WO1998010638A1 - Molecules d'interet therapeutique - Google Patents

Molecules d'interet therapeutique Download PDF

Info

Publication number
WO1998010638A1
WO1998010638A1 PCT/AU1997/000591 AU9700591W WO9810638A1 WO 1998010638 A1 WO1998010638 A1 WO 1998010638A1 AU 9700591 W AU9700591 W AU 9700591W WO 9810638 A1 WO9810638 A1 WO 9810638A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
amino acid
leu
acid sequence
lys
Prior art date
Application number
PCT/AU1997/000591
Other languages
English (en)
Inventor
Nicos Antony Nicola
Douglas James Hilton
Jian-Guo Zhang
Richard John Simpson
Original Assignee
Amrad Operations Pty. Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AUPO2262A external-priority patent/AUPO226296A0/en
Priority claimed from AUPO5374A external-priority patent/AUPO537497A0/en
Application filed by Amrad Operations Pty. Ltd. filed Critical Amrad Operations Pty. Ltd.
Priority to AU41049/97A priority Critical patent/AU4104997A/en
Publication of WO1998010638A1 publication Critical patent/WO1998010638A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates generally to therapeutic molecules. More particularly, the present invention provides therapeutic molecules capable of interacting with Interleukin- 13 (IL-13) and to genetic sequences encoding these therapeutic molecules.
  • the therapeutic molecules of the present invention are useful in modulating the action of IL-13 in vivo.
  • IL-13 Interleukin- 13
  • IL-13 is produced by activated T-cells and is involved in regulation of the immune response by, for example, inducing immunoglobulin class switching to IgGl and IgE isotypes and in inhibiting release of inflammatory mediators by macrophages.
  • EL-13 is structurally related to another, functionally similar cytokine, interleukin 4 (IL-4) and both cytokines share common receptor components (Howard and Harada, 1994; McKenzie and Zurawski, 1994; Zurawski and deVries, 1994).
  • the H-,-13 receptor ⁇ -chain (IL-13R ⁇ ) has recently been cloned (Hilton et al, 1996). Analysis of IL-13R ⁇ together with other cloned receptors indicates that IL-13 may first bind IL-13R ⁇ and then recruit IL-4R ⁇ to form a high affinity receptor. IL-2R ⁇ does not appear to play a central role in IL-13 receptor function, whereas in the case of IL-4, binding occurs initially with IL-4R ⁇ and this complex may interact with either IL-2R ⁇ or IL-13R ⁇ to yield a high affinity receptor capable of signal transduction.
  • IL-13 pleiotropic properties of many cytokines such as IL-13 may cause difficulties during treatment regimes. It would be useful to administer IL-13 or a related cytokine to effect a particular response and then to administer a blocking agent to prevent further activity at the localised area. This is also important if the IL-13 administered is capable of inducing an adverse immune response against itself or native IL- 13. There are also a range of conditions aggravated by EL- 13 such as allergic conditions. The ability to reduce IL-13 action would provide a valuable therapeutic tool in treating these conditions.
  • a high affinity binding protein for IL-13 has been identified in mammalian bodily fluid.
  • the protein is functionally, structurally and antigenicaliy distinct from cloned, soluble IL-13R ⁇ and acts as a potent antagonist of IL-13 action.
  • one aspect of the present invention provides an isolated proteinaceous molecule or a recombinant or synthetic form thereof capable of interacting with EL- 13 or a related cytokine with greater affinity than soluble IL-13R ⁇ .
  • the proteinaceous molecule may be a peptide, polypeptide or protein and may be naturally or non-naturally glycosylated or unglycosylated. Differential glycosylation patterns may be obtained depending on the host cell which synthesises the proteinaceous molecule. When a recombinant form of the molecule is produced in prokaryotic cells, for example, the molecule would be substantially non-glycosylated. All forms of glycosylation including substantial absence of glycosylation of the subject proteinaceous molecule are encompassed by the present invention.
  • the proteinaceous molecule and the IL-13 may be derived from the same animal species (ie homologous) or both molecules may be derived for different species (ie heterologous).
  • Animal species contemplated by the present invention include but are not limited to humans, livestock animals (eg sheep, cattle, horses, donkeys, pigs, goats), laboratory test animals (eg rabbits, guinea pigs, rats, mice), companion animals (eg dogs, cats), and captive wild animals (eg foxes, deer, kangaroos and other marsupials, dingoes).
  • the proteinaceous molecule is from humans or murine animals. 5
  • the proteinaceous molecule of the present invention may be a naturally occurring molecule in isolated form or may be a functional derivative thereof.
  • a "functional derivative” means that the molecule retains its ability to interact with IL-13 or a related cytokine or a derivative of EL- 13.
  • Derivatives contemplated by the present invention include mutants, fragments, parts, portions,
  • EL- 13 binding protein IL- 13BP
  • IL- 13BP EL- 13 binding protein
  • references herein to "isolated" forms of EL- 13BP includes reference to a biologically pure preparation of the molecule. Such a purified molecule has undergone at least one purification step from a mixture.
  • a biologically pure preparation is a preparation containing at least about 1%, more particularly at least about 10%, even more particularly at least about
  • EL- 13BP 20 20%, still even more particularly greater than about 30%, eg. 40-50%, 60-70% or above of EL- 13BP or its derivative as determined by, for example, weight, binding activity, antagonising ability, immunointeractivity or other convenient means.
  • Mutants include single or multiple amino acid substitutions, deletions and/or additions to the 25 naturally occurring IL-13BP amino acid sequence.
  • Hybrid forms include but are not limited to hybrids between IL-13BP and IL-4BP which hybrid being capable of interacting with both IL-13 and IL-4.
  • another aspect of the present invention provides a polypeptide having first and second portions wherein one of said 30 first and second portions is IL- 13BP or a functional derivative thereof and the other of said first and second portions is IL-4BP or a functional derivative thereof wherein said polypeptide is capable of modulating biological processes involving EL- 13 and/or IL-4.
  • the spacer may range from one amino acid to 100 amino acids, more preferably between three amino acids and twenty amino acids and even more preferably between five and fifteen amino acids.
  • the hybrid polypeptide may not necessarily modulate equally EL- 13 and IL-4 biological processes but may, for example, be 60-80% effective for EL- 13 processes and only 20-50% effective for EL-4 processes or vice versa.
  • Another particularly preferred hybrid comprises IL-13BP or derivative forms thereof and EL- 13 receptor ⁇ -chain (IL-13R ⁇ ) or its derivatives.
  • IL-13R ⁇ EL- 13 receptor ⁇ -chain
  • Such a hybrid may be particularly useful in modulating activities of related molecules such as, but not limited to, IL-13, IL-13BP, IL-13R ⁇ , IL-4, IL-4BP and IL-4 receptor ⁇ -chain (IL-4R ⁇ ).
  • the IL-13R ⁇ is disclosed in Hilton et al, 1996.
  • Still further hybrids include hybrids between IL-13BPs from different species.
  • a hybrid between all or a functional part of human and murine IL-13BPs are also included in various hybrids.
  • Analogues of IL-13BP contemplated herein include, but are not limited to, modification to side chains, incorporating unnatural amino acids and/or their derivatives during peptide, polypeptide or protein synthesis and the use of crosslinkers and other methods which impose conformational constraints on the proteinaceous molecule or their analogues.
  • side chain modifications contemplated by the present invention include modifications of amino groups such as by reductive alkylation by reaction with an aldehyde followed by reduction with NaBH ⁇ , amidination with methylacetimidate; acylation with acetic anhydride; carbamoylation of amino groups with cyanate; trinitrobenzylation of amino groups with 2, 4, 6-trinitrobenzene sulphonic acid (TNBS); acylation of amino groups with succinic anhydride and tetrahydrophthalic anhydride; and pyridoxylation of lysine with pyridoxal-5- phosphate followed by reduction with NaBH ⁇
  • modifications of amino groups such as by reductive alkylation by reaction with an aldehyde followed by reduction with NaBH ⁇ , amidination with methylacetimidate; acylation with acetic anhydride; carbamoylation of amino groups with cyanate; trinitrobenzylation of amino groups with 2, 4, 6-trinitrobenzene sulphonic acid (TNBS); acylation
  • the guanidine group of arginine residues may be modified by the formation of heterocyclic condensation products with reagents such as 2,3-butanedione, phenylglyoxal and glyoxal.
  • the carboxyl group may be modified by carbodiimide activation via O-acylisourea formation followed by subsequent derivitisation, for example, to a corresponding amide.
  • Sulphydryl groups may be modified by methods such as carboxymethylation with iodoacetic acid or iodoacetamide; performic acid oxidation to cysteic acid; formation of mixed disulphides with other thiol compounds; reaction with maleimide, maleic anhydride or other substituted maleimide; formation of mercurial derivatives using 4-chloromercuribenzoate, 4- chloromercuriphenylsulphonic acid, phenylmercury chloride, 2-chloromercuri-4-nitrophenol and other mercurials; carbamoylation with cyanate at alkaline pH.
  • Tryptophan residues may be modified by, for example, oxidation with N-bromosuccinimide or alkylation of the indole ring with 2-hydroxy-5-nitrobenzyl bromide or sulphenyl halides.
  • Tyrosine residues on the other hand, may be altered by nitration with tetranitromethane to form a 3-nitrotyrosine derivative.
  • Modification of the imidazole ring of a histidine residue may be accomplished by alkylation with iodoacetic acid derivatives or N-carbethoxylation with diethylpyrocarbonate.
  • Examples of incorporating unnatural amino acids and derivatives during peptide synthesis include, but are not limited to, use of norleucine, 4-amino butyric acid, 4-amino-3-hydroxy-5- phenylpentanoic acid, 6-aminohexanoic acid, t-butylglycine, norvaline, phenylglycine, ornithine, sarcosine, 4-amino-3-hydroxy-6-methylheptanoic acid, 2-thienyl alanine and/or D-isomers of amino acids.
  • a list of unnatural amino acid, contemplated herein is shown in Table 1.
  • peptides can be conformationally constrained by, for example, incorporation of C ⁇ and N ⁇ - methylamino acids, introduction of double bonds between C ⁇ and C p atoms of amino acids and the formation of cyclic peptides or analogues by introducing covalent bonds such as forming an amide bond between the N and C termini, between two side chains or between a side chain and the N or C terminus.
  • the present invention further contemplates chemical analogues of IL-13BP capable of acting as antagonists or agonists of EL- 13BP or which can act as functional analogues of EL-13BP which are capable of acting as antagonists of EL- 13 activity.
  • Chemical analogues may not necessarily be derived from EL-13BP but may share certain conformational similarities to the molecule as a whole or to its active site(s). Alternatively, chemical analogues may be specifically designed to mimic certain physiochemical properties of EL- 13BP. Chemical analogues may be chemically synthesised or may be detected following, for example, natural product screening.
  • Non-conventional Code Non-conventional Code amino acid amino acid
  • the interaction between IL-13BP and EL- 13 results in antagonism of IL-13 activity.
  • the antagonism may be from mild to substantial in relation to at least one property attributable to IL-13.
  • the antagonism may result in about 1- 10% reduction or about 10-30% reduction or about 30-50% reduction or about 50-70% or greater (eg >90%) relative to at least one property attributable to IL- 13 or a related cytokine.
  • EL-13BP binds to EL- 13 with a greater than 50-fold higher affinity compared to EL-13R ⁇ .
  • Another aspect of the present invention contemplates a method for purifying IL-13BP or its derivatives or hybrid forms from a biological sample including body fluid or cell culture medium, said method comprising contacting said biological sample with immobilised IL- 13 (or an IL-13 IL-4 hybrid) or a binding derivative thereof for a time and under conditions sufficient for a complex to form between said IL- 13 (or IL- 13/TL-4) and its binding protein, eluting said IL- 13BP (or IL- 13/IL-4) from the immobilised IL- 13 (or IL- 13 IL-4) and collecting said eluted IL-13BP.
  • the eluate is subjected to further purification on an HPLC or equivalent chromatography.
  • the HPLC or equivalent chromatographic purified samples are further purified or analysed on SDS-PAGE.
  • the IL-13BP is antigenicaliy, structurally and functionally distinct from IL- 13R ⁇ .
  • IL-13BP is isolatable from biological fluid such as from urine or other excretable fluid, circulatory fluid such as from serum, whole blood, plasma or lymph fluid or respiratory fluid such as sputum, nasal secretion and saliva.
  • the biological fluid may also comprise medium conditioned by human or animals cells, cell lines, organs and/or tissues.
  • the IL-13BP is isolatable from urine or serum.
  • Native soluble IL-13BP has an apparent molecular mass of approximately 40,000 to 60,000 daltons and more preferably about 55,000 ⁇ 5,000 daltons. Conveniently, the molecule weight may be determined by SDS-PAGE.
  • an isolated proteinaceous molecule comprising the following properties:
  • IL-13R ⁇ (iv) is antigenicaliy and structurally distinct from IL-13R ⁇ ; and (v) migrates as a single band on SDS-PAGE; or a derivative of said proteinaceous molecule.
  • the proteinaceous molecule is an antagonist of at least one property attributable to EL-13.
  • Another aspect of the present invention provides an isolated EL-13BP comprising the amino acid sequence EIKVNPPQDFEIXDPGXLGYLYLQ [SEQ ID NO:l] or a derivative, homologue or analogue thereof.
  • an isolated IL-13BP comprising the amino acid sequence EIKVNPPQDFEIVDPGYLGYLYLQ [SEQ ID NO:22] or a derivative, homologue or analogue thereof.
  • Yet another aspect of the present invention provides an isolated IL-13BP having an amino acid sequence set forth in one of SEQ ID NO:6 or 7 or 8 (N-terminal sequence) or SEQ ID NO: 10 or 1 1 or 12 (C-terminal sequence) or comprises at least about 50% similarity and more preferably at least about 60%, still more preferably at least about 75-80% similarity to at least one of SEQ ID NO:6 or 7 or 8 or 10 or 1 1 or 12.
  • N- or C-terminal sequences include reference to a region at the N- or C- terminal portion of the molecule. It does not, for example, imply any limitation as to including the initiating methione although such a methione may be included in said N-terminal sequence.
  • an isolated human IL-13BP having the amino acid sequence corresponding to SEQ ID NO:20 or a sequence having at least about 50% similarity thereto.
  • nucleic acid molecule comprising a sequence of nucleotides which encodes or is complementary to a sequence which encodes a proteinaceous molecule capable of interacting with EL- 13 or a related cytokine with greater affinity than soluble EL- 13R ⁇ .
  • nucleic acid molecule comprising a sequence of nucleotides which encodes or is complementary to a sequence which encodes a proteinaceous molecule comprising the following properties:
  • the proteinaceous molecule is an antagonist of at least one property attributable to IL-13.
  • the nucleic acid molecule is capable of hybridising with low stringency conditions to one or both of 5' ATGGCTTTCGTTTGCTTGGCTATC3 ' [SEQ ID NO:2] and/or 5'CAACATTCGCAAGAAAAATTCAGTTTATT3' [SEQ ID NO:3] or complementary forms thereof.
  • the nucleic acid molecule encodes a proteinaceous molecule comprising the amino acid sequence set forth in SEQ ID NO: l or 13 or 21 or 22.
  • a preferred nucleic acid molecule encodes an N-terminal amino acid sequence as set forth in one of SEQ ID NO:6 or 7 or 8 or a C-terminal amino acid sequence as set forth in SEQ ID NO: 10 or 11 or 12.
  • amino acid sequence is as set forth in SEQ ID NO: 19.
  • the nucleic acid molecule comprises the nucleotide sequence set forth in SEQ ID NO:5 and/or SEQ ID NO:9 and/or 19 or a nucleic acid molecule capable of hybridizing under low stringency conditions at 42°C and/or is a nucleic acid molecule having at least about 50% nucleotide sequence similarity thereto.
  • Preferred similarities include at least about 60%, at least about 75% and at least about 85-90% to all or preferably to at least 20 contiguous base pairs of the nucleotide sequences set forth in SEQ ID NO:5 and/or SEQ ID NO:9 and/or SEQ ID NO: 19.
  • Reference herein to a low stringency at 42°C includes and encompasses from at least about 1 % v/v to at least about 15% v/v formamide and from at least about 1M to at least about 2M salt for hybridisation, and at least about 1M to at least about 2M salt for washing conditions.
  • Alternative stringency conditions may be applied where necessary, such as medium stringency, which includes and encompasses from at least about 16% v/v to at least about 30% v/v formamide and from at least about 0.5M to at least about 0.9M salt for hybridisation, and at least about 0.5M to at least about 0.9M salt for washing conditions, or high stringency, which includes and encompasses from at least about 31% v/v to at least about 50% v/v formamide and from at least about 0.01M to at least about 0.15M salt for hybridisation, and at least about 0.01M to at least about 0.15M salt for washing conditions.
  • medium stringency which includes and encompasses from at least about 16% v/v to at least about 30% v/v formamide and from at least about 0.5M to at least about 0.9M salt for hybridisation, and at least about 0.5M to at least about 0.9M salt for washing conditions
  • high stringency which includes and encompasses from at least about 31% v/v to at least about 50% v/v form
  • the nucleic acid molecule may be genomic DNA in isolated form or cDNA or mRNA or hybrid forms thereof.
  • the nucleotide sequence may correspond to the native genomic sequence or the cDNA sequence or may comprise single or multiple nucleotide substitutions, deletions and/or additions.
  • the nucleic acid molecules are generally in isolated form but may also be integrated into or ligated to or otherwise fused or associated with other genetic molecules such as vector molecules and in particular expression vector molecules.
  • Vectors and expression vectors are generally capable of replication and, if applicable, expression in one or both of a prokaryotic cell or a eukaryotic cell.
  • prokaryotic cells include E. coli, Bacillus sp and Pseudomonas sp.
  • Preferred eukaryotic cells include yeast, fungal, mammalian and insect cells.
  • another aspect of the present invention contemplates a genetic construct comprising a vector portion and a mammalian EL-13BP gene portion or a derivative thereof, which IL-13BP gene portion encodes an IL-13BP peptide, polypeptide or protein or a functional or immunologically interactive derivative thereof capable of binding to EL- 13.
  • the IL-13BP gene portion of the genetic construct is operably linked to a promoter, such as on the vector, such that said promoter is capable of directing expression of said IL- 13BP gene portion in an appropriate cell.
  • the IL- 13BP gene portion of the genetic construct may comprise all or part of the gene fused to another genetic sequence such as a nucleotide sequence encoding glutathione-S- transferase or part thereof.
  • the IL-13BP of the present invention or its derivatives are contemplated to be useful, inter alia, in the antagonism of at least one IL- 13 activity. This may be important for IL- 13 mediated conditions such as certain allergic conditions such as asthma or to inactivate locally administered IL- 13 after IL- 13 treatment.
  • another aspect of the present invention contemplates a method of treatment comprising administering to a patient an IL-13 antagonising effective amount of an EL-13BP or its derivative for a time and under conditions sufficient to antagonise at least one property of IL-13.
  • DL-13 may have the effect of increasing the level of receptors for rhinoviruses.
  • Antagonising IL-13 would have the effect of reducing adverse rhinovirus interaction such as interaction leading to asthma.
  • the treatment is for an allergic response or allergic reaction.
  • the present invention contemplates, therefore, a pharmaceutical composition
  • a pharmaceutical composition comprising IL- 13BP or a derivative thereof or a modulator of EL- 13BP gene expression or IL-13BP activity and one or more pharmaceutically acceptable carriers and/or diluents. These components are referred to as the "active ingredients".
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions (where water soluble) and sterile powders for the extemporaneous preparation of sterile injectable solutions. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • the preventions of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride.
  • Prolonged abso ⁇ tion of the injectable compositions can be brought about by the use in the compositions of agents delaying abso ⁇ tion, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions are prepared by inco ⁇ orating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by inco ⁇ orating the various sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and the freeze-drying technique which yield a powder of the active ingredient plus any additional desired ingredient from previously sterile-filtered solution thereof.
  • the active ingredients When the active ingredients are suitably protected they may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or it may be enclosed in hard or soft shell gelatin capsule, or it may be compressed into tablets, or it may be inco ⁇ orated directly with the food of the diet.
  • the active compound For oral therapeutic administration, the active compound may be inco ⁇ orated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 1% by weight of active compound.
  • compositions and preparations may, of course, be varied and may conveniently be between about 5 to about 80% of the weight of the unit.
  • the amount of active compound in such therapeutically useful compositions in such that a suitable dosage will be obtained.
  • Preferred compositions or preparations according to the present invention are prepared so that an oral dosage unit form contains between about 0.1 ⁇ g and 2000 mg of active compound.
  • Alternative dosage amounts include from about 1 ⁇ g to about 1000 mg, from about 10 g to above 800 mg and from about 20 ⁇ g to about 500 mg.
  • the tablets, troches, pills, capsules and the like may also contain the components as listed hereafter.
  • a binder such as gum, acacia, com starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such a sucrose, lactose or saccharin may be added or a flavouring agent such as peppermint, oil of wintergreen, or cherry flavouring.
  • the dosage unit form When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit.
  • tablets, pills, or capsules may be coated with shellac, sugar or both.
  • a syrup or elixir may contain the active compound, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavouring such as cherry or orange flavour.
  • any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non-toxic in the amounts employed.
  • the active compound(s) may be inco ⁇ orated into sustained-release preparations and formulations.
  • the present invention also extends to forms suitable for topical application such as creams, lotions and gels.
  • Pharmaceutically acceptable carriers and/or diluents include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and abso ⁇ tion delaying agents and the like.
  • the use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, use thereof in the therapeutic compositions is contemplated.
  • Supplementary active ingredients can also be inco ⁇ orated into the compositions. It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage.
  • Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • the specification for the novel dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the active material and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active material for the treatment of disease in living subjects having a diseased condition in which bodily health is impaired as herein disclosed in detail.
  • the principal active ingredient is compounded for convenient and effective administration in effective amounts with a suitable pharmaceutically acceptable carrier in dosage unit form as hereinbefore disclosed.
  • a unit dosage form can, for example, contain the principal active compound in amounts ranging from 0.5 ⁇ g to about 2000 mg. Expressed in proportions, the active compound is generally present in from about 0.5 ⁇ g to about 2000 mg/ml of carrier.
  • the dosages are determined by reference to the usual dose and manner of administration of the said ingredients.
  • the effective amount of the active ingredient may be as defined above but must be in an amount effective to have the desired effect. Conveniently, this may be expressed as an amount per kilogram (kg) body weight and includes from about 10 ng to about 2000 mg/kg body weight, about 100 ng to about 1000 ng/kg body weight and about 1-10 ⁇ g to above 500 ng/kg body weight.
  • the pharmaceutical composition may also comprise genetic molecules such as a vector capable of transfecting target cells where the vector carries a nucleic acid molecule capable of modulating IL-13BP gene expression or IL-13BP activity.
  • the vector may, for example, be a viral vector.
  • Still another aspect of the present invention is directed to antibodies to IL- 13BP and its derivatives. These antibodies may be directed to soluble IL-13BP or cell surface bound IL- 13BP. Antibodies and in particular antibodies directed to the cell surface bound IL-13BP may function as antagonists.
  • the antibodies may be monoclonal or polyclonal and may be selected from naturally occurring antibodies to IL-13BP or may be specifically raised to IL-13BP or derivatives thereof.
  • the antibodies may also be anti-idiotypic antibodies to the active site of IL- 13BP.
  • IL- 13BP or its derivatives may first need to be associated with a carrier molecule in order to generate the antibodies.
  • the subject antibodies and/or IL-13BP or its derivatives of the present invention are particularly useful as therapeutic or diagnostic agents.
  • EL- 13BP and its derivatives can be used to screen for naturally occurring antibodies to IL-13BP. These may occur, for example in some autoimmune diseases.
  • specific antibodies can be used to screen for IL-13BP.
  • Techniques for such assays are well known in the art and include, for example, sandwich assays and ELISA.
  • Knowledge of IL-13BP levels may be important for diagnosis of certain disease conditions associated with IL-13.
  • the IL-13BP may also be used to assay for IL-13 directly or via antibodies.
  • Antibodies to IL-13BP of the present invention may be monoclonal or polyclonal. Alternatively, fragments of antibodies may be used such as Fab fragments. Furthermore, the present invention extends to recombinant and synthetic antibodies and to antibody hybrids. A "synthetic antibody” is considered herein to include fragments and hybrids of antibodies. The antibodies of this aspect of the present invention are particularly useful for immunotherapy and may also be used as a diagnostic tool for assessing, for example, apoptosis or monitoring the program of a therapeutic mitin.
  • specific antibodies can be used to screen for IL-13BP proteins.
  • the latter would be important, for example, as a means for screening for levels of IL-13BP in a cell extract or other biological fluid or purifying EL- 13BP made by recombinant means from culture supernatant fluid.
  • Techniques for the assays contemplated herein are known in the art and include, for example, sandwich assays and ELISA.
  • second antibodies (monoclonal, polyclonal or fragments of antibodies or synthetic antibodies) directed to the first mentioned antibodies discussed above. Both the first and second antibodies may be used in detection assays or a first antibody may be used with a commercially available anti-immunoglobulin antibody.
  • An antibody as contemplated herein includes any antibody specific to any region of 1L-13BP.
  • Both polyclonal and monoclonal antibodies are obtainable by immunization with the enzyme or protein and either type is utilizable for immunoassays.
  • the methods of obtaining both types of sera are well known in the art.
  • Polyclonal sera are less preferred but are relatively easily prepared by injection of a suitable laboratory animal with an effective amount of IL-13BP, or antigenic parts thereof, collecting serum from the animal, and isolating specific sera by any of the known immunoadsorbent techniques.
  • antibodies produced by this method are utilizable in virtually any type of immunoassay, they are generally less favoured because of the potential heterogeneity of the product.
  • the use of monoclonal antibodies in an immunoassay is particularly preferred because of the ability to produce them in large quantities and the homogeneity of the product.
  • the preparation of hybridoma cell lines for monoclonal antibody production derived by fusing an immortal cell line and lymphocytes sensitized against the immunogenic preparation can be done by techniques which are well known to those who are skilled in the art.
  • Another aspect of the present invention contemplates a method for detecting EL- 13BP in a biological sample from a subject said method comprising contacting said biological sample with an antibody specific for IL-13BP or its derivatives or homologues for a time and under conditions sufficient for an antibody-IL-13BP complex to form, and then detecting said complex.
  • IL-13BP may be detected in a number of ways such as by Western blotting and ELISA procedures.
  • a wide range of immunoassay techniques are available as can be seen by reference to US Patent Nos. 4,016,043, 4, 424,279 and 4,018,653. These, of course, include both single-site and two-site or "sandwich" assays of the non-competitive types, as well as in the traditional competitive binding assays. These assays also include direct binding of a labelled antibody to a target.
  • Sandwich assays are among the most useful and commonly used assays and are favoured for use in the present invention. A number of variations of the sandwich assay technique exist, and all are intended to be encompassed by the present invention. Briefly, in a typical forward assay, an unlabelled antibody is immobilized on a solid substrate and the sample to be tested brought into contact with the bound molecule. After a suitable period of incubation, for a period of time sufficient to allow formation of an antibody-antigen complex, a second antibody specific to the antigen, labelled with a reporter molecule capable of producing a detectable signal is then added and incubated, allowing time sufficient for the formation of another complex of antibody- antigen- labelled antibody.
  • the sample is one which might contain IL-13BP including cell extract, tissue biopsy or possibly serum, saliva, mucosal secretions, lymph, tissue fluid and respiratory fluid.
  • the sample is, therefore, generally a biological sample comprising biological fluid but also extends to fermentation fluid and supernatant fluid such as from a cell culture.
  • a first antibody having specificity for the EL- 13BP or antigenic parts thereof is either covalently or passively bound to a solid surface.
  • the solid surface is typically glass or a polymer, the most commonly used polymers being cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene.
  • the solid supports may be in the form of tubes, beads, discs of microplates, or any other surface suitable for conducting an immunoassay.
  • the binding processes are well-known in the art and generally consist of cross-linking covalently binding or physically adsorbing, the polymer-antibody complex is washed in preparation for the test sample.
  • an aliquot of the sample to be tested is then added to the solid phase complex and incubated for a period of time sufficient (e.g. 2-40 minutes or overnight if more convenient) and under suitable conditions (from about room temperature to about 40°C, eg. 25-37°C) to allow binding of any subunit present in the antibody.
  • the antibody subunit solid phase is washed and dried and incubated with a second antibody specific for a portion of the hapten.
  • the second antibody is linked to a reporter molecule which is used to indicate the binding of the second antibody to the hapten.
  • An alternative method involves immobilizing the target molecules in the biological sample and then exposing the immobilized target to specific antibody which may or may not be labelled with a reporter molecule. Depending on the amount of target and the strength of the reporter molecule signal, a bound target may be detectable by direct labelling with the antibody.
  • a second labelled antibody specific to the first antibody is exposed to the target- first antibody complex to form a target-first antibody-second antibody tertiary complex. The complex is detected by the signal emitted by the reporter molecule.
  • IL-13 or a hybrid form thereof immobilised to a solid support to bind to IL-13BP and then to use an antibody to IL-13BP to detect binding to the immobilised EL- 13.
  • the antibody may be labelled or an anti- immunoglobulin or an anti-immunoglobulin antibody labelled with a reporter molecule could be used.
  • reporter molecule as used in the present specification, is meant a molecule which, by its chemical nature, provides an analytically identifiable signal which allows the detection of antigen-bound antibody. Detection may be either qualitative or quantitative.
  • the most commonly used reporter molecules in this type of assay are either enzymes, fluorophores or radionuclide containing molecules (i.e. radioisotopes) and chemiluminescent molecules.
  • an enzyme is conjugated to the second antibody, generally by means of glutaraldehyde or periodate.
  • glutaraldehyde or periodate As will be readily recognized, however, a wide variety of different conjugation techniques exist, which are readily available to the skilled artisan.
  • Commonly used enzymes include horseradish peroxidase, glucose oxidase, beta- galactosidase and alkaline phosphatase, amongst others.
  • the substrates to be used with the specific enzymes are generally chosen for the production, upon hydrolysis by the corresponding enzyme, of a detectable colour change. Examples of suitable enzymes include alkaline phosphatase and peroxidase.
  • the enzyme-labelled antibody is added to the first antibody hapten complex, allowed to bind, and then the excess reagent is washed away. A solution containing the appropriate substrate is then added to the complex of antibody-antigen-antibody. The substrate will react with the enzyme linked to the second antibody, giving a qualitative visual signal, which may be further quantitated, usually spectrophotometrically, to give an indication of the amount of hapten which was present in the sample.
  • Reporter molecule also extends to use of cell agglutination or inhibition of agglutination such as red blood cells on latex beads, and the like.
  • fluorescent compounds such as fluorescein and rhodamine
  • fluorescein and rhodamine may be chemically coupled to antibodies without altering their binding capacity.
  • the fluorochrome-labelled antibody When activated by illumination with light of a particular wavelength, the fluorochrome-labelled antibody adsorbs the light energy, inducing a state to excitability in the molecule, followed by emission of the light at a characteristic colour visually detectable with a light microscope.
  • the fluorescent labelled antibody is allowed to bind to the first antibody-hapten complex. After washing off the unbound reagent, the remaining tertiary complex is then exposed to the light of the appropriate wavelength the fluorescence observed indicates the presence of the hapten of interest.
  • Immunofluorescence and EIA techniques are both very well established in the art and are particularly preferred for the present method. However, other reporter molecules, such as radioisotope, chemiluminescent or bioluminescent molecules, may also be employed.
  • the present invention also contemplates genetic assays such as involving PCR analysis to detect IL-13BP gene or its derivatives.
  • Alternative methods or methods used in conjunction include direct nucleotide sequencing or mutation scanning such as single stranded conformation polymo ⁇ homs analysis (SSCP) as specific oligonucleotide hybridisation, as methods such as direct protein truncation tests.
  • SSCP single stranded conformation polymo ⁇ homs analysis
  • the present invention also extends to immobilised IL-13 or derivatives thereof useful in the purification of IL- 13BP.
  • Biological fluid is contacted with the immobilised EL- 13 for a time and under conditions for a IL-13-EL-13BP complex to form.
  • the IL-13BP is then eluted from the immobilised IL-13 and subjected to further purification steps.
  • a further aspect of the present invention contemplates an isolated polypeptide comprising an amino acid sequence as set forth in SEQ ID NO:l or 13 or 21 or 22 or an amino acid sequence set forth in SEQ ID NO:6 or 7 or 8 or 10 or 11 or 12 or 20 or having at least about 30% similarity to any one or more thereof.
  • Preferred percentage similarities include at least about 40-50%, more preferably at least about 60-70%, and even more preferably at least about 80- 90% or above.
  • the polypeptide of this aspect of the present invention preferably has IL-13BP properties or is a derivative thereof or is a hybrid form thereof.
  • the present invention further contemplates knockout animals such as mice or other murine species for the EL-13BP gene including homozygous and heterozygous knockout animals.
  • knockout animals such as mice or other murine species for the EL-13BP gene including homozygous and heterozygous knockout animals.
  • Such animals provide a particularly useful live in vivo model for studying the effects of EL- 13BP as well as screening for agents capable of acting as agonists or antagonists of IL- 13BP.
  • transgenic animal comprising a mutation in at least one allele of the gene encoding IL-13BP. Additionally, the present invention provides a transgenic animal comprising a mutation in two alleles of the gene encoding EL- 13BP. Preferably, the transgenic animal is a murine animal such as a mouse or rat.
  • Figure 1 is a graphical representation of EL- 13 binding to EL-I3BP in mouse urine and serum and soluble IL-13R ⁇ by gel filtration chromatography.
  • the gel filtration column was equilibrated and run in TBS at 0.5 ml/rnin as described in the Examples.
  • Panel A 125 I-IL-13 alone (20,000 cpm); Panels C, E and G: 125 I-IL-13 (20,000 cpm) + 100 ⁇ l DBA/2J mouse serum or in the presence of either 1 ⁇ g ml unlabelled IL-13 or IL-4, respectively; Panel B: 125 I- 5 IL-13 alone (50,000 cpm); Panels D, F and H: 125 I-IL-13 (50,000 cpm) + 100 ⁇ l NodLVJax mouse urine or in the presence of either 1 ⁇ g/ml unlabelled IL-13 or BL-4, respectively.
  • Figure 2 is a graphical representation of 125 I-IL-13 binding to soluble IL-13R ⁇ and IL-13BP by gel filtration chromatography.
  • Panel A 125 I-IL-13 (50,000 cm) + 10 ⁇ g/ml soluble IL- 10 13R ⁇ ;
  • Panel B 125 I-IL-13 (50,000 cpm) + 10 ⁇ g ml soluble IL-13R ⁇ + 0.5 ⁇ g ml soluble IL- 4R ⁇ .
  • Figure 3 is a graphical representation showing a comparison of the ability of IL- 13BP and soluble IL-13R ⁇ to inhibit the binding of IL-13 to its cell surface receptor. 10 5 cpm of 125 I-IL-
  • Oligonucleotide capable of hybridising to human IL-13BP DNA (or 2 complementary form thereof)
  • Oligonucleotide capable of hybridising to human EL- 13BP DNA (or complementary form thereof)
  • Recombinant murine IL-13 was produced as a FLAG-tagged protein in Pichia pastoris.
  • 5 Recombinant mouse DL-4 were purchased from R & D Systems.
  • Recombinant soluble mouse IL-4R ⁇ was from Genzyme.
  • N-Glycosidase F and protease V8 were obtained from Boehringer.
  • BS 3 Boehringer (Bis (Sulfosuccimidyl) suberate) was from Pierce.
  • FLAG peptide (DYKDDDDK [SEQ ID NO:4]) and anti-FLAG M2 affinity gel were purchased from Scientific Imaging Systems.
  • Soluble mouse IL-13 receptor ⁇ -chain (IL-13R ⁇ ) which was N- 10 terminally-tagged with a FLAG epitope was expressed in CHO cells and purified from CHO cell-conditioned medium on an anti-FLAG M2 affinity column by affinity elution with free FLAG peptide.
  • Anti-EL-13R ⁇ polyclonal antiserum was prepared by injecting purified soluble IL-13R ⁇ into rabbits which were bled after 3 months.
  • Binding of 125 I-IL-13 to COS-7 cells expressing IL-13R ⁇ was performed as previously described (Hilton et al, 1996). Binding of 125 I-DL-13 to soluble proteins in mouse serum and urine was determined by a gel filtration-based assay using Sephadex G-50 minicolumns (Nick column, Pharmacia) to separate free from bound ligand. Briefly, 50 ⁇ l of serum or 90 ⁇ l of urine per tube was incubated for at least 30 min at 4°C with different amounts of I25 I-IL-13 in a final volume of 100 ⁇ l.
  • the gel which contained 125 I-IL-13 crosslinked to either IL-13BP from mouse urine or purified soluble IL-13R ⁇ , was sliced according to pre-stained molecular weight markers.
  • the gel pieces were added with 10 ⁇ l of Milli-Q water and 15 ⁇ l of 0.1 M sodium phosphate buffer (pH 7.0) containing 10 mM EDTA, 0.1% (w/v) SDS, 0.01% (v/v) ⁇ - mercaptoethanol and minced into small pieces with a pair of tweezers. Then 15 ⁇ l of 0.1 M sodium phosphate buffer (pH 7.0) containing 10 mM EDTA was added to the minced-gel mixtures.
  • the samples were centrifuged and the protein G-Sepharose beads were washed 3 x 0.5 ml PBS, mixed with 40 ⁇ l of two-time concentrated SDS sample buffer and heated for 2 min at 95 °C. The supematants were then analysed by a 13% (w/v) SDS/PAGE under non-reducing conditions.
  • Mouse IL-13 was produced as a N-terminally FLAG-tagged fusion protein in Pichia pastoris and applied to an anti-FLAG antibody (M2) affinity column, non-binding proteins were washed from the column with phosphate-buffered saline containing 0.02% (v/v) Tween 20 after which the proteins that bound to the column, including the FLAG-tagged IL-13, were eluted with free FLAG peptide.
  • the IL- 13 was further purified by RP-HPLC.
  • the FLAG-tagged mlL-13 was first coupled to anti-FLAG antibody M2 affinity beads (Kodak) and then covalently linked to the M2 beads by the chemical cross-linker, BS 3 (Pierce).
  • mIL-13 affinity beads 100 ml of concentrated mouse urine was incubated with mIL-13 affinity beads for 2 hr at room temperature. After removing unbound protein by centrifugation, the mIL- 13 affinity beads were washed extensively with phosphate-buffered saline, pH 7.0, containing 0.02% (v/v) Tween-20 and 0.02% (w/v) sodium azide. The bound protein was eluted with Actisep elution medium 10 (Sterogenes Bioseparations). The eluates containing the active IL-13 binding protein was loaded onto a C8 reversed-phase HPLC column to achieve further purification.
  • IL-13BP an IL-13 binding protein
  • mouse urine was fractionated on a preparative gel filtration column. Aliquots from each fraction were then mixed with 125 I-IL-13 or l25 I-IL-4 in the presence or absence of an excess of unlabelled IL-4 or EL- 13 and subject to cross-linking using the bi-functional reagent dimethyl succinimydyl suberate (DSS). The products of the cross-linking reaction were then resolved by SDS-polyacrylamide electrophoresis and visualised by autoradiography. Cross-linking of I25 I-EL-13 to unfractionated mouse urine revealed the presence of a major band that electrophoresed with an apparent molecular mass of approximately 70,000 daltons.
  • DSS bi-functional reagent dimethyl succinimydyl suberate
  • cross-linking of 125 I-IL-13 to this protein was not in competition with unlabelled IL-13; however, like cross-linking 125 I-IL-13 to purified IL-4R ⁇ , cross-linking to this protein was competed for by IL-4.
  • the addition of purified IL-4R ⁇ to purified IL-13R ⁇ did not alter the pattern of cross-linking observed to either component alone, the inventors sought to determine whether purified EL-4R ⁇ could interact with partially purified 50,000 Mr EL-13BP from mouse urine. As with the purified receptor components, no effect of adding IL-4R ⁇ was observed.
  • a polyclonal antisera to the IL-13R ⁇ was raised in rabbits. This antisera was capable of immunoprecipitating the cross-linked product of 125 I-IL-13 with IL-13R ⁇ , while no immunoprecipitation was observed with a pre-immune rabbit sera. Immunoprecipitation of the complex was not inhibited by the FLAG peptide but was inhibited by an excess of EL-13R ⁇ . In contrast to the IL-13R complex, the complex between the Mr 55,000 dalton urinary IL-13BP and l25 I-IL-13 was not recognised by the rabbit antisera to IL-13R ⁇ suggesting that these proteins are antigenicaliy, as well as structurally and functionally distinct.
  • Soluble receptors for a variety of cytokines have been described. In some cases these act to augment a biological response, while in other situations they may inhibit the biological effect.
  • the inventors examined their effects on peritoneal macrophages.
  • Figure 3 demonstrates that although both the urinary IL-13BP and soluble recombinant IL- 13R ⁇ can inhibit the binding of IL-13 to cell surface receptors expressed by macrophages, IL- 13BP is more efficient.
  • the purification of IL-13BP from mouse urine was shown following SDS-PAGE.
  • the IL- 13BP was purified on an IL- 13 affinity column and then applied to a RP-HPLC column.
  • the protein was eluted with a gradient of increasing acetonitrile.
  • Each fraction was examined by SDS-PAGE and autoradiography. The results illustrated a silver-stained band with an apparent molecular mass of approximately 45,000 daltons which co-fractionates and is of a similar size to the IL-13BP detected by cross linking.
  • the partial amino sequence of purified murine EL-13BP is determined. N-terminal, C-terminal and/or internal sequence is generally used. These data are used to generate oligonucleotide probes or primers to clone out the murine IL-13BP. Alternative cloning protocols include screening for murine IL-13BP expression using anti-EL-13BP antibodies. A variety of murine cell lines may be used as a source of EL-13BP DNA.
  • Example 12 Methods similar to those in Example 10 are used to clone the human EL-13BP gene. Alternative methods include cross hybridization using the murine EL-13BP nucleotide sequence. A variety of human cell lines may be used as a source of human IL-13BP DNA. EXAMPLE 12 N-TERMINAL AMINO ACID SEQUENCE
  • the IL-13BP isolated according to Example 8 was subjected to N-terminal amino acid sequencing and the sequence is set forth substantially as follows:
  • N-terminal sequence is EIKVNPPQDFEIXDPGLLGYLYLQ [SEQ ID NO: 13].
  • N-terminal sequence is EIKVNPPQDFEILDPGLLGYLYLQ [SEQ ID NO:21]
  • the N-terminal amino acid sequence of murine IL-13BP (Example 12) was used to scan gene EST databases.
  • the N-terminal amino acid sequence of the mouse IL-13BP shared significant homology with both the murine and human the EL-5 receptor ⁇ -chains, members of the haemopoietin receptor family which are known to bind to four-alpha helical cytokines such as IL-13.
  • the nucleotide sequence of R52795 (see SEQ ID NO:5, encodes N-terminal region of IL- 13BP) was obtained by sequencing the 5' end of a cDNA clone from a human infant brain library. The clone number was YG99F10. The 3' end of this clone was also sequenced. Translation of SEQ ID NO:5 in each of three reading frames is shown in SEQ ID NOs. 6, 7 and 8, respectively.
  • a region identical to murine IL-13BP N-terminal amino acid sequence is the amino acid sequence EIKVNPPQDFEIXDPGXLGYLYLQ [SEQ ID NO:l] which is in SEQ ID NO:6 and begins at nucleotide 211 and ends at nucleotide 282 of SEQ ID NO:5.
  • a possible initiator methione can be seen at nucleotide 127 of SEQ ID NO:5 and a putative signal sequence follows with the amino acid sequence in SEQ ID NO:6 of:
  • AFVCLAIGCLYTFLISTTFGCTSSS [SEQ ID NO: 14].
  • the putative signal sequence cleaving point would be between S and D at nucleotide positions 202 to 207.
  • the three putative amino acid translations given at SEQ ID NOs: 6-8 have been translated from nucleotide 1, 5 and 3 of SEQ ID NO:5, respectively.
  • IL-13BP is a member of the haemopoietin receptor family and, moreover, provides a means of cloning the cDNA using oligonucleotides designed from the 5' and 3' ESTs of clone YG99F10.
  • An example of suitable oligonucleotides is 5' ATGGCTTTCGTTTGCTTGGCTATC3' [SEQ ID NO:2] nucl 127-150 of R52795 and 5'CAACATTCGCAAGAAAAATTCAGTTTATT3' [SEQ ID NO:3] nucl 12-40 of R52796.
  • R52796 The nucleotide sequence of R52796 is shown in SEQ ID NO:9 (encoding C-terminal region of EL-13BP) and three putative translations in different reading frames are shown in SEQ ID NO:9
  • SEQ ID NO: 12 (nucleotides 171-185).
  • the three putative reading frames given in SEQ ID NOs: 10-12 have been translated from nucleotides 1, 2 and 3, respectively of SEQ ID NO:9.
  • the cloning product eg. PCR product
  • pEF-BOS Mizushima and Nagata, 1990
  • EXAMPLE 14 CLONING OF FULL LENGTH HUMAN IL-13BP
  • the EST YG99F10 was obtained from ATCC and sequenced in full. 5
  • PCR was carried out on the ATCC plasmid using the following primers, with conventional conditions.
  • the resultant product was digested with Asc I and Mlu I and cloned into the Mlu I site of pEF/FLAG/IL-3SS to yield a cDNA encoding the mouse IL-3 signal sequence, an N-terminal FLAG epitope tag and the mature extracellular domain (EIKVNP..to..KKTLLR) of human IL- 15 13BP.
  • This nucleotide sequence and corresponding amino acid sequence is shown in SEQ ID NO: 17.
  • the amino acid sequence alone is shown in SEQ ID NO: 18.
  • amino acid sequence from residue 1 (Met) to residue 33 (Gin) comprises the initiating methione and signal sequence of murine IL-3.
  • the Flag epitope 0 sequence follows (DYKDDDK-[SEQ ID NO:4]) and then the sequence of the mature IL-13 BP in which transcription has been terminated prior to the transmembrane domain to generate a soluble form.
  • GAGATAGTGG ATCCCGGATA CTTAGGTTAT CTCTATTTGC AATGGCAACC CCCACTGTCT 300 CTGGATCATT TTAAGGAATG CACAGTGGAA TATGAACTAA AATACCGAAA CATTGGTAGT 360 GAAACATGGG AAGGACCATC ATTACTAAGA ATCTACATTT ACAAAGGATG GGGTTTGGAT 420 CnTTAACAAG GGGCATTGAA GGCGAAGGTT ACACACGGTT TTTACCCTGG GGC 473
  • MOLECULE TYPE protein
  • FEATURE CDS, nucleotides 1-465 of SEQ ID NO: 9
  • MOLECULE TYPE DNA
  • SEQUENCE DESCRIPTION SEQ ID NO: 15:
  • GAG ATA AAA GTT AAC CCT CCT CAG GAT TTT GAG ATA GTG GAT CCC GGA 48 Glu He Lys Val Asn Pro Pro Gin Asp Phe Glu He Val Asp Pro Gly 1 5 10 15
  • Trp Lys Pro Gly He Gly Val Leu Leu Asp Thr Asn Tyr Asn Leu Phe 130 135 140

Abstract

La présente invention, qui concerne généralement des molécules d'intérêt thérapeutique, concerne plus particulièrement, non seulement des molécules d'intérêt thérapeutique capables d'interaction avec l'interleukine-13 (IL-13), mais aussi des séquences géniques codant de telles molécules d'intérêt thérapeutique. Les molécules d'intérêt thérapeutique de l'invention conviennent pour la modulation in vivo de l'action de l'IL-13.
PCT/AU1997/000591 1996-09-10 1997-09-10 Molecules d'interet therapeutique WO1998010638A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU41049/97A AU4104997A (en) 1996-09-10 1997-09-10 Therapeutic molecules

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
AUPO2262A AUPO226296A0 (en) 1996-09-10 1996-09-10 Therapeutic molecules
AUPO2262 1996-09-10
AUPO5374A AUPO537497A0 (en) 1997-02-27 1997-02-27 Therapeutic molecules - II
AUPO5374 1997-02-27

Publications (1)

Publication Number Publication Date
WO1998010638A1 true WO1998010638A1 (fr) 1998-03-19

Family

ID=25645263

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU1997/000591 WO1998010638A1 (fr) 1996-09-10 1997-09-10 Molecules d'interet therapeutique

Country Status (1)

Country Link
WO (1) WO1998010638A1 (fr)

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0812913A2 (fr) * 1996-06-12 1997-12-17 Smithkline Beecham Corporation Récepteur HR-1 appartenant la famille des récepteurs de cytokin
WO2000064944A1 (fr) * 1999-04-28 2000-11-02 Genetics Institute, Inc. Traitement de la fibrose par antagonisme de il-13 et de chaines receptrices de il-13
WO2001077332A2 (fr) * 2000-04-07 2001-10-18 Heska Corporation Compositions et methodes en rapport avec des recepteurs canins d'immunoglobuline g (igg) et d'il-13
EP1141286A4 (fr) * 1998-12-14 2002-06-26 Genetics Inst Chaine de recepteurs de cytokine
WO2003080675A2 (fr) * 2002-03-22 2003-10-02 Amrad Operations Pty Ltd Anticorps monoclonal contre le recepteur alpha1 de l'interleukine 13 (il-13ra1)
US7189400B2 (en) 1998-03-17 2007-03-13 Genetics Institute, Llc Methods of treatment with antagonists of MU-1
US7198789B2 (en) 1998-03-17 2007-04-03 Genetics Institute, Llc Methods and compositions for modulating interleukin-21 receptor activity
US7314623B2 (en) 2002-07-15 2008-01-01 Wyeth Methods and compositions for modulating T helper (Th) cell development and function
WO2008017894A1 (fr) * 2006-08-10 2008-02-14 University Of Southampton Peptide pour le traitement de l'asthme
US7501121B2 (en) 2004-06-17 2009-03-10 Wyeth IL-13 binding agents
US7553487B2 (en) 1998-12-14 2009-06-30 Genetics Institute, Llc Method and compositions for treating asthma
US7585500B2 (en) 2004-11-17 2009-09-08 Amgen Inc. Fully human monoclonal antibodies to IL-13
US7615213B2 (en) 2004-06-09 2009-11-10 Wyeth Antibodies against human interleukin-13 and pharmaceutical compositions thereof
AU2003212102B2 (en) * 2002-03-22 2010-01-14 Zenyth Operations Pty Ltd Monoclonal antibody against interleukin-13 receptor alpha 1 (IL-13Ralpha1)
US7674459B2 (en) 2003-12-23 2010-03-09 Genentech, Inc. Treatment of cancer with a novel anti-IL13 monoclonal antibody
US7705123B2 (en) 1998-03-17 2010-04-27 Genetics Institute, Llc MU-1, member of the cytokine receptor family
US9920120B2 (en) 2013-09-13 2018-03-20 Genentech, Inc. Methods and compositions comprising purified recombinant polypeptides
US9945858B2 (en) 2013-09-13 2018-04-17 Genentech, Inc. Compositions and methods for detecting and quantifying host cells protein in cell lines and recombinant polypeptide products

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994004680A1 (fr) * 1992-08-21 1994-03-03 Schering Corporation Interleukine-13 humaine
WO1997020926A1 (fr) * 1995-12-06 1997-06-12 Sanofi Polypeptide recepteur de l'il-i3

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994004680A1 (fr) * 1992-08-21 1994-03-03 Schering Corporation Interleukine-13 humaine
WO1997020926A1 (fr) * 1995-12-06 1997-06-12 Sanofi Polypeptide recepteur de l'il-i3

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
EUROPEAN JOURNAL OF IMMUNOLOGY, Volume 27, Number 4, 1997, GAUCHAT et al., "A Novel 4-kb Interleukin-13 Receptor Alpha mRNA Expressed in Human B.T. and Endothelial Cells Encoding an Alternate Type-II Interleukin-4/Interleukin-13 Receptor", pages 971-978. *
IMMUNOLOGY, Volume 87, Number 4, 1996, BOST et al., "In Vivo Treatment with Anti-Interleukin-13 Antibodies Significantly Reduces the Humoral Immune Response Against an Oral Immunogen in Mice", pages 633-641. *
THE JOURNAL OF BIOLOGICAL CHEMISTRY, Volume 272, Number 14, 1997, ZHANG et al., "Identification Purification and Characterization of a Soluble Interleukin (IL)-13-Binding Protein", pages 9474-9480. *

Cited By (48)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6664227B1 (en) 1996-03-01 2003-12-16 Genetics Institute, Llc Treatment of fibrosis by antagonism of IL-13 and IL-13 receptor chains
EP0812913A3 (fr) * 1996-06-12 1999-08-04 Smithkline Beecham Corporation Récepteur HR-1 appartenant la famille des récepteurs de cytokin
EP0812913A2 (fr) * 1996-06-12 1997-12-17 Smithkline Beecham Corporation Récepteur HR-1 appartenant la famille des récepteurs de cytokin
US7282206B2 (en) 1997-04-30 2007-10-16 Wyeth Treatment of fibrosis by antagonism of IL-13 and IL-13 receptor chains
US7705123B2 (en) 1998-03-17 2010-04-27 Genetics Institute, Llc MU-1, member of the cytokine receptor family
US7994292B2 (en) 1998-03-17 2011-08-09 Genetics Institute, Llc MU-1, member of the cytokine receptor family
US7189400B2 (en) 1998-03-17 2007-03-13 Genetics Institute, Llc Methods of treatment with antagonists of MU-1
US7198789B2 (en) 1998-03-17 2007-04-03 Genetics Institute, Llc Methods and compositions for modulating interleukin-21 receptor activity
US7507706B1 (en) 1998-12-14 2009-03-24 Genetics Institute, Llc Cytokine receptor chain
EP1141286A4 (fr) * 1998-12-14 2002-06-26 Genetics Inst Chaine de recepteurs de cytokine
US7553487B2 (en) 1998-12-14 2009-06-30 Genetics Institute, Llc Method and compositions for treating asthma
WO2000064944A1 (fr) * 1999-04-28 2000-11-02 Genetics Institute, Inc. Traitement de la fibrose par antagonisme de il-13 et de chaines receptrices de il-13
US7378275B2 (en) 2000-04-07 2008-05-27 Heska Corporation Canine IL-13 receptor alpha-1 subunit nucleic acid molecules
US6703360B2 (en) 2000-04-07 2004-03-09 Heska Corporation Compositions and methods related to canine IgG and canine IL-13 receptors
WO2001077332A2 (fr) * 2000-04-07 2001-10-18 Heska Corporation Compositions et methodes en rapport avec des recepteurs canins d'immunoglobuline g (igg) et d'il-13
WO2001077332A3 (fr) * 2000-04-07 2002-07-25 Heska Corp Compositions et methodes en rapport avec des recepteurs canins d'immunoglobuline g (igg) et d'il-13
JP2006504623A (ja) * 2002-03-22 2006-02-09 アムラッド オペレイションズ ピーティーワイ リミティッド インターロイキン１３受容体α１（ＩＬ−１３Ｒα１）に対するモノクローナル抗体
US8221755B2 (en) 2002-03-22 2012-07-17 Zenyth Operations Pty Ltd. Monoclonal antibody against interleukin-13 receptor alpha 1 (IL-13Ralpha1)
US7785590B2 (en) 2002-03-22 2010-08-31 Zenyth Operations Pty Ltd. Monoclonal antibody against interleukin-13 receptor alpha 1 (IL-13Ra1)
WO2003080675A3 (fr) * 2002-03-22 2007-03-01 Amrad Operations Pty Ltd Anticorps monoclonal contre le recepteur alpha1 de l'interleukine 13 (il-13ra1)
AU2003212102B2 (en) * 2002-03-22 2010-01-14 Zenyth Operations Pty Ltd Monoclonal antibody against interleukin-13 receptor alpha 1 (IL-13Ralpha1)
WO2003080675A2 (fr) * 2002-03-22 2003-10-02 Amrad Operations Pty Ltd Anticorps monoclonal contre le recepteur alpha1 de l'interleukine 13 (il-13ra1)
US7314623B2 (en) 2002-07-15 2008-01-01 Wyeth Methods and compositions for modulating T helper (Th) cell development and function
US7731946B2 (en) 2002-07-15 2010-06-08 Wyeth Llc Methods and compositions for modulating T helper (TH) cell development and function
US8734797B2 (en) 2003-12-23 2014-05-27 Genentech, Inc. Anti-IL13 antibodies and uses thereof
US8734801B2 (en) 2003-12-23 2014-05-27 Genentech, Inc. Anti-IL13 antibodies and uses thereof
US9605065B2 (en) 2003-12-23 2017-03-28 Genentech, Inc. Anti-IL13 antibodies and uses thereof
US9067994B2 (en) 2003-12-23 2015-06-30 Genentech, Inc. Anti-IL13 antibodies and uses thereof
US7674459B2 (en) 2003-12-23 2010-03-09 Genentech, Inc. Treatment of cancer with a novel anti-IL13 monoclonal antibody
US11434287B2 (en) 2003-12-23 2022-09-06 Genentech, Inc. Anti-IL13 antibodies and uses thereof
US8067199B2 (en) 2003-12-23 2011-11-29 Genentech, Inc. Anti-IL13 antibodies and uses thereof
US8088618B2 (en) 2003-12-23 2012-01-03 Genentech, Inc. Anti-IL 13 antibodies and uses thereof
US8318160B2 (en) 2003-12-23 2012-11-27 Genentech, Inc. Treatment of cancer with novel anti-IL13 monoclonal antibodies
US7615213B2 (en) 2004-06-09 2009-11-10 Wyeth Antibodies against human interleukin-13 and pharmaceutical compositions thereof
US7501121B2 (en) 2004-06-17 2009-03-10 Wyeth IL-13 binding agents
US7943342B2 (en) 2004-06-17 2011-05-17 Wyeth Llc Nucleic acids encoding IL-13 binding agents
US7994302B2 (en) 2004-11-17 2011-08-09 Amgen Inc. Fully human monoclonal antibodies to IL-13
US7585500B2 (en) 2004-11-17 2009-09-08 Amgen Inc. Fully human monoclonal antibodies to IL-13
WO2008017894A1 (fr) * 2006-08-10 2008-02-14 University Of Southampton Peptide pour le traitement de l'asthme
US9945858B2 (en) 2013-09-13 2018-04-17 Genentech, Inc. Compositions and methods for detecting and quantifying host cells protein in cell lines and recombinant polypeptide products
US10494429B2 (en) 2013-09-13 2019-12-03 Genentech, Inc. Compositions comprising purified anti-abeta monoclonal antibodies
US10597447B2 (en) 2013-09-13 2020-03-24 Genentech, Inc. Compositions comprising purified recombinant IL-13 antibody
US10597446B2 (en) 2013-09-13 2020-03-24 Genentech, Inc. Method of treatment comprising purified recombinant IL-13 antibody
US10788494B2 (en) 2013-09-13 2020-09-29 Genentech, Inc. Compositions and methods for detecting and quantifying host cell protein in cell lines and recombinant polypeptide products
US10822404B2 (en) 2013-09-13 2020-11-03 Genentech, Inc. Methods and compositions comprising purified recombinant polypeptides
US9920120B2 (en) 2013-09-13 2018-03-20 Genentech, Inc. Methods and compositions comprising purified recombinant polypeptides
US11519912B2 (en) 2013-09-13 2022-12-06 Genentech, Inc. Compositions and methods for detecting and quantifying host cell protein in cell lines and recombinant polypeptide products
US11667706B2 (en) 2013-09-13 2023-06-06 Genentech, Inc. Methods of purifying recombinant anti-abeta antibodies

Similar Documents

Publication Publication Date Title
AU718899C (en) A novel haemopoietin receptor and genetic sequences encoding same
US20080009444A1 (en) Biologically active complex of NR6 and cardiotrophin-like-cytokine
WO1998010638A1 (fr) Molecules d'interet therapeutique
US6414128B1 (en) Haemopoietin receptor and genetic sequences encoding same
EP0931149B1 (fr) Nouveau recepteur d'hematopoietine et sequences genetiques codant ce dernier
US6911530B1 (en) Haemopoietin receptor and genetic sequences encoding same
US20090143571A1 (en) Novel genes and their use in the modulation of obesity, diabetes and energy imbalance
US20080274973A1 (en) novel haemopoietin receptor and genetic sequences encoding same
EP0932674B1 (fr) NOUVEAU GENE DE MAMMIFERE bcl-w APPARTENANT A LA FAMILLE bcl-2 DE GENES LUTTANT CONTRE L'APOPTOSE
US6326179B1 (en) Catalytic antibodies and a method of producing same
US20070065915A1 (en) Nucleic acid expressed in the hypothalamus or muscle tissue in obese animals
WO1997004091A1 (fr) Nouveaux ligands de recepteurs et sequences genetiques codant ces ligands
US7220828B2 (en) Haemopoietin receptor and genetic sequence encoding same
WO1998034951A1 (fr) Nouvelle famille de cytokines et utilisations correspondantes
US20060294608A1 (en) Novel haemopoietin receptor and genetic sequences encoding same
US7192576B1 (en) Biologically active complex of NR6 and cardiotrophin-like-cytokine
EP1196438A1 (fr) Ligand de la proteine balise
AU711646B2 (en) Novel receptor ligands and genetic sequences encoding same
WO2003031468A1 (fr) Molecules therapeutiques et diagnostiques pouvant interagir avec des proteines socs
AU2002227795A1 (en) Nucleic acid expressed in the hypothalamus or muscle tissue in obese animals
WO2002100416A1 (fr) Molecules socs-5, leur criblage et leurs utilisations therapeutiques
AU5848698A (en) A new cytokine family and uses thereof
AU2002332956A1 (en) Differentially expressed genes associated with obesity and type 2 diabetes

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH KE LS MW SD SZ UG ZW AT BE CH DE DK ES FI FR GB GR IE IT LU MC

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 1998513054

Format of ref document f/p: F

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA