WO1998016643A1 - Inhibiteur cerebro-associe de l'activateur du plasminogene de type tissulaire - Google Patents

Inhibiteur cerebro-associe de l'activateur du plasminogene de type tissulaire Download PDF

Info

Publication number
WO1998016643A1
WO1998016643A1 PCT/US1996/016484 US9616484W WO9816643A1 WO 1998016643 A1 WO1998016643 A1 WO 1998016643A1 US 9616484 W US9616484 W US 9616484W WO 9816643 A1 WO9816643 A1 WO 9816643A1
Authority
WO
WIPO (PCT)
Prior art keywords
bait
amino acid
polypeptide
seq
leu
Prior art date
Application number
PCT/US1996/016484
Other languages
English (en)
Inventor
Gregg A. Hastings
Daniel A. Lawrence
Timothy A. Coleman
Patrick J. Dillon
Original Assignee
Human Genome Sciences, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences, Inc. filed Critical Human Genome Sciences, Inc.
Priority to PCT/US1996/016484 priority Critical patent/WO1998016643A1/fr
Priority to CA002268007A priority patent/CA2268007A1/fr
Priority to AU74317/96A priority patent/AU7431796A/en
Priority to EP96936500A priority patent/EP0934410A1/fr
Priority to JP51829398A priority patent/JP2002501365A/ja
Publication of WO1998016643A1 publication Critical patent/WO1998016643A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/81—Protease inhibitors
    • C07K14/8107—Endopeptidase (E.C. 3.4.21-99) inhibitors
    • C07K14/811—Serine protease (E.C. 3.4.21) inhibitors
    • C07K14/8121—Serpins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/04—Antineoplastic agents specific for metastasis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system

Definitions

  • the present invention relates to a novel human gene encoding a polypeptide expressed in human brain tissue which is a member of the serine protease inhibitor
  • BAIT Tissue-Type Plasminogen Activator
  • BAIT polypeptides are also provided, as are vectors, host cells and recombinant methods for producing the same.
  • the invention further relates to screening methods for identifying agonists and antagonists of BAIT activity. Also provided are diagnostic methods for detecting disorders related to the central and peripheral nervous system and the circulatory system, and therapeutic methods for treating such disorders.
  • Plasmin plays a critical regulatory role in a variety of important biological processes.
  • the enzyme plasmin plays such a role in hemostasis, angiogenesis, tumor metastisis, cellular migration and ovulation.
  • Plasmin is generated from its precursor zymogen plasminogen by the action of plasminogen activators (PAs) such as tissue-type PA (t- PA) and urokinase-type (u-PA), both of which are serine proteases.
  • PAs plasminogen activators
  • t- PA tissue-type PA
  • u-PA urokinase-type
  • the activity of the PA system is precisely regulated by several mechanisms, one of which involves the interaction of t-PA and u-PA with specific plasminogen activator inhibitors.
  • PAI-1 plasminogen activator inhibitor type 1
  • se ⁇ ins serine protease inhibitors
  • PAI-1 plasminogen activator inhibitor type 1
  • PAI-1 deficiency may represent an inherited autosomal recessive bleeding disorder. See, for instance, Reilly, T. M., et al.,
  • Recombinant plasminogen activator inhibitor type 1 a review of structural, functional, and biological aspects, Blood Coag. And Fibrinolysis 5:73-81 (1994).
  • the se ⁇ ins are a gene family that encompasses a wide variety of protein products, including many of the proteinase inhibitors in plasma (Huber & Carrell,
  • se ⁇ ins are proteinase inhibitors. They include steroid binding globulins, the prohormone angiotensinogen, the egg white protein ovalbumin, and barley protein Z, a major constituent of beer. The se ⁇ ins are thought to share a common tertiary structure (Doolittle. 1983) and to have evolved from a common ancestor (Hunt & Dayhoff. 1980). Proteins with recognizable sequence homology have been identified in vertebrates, plants, insects and viruses but not, thus far, in prokaryotes (Huber & Carrell. 1989; Sasaki.
  • the native reactive center is part of an exposed loop, also called the strained loop (Loebermann, Tokuoka, Deisenhofer, & Huber. 1984; Carrell & Boswell. 1986; Sprang. 1992).
  • this loop moves or "snaps back", becoming one of the central strands in a major ⁇ -sheet structure ( ⁇ -sheet A).
  • This transformation is accompanied by a large increase in thermal stability (Carrell & Owen. 1985; Gettins & Harten. 1988; Bruch, Weiss, & Engel. 1988; Lawrence, Olson, Palaniappan, & Ginsburg. 1994b).
  • the bait amino acid is called the PI residue, with the amino acids toward the N-terminal side of the scissile reactive center bond labeled in order PI P2 P3 etc. and the amino acids on the carboxyl side labeled PI' P2' etc. (Carrell & Boswell. 1986).
  • the reactive center Pl-Pl' residues appear to play a major role in determining target specificity.
  • Se ⁇ ins the superfamily of plasma serine proteinase inhibitors.
  • Se ⁇ ins mobile conformations in a family of proteinase inhibitors. Curr Opin Struct Biol, 2, 438-446.
  • Angiotensinogen is related to the antitrypsin-antithrombin- ovalbumin family. Science, 222, 417-419. Fa, M., Karolin, J., Aleshkov, S., Strandberg, L., Johansson, L.B.-A., & Ny, T. (1995). Time-Resolved Polarized Fluorescence Spectroscopy Studies of Plasminogen Activator Inhibitor Type 1 : Conformational Changes of the Reactive Center upon Interactions with Target proteases, Vitronectin and Heparin. Biochemistry, 34, 13833-13840.
  • Endothelial cells produce a latent inhibitor of plasminogen activators that can be activated by denaturants.
  • PAI-1 Engineering plasminogen activator inhibitor- 1 (PAI-1) mutants with increased functional stability. Biochemistry, 33, 3643-3648. Lawrence, D.A., Olson, S ., Palaniappan, S., & Ginsburg, D. (1994b). Se ⁇ in reactive-center loop mobility is required for inhibitor function but not for enzyme recognition. The Journal of Biological Chemistry, 269, 27657-27662.
  • Se ⁇ in-serine protease binding kinetics alpha-2-antiplasmin as a model inhibitor. Biochemistry, 30, 979-986.
  • neurons form axons which extend along a prespecified path into the target area, where they engage in the formation and refinement of synaptic connections. These stages depend critically on the capability of the axonal growth cones to interact with a variety of structures which they encounter along their way and at their destination. These structures include cell surfaces of neuronal and non-neuronal origin and the extracellular matrix.
  • growth cones along their trajectory and at their target sites, growth cones not only receive and respond to signals from their local environment, but also actively secrete macromolecules.
  • secreted proteases have been implicated in supporting the growth cone advancement through the tissue. More than a decade ago, it was demonstrated that plasminogen activators are axonally secreted by neurons in culture.
  • PNI Protease nexin I
  • glia-derived nexin is a 43-47-kDa protein that was first found secreted by cultured fibroblasts but is also produced by glial (glioma and primary) and skeletal muscle cells.
  • PNI has been shown to promote neurite outgrowth from different neuronal cell types. These include neuroblastoma cells, as well as primary hippocampal and sympathetic neurons.
  • the neurite- promoting activity of PNI in vitro is mediated by inhibition of thrombin, a potent serine protease.
  • PNI mRNA and protein
  • PNI-producing cells are localized distal to the lesion site. This up-regulation of PNI occurs 2-3 days after a similar up-regulation of prothrombin and thrombin in the distal stump. Free PNI protein is significantly decreased, while endogenous PNI-thrombin complexes are increased, in various anatomical brain regions, including hippocampus of patients with Alzheimer disease.
  • neurose ⁇ in may function as an axonally secreted regulator of the local extracellular proteolysis involved in the reorganization of the synaptic connectivity during development and synapse plasticity in the adult.
  • a role for serine proteases and se ⁇ ins in neuronal remodeling is further supported by the finding that elevated tPA mRNA and protein levels are found in cerebellar Purkinje neurons of rats undergoing motor learning (Seeds NW; Williams BL; Bickford P.C, "Tissue plasminogen activator induction in Purkinje neurons after cerebellar motor learning.” Science 270: 1992-4 (1995)).
  • the present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding the human BAIT polypeptide having the amino acid sequence shown in Figure 1 (SEQ ID NO:2) or the amino acid sequence encoded by the cDNA clone deposited in a bacterial host as ATCC Deposit Number 97722 on September 18, 1996.
  • the nucleotide sequence determined by sequencing the deposited BAIT clone, which is shown in Figure 1 (SEQ ID NO: 1) contains an open reading frame encoding a complete polypeptide of 410 amino acid residues, including an initiation codon at positions 89-91, and a predicted molecular weight of about 46.4 kDa.
  • the encoded polypeptide has a leader sequence of 18 amino acids, underlined in Figure 1; and the amino acid sequence of the expressed mature BAIT protein is also shown in Figure 1, as amino acid residues 19-410 (SEQ ID NO: 2).
  • the human BAIT protein of the present invention has been shown to exhibit selective inhibition of tissue-type plasminogen activator (t-PA) with relatively little inhibition of trypsin, thrombin or urokinase-type plasminogen activator (u-PA).
  • t-PA tissue-type plasminogen activator
  • u-PA urokinase-type plasminogen activator
  • the human BAIT polypeptide also shares extensive sequence homology with the translation product of the mRNA for a se ⁇ in-related protein isolated from brain cDNA library which has been named "neurose ⁇ in” (SEQ ID NO:3) (see Figure 2).
  • Neurose ⁇ in in the chicken is thought to play an important an important role in regulation of local extracellular proteolysis involved in the reorganization of the synaptic connectivity during development and synapse plasticity in the adult.
  • one aspect of the invention provides an isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence encoding the BAIT polypeptide having the complete amino acid sequence in Figure 1 (SEQ ID NO:2); (b) a nucleotide sequence encoding the expressed mature BAIT polypeptide having the amino acid sequence at positions 19-410 in Figure 1 (SEQ ID NO:2); (c) a nucleotide sequence encoding the
  • nucleic acid molecules that comprise a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical, to any of the nucleotide sequences in (a), (b), (c), (d) or (e), above, or a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide in (a), (b), (c),
  • An additional nucleic acid embodiment of the invention relates to an isolated nucleic acid molecule comprising a polynucleotide which encodes the amino acid sequence of an epitope-bearing portion of a BAIT polypeptide having an amino acid sequence in (a), (b), (c) or (d), above.
  • the present invention also relates to recombinant vectors, which include the isolated nucleic acid molecules of the present invention, and to host cells containing the recombinant vectors, as well as to methods of making such vectors and host cells and for using them for production of BAIT polypeptides or peptides by recombinant techniques.
  • the invention further provides an isolated BAIT polypeptide having an amino acid sequence selected from the group consisting of: (a) the amino acid sequence of the BAIT polypeptide having the complete amino acid sequence including the leader sequence shown in Figure 1 (SEQ ID NO:2); (b) the amino acid sequence of the mature BAIT polypeptide (without the leader) having the amino acid sequence at positions 19-410 in Figure 1 (SEQ ID NO:2); (c) the amino acid sequence of the BAIT polypeptide having the complete amino acid sequence, including the leader, encoded by the cDNA clone contained in ATCC Deposit No. 97722; and (d) the amino acid sequence of the mature BAIT polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No.
  • polypeptides of the present invention also include polypeptides having an amino acid sequence at least 80% identical, more preferably at least 90% identical, and still more preferably 95%, 96%, 97%, 98% or 99% identical to those described in (a), (b), (c) or (d) above, as well as polypeptides having an amino acid sequence with at least 90% similarity, and more preferably at least 95%, 96%, 97%, 98% or 99% similarity, to those above.
  • An additional embodiment of this aspect of the invention relates to a peptide or polypeptide which has the amino acid sequence of an epitope-bearing portion of a BAIT polypeptide having an amino acid sequence described in (a), (b), (c) or (d), above.
  • Peptides or polypeptides having the amino acid sequence of an epitope-bearing portion of a BAIT polypeptide of the invention include portions of such polypeptides with at least six or seven, preferably at least nine, and more preferably at least about 30 amino acids to about 50 amino acids, although epitope-bearing polypeptides of any length up to and including the complete amino acid sequence of a polypeptide of the invention described above also are included in the invention.
  • the invention provides an isolated antibody that binds specifically to a BAIT polypeptide having an amino acid sequence described in (a), (b), (c) or (d) above.
  • the invention further provides methods for isolating antibodies that bind specifically to a BAIT polypeptide having an amino acid sequence as described herein. Such antibodies are useful diagnostically or therapeutically as described below.
  • the present invention also provides a screening method for identifying compounds capable of enhancing or inhibiting a biological activity of the BAIT polypeptide, which involves contacting a protease which is inhibited by the BAIT polypeptide with the candidate compound in the presence of a partially inhibitory amount of BAIT polypeptide, assaying proteolytic activity of the protease on a susceptible substrate in the presence of the candidate compound and partially inhibitory amount of BAIT polypeptide, and comparing the proteolytic activity to a standard level of activity, the standard being assayed when contact is made between the protease and its substrate in the presence of the partially inhibitory amount of BAIT polypeptide and the absence of the candidate compound
  • an increase in inhibition of proteolytic activity over the standard indicates that the candidate compound is an agonist of BAIT inhibitory activity and a decrease in inhibition of proteolytic activity compared to the standard indicates that the compound is an antagonist of BAIT inhibitory activity.
  • a screening assay for agonists and antagonists involves determining the effect a candidate compound has on BAIT binding to the active site of a susceptible protease.
  • the method involves contacting the BAIT-susceptible protease with a BAIT polypeptide and a candidate compound and determining whether BAIT polypeptide binding to the BAIT-susceptible protease is increased or decreased due to the presence of the candidate compound.
  • BAIT is expressed in whole human brain, and to a much lesser extent in adult pancreas and adult heart.
  • significantly higher or lower levels of BAIT gene expression may be detected in certain tissues (e.g., adult brain, embryonic retina, cerebellum and spinal chord) or bodily fluids (e.g., serum, plasma, urine, synovial fluid or spinal fluid) taken from an individual having such a disorder, relative to a "standard" BAIT gene expression level, i.e., the BAIT expression level in healthy tissue from an individual not having the nervous system disorder.
  • the invention provides a diagnostic method useful during diagnosis of nervous system disorders, which involves: (a) assaying BAIT gene expression level in cells or body fluid of an individual; (b) comparing the BAIT gene expression level with a standard BAIT gene expression level, whereby an increase or decrease in the assayed BAIT gene expression level compared to the standard expression level is indicative of disorder in the nervous system.
  • An additional aspect of the invention is related to a method for treating an individual in need of an increased level of BAIT activity in the body (i.e., insufficient protease inhibitory activity of BAIT and/or excessive protease activity of a protease inhabited by BAIT, particularly t-PA), which method comprises administering to such an individual a composition comprising a therapeutically effective amount of an isolated BAIT polypeptide of the invention or an agonist thereof.
  • a still further aspect of the invention is related to a method for treating an individual in need of a decreased level of BAIT activity in the body (i.e., less inhibition of a protease susceptible to BAIT) comprising, administering to such an individual a composition comprising a therapeutically effective amount of a BAIT antagonist.
  • Preferred antagonists for use in the present invention are BAIT-specific antibodies.
  • Figure 1 shows the nucleotide sequence (SEQ ID NO:l) and deduced amino acid sequence (SEQ ID NO:2) of the human BAIT polypeptide.
  • the leader sequence of 18 amino acids is underlined.
  • Figure 2 shows the regions of identity between the amino acid sequences of the human BAIT protein and other indicated se ⁇ ins with which the human BAIT polypeptide shares significant homology, as follows: bovine plasminogen activator inhibitor-1 (BovPAIl; SEQ ID NO:4); rat glial-derived nexin I (RatGDNI; SEQ ID NO:5); mouse antithrombin III (MusATIII; SEQ ID NO:6); chicken neurose ⁇ in
  • FIG. 3 shows an analysis of the BAIT amino acid sequence. Alpha, beta, turn and coil regions; hydrophilicity and hydrophobicity; amphipathic regions; flexible regions; antigenic index and surface probability are shown.
  • Antigenic Index - Jameson- Wolf ' graph the location of the highly antigenic regions of the BAIT protein, i.e., regions from which epitope-bearing peptides of the invention may be obtained.
  • Figure 4 shows the relationship between the deposited cDNA clone (identified as clone HSDFB5501X; SEQ ID NO: 1) and three related cDNA clones of the invention, designated HPBCT06R (SEQ ID NO:7), HBPDG64R (SEQ ID NO:8), and HPBCR79R (SEQ ID NO:9).
  • Figure 5 shows the results of tests for inhibitory activity of purified human BAIT polypeptide on several proteolytic enzymes including thrombin (2 nM; - ⁇ -); tissue-type plasminogen activator (tPA, 5 nM; -O-), urokinase-type plasminogen activator (uPA, 2 nM; -D-), plasmin (5 nM; -V-), and trypsin (2 nM; - -).
  • thrombin 2 nM; - ⁇ -
  • tissue-type plasminogen activator tPA, 5 nM; -O-
  • uPA urokinase-type plasminogen activator
  • uPA urokinase-type plasminogen activator
  • uPA urokinase-type plasminogen activator
  • uPA urokinase-type plasminogen activator
  • plasmin 5 nM; -V
  • the present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding a human BAIT polypeptide having the amino acid sequence shown in Figure 1 (SEQ ID NO:2), which was determined by sequencing a cloned cDNA.
  • the nucleotide sequence shown in Figure 1 (SEQ ID NO: 1) was obtained by sequencing the HSDFB55S01 clone, which was deposited on September 18, 1996 at the American Type Culture Collection, 12301 Park Lawn Drive, Rockville, Maryland 20852, and given accession number ATCC 97722.
  • the deposited clone is contained in the pBluescript SK(-) plasmid (Stratagene, La Jolla, CA).
  • nucleotide sequences determined by sequencing a DNA molecule herein were determined using an automated DNA sequencer (such as the Model 373 from Applied Biosystems, Inc., Foster City, CA), and all amino acid sequences of polypeptides encoded by DNA molecules determined herein were predicted by translation of a DNA sequence determined as above. Therefore, as is known in the art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein may contain some errors. Nucleotide sequences determined by automation are typically at least about 90% identical, more typically at least about 95% to at least about 99.9% identical to the actual nucleotide sequence of the sequenced DNA molecule. The actual sequence can be more precisely determined by other approaches including manual DNA sequencing methods well known in the art.
  • nucleotide sequence As is also known in the art, a single insertion or deletion in a determined nucleotide sequence compared to the actual sequence will cause a frame shift in translation of the nucleotide sequence such that the predicted amino acid sequence encoded by a determined nucleotide sequence will be completely different from the amino acid sequence actually encoded by the sequenced DNA molecule, beginning at the point of such an insertion or deletion.
  • each "nucleotide sequence" set forth herein is presented as a sequence of deoxyribonucleotides (abbreviated A, G, C and T).
  • nucleotide sequence of a nucleic acid molecule or polynucleotide is intended, for a DNA molecule or polynucleotide, a sequence of deoxyribonucleotides, and for an RNA molecule or polynucleotide, the corresponding sequence of ribonucleotides (A, G, C and U), where each thymidine deoxyribonucleotide (T) in the specified deoxyribonucleotide sequence is replaced by the ribonucleotide uridine (U).
  • RNA molecule having the sequence of SEQ ID NO: 1 set forth using deoxyribonucleotide abbreviations is intended to indicate an RNA molecule having a sequence in which each deoxyribonucleotide A, G or C of
  • SEQ ID NO: 1 has been replaced by the corresponding ribonucleotide A, G or C, and each deoxyribonucleotide T has been replaced by a ribonucleotide U.
  • a nucleic acid molecule of the present invention encoding a BAIT polypeptide may be obtained using standard cloning and screening procedures, such as those for cloning cDNAs using mRNA as starting material.
  • the nucleic acid molecule described in Figure 1 (SEQ ID NO: 1) was discovered in a cDNA library derived from whole human brain. Additional cDNA clones of the BAIT gene were also identified in cDNA libraries from the following tissues: spinal cord, pineal gland and adrenal gland tumor.
  • the determined nucleotide sequence of the BAIT cDNA of Figure 1 contains an open reading frame encoding a protein of 410 amino acid residues, with an initiation codon at positions 89-91, and a predicted molecular weight of about 46.4 kDa.
  • the encoded polypeptide has a leader sequence of 18 amino acids, underlined in Figure 1 ; and the amino acid sequence of the expressed mature BAIT protein is also shown in Figure 1, as amino acid residues 19-410 (SEQ ID NO:2).
  • the amino acid sequence of the BAIT protein shown in Figure 1 is about 80 % identical to the published mRNA for chicken neurose ⁇ in (Osterwalder, T., et al., 1996, supra) as shown in Figure 2.
  • Figure 2 shows the regions of identity between the amino acid sequences of the human BAIT protein and other indicated se ⁇ ins with which the human BAIT polypeptide shares significant homology, as follows: bovine plasminogen activator inhibitor- 1 (BovPAIl; SEQ ID NO:4); rat glial-derived nexin I (RatGDNI; SEQ ID NO:5); mouse antithrombin IH (MusATIII; SEQ ID NO:6); chicken neurose ⁇ in (ChkNSP;SEQ ID NO:3).
  • the BAIT region corresponding to the ATffl heparin-binding site has 4 acidic amino acids which implies that heparin is not a co-factor as it is with ATIII.
  • One potentially significant difference between BAIT and neurose ⁇ in is the presence of 3 consensus N-linked glycosylation sites in the former versus 2 in the latter.
  • BAIT and neurose ⁇ in are likely to have similar enzymatic properties which may not overlap those of the related se ⁇ ins.
  • the amino acid sequence of the complete BAIT protein includes a leader sequence and a mature protein, as shown in Figure 1 (SEQ ID NO:2). More in particular, the present invention provides nucleic acid molecules encoding one or more mature form(s) of the BAIT protein.
  • proteins secreted by mammalian cells have a signal or secretory leader sequence which is cleaved from the mature protein once export of the growing protein chain across the rough endoplasmic reticulum has been initiated.
  • Most mammalian cells and even insect cells cleave secreted proteins with the same specificity. However, in some cases, cleavage of a secreted protein is not entirely uniform, which results in two or more mature species of the protein.
  • the present invention provides a nucleotide sequence encoding the mature BAIT polypeptide having the amino acid sequence encoded by the cDNA clone contained in the host identified as ATCC Deposit No. 97722.
  • Deposit No. 97722 is meant the mature form(s) of the BAIT protein produced by expression in a mammalian cell (e.g., COS cells, as described below) of the complete open reading frame encoded by the human DNA sequence of the clone contained in the vector in the deposited host.
  • a mammalian cell e.g., COS cells, as described below
  • the deposited cDNA has been expressed in insect cells using a baculovirus expression vector, as described hereinbelow; and amino acid sequencing of the amino terminus of the secreted species indicated that the N-terminus of the mature BAIT protein comprises the amino acid sequence beginning at amino acid 19 of Figure 1 (SEQ ID NO:2).
  • the leader sequence of the BAIT protein in the amino acid sequence of Figure 1 is 18 amino acids, from position 1 to 18 in Figure 1 (SEQ ID NO:2).
  • the predicted 410 amino acids of the complete BAIT (prepro) polypeptide is expected to yield a 46.4 kDa band.
  • the observed doublet band of 45 and 46 kDa upon expression in the baculovirus system was within the expected size range when the putative 18 amino acid signal peptide is removed.
  • the approximate 1 kDa difference in the observed doublet bands may be explained by differential glycosylation.
  • Evidence to support this includes the three consensus N-linked glycosylation site present in the nucleotide sequence ( Figure 1) and the presence of oligosaccharide moieties on the purified protein determined experimentally.
  • N-Terminal and C-terminal Deletion Mutants In addition to the mature form of a protein being biologically active, it is known in the art for many proteins, including the mature form(s) of a secreted protein, that one or more amino acids may be deleted from the N-terminus without substantial loss of biological function. In the present case, deletions of at least up to 30 N- terminal amino acids from the end of the mature (secreted) polypeptide may retain some biological activity such as binding to the active site of at least one protease.
  • deletion of one or more amino acids from the N-terminus of a protein results in modification of loss of one or more biological functions of the protein, other biological activities may still be retained.
  • the ability of the shortened protein to induce and/or binding to antibodies which recognize the complete or mature protein generally will be retained when less than the majority of the residues of the complete or mature protein are removed from the N-terminus. Whether a particular polypeptide lacking N-terminal residues of a complete protein retains such immunologic activities can readily be determined by routine methods described herein and otherwise known in the art.
  • deletion of one or more amino acids from the C-terminus of a protein also may provide shortened polypeptides which retain some or all biological activities.
  • the present invention further provides polypeptides having one or more residues from the amino terminus of the amino acid sequence of the complete BAIT polypeptide in SEQ ID NO:2, up to 30 residues from the amino terminus after the leader cleavage site described above, and polynucleotides encoding such polypeptides.
  • the present invention provides polypeptides having the amino acid sequence of residues n-410 of the amino acid sequence in SEQ ID NO:2, where n is any integer in the range of 2-49 specified range and 49 is the position of the 30th residue from the N-terminus of the mature polypeptide, after the above leader cleavage site, as shown in the amino acid sequence in SEQ ID NO:2. More in particular, the invention provides polypeptides having the amino acid sequence of residues 2-410, 3-410, 4-410, 5-410, 6-410, 7-410, 8-410, 9-410, 10-410, 1 1-410,
  • the present invention further provides polypeptides having one or more residues from the carboxyl terminus of the amino acid sequence of the complete BAIT polypeptide in SEQ ID NO:2, up to 30 residues from the carboxyl terminus, and polynucleotides encoding such polypeptides.
  • the present invention provides polypeptides having the amino acid sequence of residues 1 -m of the amino acid sequence in SEQ ID NO:2, where m is any integer in the range of 381-409, as shown in the amino acid sequence in SEQ ID NO:2. More in particular, the invention provides polypeptides having the amino acid sequence of residues 1-381, 1-382, 1- 383, 1-384, 1-385, 1-386, 1-387, etc.
  • polypeptides up to 1-408 of SEQ ID NO:2.
  • Polynucleotides encoding these polypeptides also are provided.
  • polypeptides (and polynucleotides encoding these) having both N-terminal and C- terminal deletions together, of the general formula n-m of SEQ ID NO: 2 are included, where n and m are integers as defined above.
  • nucleic acid molecules of the present invention may be in the form of RNA, such as mRNA, or in the form of DNA, including, for instance, cDNA and genomic DNA obtained by cloning or produced synthetically.
  • the DNA may be double-stranded or single-stranded.
  • Single-stranded DNA or RNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also referred to as the anti-sense strand.
  • isolated nucleic acid molecule(s) is intended a nucleic acid molecule,
  • DNA or RNA which has been removed from its native environment
  • recombinant DNA molecules contained in a vector are considered isolated for the pu ⁇ oses of the present invention.
  • isolated DNA molecules include recombinant DNA molecules maintained in heterologous host cells or purified (partially or substantially) DNA molecules in solution.
  • isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA molecules of the present invention.
  • Isolated nucleic acid molecules according to the present invention further include such molecules produced synthetically.
  • Isolated nucleic acid molecules of the present invention include DNA molecules comprising an open reading frame (ORF) with an initiation codon at positions 89-91 of the nucleotide sequence shown in Figure 1 (SEQ ID NO: 1); DNA molecules comprising the coding sequence for the mature BAIT protein shown in Figure 1 (amino acids 19-410) (SEQ ID NO: 2); and DNA molecules which comprise a sequence substantially different from those described above but which, due to the degeneracy of the genetic code, still encode the BAIT protein.
  • ORF open reading frame
  • SEQ ID NO: 2 DNA molecules comprising the coding sequence for the mature BAIT protein shown in Figure 1 (amino acids 19-410)
  • SEQ ID NO: 2 DNA molecules which comprise a sequence substantially different from those described above but which, due to the degeneracy of the genetic code, still encode the BAIT protein.
  • the genetic code is well known in the art. Thus, it would be routine for one skilled in the art to generate the degenerate variants described above.
  • the invention provides isolated nucleic acid molecules encoding the BAIT polypeptide having an amino acid sequence encoded by the cDNA clone contained in the plasmid deposited as ATCC Deposit No. 97722.
  • this nucleic acid molecule will encode the mature polypeptide encoded by the above-described deposited cDNA clone.
  • the invention further provides an isolated nucleic acid molecule having the nucleotide sequence shown in Figure 1 (SEQ ID NO: 1 ) or the nucleotide sequence of the BAIT cDNA contained in the above-described deposited clone, or a nucleic acid molecule having a sequence complementary to one of the above sequences.
  • Such isolated molecules, particularly DNA molecules are useful as probes for gene mapping, by in situ hybridization with chromosomes, and for detecting expression of the BAIT gene in human tissue, for instance, by Northern blot analysis.
  • the present invention is further directed to nucleic acid molecules encoding portions of the nucleotide sequences described herein as well as to fragments of the isolated nucleic acid molecules described herein.
  • the invention provides a polynucleotide having a nucleotide sequence representing the portion of SEQ ID NO: l which consists of positions 1-410 of SEQ ID NO: 1.
  • the invention provides nucleic acid molecules having related nucleotide sequences determined from the following related cDNA clones: HPBCT06R (SEQ ID NO:7), HBPDG64R (SEQ
  • fragments 50-300 nt in length are also useful according to the present invention as are fragments corresponding to most, if not all, of the nucleotide sequence of the deposited cDNA or as shown in Figure 1 (SEQ ID NO: 1).
  • a fragment at least 20 nt in length for example, is intended fragments which include 20 or more contiguous bases from the nucleotide sequence of the deposited cDNA or the nucleotide sequence as shown in Figure 1 (SEQ ID NO: 1). Since the gene has been deposited and the nucleotide sequence shown in Figure 1 (SEQ ID NO:l) is provided, generating such DNA fragments would be routine to the skilled artisan. For example, restriction endonuclease cleavage or shearing by sonication could easily be used to generate fragments of various sizes. Alternatively, such fragments could be generated synthetically.
  • Preferred nucleic acid fragments of the present invention include nucleic acid molecules encoding epitope-bearing portions of the BAIT polypeptide as identified in Figure 3 and described in more detail below.
  • the invention provides an isolated nucleic acid molecule comprising a polynucleotide which hybridizes under stringent hybridization conditions to a portion of the polynucleotide in a nucleic acid molecule of the invention described above, for instance, the cDNA clone contained in ATCC Deposit 97722.
  • stringent hybridization conditions is intended overnight incubation at 42 C in a solution comprising: 50% formamide, 5x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in O.lx SSC at about 65 C
  • a polynucleotide which hybridizes to a "portion" of a polynucleotide is intended a polynucleotide (either DNA or RNA) hybridizing to at least about 15 nucleotides (nt), and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably about 50-70 nt of the reference polynucleotide. These are useful as diagnostic probes and primers as discussed above and in more detail below.
  • polynucleotides hybridizing to a larger portion of the reference polynucleotide e.g., the deposited cDNA clone
  • a portion 50-300 nt in length, or even to the entire length of the reference polynucleotide are also useful as probes according to the present invention, as are polynucleotides corresponding to most, if not all, of the nucleotide sequence of the deposited cDNA or the nucleotide sequence as shown in Figure 1 (SEQ ID NO: 1).
  • such portions are useful diagnostically either as a probe according to conventional DNA hybridization techniques or as primers for amplification of a target sequence by the polymerase chain reaction (PCR), as described, for instance, in Molecular Cloning, A Laboratory Manual, 2nd. edition, Sambrook, J., Fritsch, E. F. and Maniatis, T., eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
  • generating polynucleotides which hybridize to a portion of the BAIT cDNA molecule would be routine to the skilled artisan.
  • restriction endonuclease cleavage or shearing by sonication of the BAIT cDNA clone could easily be used to generate DNA portions of various sizes which are polynucleotides that hybridize to a portion of the BAIT cDNA molecule.
  • the hybridizing polynucleotides of the present invention could be generated synthetically according to known techniques.
  • a polynucleotide which hybridizes only to a poly A sequence such as the 3 terminal poly(A) tract of the BAIT cDNA shown in Figure 1 (SEQ ID NO: 1)), or to a complementary stretch of T (or U) residues, would not be included in a polynucleotide of the invention used to hybridize to a portion of a nucleic acid of the invention, since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly (A) stretch or the complement thereof (e.g., practically any double-stranded cDNA clone).
  • nucleic acid molecules of the present invention which encode a BAIT polypeptide may include, but are not limited to those encoding the amino acid sequence of the mature polypeptide, by itself; the coding sequence for the mature polypeptide and additional sequences, such as those encoding the about 18 amino acid leader or secretory sequence, such as a pre-, or pro- or prepro- protein sequence; the coding sequence of the mature polypeptide, with or without the aforementioned additional coding sequences, together with additional, non-coding sequences, including for example, but not limited to introns and non-coding 5' and 3' sequences, such as the transcribed, non-translated sequences that play a role in transcription, mRNA processing, including splicing and polyadenylation signals, for example - ribosome binding and stability of mRNA; an additional coding sequence which codes for additional amino acids, such as those which provide additional functionalities.
  • the sequence encoding the polypeptide may be fused to a marker sequence, such as a sequence encoding a peptide which facilitates purification of the fused polypeptide.
  • the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc.), among others, many of which are commercially available.
  • hexa-histidine provides for convenient purification of the fusion protein.
  • the "HA” tag is another peptide useful for purification which corresponds to an epitope derived from the influenza hemagglutinin protein, which has been described by Wilson et al., Cell 57:767 (1984).
  • other such fusion proteins include the BAIT fused to Fc at the N- or C-terminus.
  • the present invention further relates to variants of the nucleic acid molecules of the present invention, which encode portions, analogs or derivatives of the BAIT protein.
  • Variants may occur naturally, such as a natural allelic variant.
  • allelic variant is intended one of several alternate forms of a gene occupying a given locus on a chromosome of an organism. Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985).
  • Non-naturally occurring variants may be produced using art-known mutagenesis techniques.
  • Such variants include those produced by nucleotide substitutions, deletions or additions. The substitutions, deletions or additions may involve one or more nucleotides.
  • the variants may be altered in coding regions, non-coding regions, or both. Alterations in the coding regions may produce conservative or non-conservative amino acid substitutions, deletions or additions. Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the BAIT protein or portions thereof. Also especially preferred in this regard are conservative substitutions. Most highly preferred are nucleic acid molecules encoding the mature protein having the amino acid sequence shown in Figure 1 (SEQ ID NO:2) or the mature BAIT amino acid sequence encoded by the deposited cDNA clone.
  • nucleic acid molecules comprising a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical to (a) a nucleotide sequence encoding the full-length BAIT polypeptide having the complete amino acid sequence in Figure 1 (SEQ ID NO:2), including the leader sequence; (b) a nucleotide sequence encoding the mature BAIT polypeptide (full-length polypeptide with the leader removed) having the amino acid sequence at positions 19-94 in Figure 1 (SEQ ID NO:2); (c) a nucleotide sequence encoding the full-length BAIT polypeptide having the complete amino acid sequence including the leader encoded by the cDNA clone contained in ATCC Deposit No.
  • a polynucleotide having a nucleotide sequence at least, for example, 95% "identical" to a reference nucleotide sequence encoding a BAIT polypeptide is intended that the nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the BAIT polypeptide.
  • a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence.
  • These mutations of the reference sequence may occur at the 5 or 3 terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.
  • nucleic acid molecule is at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the nucleotide sequence shown in Figure 1 or to the nucleotides sequence of the deposited cDNA clone can be determined conventionally using known computer programs such as the
  • Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711). Bestfit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2:482-489 (1981), to find the best segment of homology between two sequences.
  • Bestfit or any other sequence alignment program to determine whether a particular sequence is, for instance, 95% identical to a reference sequence according to the present invention, the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference nucleotide sequence and that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.
  • the present application is directed to nucleic acid molecules at least 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence shown in Figure 1 (SEQ ID NO:l) or to the nucleic acid sequence of the deposited cDNA, irrespective of whether they encode a polypeptide having BAIT activity. This is because even where a particular nucleic acid molecule does not encode a polypeptide having BAIT activity, one of skill in the art would still know how to use the nucleic acid molecule, for instance, as a hybridization probe or a polymerase chain reaction (PCR) primer.
  • PCR polymerase chain reaction
  • nucleic acid molecules of the present invention that do not encode a polypeptide having BAIT activity include, inter alia, (1) isolating the BAIT gene or allelic variants thereof in a cDNA library; (2) in situ hybridization (e.g., "FISH") to metaphase chromosomal spreads to provide precise chromosomal location of the BAIT gene, as described in Verma et al., Human Chromosomes: A Manual of Basic
  • nucleic acid molecules having sequences at least 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence shown in Figure 1 (SEQ ID NO: 1) or to the nucleic acid sequence of the deposited cDNA which do, in fact, encode a polypeptide having BAIT protein activity.
  • a polypeptide having BAIT activity is intended polypeptides exhibiting activity similar, but not necessarily identical, to an activity of the BAIT protein of the invention (either the full-length protein or, preferably, the mature protein), as measured in a particular biological assay.
  • the BAIT protein of the present invention inhibits the proteolytic activity of tissue-type plasminogen activator (t-PA).
  • the assay involves measuring the inhibitory activity against various proteases, particularly tPA, using a single step chromogenic assay essentially as described (Lawrence, Strandberg, Ericson, & Ny, "Structure-function studies of the SERPIN plasminogen activator inhibitor type 1: analysis of chimeric strained loop mutants.” J. Biol. Chem. 265:
  • BAIT protein inhibits proteolytic activity of t-PA in a dose-dependent manner in the above-described assay.
  • a polypeptide having BAIT protein activity includes polypeptides that also exhibit any of the same t-PA-inhibiting activities in the above-described assay in a dose-dependent manner.
  • the degree of dose- dependent activity need not be identical to that of the BAIT protein, preferably, "a polypeptide having BAIT protein activity” will exhibit substantially similar dose- dependence in a given activity as compared to the BAIT protein (i.e., the candidate polypeptide will exhibit greater activity or not more than about 25-fold less and, preferably, not more than about tenfold less activity relative to the reference BAIT protein).
  • nucleic acid molecules having a sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of the deposited cDNA or the nucleic acid sequence shown in
  • Figure 1 SEQ ID NO: 1 will encode a polypeptide "having BAIT protein activity.”
  • degenerate variants of these nucleotide sequences all encode the same polypeptide, this will be clear to the skilled artisan even without performing the above described comparison assay.
  • a reasonable number will also encode a polypeptide having BAIT protein activity. This is because the skilled artisan is fully aware of amino acid substitutions that are either less likely or not likely to significantly effect protein function (e.g., replacing one aliphatic amino acid with a second aliphatic amino acid), as further described below.
  • Vectors and Host Cells The present invention also relates to vectors which include the isolated DNA molecules of the present invention, host cells which are genetically engineered with the recombinant vectors, and the production of BAIT polypeptides or fragments thereof by recombinant techniques.
  • the vector may be, for example, a phage, plasmid, viral or retroviral vector. Retroviral vectors may be replication competent or replication defective. In the latter case, viral propagation generally will occur only in complementing host cells.
  • the polynucleotides may be joined to a vector containing a selectable marker for propagation in a host.
  • a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, it may be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.
  • vectors comprising cis-acting control regions to the polynucleotide of interest.
  • Appropriate trans-acting factors may be supplied by the host, supplied by a complementing vector or supplied by the vector itself upon introduction into the host.
  • the vectors provide for specific expression, which may be inducible and/or cell type-specific. Particularly preferred among such vectors are those inducible by environmental factors that are easy to manipulate, such as temperature and nutrient additives.
  • Expression vectors useful in the present invention include chromosomal-, episomal- and virus-derived vectors, e.g., vectors derived from bacterial plasmids, bacteriophage, yeast episomes, yeast chromosomal elements, viruses such as baculoviruses, papova viruses, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as cosmids and phagemids.
  • the DNA insert should be operatively linked to an appropriate.
  • bacterial promoters suitable for use in the present invention include the E. coli lacl and lacZ promoters, the T3 and T7 promoters, the gpt promoter, the phage lambda PR and PL promoters, the phoA promoter and the trp promoter.
  • Suitable eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late S V40 promoters, the promoters of retroviral LTRs, such as those of the Rous sarcoma virus (RSV), and metallothionein promoters, such as the mouse metallothionein-I promoter.
  • RSV Rous sarcoma virus
  • metallothionein promoters such as the mouse metallothionein-I promoter.
  • Other suitable promoters will be known to the skilled artisan.
  • the expression constructs will further contain sites for transcription initiation, termination and, in the transcribed region, a ribosome binding site for translation.
  • the coding portion of the mature transcripts expressed by the constructs will preferably include a translation initiating at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated.
  • the expression vectors will preferably include at least one selectable marker. Such markers include dihydrofolate reductase, G418 or neomycin resistance for eukaryotic cell culture and tetracycline, kanamycin or ampicillin resistance genes for culturing in E. coli and other bacteria.
  • bacterial cells such as E. coli, Streptomyces and Salmonella typhimurium cells
  • fungal cells such as yeast cells
  • insect cells such as Drosophila S2 and Spodoptera Sf9 cells
  • animal cells such as CHO, COS, 293 and Bowes melanoma cells
  • plant cells Appropriate culture mediums and conditions for the above-described host cells are known in the art.
  • vectors preferred for use in bacteria include pQE70, pQE60 and pQE-9, available from QIAGEN; pBS vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNHl ⁇ a, pNH18A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia.
  • preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia.
  • Other suitable vectors will be readily apparent to the skilled artisan.
  • Recombinant constructs may be introduced into host cells using well known techniques such as infection, transduction, transfection, transvection, electroporation and transformation.
  • introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection or other methods.
  • Such methods are described in many standard laboratory manuals, such as Davis et al., Basic Methods In Molecular Biology (1986).
  • Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp in length that act to increase transcriptional activity of a promoter in a given host cell-type.
  • enhancers include the SV40 enhancer, which is located on the late side of the replication origin at bp 100 to 270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, immunoglobulin enhancer and adenovirus enhancers.
  • secretion signals may be inco ⁇ orated into the expressed polypeptide.
  • the signals may be endogenous to the polypeptide or they may be heterologous signals.
  • the polypeptide may be expressed in a modified form, such as a fusion protein, and may include not only secretion signals, but also additional heterologous functional regions. For instance, a region of additional amino acids, particularly charged amino acids, may be added to the N-terminus of the polypeptide to improve stability and persistence in the host cell, during purification, or during subsequent handling and storage. Also, peptide moieties may be added to the polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the polypeptide. The addition of peptide moieties to polypeptides to engender secretion or excretion, to improve stability and to facilitate purification, among others, are familiar and routine techniques in the art.
  • a preferred fusion protein comprises a heterologous region from immunoglobulin that is useful to stabilize and purify proteins.
  • EP-A-O 464 533 (Canadian counte ⁇ art 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobulin molecules together with another human protein or part thereof.
  • the Fc part in a fusion protein is thoroughly advantageous for use in therapy and diagnosis and thus results, for example, in improved pharmacokinetic properties (EP-A 0232 262).
  • Fc portion proves to be a hindrance to use in therapy and diagnosis, for example when the fusion protein is to be used as antigen for immunizations.
  • human proteins, such as hIL-5 has been fused with Fc portions for the pu ⁇ ose of high-throughput screening assays to identify antagonists of hIL-5. See, D. Bennett et al., Journal of Molecular Recognition 8:52-58 (1995) and K. Johanson et al., The Journal of Biological Chemistry 270:9459-9471 (1995).
  • Peptides and polypeptides of the present invention can be produced by chemical synthetic procedures known to those of ordinary skill in the art.
  • polypeptides up to about 80-90 amino acid residues in length may be produced on a commercially available peptide synthesizer model 433A (Applied Biosystems, Inc., Foster City, CA).
  • model 433A Applied Biosystems, Inc., Foster City, CA.
  • the full- length mature BAIT polypeptide can be produced synthetically.
  • the BAIT protein can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography (“HPLC”) is employed for purification.
  • HPLC high performance liquid chromatography
  • Polypeptides of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells. Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. In addition, polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes.
  • the invention further provides an isolated BAIT polypeptide having the amino acid sequence encoded by the deposited cDNA, or the amino acid sequence in Figure 1 (SEQ ID NO: 2), or a peptide or polypeptide comprising a portion of the above polypeptides.
  • the terms "peptide” and “oligopeptide” are considered synonymous (as is commonly recognized) and each term can be used interchangeably as the context requires to indicate a chain of at least two amino acids coupled by peptidyl linkages.
  • polypeptide is used herein for chains containing more than ten amino acid residues. All oligopeptide and polypeptide formulas or sequences herein are written from left to right and in the direction from amino terminus to carboxy terminus.
  • the invention further includes variations of the BAIT polypeptide which show substantial BAIT polypeptide activity or which include regions of BAIT protein such as the protein portions discussed below.
  • Such mutants include deletions, insertions, inversions, repeats, and type substitutions selected according to general rules known in the art so as have little effect on activity.
  • guidance concerning how to make phenotypically silent amino acid substitutions is provided in Bowie, J. U. et al., "Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substitutions," Science 247:1306-1310 (1990), wherein the authors indicate that there are two main approaches for studying the tolerance of an amino acid sequence to change.
  • the first method relies on the process of evolution, in which mutations are either accepted or rejected by natural selection.
  • the second approach uses genetic engineering to introduce amino acid changes at specific positions of a cloned gene and selections or screens to identify sequences that maintain functionality.
  • the BAIT polypeptide includes a reactive center loop (RCL) which interacts with its target proteinase.
  • RCL reactive center loop
  • Short peptides e.g., 8-30 residues
  • Such peptides are therefore antagonists of BAIT and also form part of the present invention.
  • mutants of BAIT with enhanced function are also provided by the invention, including : RCL replacements to increase inhibitory activity with tPA, trypsin or thrombin; mutations that increase structural stability or clearance half-life ; and mutations which enhance or block association with cof actors.
  • polypeptides of the present invention are preferably provided in an isolated form, and preferably are substantially purified.
  • a recombinantly produced version of the BAIT polypeptide can be substantially purified by the method described in Osterwalder et al., 1996, supra
  • the polypeptides of the present invention include the polypeptide encoded by the deposited cDNA including the leader, the mature polypeptide encoded by the deposited cDNA minus the leader (i.e., the mature protein), the polypeptide of Figure 1 (SEQ ID NO:2) including the leader, the polypeptide of Figure 1 (SEQ ID NO:2) minus the leader, as well as polypeptides which have at least 90% similarity, more preferably at least 95% similarity, and still more preferably at least 96%, 97%, 98% or
  • polypeptides of the present invention include polypeptides at least 80% identical, more preferably at least 90% or 95% identical, still more preferably at least 96%, 97%, 98% or 99% identical to the polypeptide encoded by the deposited cDNA, to the polypeptide of Figure 1 (SEQ ID NO:2), and also include portions of such polypeptides with at least 30 amino acids and more preferably at least 50 amino acids.
  • % similarity for two polypeptides is intended a similarity score produced by comparing the amino acid sequences of the two polypeptides using the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI
  • Bestfit uses the local homology algorithm of Smith and Waterman (Advances in Applied Mathematics 2:482-489, 1981) to find the best segment of similarity between two sequences.
  • a polypeptide having an amino acid sequence at least, for example, 95% "identical" to a reference amino acid sequence of a BAIT polypeptide is intended that the amino acid sequence of the polypeptide is identical to the reference sequence except that the polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the reference amino acid of the BAIT polypeptide.
  • up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference sequence.
  • alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
  • any particular polypeptide is at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the amino acid sequence shown in Figure 1 (SEQ ID NO:2) or to the amino acid sequence encoded by deposited cDNA clone can be determined conventionally using known computer programs such the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix,
  • the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference amino acid sequence and that gaps in homology of up to 5% of the total number of amino acid residues in the reference sequence are allowed.
  • polypeptide of the present invention could be used as a molecular weight marker on SDS-PAGE gels or on molecular sieve gel filtration columns using methods well known to those of skill in the art.
  • the polypeptides of the present invention can also be used to raise polyclonal and monoclonal antibodies, which are useful in assays for detecting BAIT protein expression as described below or as antagonists capable of enhancing or inhibiting BAIT protein function.
  • polypeptides can be used in the yeast two-hybrid system to "capture" BAIT protein binding proteins which are candidate target proteins for BAIT inhibition, according to the present invention.
  • the yeast two hybrid system is described in Fields and Song, Nature 340:245-246 (1989).
  • the invention provides a peptide or polypeptide comprising an epitope-bearing portion of a polypeptide of the invention.
  • the epitope of this polypeptide portion is an immunogenic or antigenic epitope of a polypeptide of the invention.
  • An "immunogenic epitope" is defined as a part of a protein that elicits an antibody response when the whole protein is the immunogen. These immunogenic epitopes are believed to be confined to a few loci on the molecule.
  • an antigenic epitope a region of a protein molecule to which an antibody can bind is defined as an "antigenic epitope.”
  • the number of immunogenic epitopes of a protein generally is less than the number of antigenic epitopes. See, for instance, Geysen et al., Proc. Natl. Acad. Sci. USA 81:3998- 4002 (1983).
  • Non-limiting examples of antigenic polypeptides or peptides that can be used to generate BAIT-specific antibodies include amino acid sequences shown in Figure 1 , as follows: a polypeptide comprising amino acid residues from about Val 31 to about Leu 47 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about Leu 62 to about Ser 88 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about Val 155 to about Ala 175 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about Phe 186 to about Pro 215 (SEQ ID NO: 2); a polypeptide comprising amino acid residues from about Tyr 225 to about He 239 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about Leu 243 to about Leu 255 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about Arg 380 to about Gly 386 (SEQ ID NO:2); and a poly
  • peptides or polypeptides bearing an antigenic epitope i.e., that contain a region of a protein molecule to which an antibody can bind
  • relatively short synthetic peptides that mimic part of a protein sequence are routinely capable of eliciting an antiserum that reacts with the partially mimicked protein. See, for instance, Sutcliffe, J. G., Shinnick, T. M., Green, N. and Learner, R.A. (1983) "Antibodies that react with predetermined sites on proteins", Science, 219:660-666.
  • Peptides capable of eliciting protein-reactive sera are frequently represented in the primary sequence of a protein, can be characterized by a set of simple chemical rules, and are confined neither to immunodominant regions of intact proteins (i.e., immunogenic epitopes) nor to the amino or carboxyl terminals. Peptides that are extremely hydrophobic and those of six or fewer residues generally are ineffective at inducing antibodies that bind to the mimicked protein; longer, peptides, especially those containing proline residues, usually are effective. Sutcliffe et al., supra, at 661.
  • 18 of 20 peptides designed according to these guidelines containing 8-39 residues covering 75% of the sequence of the influenza virus hemagglutinin HA1 polypeptide chain, induced antibodies that reacted with the HA1 protein or intact virus; and 12/12 peptides from the MuLV polymerase and 18/18 from the rabies glycoprotein induced antibodies that precipitated the respective proteins.
  • Antigenic epitope-bearing peptides and polypeptides of the invention are therefore useful to raise antibodies, including monoclonal antibodies, that bind specifically to a polypeptide of the invention.
  • a high proportion of hybridomas obtained by fusion of spleen cells from donors immunized with an antigen epitope-bearing peptide generally secrete antibody reactive with the native protein.
  • the antibodies raised by antigenic epitope-bearing peptides or polypeptides are useful to detect the mimicked protein, and antibodies to different peptides may be used for tracking the fate of various regions of a protein precursor which undergoes post-translational processing.
  • the peptides and anti-peptide antibodies may be used in a variety of qualitative or quantitative assays for the mimicked protein, for instance in competition assays since it has been shown that even short peptides (e.g., about 9 amino acids) can bind and displace the larger peptides in immunoprecipitation assays. See, for instance, Wilson et al., Cell 37:161-11% (1984) at 777.
  • the anti- peptide antibodies of the invention also are useful for purification of the mimicked protein, for instance, by adso ⁇ tion chromatography using methods well known in the art.
  • Antigenic epitope-bearing peptides and polypeptides of the invention designed according to the above guidelines preferably contain a sequence of at least seven, more preferably at least nine and most preferably between about 15 to about 30 amino acids contained within the amino acid sequence of a polypeptide of the invention.
  • peptides or polypeptides comprising a larger portion of an amino acid sequence of a polypeptide of the invention, containing about 30 to about 50 amino acids, or any length up to and including the entire amino acid sequence of a polypeptide of the invention, also are considered epitope-bearing peptides or polypeptides of the invention and also are useful for inducing antibodies that react with the mimicked protein.
  • the amino acid sequence of the epitope-bearing peptide is selected to provide substantial solubility in aqueous solvents (i.e., the sequence includes relatively hydrophilic residues and highly hydrophobic sequences are preferably avoided); and sequences containing proline residues are particularly preferred.
  • the epitope-bearing peptides and polypeptides of the invention may be produced by any conventional means for making peptides or polypeptides including recombinant means using nucleic acid molecules of the invention. For instance, a short epitope-bearing amino acid sequence may be fused to a larger polypeptide which acts as a carrier during recombinant production and purification, as well as during immunization to produce anti-peptide antibodies. Epitope-bearing peptides also may be synthesized using known methods of chemical synthesis.
  • Houghten has described a simple method for synthesis of large numbers of peptides, such as 10-20 mg of 248 different 13 residue peptides representing single amino acid variants of a segment of the HA1 polypeptide which were prepared and characterized (by
  • Epitope-bearing peptides and polypeptides of the invention are used to induce antibodies according to methods well known in the art. See, for instance, Sutcliffe et al., supra; Wilson et al., supra; Chow, M. et al., Proc. Natl. Acad. Sci. USA 82:910-914; and Bittle, F. J. et al., J. Gen. Virol. 66:2341-2354 (1985).
  • animals may be immunized with free peptide; however, anti-peptide antibody titer may be boosted by coupling of the peptide to a macromolecular carrier, such as keyhole limpet hemacyanin (KLH) or tetanus toxoid.
  • KLH keyhole limpet hemacyanin
  • peptides containing cysteine may be coupled to a carrier using a linker such as m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), while other peptides may be coupled to a carrier using a more general linking agent such as glutaraldehyde.
  • Animals such as rabbits, rats and mice are immunized with either free or carrier-coupled peptides, for instance, by intraperitoneal and/or intradermal injection of emulsions containing about 100 g peptide or carrier protein and Freund's adjuvant. Several booster injections may be needed, for instance, at intervals of about two weeks, to provide a useful titer of anti-peptide antibody which can be detected, for example, by ELISA assay using free peptide adsorbed to a solid surface.
  • the titer of anti-peptide antibodies in serum from an immunized animal may be increased by selection of anti-peptide antibodies, for instance, by adso ⁇ tion to the peptide on a solid support and elution of the selected antibodies according to methods well known in the art.
  • Immunogenic epitope-bearing peptides of the invention i.e., those parts of a protein that elicit an antibody response when the whole protein is the immunogen, are identified according to methods known in the art. For instance, Geysen et al., supra, discloses a procedure for rapid concurrent synthesis on solid supports of hundreds of peptides of sufficient purity to react in an enzyme-linked immunosorbent assay. Interaction of synthesized peptides with antibodies is then easily detected without removing them from the support. In this manner a peptide bearing an immunogenic epitope of a desired protein may be identified routinely by one of ordinary skill in the art.
  • the immunologically important epitope in the coat protein of foot-and-mouth disease virus was located by Geysen et al. with a resolution of seven amino acids by synthesis of an overlapping set of all 208 possible hexapeptides covering the entire 213 amino acid sequence of the protein. Then, a complete replacement set of peptides in which all 20 amino acids were substituted in turn at every position within the epitope were synthesized, and the particular amino acids conferring specificity for the reaction with antibody were determined.
  • peptide analogs of the epitope-bearing peptides of the invention can be made routinely by this method.
  • BAIT polypeptides of the present invention and the epitope-bearing fragments thereof described above can be combined with parts of the constant domain of immunoglobulins (IgG), resulting in chimeric polypeptides.
  • IgG immunoglobulins
  • These fusion proteins facilitate purification and show an increased half-life in vivo. This has been shown, e.g., for chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins (EP A 394,827;
  • BAIT is expressed in whole human brain, and to a much lesser extent in adult pancreas and adult heart. More particularly, by Northern blotting a 2 kb mRNA was expressed mostly in adult brain
  • ⁇ 5X pancreas
  • ⁇ 1X pancreas
  • -0.5X adult pancreas
  • Adult tissues not expressing significant amounts of mRNA include placenta, lung, liver, skeletal muscle, kidney, spleen, thymus, prostate, testis, ovary, small intestine, colon, and peripheral blood leukocytes.
  • a 2 kb mRNA was seen in cerebral cortex, medulla, occipital lobe, frontal lobe, temporal lobe, putamen, and spinal cord but not in cerebellum.
  • neurose ⁇ in the presumptive ortholog of the human BAIT protein, was found to be secreted from axons of both CNS and PNS neurons. Osterwalder et al., supra. The most prominant expression of neurose ⁇ in in adult chickens is found in the hyperstriatum accessorium, the neostriaum and the hippocampus, plastic regions of the adult brain involved in processes of learning and memory where a subtle balance between and anti-proteolytic activities seems to be required for appropriate synaptic function. Id. at 2951.
  • transgenic mice with an enhanced proteolytic activity in the cortex and hippocampus due to overexpression of urokinase-type plasminogen activator (u-PA) have been found to exhibit impaired spatial, olfactory and taste-aversion learning.
  • u-PA urokinase-type plasminogen activator
  • elimination of a se ⁇ in inhibitor of u-PA, PNI (described above) by homologous recombination leads to reduced long-term potentiation (LTP) of learning, whereas overexpression of PNI results in enhanced LTP of hippocampal neurons.
  • BAIT gene expression may be detected in certain tissues (e.g., adult brain, embryonic retina, cerebellum and spinal chord), or bodily fluids (e.g., serum, plasma, urine, synovial fluid or spinal fluid) taken from an individual having such a disorder, relative to a "standard" BAIT gene expression level, i.e., the BAIT expression level in healthy tissue from an individual not having the nervous system disorder.
  • tissues e.g., adult brain, embryonic retina, cerebellum and spinal chord
  • bodily fluids e.g., serum, plasma, urine, synovial fluid or spinal fluid
  • the invention provides a diagnostic method useful during diagnosis of nervous system disorders, which involves: (a) assaying BAIT gene expression level in cells or body fluid of an individual; (b) comparing the BAIT gene expression level with a standard BAIT gene expression level, whereby an increase or decrease in the assayed BAIT gene expression level compared to the standard expression level is indicative of disorder in the nervous system.
  • mammalian individuals preferably humans, including adults, children, babies and embryos or fetuses at all stages of development of the nervous system.
  • measuring the expression level of the gene encoding the BAIT protein is intended qualitatively or quantitatively measuring or estimating the level of the BAIT protein or the level of the mRNA encoding the BAIT protein in a first biological sample either directly (e.g., by determining or estimating absolute protein level or mRNA level) or relatively (e.g., by comparing to the BAIT protein level or mRNA level in a second biological sample).
  • the BAIT protein level or mRNA level in the first biological sample is measured or estimated and compared to a standard BAIT protein level or mRNA level, the standard being taken from a second biological sample obtained from an individual not having the disorder or being determined by averaging levels from a population of individuals not having a disorder of the immune system.
  • a standard BAIT protein level or mRNA level is known, it can be used repeatedly as a standard for comparison.
  • biological sample any biological sample obtained from an individual, body fluid, cell line, tissue culture, or other source which contains BAIT protein or mRNA.
  • biological samples include body fluids (such as sera, plasma, urine, synovial fluid and spinal fluid) which contain secreted mature BAIT protein, nervous system tissue, and other tissue sources found to express BAIT or a BAIT receptor.
  • body fluids such as sera, plasma, urine, synovial fluid and spinal fluid
  • tissue biopsies and body fluids from mammals are well known in the art.
  • tissue biopsy is the preferred source.
  • the present invention is useful for diagnosis of various nervous system- related disorders in mammals, preferably humans.
  • disorders include impaired processes of learning and memory, including impaired spatial, olfactory and taste- aversion learning, learning and memory impairments associated with Alzherimer's disease, and the like.
  • Total cellular RNA can be isolated from a biological sample using any suitable technique such as the single-step guanidinium-thiocyanate-phenol-chloroform method described in Chomczynski and Sacchi, Anal. Biochem. 162: 156-159 (1987). Levels of mRNA encoding the BAIT protein are then assayed using any appropriate method.
  • RNA molecules include Northern blot analysis, S 1 nuclease mapping, the polymerase chain reaction (PCR), reverse transcription in combination with the polymerase chain reaction (RT-PCR), and reverse transcription in combination with the ligase chain reaction (RT-LCR).
  • PCR polymerase chain reaction
  • RT-PCR reverse transcription in combination with the polymerase chain reaction
  • RT-LCR reverse transcription in combination with the ligase chain reaction
  • RNA is prepared from a biological sample as described above.
  • an appropriate buffer such as glyoxal/dimethyl sulfoxide/sodium phosphate buffer
  • the filter is prehybridized in a solution containing formamide, SSC, Denhardt's solution, denatured salmon sperm, SDS, and sodium phosphate buffer.
  • BAIT protein cDNA labeled according to any appropriate method such as the 32 P-multiprimed DNA labeling system (Amersham) is used as probe. After hybridization overnight, the filter is washed and exposed to x-ray film.
  • cDNA for use as probe according to the present invention is described in the sections above and will preferably be at least 15 bp in length. SI mapping can be performed as described in Fujita et al, Cell 49:351- 367
  • probe DNA for use in SI mapping
  • the sense strand of above-described cDNA is used as a template to synthesize labeled antisense DNA.
  • the antisense DNA can then be digested using an appropriate restriction endonuclease to generate further DNA probes of a desired length.
  • Such antisense probes are useful for visualizing protected bands corresponding to the target mRNA (i.e., mRNA encoding the BAIT protein).
  • Northern blot analysis can be performed as described above.
  • levels of mRNA encoding the BAIT protein are assayed using the RT-PCR method described in Makino et al, Technique 2:295-301 (1990).
  • the radioactivities of the "amplicons" in the polyacrylamide gel bands are linearly related to the initial concentration of the target mRNA.
  • this method involves adding total RNA isolated from a biological sample in a reaction mixture containing a RT primer and appropriate buffer. After incubating for primer annealing, the mixture can be supplemented with a RT buffer, dNTPs, DTT, RNase inhibitor and reverse transcriptase. After incubation to achieve reverse transcription of the RNA, the RT products are then subject to PCR using labeled primers.
  • a labeled dNTP can be included in the PCR reaction mixture.
  • PCR amplification can be performed in a DNA thermal cycler according to conventional techniques. After a suitable number of rounds to achieve amplification, the PCR reaction mixture is electrophoresed on a polyacrylamide gel. After drying the gel, the radioactivity of the appropriate bands (corresponding to the mRNA encoding the BAIT protein)) is quantified using an imaging analyzer.
  • RT and PCR reaction ingredients and conditions, reagent and gel concentrations, and labeling methods are well known in the art. Variations on the RT-PCR method will be apparent to the skilled artisan. Any set of oligonucleotide primers which will amplify reverse transcribed target mRNA can be used and can be designed as described in the sections above.
  • Assaying BAIT protein levels in a biological sample can occur using any art-known method.
  • Preferred for assaying BAIT protein levels in a biological sample are antibody-based techniques.
  • BAIT protein expression in tissues can be studied with classical immunohistological methods. In these, the specific recognition is provided by the primary antibody (polyclonal or monoclonal) but the secondary detection system can utilize fluorescent, enzyme, or other conjugated secondary antibodies.
  • an immunohistological staining of tissue section for pathological examination is obtained.
  • Tissues can also be extracted, e.g., with urea and neutral detergent, for the liberation of BAIT protein for Western-blot or dot/slot assay (Jalkanen, M., et al, J. Cell. Biol.
  • antibody-based methods useful for detecting BAIT protein gene expression include immunoassays, such as the enzyme linked immunosorbent assay
  • ELISA ELISA
  • RIA radioimmunoassay
  • a BAIT protein-specific monoclonal antibody can be used both as an immunoadsorbent and as an enzyme-labeled probe to detect and quantify the BAIT protein.
  • the amount of BAIT protein present in the sample can be calculated by reference to the amount present in a standard preparation using a linear regression computer algorithm.
  • Such an ELISA for detecting a tumor antigen is described in Iacobelli et al, Breast Cancer Research and Treatment 77:19-30 (1988).
  • two distinct specific monoclonal antibodies can be used to detect BAIT protein in a body fluid. In this assay, one of the antibodies is used as the immunoadsorbent and the other as the enzyme-labeled probe.
  • the above techniques may be conducted essentially as a "one-step” or “two-step” assay.
  • the "one-step” assay involves contacting BAIT protein with immobilized antibody and, without washing, contacting the mixture with the labeled antibody.
  • the "two-step” assay involves washing before contacting the mixture with the labeled antibody.
  • Other conventional methods may also be employed as suitable. It is usually desirable to immobilize one component of the assay system on a support, thereby allowing other components of the system to be brought into contact with the component and readily removed from the sample.
  • Suitable enzyme labels include, for example, those from the oxidase group, which catalyze the production of hydrogen peroxide by reacting with substrate.
  • Glucose oxidase is particularly preferred as it has good stability and its substrate (glucose) is readily available.
  • Activity of an oxidase label may be assayed by measuring the concentration of hydrogen peroxide formed by the enzyme-labeled antibody/substrate reaction.
  • radioisotopes such as iodine ( 125 I, 121 I), carbon ( l4 C), sulfur ( 35 S), tritium ( 3 H), indium ( 112 In), and technetium ( 99m Tc), and fluorescent labels, such as fluorescein and rhodamine, and biotin.
  • BAIT protein can also be detected in vivo by imaging.
  • Antibody labels or markers for in vivo imaging of BAIT protein include those detectable by X-radiography, NMR or ESR.
  • suitable labels include radioisotopes such as barium or cesium, which emit detectable radiation but are not overtly harmful to the subject.
  • Suitable markers for NMR and ESR include those with a detectable characteristic spin, such as deuterium, which may be inco ⁇ orated into the antibody by labeling of nutrients for the relevant hybridoma.
  • a BAIT protein-specific antibody or antibody fragment which has been labeled with an appropriate detectable imaging moiety such as a radioisotope (for example,
  • I31 I, l l2 In, 99m Tc a radio-opaque substance, or a material detectable by nuclear magnetic resonance, is introduced (for example, parenterally, subcutaneously or intraperitoneally) into the mammal to be examined for immune system disorder. It will be understood in the art that the size of the subject and the imaging system used will determine the quantity of imaging moiety needed to produce diagnostic images.
  • the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of 99m Tc.
  • the labeled antibody or antibody fragment will then preferentially accumulate at the location of cells which contain BAIT protein.
  • In vivo tumor imaging is described in S.W. Burchiel et al , "Immunopharmaco-kinetics of Radiolabeled Antibodies and Their
  • BAIT-protein specific antibodies for use in the present invention can be raised against the intact BAIT protein or an antigenic polypeptide fragment thereof, which may be presented together with a carrier protein, such as an albumin, to an animal system (such as rabbit or mouse) or, if it is long enough (at least about 25 amino acids), without a carrier.
  • a carrier protein such as an albumin
  • antibody As used herein, the term "antibody” (Ab) or “monoclonal antibody” (Mab) is meant to include intact molecules as well as antibody fragments (such as, for example, Fab and F(ab') 2 fragments) which are capable of specifically binding to BAIT protein. Fab and F(ab') 2 fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibody (Wahl et al, J. Nucl. Med. 24:316-325 (1983)). Thus, these fragments are preferred.
  • Fab and F(ab') 2 fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibody (Wahl et al, J. Nucl. Med. 24:316-325 (1983)). Thus, these fragments are preferred.
  • the antibodies of the present invention may be prepared by any of a variety of methods. For example, cells expressing the BAIT protein or an antigenic fragment thereof can be administered to an animal in order to induce the production of sera containing polyclonal antibodies.
  • a preparation of BAIT protein is prepared and purified to render it substantially free of natural contaminants. Such a preparation is then introduced into an animal in order to produce polyclonal antisera of greater specific activity.
  • the antibodies of the present invention are monoclonal antibodies (or BAIT protein binding fragments thereof).
  • Such monoclonal antibodies can be prepared using hybridoma technology (Kohler et al, Nature 256:495 (1975); Kohler et al, Eur. J. Immunol.
  • Such procedures involve immunizing an animal (preferably a mouse) with a BAIT protein antigen or, more preferably, with a BAIT protein-expressing cell.
  • Suitable cells can be recognized by their capacity to bind anti-BAIT protein antibody.
  • Such cells may be cultured in any suitable tissue culture medium; however, it is preferable to culture cells in Earle's modified Eagle's medium supplemented with 10% fetal bovine serum
  • mice are extracted and fused with a suitable myeloma cell line.
  • Any suitable myeloma cell line may be employed in accordance with the present invention; however, it is preferable to employ the parent myeloma cell line (SP 2 O), available from the American Type Culture Collection, Rockville, Maryland.
  • SP 2 O parent myeloma cell line
  • the resulting hybridoma cells are selectively maintained in HAT medium, and then cloned by limiting dilution as described by Wands et al.
  • the hybridoma cells obtained through such a selection are then assayed to identify clones which secrete antibodies capable of binding the BAIT protein antigen.
  • additional antibodies capable of binding to the BAIT protein antigen may be produced in a two-step procedure through the use of anti-idiotypic antibodies.
  • Such a method makes use of the fact that antibodies are themselves antigens, and that, therefore, it is possible to obtain an antibody which binds to a second antibody.
  • BAIT-protein specific antibodies are used to immunize an animal, preferably a mouse.
  • the splenocytes of such an animal are then used to produce hybridoma cells, and the hybridoma cells are screened to identify clones which produce an antibody whose ability to bind to the BAIT protein-specific antibody can be blocked by the BAIT protein antigen.
  • Such antibodies comprise anti-idiotypic antibodies to the BAIT protein-specific antibody and can be used to immunize an animal to induce formation of further BAIT protein-specific antibodies.
  • Fab and F(ab') 2 and other fragments of the antibodies of the present invention may be used according to the methods disclosed herein.
  • Such fragments are typically produced by proteolytic cleavage, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab') 2 fragments).
  • BAIT protein-binding fragments can be produced through the application of recombinant DNA technology or through synthetic chemistry.
  • chimeric monoclonal antibodies can be produced using genetic constructs derived from hybridoma cells producing the monoclonal antibodies described above. Methods for producing chimeric antibodies are known in the art. See, for review, Morrison, Science 229: 1202 (1985); Oi et al, BioTechniques 4:214 (1986); Cabilly et al, U.S. Patent No.
  • suitable labels for the BAIT protein-specific antibodies of the present invention are provided below.
  • suitable enzyme labels include malate dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, yeast-alcohol dehydrogenase, alpha-glycerol phosphate dehydrogenase, triose phosphate isomerase, peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase, and acetylcholine esterase.
  • radioisotopic labels examples include H, '"In, 125 I, l31 1, 32 P, 35 S,
  • this radionucleotide has a more favorable gamma emission energy for imaging (Perkins et al, Eur. J. Nucl. Med. 70:296-301 (1985); Carasquillo et al, J.
  • fluorescent labels examples include an 152 Eu label, a fluorescein label, an isothiocyanate label, a rhodamine label, a phycoerythrin label, a phycocyanin label, an allophycocyanin label, an o-phthaldehyde label, and a fluorescamine label.
  • Suitable toxin labels include diphtheria toxin, ricin, and cholera toxin.
  • chemiluminescent labels include a luminal label, an isoluminal label, an aromatic acridinium ester label, an imidazole label, an acridinium salt label, an oxalate ester label, a luciferin label, a luciferase label, and an aequorin label.
  • nuclear magnetic resonance contrasting agents include heavy metal nuclei such as Gd,
  • Typical techniques for binding the above-described labels to antibodies are provided by Kennedy et al, Clin. Chim. Ada 70: 1-31 (1976), and Schurs et al, Clin. Chim. Ada 87:1-40 (1977). Coupling techniques mentioned in the latter are the glutaraldehyde method, the periodate method, the dimaleimide method, the m-maleimidobenzyl-N-hydroxy-succinimide ester method, all of which methods are inco ⁇ orated by reference herein.
  • BAIT polynucleotides, polypeptides and other aspects of this invention are useful for diagnosis of various nervous system-related disorders in mammals, including impaired processes of learning and memory, including impaired spatial, olfactory and taste-aversion learning, learning and memory impairments associated with Alzherimer's disease, and the like.
  • impaired processes of learning and memory including impaired spatial, olfactory and taste-aversion learning, learning and memory impairments associated with Alzherimer's disease, and the like.
  • Given the activities modulated by BAIT it is readily apparent that a substantially altered (increased or decreased) level of expression of BAIT in an individual compared to the standard or "normal" level produces pathological conditions such as those described above in relation to diagnosis of nervous system-related disorders.
  • the BAIT protein of the invention is translated with a leader peptide suitable for secretion of the mature protein from the cells which express BAIT, when BAIT protein (particularly the mature form) is added from an exogenous source to cells, tissues or the body of an individual, the protein will exert its modulating activities on any of its target cells of that individual. Therefore, it will be appreciated that conditions caused by a decrease in the standard or normal level of BAIT activity in an individual, or an increase in a protease susceptible to inhibition by BAIT, particularly disorders of the nervous system, can be treated by administration of BAIT protein.
  • the human BAIT protein of the present invention has been shown to exhibit selective inhibition of tissue-type plasminogen activator (t-PA) with a lesser degree of inhibition of trypsin, thrombin or urokinase-type plasminogen activator (u-PA). More in particular, in vitro enzymatic activity has been demonstrated for the baculovirus- expressed purified protein.
  • Figure 5 shows the inhibition of t-PA, u-PA, plasmin, trypsin, and thrombin proteolytic activity with increasing amounts of purified protein expressed and purified as described below.
  • t-PA was inhibited with a half-maximal inhibitory concentration (IC 50 ) of 200 nM.
  • u-PA and trypsin were inhibited at an IC 50 of 1 ⁇ M and 0.7 ⁇ M, respectively. No other protease was inhibited to 50% of control.
  • the rate constant for BAIT reaction with tPA is about 7.8 ⁇ 1.5 x 10 4 mol/sec.
  • the inhibitory activity against various tPA was determined in a single step chromogenic assay essentially as described (Lawrence, Strandberg, Ericson, & Ny, 1990, supra). Briefly, BAIT containing samples were serially diluted in microtiter plates into 0.15 M NaCl, 0.05 M Tris-HCl, pH 7.5 containing 100 ⁇ g/ml bovine serum albumin, and 0.01 % Tween 80, 100 ⁇ l final volume.
  • Enzyme was added (5 nM for tPA and plasmin, and 2 nM for thrombin, uPA, and trypsin), and the samples incubated for 30 minutes at 23° C. Next, 100 ⁇ l of the same buffer containing 0.5 mM substrate, (Spectrozyme tPA (BioPool) for tPA, S2444 (Chromogenix) for uPA, S2390 (Chromogenix) for plasmin, and chromozym TRY (Boehringer Mannheim) for trypsin and thrombin. The plates were then were incubated at 37°C in a ThermoMax plate reader and the change in absorbance at 405 nM monitored for 30 minutes. The amount of inhibition was calculated from the residual enzyme activity. These results of these assays are shown in Figure 5 where the % inhibition of each enzyme is plotted against the concentration of BAIT ("neural se ⁇ in").
  • the invention also provides a method of treatment of an individual in need of an increased level of BAIT activity (or of decreased proteolytic activity of a BAIT-susceptible protease, particularly t-PA) comprising administering to such an individual a pharmaceutical composition comprising an amount of an isolated BAIT polypeptide of the invention, particularly a mature form of the BAIT protein of the invention, effective to increase the BAIT activity level (and, thereby decrease the BAIT-susceptible protease activity) in such an individual.
  • a pharmaceutical composition comprising an amount of an isolated BAIT polypeptide of the invention, particularly a mature form of the BAIT protein of the invention, effective to increase the BAIT activity level (and, thereby decrease the BAIT-susceptible protease activity) in such an individual.
  • PNI protease nexin I
  • GDN glia-derived nexin
  • the PNI gene is induced transcriptionally and protein levels are increased following rat sciatic nerve axotomy.
  • Other neurotrophic factors like nerve growth factor, brain-derived neurotrophic factor, and insulin-like growth factor I respond likewise to peripheral nerve damage.
  • E6-E9 lumbrosacral motoneurons which normally undergo apoptosis, with PNI results in increased survival of motoneurons.
  • Motoneuron death experimentally induced by sciatic nerve lesioning in mouse is also decreased by PNI addition.
  • Alzheimer-diseased brain regions contain higher PNI/thrombin complexes compared with free PNI than do normal brains suggesting that PNI may have a role in CNS pathology.
  • BAIT can be used for treating peripheral neuropathies such as ALS or multiple sclerosis.
  • Motoneuron or sensory neuron damage resulting from spinal cord injury also my be prevented by treatment with BAIT .
  • central nervous system diseases like Alzheimer's disease may be treated with BAIT or, preferably, a small molecule analog capable of crossing the blood-brain barrier, which analog can be identified according to the methods of the present invention.
  • the protease inhibitory activity of BAIT protein of the present invention also indicates that this protein may be used for therapeutic treatment of other conditions where excessive proteolytic activity of a BAIT susceptible protease may be involved, particularly t-PA.
  • BAIT may be used to modulate the process of clot breakdown, for instance, in combination with Activase (recombinant t-PA) which Genentec is marketing for clot dissolution after stoke.
  • Activase recombinant t-PA
  • BAIT provides a specific inhibitor of t-PA which would fine tune the treatment process and not interact with other serine proteases in the nervous system.
  • a product called Trasylol aprotinin
  • aprotinin a protease inhibitor
  • BAIT has been shown to inhibit breakdown of extracellular matrix in a fibroblast tumor cell line . Such breakdown is thought to enable tumor cells to metastasize by weakening of extracellular matrix which normally prevents penetration of unrelated cells through a tissue. BAIT also may be used to inhibit extracellular matrix destruction associated with tumors secreting a BAIT-susceptible protease, for instance, neural tissue tumors secreting t-PA.
  • the BAIT polypeptide composition will be formulated and dosed in a fashion consistent with good medical practice, taking into account the clinical condition of the individual patient (especially the side effects of treatment with BAIT polypeptide alone), the site of delivery of the BAIT polypeptide composition, the method of administration, the scheduling of administration, and other factors known to practitioners.
  • the "effective amount" of BAIT polypeptide for pu ⁇ oses herein is thus determined by such considerations.
  • the total pharmaceutically effective amount of BAIT polypeptide administered parenterally per dose will be in the range of about 1 ⁇ g/kg/day to 10 mg/kg/day of patient body weight, although, as noted above, this will be subject to therapeutic discretion.
  • this dose is at least 0.01 mg/kg/day, and most preferably for humans between about 0.01 and 1 mg/kg/day for the hormone.
  • the BAIT polypeptide is typically administered at a dose rate of about 1 ⁇ g/kg/hour to about 50 ⁇ g/kg/hour, either by 1-4 injections per day or by continuous subcutaneous infusions, for example, using a mini-pump.
  • An intravenous bag solution may also be employed. The length of treatment needed to observe changes and the interval following treatment for responses to occur appears to vary depending on the desired effect.
  • compositions containing the BAIT of the invention may be administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, drops or transdermal patch), bucally, or as an oral or nasal spray.
  • pharmaceutically acceptable carrier is meant a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
  • parenteral refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.
  • the BAIT polypeptide is also suitably administered by sustained-release systems.
  • sustained-release compositions include semi- permeable polymer matrices in the form of shaped articles, e.g., films, or mirocapsules.
  • Sustained-release matrices include polylactides (U.S. Pat. No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman, U. et al, Biopolymers 22:541-556 (1983)), poly (2- hydroxyethyl methacrylate) (R. Langer et al, J. Biomed. Mater. Res.
  • Sustained-release BAIT polypeptide compositions also include liposomally entrapped BAIT polypeptide.
  • Liposomes containing BAIT polypeptide are prepared by methods known per se: DE 3,218,121; Epstein et al, Proc. Natl. Acad. Sci. (USA) 82:3688-3692 (1985); Hwang et al, Proc. Natl. Acad. Sci. (USA) 77:4030-4034 (1980); EP 52,322; EP
  • the liposomes are of the small (about 200-800 Angstroms) unilamellar type in which the lipid content is greater than about 30 mol. percent cholesterol, the selected proportion being adjusted for the optimal BAIT polypeptide therapy.
  • the BAIT polypeptide is formulated generally by mixing it at the desired degree of purity, in a unit dosage injectable form (solution, suspension, or emulsion), with a pharmaceutically acceptable carrier, i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
  • a pharmaceutically acceptable carrier i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
  • the formulation preferably does not include oxidizing agents and other compounds that are known to be deleterious to polypeptides.
  • the formulations are prepared by contacting the BAIT polypeptide (and, optionally, any cofactor which may enhance its activity) uniformly and intimately with liquid carriers or finely divided solid carriers or both. Then, if necessary, the product is shaped into the desired formulation.
  • the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient. Examples of such carrier vehicles include water, saline, Ringer's solution, and dextrose solution. Non-aqueous vehicles such as fixed oils and ethyl oleate are also useful herein, as well as liposomes.
  • the carrier suitably contains minor amounts of additives such as substances that enhance isotonicity and chemical stability.
  • additives such as substances that enhance isotonicity and chemical stability.
  • Such materials are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, succinate, acetic acid, and other organic acids or their salts; antioxidants such as ascorbic acid; low molecular weight (less than about ten residues) polypeptides, e.g., polyarginine or tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, manose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbi
  • the BAIT polypeptide is typically formulated in such vehicles at a concentration of about 0.1 mg/ml to 100 mg/ml, preferably 1-10 mg/ml, at a pH of about 3 to 8. It will be understood that the use of certain of the foregoing excipients, carriers, or stabilizers will result in the formation of BAIT polypeptide salts. BAIT polypeptide to be used for therapeutic administration must be sterile.
  • BAIT polypeptide compositions generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
  • BAIT polypeptide ordinarily will be stored in unit or multi-dose containers, for example, sealed ampoules or vials, as an aqueous solution or as a lyophilized formulation for reconstitution.
  • a lyophilized formulation 10-ml vials are filled with 5 ml of sterile-filtered 1 % (w/v) aqueous BAIT polypeptide solution, and the resulting mixture is lyophilized.
  • the infusion solution is prepared by reconstituting the lyophilized BAIT polypeptide using bacteriostatic Water-for-
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • the polypeptides of the present invention may be employed in conjunction with other therapeutic compounds. Agonists and Antagonists - Assays and Molecules
  • the invention also provides a method of screening compounds to identify those which enhance or block the action of BAIT on proteases, such as its interaction with proteases or with protein cofactors such as extracellular matrix proteins.
  • protease -inhibiting activity of another se ⁇ in, plasminogen activator inhibitor-I (PAI-) PAI-
  • an agonist in the present context is a compound which increases the natural biological functions of BAIT or which functions in a manner similar to BAIT, while antagonists decrease or eliminate such functions.
  • a cellular compartment such as a membrane or a preparation thereof, such as a membrane-preparation, may be prepared from a cell that expresses a molecule that binds BAIT, such as a molecule of a signaling or regulatory pathway modulated by BAIT.
  • the preparation is incubated with labeled BAIT in the absence or the presence of a candidate molecule which may be a BAIT agonist or antagonist.
  • the ability of the candidate molecule to bind the binding molecule is reflected in decreased binding of the labeled ligand.
  • Molecules which bind gratuitously, i.e., without inducing the effects of BAIT on binding the BAIT binding molecule are most likely to be good antagonists.
  • Molecules that bind well and elicit effects that are the same as or closely related to BAIT are agonists.
  • B AIT-like effects of potential agonists and antagonists may be measured, for instance, by determining activity of a second messenger system following interaction of the candidate molecule with a cell or appropriate cell preparation, and comparing the effect with that of BAIT or molecules that elicit the same effects as BAIT.
  • Second messenger systems that may be useful in this regard include but are not limited to AMP guanylate cyclase, ion channel or phosphoinositide hydrolysis second messenger systems.
  • an assay for BAIT antagonists is a competitive assay that combines BAIT and a potential antagonist BAIT-susceptible protease, particularly t- PA, under appropriate conditions for a competitive inhibition assay.
  • BAIT can be labeled, such as by radioactivity, such that the number of BAIT molecules bound to protease molecules can be determined accurately to assess the effectiveness of the potential antagonist.
  • Potential antagonists include small organic molecules, peptides, polypeptides and antibodies that bind to a polypeptide of the invention and thereby inhibit or extinguish its activity. Potential antagonists also may be small organic molecules, a peptide, a polypeptide such as a closely related protein or antibody that binds the same sites on a binding molecule, such as BAIT susceptible protease molecule, without inducing B AIT-induced activities, thereby preventing the action of BAIT by excluding BAIT from binding. Other potential antagonists include antisense molecules. Antisense technology can be used to control gene expression through antisense DNA or RNA or through triple-helix formation. Antisense techniques are discussed, for example, in Okano, J. Neurochem.
  • the methods are based on binding of a polynucleotide to a complementary DNA or RNA.
  • the 5' coding portion of a polynucleotide that encodes the mature polypeptide of the present invention may be used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and the production of BAIT.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into BAIT polypeptide.
  • the oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of BAIT.
  • the agonists and antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as described above.
  • the BAIT agonists may be employed in place of a BAIT polypeptide, for instance, for treating peripheral neuropathies such as ALS or multiple sclerosis.
  • Motoneuron or sensory neuron damage resulting from spinal cord injury also may be prevented by treatment with BAIT agonists.
  • central nervous system diseases like Alzheimer's disease may be treated a small molecule agonist capable of crossing the blood-brain barrier, which analog can be identified according to the methods of the present invention.
  • BAIT agonists also may be used for therapeutic treatment of other conditions where excessive proteolytic activity of a BAIT susceptible protease may be involved, particularly t-PA.
  • BAIT may be used to modulate the process of clot breakdown, for instance, in combination with Activase (recombinant t-PA) for clot dissolution after stoke.
  • BAIT agonists also may be used to inhibit extracellular matrix destruction associated with tumors secreting a BAIT-susceptible protease, for instance, neural tissue tumors secreting t-PA.
  • the BAIT antagonists may be used in a method for treating an individual in need of a decreased level of BAIT activity in the body (i.e., less inhibition of a protease susceptible to BAIT) comprising administering to such an individual a composition comprising a therapeutically effective amount of a BAIT antagonist.
  • the nucleic acid molecules of the present invention are also valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with the above particular location on an individual human chromosome.
  • the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
  • the cDNA herein disclosed is used to clone genomic DNA of a BAIT protein gene. This can be accomplished using a variety of well known techniques and libraries, which generally are available commercially.
  • the genomic DNA then is used for in situ chromosome mapping using well known techniques for this pu ⁇ ose. Typically, in accordance with routine procedures for chromosome mapping, some trial and error may be necessary to identify a genomic probe that gives a good in situ hybridization signal.
  • sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3 untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process.
  • primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified portion.
  • PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
  • sublocalization can be achieved with panels of portions from specific chromosomes or pools of large genomic clones in an analogous manner.
  • Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow- sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
  • Fluorescence in situ hybridization of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with probes from the cDNA as short as 50 or 60 bp.
  • genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes). Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.
  • a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. This assumes 1 megabase mapping resolution and one gene per 20 kb.
  • the bacterial expression vector pQE9 (pDIO) is used for bacterial expression in this example.
  • pQE9 encodes ampicillin antibiotic resistance ("Ampr") and contains a bacterial origin of replication ("ori"), an IPTG inducible promoter, a ribosome binding site (“RBS”), six codons encoding histidine residues that allow affinity purification using nickel- nitrilo-tri-acetic acid (“Ni-NTA”) affinity resin sold by QIAGEN, Inc., supra, and suitable single restriction enzyme cleavage sites.
  • These elements are arranged such that an inserted DNA fragment encoding a polypeptide expresses that polypeptide with the six His residues (i.e., a "6 X His tag”) covalently linked to the amino terminus of that polypeptide.
  • the DNA sequence encoding the desired portion BAIT protein lacking the hydrophobic leader sequence is amplified from the deposited cDNA clone using PCR oligonucleotide primers which anneal to the amino terminal sequences of the desired portion of the BAIT protein and to sequences in the deposited construct 3' to the cDNA coding sequence. Additional nucleotides containing restriction sites to facilitate cloning in the pQE9 vector are added to the 5' and 3' primer sequences, respectively.
  • the 5' primer has the sequence
  • 5' GAGCATGGATCCGCCACTTTCCCTGAGGAA 3' (SEQ ID NO: 10) containing the underlined BamHI restriction site followed by 18 nucleotides of the amino terminal coding sequence of the mature BAIT sequence in Figure 1.
  • the point in the protein coding sequence where the 5' primer begins may be varied to amplify a DNA segment encoding any desired portion of the complete BAIT protein shorter or longer than the mature form.
  • the 3' primer has the sequence
  • the amplified BAIT DNA fragment and the vector pQE9 are digested with BamHI and the digested DNAs are then ligated together. Insertion of the BAIT DNA into the restricted pQE9 vector places the BAIT protein coding region downstream from the IPTG-inducible promoter and in-frame with an initiating AUG and the six histidine codons.
  • the ligation mixture is transformed into competent E. coli cells using standard procedures such as those described in Sambrook et al., Molecular Cloning: a Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring
  • E. coli strain M15/rep4 containing multiple copies of the plasmid pREP4, which expresses the lac repressor and confers kanamycin resistance (“Kanr"), is used in carrying out the illustrative example described herein.
  • This strain which is only one of many that are suitable for expressing BAIT protein, is available commercially from QIAGEN, Inc., supra.
  • Transformants are identified by their ability to grow on LB plates in the presence of ampicillin and kanamycin. Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA confirmed by restriction analysis, PCR and DNA sequencing.
  • Clones containing the desired constructs are grown overnight ("O/N") in liquid culture in LB media supplemented with both ampicillin (100 ⁇ g/ml) and kanamycin
  • the O/N culture is used to inoculate a large culture, at a dilution of approximately 1:25 to 1:250.
  • the cells are grown to an optical density at 600 nm ("OD600") of between 0.4 and 0.6.
  • isopropyl-b-D-thiogalactopyranoside (“IPTG”) is then added to a final concentration of 1 mM to induce transcription from the lac repressor sensitive promoter, by inactivating the lad repressor.
  • IPTG isopropyl-b-D-thiogalactopyranoside
  • Cells subsequently are incubated further for 3 to 4 hours. Cells then are harvested by centrifugation.
  • the cells are then stirred for 3-4 hours at 4° C in 6M guanidine-HCl, pH 8.
  • Ni-NTA nickel-nitrilo-tri-acetic acid
  • NTA resin with high affinity and can be purified in a simple one-step procedure for details see: The QIAexpressionist, 1995, QIAGEN, Inc., supra). Briefly the supernatant is loaded onto the column in 6 M guanidine-HCl, pH 8, the column is first washed with 10 volumes of 6 M guanidine-HCl, pH 8, then washed with 10 volumes of 6 M guanidine-HCl pH 6, and finally the BAIT is eluted with 6 M guanidine-HCl, pH 5.
  • the purified protein is then renatured by dialyzing it against phosphate- buffered saline (PBS) or 50 mM Na-acetate, pH 6 buffer plus 200 mM NaCl.
  • PBS phosphate- buffered saline
  • the protein can be successfully refolded while immobilized on the Ni- NTA column.
  • the recommended conditions are as follows: renature using a linear 6M-1M urea gradient in 500 mM NaCl, 20% glycerol, 20 mM Tris/HCl pH 7.4, containing protease inhibitors.
  • the renaturation should be performed over a period of 1.5 hours or more.
  • the proteins can be eluted by the addition of 250 mM immidazole. Immidazole is removed by a final dialyzing step against PBS or 50 mM sodium acetate pH 6 buffer plus 200 mM NaCl.
  • the purified protein is stored at
  • Example 2 Cloning, Expression and Purification of BAIT protein in a Baculovirus Expression System
  • the plasmid shuttle vector pA2 is used to insert the cloned DNA encoding the complete protein, including its naturally associated secretory signal (leader) sequence, into a baculovirus to express the mature BAIT protein, using standard methods as described in Summers et al., A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas Agricultural Experimental Station Bulletin No. 1555 (1987).
  • This expression vector contains the strong polyhedrin promoter of the Autographa calif ornica nuclear polyhedrosis virus (AcMNPV) followed by convenient restriction sites such as BamHI, Xba I and Asp718.
  • the polyadenylation site of the simian virus 40 ("SV40") is used for efficient polyadenylation.
  • the plasmid contains the beta-galactosidase gene from E. coli under control of a weak
  • Drosophila promoter in the same orientation, followed by the polyadenylation signal of the polyhedrin gene.
  • the inserted genes are flanked on both sides by viral sequences for cell-mediated homologous recombination with wild-type viral DNA to generate viable virus that express the cloned polynucleotide.
  • Many other baculovirus vectors could be used in place of the vector above, such as pAc373, pVL941 and pAcIMl, as one skilled in the art would readily appreciate, as long as the construct provides appropriately located signals for transcription, translation, secretion and the like, including a signal peptide and an in- frame AUG as required.
  • Such vectors are described, for instance, in Luckow et al., Virology 170:3 ⁇ -39 ( ⁇ 9 9).
  • the cDNA sequence encoding the full length BAIT protein in the deposited clone, including the AUG initiation codon and the naturally associated leader sequence shown in Figure 1 is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene.
  • the 5' primer has the sequence 5 ' GAGC ATGGATCCGCC ATCATGGCTTTCCTTGGACTC 3 ' (SEQ ID NO: 12) containing the underlined BamHI restriction enzyme site, an efficient signal for initiation of translation in eukaryotic cells, as described by Kozak, M., J. Mol. Biol.
  • the 3' primer has the sequence 5 ' -G AGC ATTCTAGAGTTGC AA AC AT AATGTGC-3 '
  • the amplified fragment was isolated from a 1 % agarose gel using a commercially available kit ("Geneclean,” BIO 101 Inc., La Jolla, Ca.). The fragment then is digested with BamHI and Xbal and again was purified on a 1% agarose gel.
  • the plasmid was digested with the restriction enzymes BamHI and Xbal using routine procedures known in the art.
  • the DNA was then isolated from a 1 % agarose gel using a commercially available kit ("Geneclean” BIO 101 Inc., La Jolla, Ca.). This vector DNA is designated herein "VI ".
  • Fragment FI and the plasmid VI were ligated together with T4 DNA ligase. Competent E. coli cells were transformed with the ligation mixture and spread on culture plates. Bacteria were identified that contain the plasmid with the human BAIT gene by digesting DNA from individual colonies using BamHI and Xbal and then analyzing the digestion product by gel electrophoresis. The sequence of the cloned fragment was confirmed by DNA sequencing. This plasmid is designated herein pA2BAIT.
  • plasmid pA2B AIT Five ⁇ g of the plasmid pA2B AIT was co-transfected with 1.0 ⁇ g of a commercially available linearized baculovirus DNA ("BaculoGoldTM baculovirus DNA", Pharmingen, San Diego, CA), using the lipofection method described by
  • the plate was then incubated for 5 hours at 27° C. After 5 hours the transfection solution was removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum was added. The plate was put back into an incubator and cultivation was continued at 27° C for four days.
  • plaque assay After four days the supernatant was collected and a plaque assay was performed, as described by Summers and Smith, supra. An agarose gel with "Blue Gal” (Life Technologies Inc., Gaithersburg) was used to allow easy identification and isolation of gal-expressing clones, which produce blue-stained plaques. (A detailed description of a "plaque assay” of this type can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9-10). After appropriate incubation, blue stained plaques were picked with the tip of a micropipettor (e.g., Eppendorf).
  • a micropipettor e.g., Eppendorf
  • the agar containing the recombinant viruses were then resuspended in a microcentrifuge tube containing 200 ⁇ l of Grace's medium and the suspension containing the recombinant baculovirus was used to infect Sf9 cells seeded in 35 mm dishes. Four days later the supernatants of these culture dishes were harvested and then they were stored at 4° C.
  • the recombinant virus is called V-BAJT.
  • Sf9 cells were grown in Grace's medium supplemented with 10% heat-inactivated FBS.
  • the cells were infected with the recombinant baculovirus V-BAIT at a multiplicity of infection ("MOI") of about 2.
  • MOI multiplicity of infection
  • the medium was removed and replaced with SF900 II medium minus methionine and cysteine (available from Life Technologies Inc., Rockville, MD).
  • 5 ⁇ Ci of 5 S -methionine and 5 ⁇ Ci 35 S-cysteine available from Amersham
  • the proteins in the supernatant as well as the intracellular proteins were analyzed by SDS-PAGE followed by autoradiography (if radiolabeled).
  • Sf9 cells were seeded in serum-free media at a density of 1.5xl0 6 cells/ml in 200 ml spinner flasks. They were infected at an multiplicity of infection (moi) of 1 with the recombinant baculovirus encoding BAIT.
  • m multiplicity of infection
  • pi the cells were removed by centrifugation, and the conditioned media used as starting material.
  • Medium was diluted 1 : 1 (vol: vol) with 50 mM Na- Acetate pH 6.0 (Buffer A).
  • the sample was applied to an HQ-50 column (Poros Resins, Perseptive Biosystems) at a flow rate of 30 mls/min.
  • Bound protein was step-eluted with Buffer A containing 0.15, 0.35, 0.6 and 1.0 M NaCl and the fractions analyzed by SDS-PAGE.
  • BAIT- containing fraction 350 mM step
  • BAIT- containing fraction 350 mM step
  • Buffer A 350 mM step
  • Bound proteins were step eluted with Buffer A containing 1.0 M NaCl and fractions analyzed by SDS-PAGE. Finally, the pooled fractions were applied to an S-200 (Pharmacia) gel filtration column previously equilibrated with 50 mM Na-Acetate pH 6.5; 250 mM NaCl. BAIT-containing fractions eluted as a single peak which were pooled.
  • Protein concentration was determined using the Bio-Rad Protein Assay with BSA as a standard. Alternatively, the BCA Assay (Pierce) was used. The protein was -90% pure as judged by SDS-PAGE. The baculovirus produced protein was shown to be glycosylated and the isolectric point (pi) of the protein was determined to be 5.0. This protein was used for in vitro activity assays described hereinabove. Microsequencing of the amino acid sequence of the amino terminus of the purified protein immediately after purification was used to determine the amino terminal sequence of the mature protein and thus the cleavage point and length (18 amino acids) of the secretory signal peptide, as shown in Figure 1 (SEQ ID NO:2).
  • a typical mammalian expression vector contains the promoter element, which mediates the initiation of transcription of mRNA, the protein coding sequence, and signals required for the termination of transcription and polyadenylation of the transcript. Additional elements include enhancers, Kozak sequences and intervening sequences flanked by donor and acceptor sites for RNA splicing. Highly efficient transcription can be achieved with the early and late promoters from SV40, the long terminal repeats (LTRs) from Retroviruses, e.g., RSV, HTLVI, HIVI and the early promoter of the cytomegalovirus (CMV). However, cellular elements can also be used (e.g., the human actin promoter).
  • Suitable expression vectors for use in practicing the present invention include, for example, vectors such as pSVL and pMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and pBC12MI (ATCC 67109).
  • Mammalian host cells that could be used include, human Hela, 293, H9 and Jurkat cells, mouse NIH3T3 and C127 cells, Cos 1, Cos 7 and CV1, quail QC1-3 cells, mouse L cells and Chinese hamster ovary (CHO) cells.
  • the gene can be expressed in stable cell lines that contain the gene integrated into a chromosome.
  • a selectable marker such as dhfr, gpt, neomycin, hygromycin allows the identification and isolation of the transfected cells.
  • the transfected gene can also be amplified to express large amounts of the encoded protein.
  • the DHFR (dihydrofolate reductase) marker is useful to develop cell lines that carry several hundred or even several thousand copies of the gene of interest.
  • Another useful selection marker is the enzyme glutamine synthase (GS)
  • the expression vectors pCl and pC4 contain the strong promoter (LTR) of the Rous Sarcoma Virus (Cullen et al., Molecular and Cellular Biology, 438-447 (March, 1985)) plus a fragment of the CMV-enhancer (Boshart et al., Cell 41:521-530 (1985)). Multiple cloning sites, e.g., with the restriction enzyme cleavage sites BamHI, Xbal and Asp718, facilitate the cloning of the gene of interest.
  • the vectors contain in addition the 3' intron, the polyadenylation and termination signal of the rat preproinsulin gene.
  • the expression plasmid, pBAIT HA is made by cloning a cDNA encoding BAIT into the expression vector pcDNAI/Amp or pcDNAIII (which can be obtained from Invitrogen, Inc.).
  • the expression vector pcDNAI/amp contains: (1) an E. coli origin of replication effective for propagation in E. coli and other prokaryotic cells; (2) an ampicillin resistance gene for selection of plasmid-containing prokaryotic cells; (3) an SV40 origin of replication for propagation in eukaryotic cells; (4) a CMV promoter, a polylinker, an SV40 intron; (5) several codons encoding a hemagglutinin fragment (i.e., an "HA" tag to facilitate purification) followed by a termination codon and polyadenylation signal arranged so that a cDNA can be conveniently placed under expression control of the CMV promoter and operably linked to the S V40 intron and the polyadenylation signal by means of restriction sites in the polylinker.
  • an E. coli origin of replication effective for propagation in E. coli and other prokaryotic cells
  • an ampicillin resistance gene for selection of plasmid-containing prokaryotic cells
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein described by Wilson et al., Cell 37: 767 (1984).
  • the fusion of the HA tag to the target protein allows easy detection and recovery of the recombinant protein with an antibody that recognizes the HA epitope.
  • pcDNAIII contains, in addition, the selectable neomycin marker.
  • a DNA fragment encoding the BAIT is cloned into the polylinker region of the vector so that recombinant protein expression is directed by the CMV promoter.
  • the plasmid construction strategy is as follows.
  • the BAIT cDNA of the deposited clone is amplified using primers that contain convenient restriction sites, much as described above for construction of vectors for expression of BAIT in E. coli. Suitable primers include the following, which are used in this example.
  • the 5' primer containing the underlined BamHI site, a Kozak sequence, an AUG start codon and 18 nucleotides of the 5' coding region of the complete BAIT has the following sequence: 5' GAGCATGGATCCGCCATCATGGCTTTCCTTGGACTC 3' (SEQ ID NO:
  • the 3' primer containing the underlined BamHI site and 15 nucleotides complementary to the 3' coding sequence, has the following sequence: 5' GCACATGGATCCAAGTTCTTCGAAATCATG 3' (SEQ ID NO: 15).
  • the PCR amplified DNA fragment and the vector, pcDNAI/Amp, are digested with BamHI, the vector is dephosphorylated and then the vector and amplified DNA are ligated.
  • the ligation mixture is transformed into E. coli strain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037), and the transformed culture is plated on ampicillin media plates which then are incubated to allow growth of ampicillin resistant colonies. Plasmid DNA is isolated from resistant colonies and examined by restriction analysis or other means for the presence of the BAIT-encoding fragment.
  • COS cells are transfected with an expression vector, as described above, using DEAE-DEXTRAN, as described, for instance, in Sambrook et al., Molecular Cloning: a Laboratory Manual, Cold Spring Laboratory Press, Cold Spring Harbor, New York (1989). Cells are incubated under conditions for expression of BAIT by the vector.
  • B AIT-HA fusion protein is detected by radiolabeling and immunoprecipitation, using methods described in, for example Harlow et al., Antibodies: A Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1988). To this end, two days after transfection, the cells are labeled by incubation in media containing 35 S-cysteine for 8 hours. The cells and the media are collected, and the cells are washed and the lysed with detergent- containing RIPA buffer: 150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5, as described by Wilson et al. cited above.
  • Proteins are precipitated from the cell lysate and from the culture media using an HA-specific monoclonal antibody. The precipitated proteins then are analyzed by SDS-PAGE and autoradiography. An expression product of the expected size is seen in the cell lysate, which is not seen in negative controls.
  • Plasmid pC4 is used for the expression of BAIT protein.
  • Plasmid pC4 is a derivative of the plasmid pSV2-dhfr (ATCC Accession No. 37146)
  • the plasmid contains the mouse DHFR gene under control of the S V40 early promoter.
  • Chinese hamster ovary- or other cells lacking dihydrofolate activity that are transfected with these plasmids can be selected by growing the cells in a selective medium (alpha minus MEM, Life Technologies) supplemented with the chemotherapeutic agent methotrexate.
  • MTX methotrexate
  • DHFR target enzyme
  • a second gene is linked to the DHFR gene, it is usually co-amplified and over-expressed. It is known in the art that this approach may be used to develop cell lines carrying more than 1,000 copies of the amplified gene(s). Subsequently, when the methotrexate is withdrawn, cell lines are obtained which contain the amplified gene integrated into one or more chromosome(s) of the host cell.
  • Plasmid pC4 contains for expressing the gene of interest the strong promoter of the long terminal repeat (LTR) of the Rouse Sarcoma Virus (Cullen, et al., Molecular and Cellular Biology, March 1985:438-447) plus a fragment isolated from the enhancer of the immediate early gene of human cytomegalovirus (CMV) (Boshart et al., Cell 47:521-530 (1985)). Downstream of the promoter are the following single restriction enzyme cleavage sites that allow the integration of the genes: BamHI, Xba I, and Asp718. Behind these cloning sites the plasmid contains the 3' intron and polyadenylation site of the rat preproinsulin gene.
  • LTR long terminal repeat
  • CMV cytomegalovirus
  • high efficiency promoters can also be used for the expression, e.g., the human ⁇ -actin promoter, the SV40 early or late promoters or the long terminal repeats from other retroviruses, e.g., HIV and HTLVI.
  • Clontech's Tet-Off and Tet-On gene expression systems and similar systems can be used to express the BAIT in a regulated way in mammalian cells
  • the plasmid pC4 is digested with the restriction enzymes BamHI and Xbal and then dephosphorylated using calf intestinal phosphates by procedures known in the art.
  • the vector is then isolated from a 1 % agarose gel.
  • the DNA sequence encoding the complete BAIT protein including its leader sequence is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene.
  • the 5' primer has the sequence 5' GAGCATGGATCCGCCATCATGGCTTTCCTTGGACTC 3' (SEQ ID NO: 16) containing the underlined BamHI restriction enzyme site followed by an efficient signal for initiation of translation in eukaryotes, as described by Kozak, M.,
  • the 3' primer has the sequence 5' GAGCATTCTAGAGTTGCAAACATAATGTGC 3' (SEQ ID NO: 17) containing the underlined Xbal restriction site followed by 18 nucleotides complementary to the non-translated region of the BAIT gene shown in Figure 1 (SEQ ID NO: 1).
  • the amplified fragment is digested with the endonucleases BamHI and Xbal and then purified again on a 1% agarose gel.
  • the isolated fragment and the dephosphorylated vector are then ligated with T4 DNA ligase.
  • E. coli HB101 or XL- 1 Blue cells are then transformed and bacteria are identified that contain the fragment inserted into plasmid pC4 using, for instance, restriction enzyme analysis.
  • Chinese hamster ovary cells lacking an active DHFR gene are used for transfection.
  • Five ⁇ g of the expression plasmid pC4 is cotransfected with 0.5 ⁇ g of the plasmid pSVneo using lipofectin (Feigner et al., supra).
  • the plasmid pSV2-neo contains a dominant selectable marker, the neo gene from Tn5 encoding an enzyme that confers resistance to a group of antibiotics including G418.
  • the cells are seeded in alpha minus MEM supplemented with 1 mg/ml G418.
  • the cells are trypsinized and seeded in hybridoma cloning plates (Greiner, Germany) in alpha minus MEM supplemented with 10, 25, or 50 ng/ml of metothrexate plus 1 mg/ml G418. After about 10-14 days single clones are trypsinized and then seeded in 6- well petri dishes or 10 ml flasks using different concentrations of methotrexate (50 nM,
  • Clones growing at the highest concentrations of methotrexate are then transferred to new 6-well plates containing even higher concentrations of methotrexate (1 ⁇ M, 2 ⁇ M, 5 ⁇ M, 10 mM, 20 mM). The same procedure is repeated until clones are obtained which grow at a concentration of 100 - 200 ⁇ M. Expression of the desired gene product is analyzed, for instance, by SDS-
  • the probe is purified using a CHROMA SPIN- 100TM column (Clontech Laboratories, Inc.), according to manufacturer's protocol number PTl 200-1. The purified labeled probe is then used to examine various human tissues for BAIT mRNA.
  • MTN Multiple Tissue Northern
  • H human tissues
  • IM human immune system tissues
  • ADDRESSEE HUMAN GENOME SCIENCES, INC.
  • MOLECULE TYPE DNA (genomic)
  • GGT GAA GAT GAA AAT ATT CTC TTC TCT CCA TTG AGT ATT GCT CTT GCA 256
  • Gly Glu Asp Glu Asn lie Leu Phe Ser Pro Leu Ser lie Ala Leu Ala 25 30 35
  • AGTATTAAGC TAATGGTCCT GTTATGTCAT TGTGTTTGTGTGCTGTTGTT TAAAATAAAA 1548
  • Val Ala Val Ala Asn Tyr lie Asn Lys Trp Val Glu Asn Asn Thr Asn 130 135 140
  • Glu Ser Glu Val Gin lie Pro Met Met Tyr Gin Gin Gly Glu Phe Tyr 195 200 205
  • Val Leu Glu lie Pro Tyr Glu Gly Asp Glu lie Ser Met Met Leu Val 225 230 235
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Oncology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne une nouvelle protéine de l'inhibiteur cérébro-associé de l'activateur du plasminogène de type tissulaire (BAIT), laquelle est un membre de la superfamille des serpines, qui s'exprime généralement dans le tissu du cerveau. L'invention concerne notamment des molécules d'acides nucléiques isolées codant la protéine humaine BAIT. On décrit également des polypeptides BAIT en tant que vecteurs et cellules hôtes, ainsi que des procédés de recombinaison aux fins de production de ceux-ci. L'invention concerne encore des procédés de criblage destinés à l'identification des agonistes et antagonistes de l'activité de BAIT, des procédés de diagnostic destinés à détecter des troubles associés au système nerveux, de même que des procédés thérapeutiques destinés au traitement de troubles associés au système nerveux.
PCT/US1996/016484 1996-10-11 1996-10-11 Inhibiteur cerebro-associe de l'activateur du plasminogene de type tissulaire WO1998016643A1 (fr)

Priority Applications (5)

Application Number Priority Date Filing Date Title
PCT/US1996/016484 WO1998016643A1 (fr) 1996-10-11 1996-10-11 Inhibiteur cerebro-associe de l'activateur du plasminogene de type tissulaire
CA002268007A CA2268007A1 (fr) 1996-10-11 1996-10-11 Inhibiteur cerebro-associe de l'activateur du plasminogene de type tissulaire
AU74317/96A AU7431796A (en) 1996-10-11 1996-10-11 Brain-associated inhibitor of tissue-type plasminogen activator
EP96936500A EP0934410A1 (fr) 1996-10-11 1996-10-11 Inhibiteur cerebro-associe de l'activateur du plasminogene de type tissulaire
JP51829398A JP2002501365A (ja) 1996-10-11 1996-10-11 組織型プラスミノーゲンアクチベーターの脳関連インヒビター

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US1996/016484 WO1998016643A1 (fr) 1996-10-11 1996-10-11 Inhibiteur cerebro-associe de l'activateur du plasminogene de type tissulaire

Publications (1)

Publication Number Publication Date
WO1998016643A1 true WO1998016643A1 (fr) 1998-04-23

Family

ID=22255955

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1996/016484 WO1998016643A1 (fr) 1996-10-11 1996-10-11 Inhibiteur cerebro-associe de l'activateur du plasminogene de type tissulaire

Country Status (5)

Country Link
EP (1) EP0934410A1 (fr)
JP (1) JP2002501365A (fr)
AU (1) AU7431796A (fr)
CA (1) CA2268007A1 (fr)
WO (1) WO1998016643A1 (fr)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999041381A1 (fr) * 1998-02-13 1999-08-19 Peter Sonderegger Neuroserpine
WO2000065349A2 (fr) * 1999-04-28 2000-11-02 Cardiogenics Inc. Procede de determination d'inhibiteur d'un activateur de plasminogene
US7087574B2 (en) 1999-03-10 2006-08-08 Human Genome Sciences, Inc. Brain associated inhibitor of tissue-type plasminogen activator
US7235529B2 (en) 1996-10-11 2007-06-26 Human Genome Sciences, Inc. Brain-associated inhibitor of tissue-type plasminogen activator
US7776340B2 (en) 2002-07-27 2010-08-17 The Royal Veterinary College Canine respiratory coronavirus (CRCV) spike protein, polymerase and hemagglutinin/esterase
WO2011079902A2 (fr) 2009-12-18 2011-07-07 Biolnvent International Ab Matériaux biologiques et utilisations de ceux-ci
EP2390333A1 (fr) 2002-07-23 2011-11-30 Novozymes Biopharma DK A/S Polypeptides avec une pre-séquence de sécrétion de la sérum albumine humaine modifiée avec rendement de sécrétion amelioré
WO2012076066A1 (fr) 2010-12-10 2012-06-14 Bioinvent International Ab Anticorps anti-ror1 et leurs applications
US8329194B2 (en) 2003-07-01 2012-12-11 The Royal Veterinary College Vaccine composition for vaccinating dogs against canine infectious respiratory disease (CIRD)
WO2014068320A1 (fr) 2012-11-01 2014-05-08 Benf Ab Inhibiteurs de corps de cétone utilisables dans le traitement d'une lésion de la muqueuse du tractus gastro-intestinal
WO2014134561A2 (fr) 2013-03-01 2014-09-04 Boehringer Ingelheim Vetmedica, Inc. Quantification de compositions de vaccin
US9023366B2 (en) 2003-07-01 2015-05-05 The Royal Veterinary College Vaccine composition for vaccinating dogs against canine infectious respiratory disease (CIRD)
WO2015075475A1 (fr) 2013-11-22 2015-05-28 The University Of Nottingham Traitement contre le cancer

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996040922A1 (fr) * 1995-06-07 1996-12-19 Incyte Pharmaceuticals, Inc. Nouvelle serpine derivee de l'hypothalamus humain

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996040922A1 (fr) * 1995-06-07 1996-12-19 Incyte Pharmaceuticals, Inc. Nouvelle serpine derivee de l'hypothalamus humain

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
T OSTERWALDER ET AL: "Neuroserpin, an axonally secreted serine protease inhibitor", EMBO JOURNAL, vol. 15, no. 12, June 1996 (1996-06-01), pages 2944 - 2953, XP000675460 *

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7235529B2 (en) 1996-10-11 2007-06-26 Human Genome Sciences, Inc. Brain-associated inhibitor of tissue-type plasminogen activator
WO1999041381A1 (fr) * 1998-02-13 1999-08-19 Peter Sonderegger Neuroserpine
US7087574B2 (en) 1999-03-10 2006-08-08 Human Genome Sciences, Inc. Brain associated inhibitor of tissue-type plasminogen activator
WO2000065349A2 (fr) * 1999-04-28 2000-11-02 Cardiogenics Inc. Procede de determination d'inhibiteur d'un activateur de plasminogene
WO2000065349A3 (fr) * 1999-04-28 2001-03-08 Cardiogenics Inc Procede de determination d'inhibiteur d'un activateur de plasminogene
US8258102B2 (en) 2002-07-23 2012-09-04 Novozymes Biopharma Dk A/S Gene and polypeptide sequences
US9133265B2 (en) 2002-07-23 2015-09-15 Novozymes Biopharma Dk A/S Gene and polypeptide sequences
EP2390333A1 (fr) 2002-07-23 2011-11-30 Novozymes Biopharma DK A/S Polypeptides avec une pre-séquence de sécrétion de la sérum albumine humaine modifiée avec rendement de sécrétion amelioré
US7776340B2 (en) 2002-07-27 2010-08-17 The Royal Veterinary College Canine respiratory coronavirus (CRCV) spike protein, polymerase and hemagglutinin/esterase
US7981427B2 (en) 2002-07-27 2011-07-19 The Royal Veterinary College Canine respiratory coronavirus (CRCV) spike protein
US9023366B2 (en) 2003-07-01 2015-05-05 The Royal Veterinary College Vaccine composition for vaccinating dogs against canine infectious respiratory disease (CIRD)
US8329194B2 (en) 2003-07-01 2012-12-11 The Royal Veterinary College Vaccine composition for vaccinating dogs against canine infectious respiratory disease (CIRD)
WO2011079902A2 (fr) 2009-12-18 2011-07-07 Biolnvent International Ab Matériaux biologiques et utilisations de ceux-ci
US9150647B2 (en) 2009-12-18 2015-10-06 Kancera Ab Biological inhibitors of ROR1 capable of inducing cell death
WO2012076727A1 (fr) 2010-12-10 2012-06-14 Bioinvent International Ab Anticorps anti-ror1 et leurs utilisations
WO2012076066A1 (fr) 2010-12-10 2012-06-14 Bioinvent International Ab Anticorps anti-ror1 et leurs applications
WO2014068320A1 (fr) 2012-11-01 2014-05-08 Benf Ab Inhibiteurs de corps de cétone utilisables dans le traitement d'une lésion de la muqueuse du tractus gastro-intestinal
WO2014134561A2 (fr) 2013-03-01 2014-09-04 Boehringer Ingelheim Vetmedica, Inc. Quantification de compositions de vaccin
EP3587439A2 (fr) 2013-03-01 2020-01-01 Boehringer Ingelheim Animal Health USA Inc. Quantification améliorée de compositions de vaccin
WO2015075475A1 (fr) 2013-11-22 2015-05-28 The University Of Nottingham Traitement contre le cancer

Also Published As

Publication number Publication date
EP0934410A1 (fr) 1999-08-11
CA2268007A1 (fr) 1998-04-23
AU7431796A (en) 1998-05-11
JP2002501365A (ja) 2002-01-15

Similar Documents

Publication Publication Date Title
US6548262B2 (en) Methods of measuring tissue factor pathway inhibitor-3
US20060045878A1 (en) Pancreas-derived plasminogen activator inhibitor
US7611846B2 (en) Diagnostic methods involving human growth factor huXAG-1
US20030135028A1 (en) Human serine protease and serpin polypeptides
WO1998007749A1 (fr) Nouveaux facteurs de croissance humains
EP0934410A1 (fr) Inhibiteur cerebro-associe de l'activateur du plasminogene de type tissulaire
US6617132B2 (en) Human cystatin E polynucleotides
US6541452B1 (en) Brain-associated inhibitor of tissue-type plasminogen activator
US6232100B1 (en) Cortistatin Polypeptides
WO1998007735A1 (fr) Inhibiteur de l'activateur du plasminogene derive du pancreas
EP0990000B1 (fr) Facteur de croissance 3 du tissu conjonctif
WO1998029438A9 (fr) Polypeptides de cortistatine
US7737257B2 (en) Connective tissue growth factor (CTGF-3)
US20020132304A1 (en) Human parotid secretory protein
WO1999009161A1 (fr) Inhibiteur de l'activateur du plasminogene derive du pancreas

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU BG BR CA CN CZ EE FI GE HU IL JP KR LT LV MN MX NO NZ PL RO SI SK TR UA US UZ AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref document number: 2268007

Country of ref document: CA

Ref country code: CA

Ref document number: 2268007

Kind code of ref document: A

Format of ref document f/p: F

ENP Entry into the national phase

Ref country code: JP

Ref document number: 1998 518293

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1996936500

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1996936500

Country of ref document: EP

WWR Wipo information: refused in national office

Ref document number: 1996936500

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1996936500

Country of ref document: EP