Leu Gln Gly Glu Phe Gln Arg Lys Leu Tyr Lys Glu 32 Leu Val Lys Asn Tyr Asn Pro Leu Glu Arg Pro Val Wing Asn Asp Ser 48 Gln Pro Leu Thr Val Tyr Phe Ser Leu Ser Leu Leu Gln He Met Asp 64 Val Asp Glu Lys Asn Gln Val Leu Thr Thr Asn He Trp Leu Gln Met 80 Ser Trp Thr Asp His Tyr Leu Gln Trp Asn Val Ser Glu Tyr Pro Gly 96 Val Lys Thr Val Arg Phe Pro Asp Gly Gln He Trp Lys Pro Asp He 112 Leu Leu Tyr Asn Ser Wing Asp Glu Arg Phe Asp Wing Thr Phe His Thr 128 Asn Val Leu Val Asn Ser Ser Gly His Cys Gln Tyr Leu Pro Pro Gly 144 He Phe Lys Ser Ser Cys Tyr He Asp Val Arg Trp Phe Pro Phe Asp 160 Val Gln His Cys Lys Leu Lys Phe Gly Ser Trp Ser Tyr Gly Gly Trp 176 Being Leu Asp Leu Gln Met Gln Glu Wing Asp He Ser Gly Tyr He Pro 192 Asn Gly Glu Trp Asp Leu Val Gly He Pro Gly Lys Arg Ser Glu Arg 208 Phe Tyr Glu Cys Cys Lys Glu Pro Tyr Pro Asp Val Thr Phe Thr Val 224 Thr Met Arg Arg Arg Thr Leu Tyr Tyr Gly Leu Asn Leu Leu He Pro 240 Cys Val Leu He Ser Ala Leu Ala Leu Leu Val Phe Leu Leu Pro Ala 256 Asp Ser Gly Glu Lys Be Ser Leu Gly He Thr Val Leu Leu Ser Leu 272 Thr Thr Phe Met Leu Leu Val Wing Glu He Met Pro Wing Thr Ser Asp 288 Ser Val Pro Leu He Wing Gln Tyr Phe Wing Being Thr Met He He Val 304 Gly Leu Ser Val Val Val Thr Val He Val Leu Gln Tyr His His His 320 Asp Pro Asp Gly Gly Lys Met Pro Lys Trp Thr Arg Val He Leu Leu 336 Asn Trp Cys Wing Trp Phe Leu Arg Met Lys Arg Pro Gly Glu Asp Lys 352 Val Arg Pro Wing Cys Gln His Lys Gln Arg Arg Cys Ser Leu Wing Ser 368 Val Glu Met Ser Ala Ala Ala Ala Pro Pro Pro Ala Ser Asn Gly Asn Leu 384 Leu Tyr He Gly Phe Arg Gly Leu Asp Gly Val His Cys Val Pro Thr 400 Pro Asp Ser Gly Val Val Cys Gly Arg Met Wing Cys Ser Pro Thr His 416 Asp Glu Hie Leu Leu His Gly Gly Gln Pro Pro Glu Gly Asp Pro Asp 432 Leu Ala Lys He Leu Glu Glu Val Arg Tyr He Wing Asn Arg Phe Arg 448 Cys Gln Asp Glu Ser Glu Wing Val Cys Ser Glu Trp Lys Phe Wing Wing 464 Cys Val Val Asp Arg Leu Cys Leu Met Wing Phe Ser Val Phe Thr He 480 He Cys Thr He Gly He Leu Met Ser Wing Pro Asn Phe Val Glu Wing 496 Val Ser Lys Asp Phe Wing 502 (2) INFORMATION FOR SEQ ID NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 25 amino acids (B) TI PO: amino acid (D) TOPOLOGY: linear (ii) IT POINT OF MOLECULE: protein (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 3 Met Arg Cys Ser Pro Gly Val Trp Leu Ala Leu Ala Ala Ser Leu 16 Leu His Val Ser Leu Gln Gly Glu Phe 25 (2) I NFORMATION FOR SEQ ID NO: 4: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 1 18 base pairs (B) TYPE: nucleic acid (C) FI LAMENT: simple (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4 GGGGGCAGCACTCGAGCCCATGAGGTGTAG CCCCGGAGGA GTGTGGCTGG CACTGGCAGC 60 ATCTCTCCTG CACX5TGTCCCTGCAAGGCGAGTTC AGAGGMGCTTTACAAGGAGGGG 118 (2) INFORMATION FOR SEQ ID NO: 5: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 20 base pairs (B) TI PO: nucleic acid (C) FILAMENTO: simple (D) TOPOLOGY: linear ( xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5 GTTTGGGTCC TGGTCTTACG 20 (2) INFORMATION FOR SEQ ID NO: 6: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 23 base pairs (B) TI PO: nucleic acid (C) FILAMENTO: simple (D) TOPOLOGY: linear (xi) ) SEQUENCE DESCRITION: SEQ ID NO: 6 GCAGCATGAA GGTGGTAAGA GAG 23 (2) INFORMATION FOR SEQ ID NO: 7: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) FI LAMENT: simple (D) TOPOLOGY: linear (xi) ) DESCRI PTION OF SEQUENCE: SEQ ID NO: 7 CTCTCTTACC ACCTTCATGC TGC 23 (2) INFORMATION FOR SEQ ID NO: 8: (i) CHARACTERISTICS OF THE SECU ENCIA: (A) LENGTH: 20 base pairs (B) TI PO: nucleic acid (C) FI LAMENT: simple (D) TOPOLOGY: linear (xi) SEQUENCE DESCRITION: SEQ ID NO: 8 GTACTGCAGC ACGATCACCG 20 (2) INFORMATION FOR SEQ ID NO: 9: (i) CHARACTERISTICS OF THE SECU ENCIA: (A) LENGTH: 20 base pairs (B) TI PO: nucleic acid (C) FI LAMENT: simple (D) TOPOLOGY: linear (xi) DESCRITION OF SEQUENCE: SEQ ID NO: 9 GGCTACACCT CATGGGCTCG 20 (2) INFORMATION FOR SEQ ID NO: 10: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) FILAMENTO: simple (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10 CGAGCCCATG AGGTGTAGCC 20 (2) INFORMATION FOR SEQ ID NO: 11: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) FILAMENTO: simple (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO.11 CCAGGCATTC GGAGCTTGCC 20

Claims (10)

REIVI NDI CATIONS

1 . A polynucleotide encoding a variant of a nicotinic acetylcholine receptor (nAChR) subunit to the wild-type human, wherein the polynucleotide encodes a polypeptide having an amino acid substitution at the valine-274 position of the human a7 nAChR subunit polypeptide of natural type, and degenerative variants thereof.

2. The polynucleotide of claim 1, wherein the substitution is a threonine by valine-274.

3. A host cell comprising the polynucleotide of claim 1.

4. The host cell of claim 3, wherein said cell is selected from the group consisting of a bacterial cell, a mammalian cell, a yeast cell, an amphibian cell and a starfish cell.

5. An expression vector comprising the polynucleotide of claim 1 operably linked to control sequences that direct the transcription of the polynucleotide, whereby said polynucleotide is expressed in a host cell.

6. The expression vector of claim 5, wherein the nAChR to the human variant is nAChR a5V274T human.

7. A host cell comprising the expression vector of claims 5 or 6.

8. The host cell of claim 7, wherein the cell is selected from the group consisting of a bacterial cell, a mammalian cell, a yeast cell and an amphibian cell.

9. A nicotinic acetylcholine receptor subunit (nAChR) to the human variant, wherein the nAChR subunit to the human variant comprises an amino acid substitution at the valine-274 position of the nAChR polypeptide to the wild-type human.

10. The human variant receptor of claim 9, wherein the substitution in a threonine by valine-274. eleven . A method for identifying compounds that modulate anicotinic acetylcholine receptor (nAChR) activity, comprising: (a) providing a cell expressing a nAChR polypeptide to the human variant, which has an amino acid substitution at the valine-274 position of the polypeptide from nAChR a7 of the wild type; (b) mixing a test compound with the cell; and (c) measuring either (i) the effect of the test compound on the receptor to the variant or the cell expressing said subunit, or (ii) the ligation of the test compound to the cell or receptor. A method for identifying a cyotective compound, comprising: (a) providing a cell expressing a subunit polypeptide to the human variant or fragment thereof, having an amino acid substitution at the valine-274 position of the subunit to the human polypeptide of natural type; (b) combining a test compound with the cell; and (c) monitoring the cell or cell function for an indication of cytotoxicity. 3. A method for detecting subunit target polynucleotides to the human variant in a test sample, comprising: (a) contacting a subunit target polynucleotide to the human variant with at least one subunit-specific polynucleotide probe to the human variant or complement of the same; and (b) detecting the presence of the target polynucleotide complex and probe in the test sample. 14. A purified polynucleotide or fragment thereof derived from the subunit to the human variant capable of selectively hybridizing to the nucleic acid of the subunit to the human variant, wherein the sequence of said polynucleotide comprises SEQ ID NO: 1 or a portion thereof, being produced said polynucleotide by recombinant techniques. 15. A polypeptide encoded by a subunit polynucleotide to the human variant, wherein the sequence of said polypeptide comprises SEQ ID NO: 2 or a portion thereof, said polypeptide being produced by recombinant or synthetic techniques. 16. A monoclonal antibody, which is specifically linked to the human variant a7 subunit, having the amino acid sequence of SEQ ID NO: 2 or a portion thereof.