WO1998007870A1 - Novel raftk signaling molecules and uses therefor - Google Patents

Novel raftk signaling molecules and uses therefor Download PDF

Info

Publication number
WO1998007870A1
WO1998007870A1 PCT/US1997/014093 US9714093W WO9807870A1 WO 1998007870 A1 WO1998007870 A1 WO 1998007870A1 US 9714093 W US9714093 W US 9714093W WO 9807870 A1 WO9807870 A1 WO 9807870A1
Authority
WO
WIPO (PCT)
Prior art keywords
raftk
cell
protein
gene
cells
Prior art date
Application number
PCT/US1997/014093
Other languages
French (fr)
Other versions
WO1998007870A9 (en
Inventor
Shalom Avraham
Hava Avraham
Jerome E. Groopman
Original Assignee
Beth Israel Deaconess Medical Center, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beth Israel Deaconess Medical Center, Inc. filed Critical Beth Israel Deaconess Medical Center, Inc.
Priority to AU41479/97A priority Critical patent/AU4147997A/en
Publication of WO1998007870A1 publication Critical patent/WO1998007870A1/en
Publication of WO1998007870A9 publication Critical patent/WO1998007870A9/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • PTK protein tyrosine kinase
  • Protein kinase cascades allow for amplification, feedback, cross-talk, and branching in signal transduction pathways.
  • the integrin cell surface receptors are also capable of transducing cytoplasmic signals (Hynes, R.O. (1992) Cell 69, 11-25; Juliano, R.L., and Haskill, S. (1993) J. Cell Biol. 120, 577-585; Schwartz, M.A. (1992) Trends Cell Biol. 2, 304-308) and activation of this pathway is linked to one or more PTKs (Guan, J.-L., et al. (1991) Cell Regul. 2, 951 -964; Kornberg, L.J.et al. ( 1991 ) Proc. Natl. Acad. Sci. USA 88, 8392-8396).
  • Integrins are the major family of cell surface receptors that mediate adhesive interactions (Albelda, S. M. and Buck, C. A. (1990) FASEB J4, 2868). Integrin receptor engagement and subsequent clustering of integrins lead to the formation of focal adhesion sites. Protein assemblies of integrins, linked to intracellular cytoskeletal complexes and to bundles of actin filaments in focal adhesions, play critical roles in modulating adhesion and inducing shape changes involved in cell spreading and locomotion (Hynes R O. (1992) Cell 69, 1 1). Such cellular adhesive interactions, mediated by cell surface receptors that bind to ligands on adjacent cells or in the extracellular matrix, participate in the processes of cell migration, proliferation and differentiation (Gumbiner. B.
  • focal adhesion proteins Two focal adhesion proteins that demonstrate a high stoichiometry of tyrosine phosphorylation upon integrin activation are the focal adhesion kinase (FAK) and paxillin (Schaller, M. D. et al. ( 1992) Proc Natl Acad Sci USA 89, 5192; Hanks, S. K. et al. (1992) Proc Natl Acad Sci USA 89, 8487; Burridge, K. et al. (1992) J Cell Biol 1 19, 893).
  • the tyrosine phosphorylation of these two proteins has been suggested as being involved in both the formation of focal adhesions and the assembly of actin stress fibers (Burridge, K. et al.
  • Src tyrosine kinases are capable of interacting with components of focal adhesions upon kinase activation (Weng, Z. et al. (1993) J Biol Chem 268, 14956; Schaller, M. D. et al. (1994) Mol Cell Biol 14, 1680).
  • the Tyr* 39 ? of FAK is autophosphorylated upon integrin-mediated stimulation.
  • This phosphotyrosine then provides a binding site for the SH2 domain of p ⁇ OSrc and its family members, e.g. p59Fyn (Cobb, B. S. et al. (1994) Mol Cell Biol 14, 147 Eide, B. L. et al. (1995) Mol Cell Biol 15, 2819).
  • Integrin-mediated signal transduction was found to be linked to the Ras pathway by Grb2 binding to FAK (Schlaepfer, D. D. et al. (1994) Nature 372, 786; Kharbanda, S. et al. (1995) Proc Natl Acad Sci USA 92, 6132).
  • Phosphatidylinositol 3-kinase (PI-3 kinase) was also associated with the activated FAK (Chen, H-C et al. (1994) Proc Natl Acad Sci USA 91 , 10148; Guinebault, C. et al. (1995) J Cell Biol 129, 831).
  • FAK phosphorylation is stimulated by a number of other substances, including small peptide mitogens such as vasopressin, bombesin, endothelin (Zachary, I. et al. (1992) J Biol Chem 267, 19031; Colltt- Smith, J, et al. (1993) . / Biol Chem 268, 14261), and bradykinin (Leeb-Lundberg, L. M. F et al. (1994) J Biol Chem 269, 24328); bioactive lipids such as Alzheimer's Ab peptide (Zhang C et al.
  • the present invention is based on the discovery of novel molecules, referred to herein as "related adhesion focal tyrosine kinase” or "RAFTK” polypeptide molecules and the nucleic acid molecules coding therefore.
  • the RAFTK molecules of the present invention are useful in regulating a variety of cellular processes.
  • the RAFTK polypeptide is an intracytoplasmic protein tyrosine kinase.
  • the invention features isolated vertebrate RAFTK nucleic acid molecules.
  • a RAFTK nucleic acid has a nucleic acid sequence shown in one of SEQ ID NOs: 1 or 3, or a complement or fragment thereof.
  • the disclosed molecules can be non-coding, (e.g. probe, antisense or ribozyme molecules) or can encode a polypeptide with RAFTK bioactivity.
  • a RAFTK nucleic acid of the present invention comprises the coding region of one of SEQ ID NOs: 1 or 3.
  • the subject RAFTK nucleic acids encode a polypeptide with a RAFTK bioactivity.
  • the nucleic acid of the present invention encodes a polypeptide shown in one of SEQ ID NOs: 2 or 4.
  • the nucleic acids of the present invention can hybridize to a vertebrate RAFTK gene or to the complement of a vertebrate RAFTK gene.
  • a RAFTK nucleic acid hybridizes with the coding sequence designated in one of SEQ ID NOs: l or 3 or to the complement to the coding sequence designated in one of SEQ ID NOs:l or 3.
  • the hybridization is conducted under stringent conditions.
  • the nucleic acid molecule is a RAFTK nucleic acid molecule that is at least 60%, at least 70%, preferably 80%, more preferably 85%, and even more preferably at least 95% homologous in sequence to the nucleic acids shown in one of SEQ ID NOs: 1 or 3 or to the complement of the nucleic acid shown in one of SEQ ID NOs:l or 3.
  • the RAFTK nucleic acid molecule encodes a polypeptide that is at least 60%, preferably at least 70%, preferably 80%, and more preferably at least 85%, and even more preferably at least 95% homologous in sequence to the polypeptide shown in one of SEQ ID NOs: 2 or 4.
  • the invention also provides probes and primers comprising substantially purified oligonucleotides, which correspond to a region of nucleotide sequence which hybridizes to at least 6 consecutive nucleotides of the sequence set forth in one of SEQ ID NOs:l or 3. the complement of one of SEQ ID NOs: 1 or 3, or naturally occurring mutants thereof.
  • a probe or primer of the present invention hybridizes under stringent conditions to a nucleic acid corresponding to at least 12 consecutive nucleotides of either sense or antisense sequence of one or more of SEQ ID NOs:l or 3; preferably to at least 25 consecutive nucleotides; and more preferably to at least 40, 50 or 75 consecutive nucleotides of either sense or antisense sequence of one or more of SEQ ID NOs: 1 or 3.
  • a probe of the present invention comprises all or a portion of nucleotides 1595-2974 of one of SEQ ID NOs: l or 3.
  • the probe/primer further includes a label group, which is capable of being detected.
  • the subject RAFTK nucleic acids can include a transcriptional regulatory sequence, e.g. at least one of a transcriptional promoter (e.g., for constitutive expression or inducible expression) or transcriptional enhancer sequence, which regulatory sequence is operably linked to the RAFTK gene sequence.
  • a transcriptional promoter e.g., for constitutive expression or inducible expression
  • transcriptional enhancer sequence which regulatory sequence is operably linked to the RAFTK gene sequence.
  • Such regulatory sequences in conjunction with a RAFTK nucleic acid molecules can be useful vectors for gene expression.
  • This invention also features host cells transfected with such an expression vector whether prokaryotic or eukaryotic and m vitro (e.g. cell culture) and in vivo (e.g. transgenic) methods for producing RAFTK polypeptides by employing the expression vectors.
  • the invention also features transgenic non-human animals which include a heterologous form of a RAFTK gene described herein, or which misexpress an endogenous RAFTK gene (e.g., an animal in which expression of one or more of the subject RAFTK proteins is disrupted).
  • a transgenic animal can serve as an animal model for studying cellular and tissue disorders comprising mutated or mis- expressed RAFTK alleles or can be used in drug screening.
  • a transgenic animal can be useful for expressing recombinant RAFTK polypeptides.
  • the invention features isolated RAFTK polypeptides, preferably substantially pure preparations e.g., of plasma purified or recombinantly produced RAFTK polypeptides.
  • the polypeptide has a RAFTK bioactivity.
  • RAFTK polypeptides which specifically antagonize the activity of a native RAFTK polypeptide, such as can be provided by truncation mutants or other dominant negative mutants, are also specifically contemplated by the present invention.
  • the polypeptide is identical to or homologous to a RAFTK protein represented in one of SEQ ID NOs: 2 or 4.
  • a RAFTK polypeptide has an amino acid sequence at least 60%, at least 70% homologous, preferably at least 80%, more preferably at least 90%, and even more preferably at least 95% homologous to the polypeptide represented by one of SEQ ID NOs: 2 or 4.
  • the RAFTK polypeptide is encoded by a nucleic acid which hybridizes with a nucleic acid sequence represented in one of SEQ ID NOs: 1 or 3.
  • the subject RAFTK polypeptides also include modified polypeptides, which are resistant to post-translation modification, as for example, due to mutations which alter modification sites (such as tyrosine, threonine, serine or aspargine residues), or which prevent glycosylation of the protein, or which prevent interaction of the protein with intracellular proteins.
  • modified polypeptides which are resistant to post-translation modification, as for example, due to mutations which alter modification sites (such as tyrosine, threonine, serine or aspargine residues), or which prevent glycosylation of the protein, or which prevent interaction of the protein with intracellular proteins.
  • the RAFTK polypeptide can comprise a full length protein, such as represented in one of SEQ ID NOs: 2 or 4, or it can comprise a fragment corresponding to one or more particular motifs/domains, or to arbitrary sizes, e.g., at least 5, 10, 25, 50, 100, 150 or 200 amino acids in length.
  • the RAFTK polypeptide includes at least a portion of an RAFTK kinase domain and has a RAFTK bioactivity.
  • the subject RAFTK polypeptides have a molecular weight of approximately 123kD.
  • chimeric molecules comprised of a RAFTK polypeptides.
  • the RAFTK polypeptides can be provided as a recombinant fusion protein which includes a second polypeptide portion, e.g., a second polypeptide having an amino acid sequence unrelated (heterologous) to the RAFTK polypeptide, (e.g. the second polypeptide portion is glutathione-S-transferase, an enzymatic activity such as alkaline phosphatase or an epitope tag).
  • a further aspect of the invention features pharmaceutical preparations including RAFTK polypeptides or homologues, or the nucleic acids encoding RAFTK polypeptides and a pharmaceutically acceptable carrier.
  • an immunogen comprising a RAFTK polypeptide in an immunogenic preparation, the immunogen being capable of eliciting an immune response specific for a RAFTK polypeptide, e.g., a humoral response, an antibody response and/or cellular response.
  • the immunogen comprises an antigenic determinant, e.g. a unique determinant, from the protein represented by one of SEQ ID NOs: 2 or 4.
  • a still further aspect of the present invention features antibodies and antibody preparations specifically reactive with an epitope of the RAFTK protein.
  • the antibody specifically binds to an epitope represented in one of SEQ ID NOs:2 or 4.
  • an antibody of the present specifically recognizes amino acids 68-1009 from the RAFTK c-terminus.
  • Yet another aspect of the present invention concerns a method for modulating the growth, migration, differentiation, and/or survival of a cell, e.g., a mast cell, a melanocyte, or a megakaryocyte, by modulating RAFTK bioactivity (e.g., by potentiating or disrupting certain protein-protein interactions in a RAFTK signaling pathway).
  • a cell e.g., a mast cell, a melanocyte, or a megakaryocyte
  • the method comprises treating the cell with an effective amount of a RAFTK therapeutic so as to alter, relative to the cell in the absence of treatment, at least one of (i) rate of growth, (ii) differentiation, (iii) hematopoiesis or (iv) survival of the cell.
  • the cells are selected from a group incouding mast cells, melanocytes, and megakaryocytic cells.
  • a RAFTK therapeutic can be used in a method of modulatin cell adhesion, migration, phagocytosis, or motility.
  • the method can be used to modulate focal adhesion formation or to treat metastasis by a tumor cell.
  • RAFTK therapeutics such as peptide and peptidomimetics or other molecules identified in the above-referenced drug screens which agonize or antagonize the effects of signaling from a RAFTK protein or ligand binding of a RAFTK protein.
  • Other RAFTK therapeutics include antisense constructs for inhibiting expression of RAFTK proteins, and dominant negative mutants of RAFTK proteins which competitively inhibit ligand interactions upstream and signal transduction downstream of the wild-type RAFTK protein.
  • the subject RAFTK peptides are capable of modulating signal transduction in a pathway involving stem cell factor, thrombin, fibronectin, CSF-l/M- CSF, T cell receptor stimulation, bFGF, oncoprotein M, IL-6, or TNFa.
  • a further aspect of the present invention provides a method of determining if a subject is at risk for a disorder characterized by unwanted cell proliferation or aberrant control of differentiation.
  • the method includes detecting, in a tissue of the subject, the presence or absence of a genetic lesion characterized by at least one of (i) a mutation of a gene encoding a RAFTK protein, e.g. represented in one of SEQ ID NOs: 1 or 3, or a homolog thereof; or (ii) the mis-expression of a RAFTK gene.
  • detecting the genetic lesion includes ascertaining the existence of at least one of: a deletion of one or more nucleotides from a RAFTK gene; an addition of one or more nucleotides to the gene, a substitution of one or more nucleotides of the gene, a gross chromosomal rearrangement of the gene; an alteration in the level of a messenger RNA transcript of the gene; the presence of a non- wild type splicing pattern of a messenger RNA transcript of the gene; a non- wild type level of the protein; and/or an aberrant level of RAFTK protein.
  • detecting the genetic lesion can include (i) providing a probe/primer comprised of an oligonucleotide which hybridizes to a sense or antisense sequence of a RAFTK gene or naturally occurring mutants thereof, or 5' or 3' flanking sequences naturally associated with the RAFTK gene; (ii) contacting the probe/primer with an appropriate nucleic acid containing sample; and (iii) detecting, by hybridization of the probe/primer to the nucleic acid, the presence or absence of the genetic lesion; e.g., wherein detecting the lesion comprises utilizing the probe/primer to determine the nucleotide sequence of the RAFTK gene and, optionally, of the flanking nucleic acid sequences.
  • the primer can be employed in a polymerase chain reaction (PCR) or in a ligation chain reaction (LCR).
  • the level of a RAFTK protein is detected in an immunoassay using an antibody which is specifically immunoreactive with the RAFTK protein.
  • the invention provides for methods of preparing differentiated blood cells by modulating the activity of a RAFTK protein in a progenitor stem cell.
  • the subject method can be used to prepare megakaryocytes. Platelets can also be prepared using the subject method.
  • the invention provides assays, e.g., for screening test compounds to identify inhibitors, or alternatively, potentiators, of an interaction between a RAFTK protein and, for example, an intracellular protein which binds to the RAFTK protein.
  • An exemplary method includes the steps of (i) combining a RAFTK polypeptide or bioactive fragments thereof, a RAFTK target molecule, and a test compound, e.g., under conditions wherein, but for the test compound, the RAFTK protein and target molecule arc able to interact; and (ii) detecting the formation of a complex which includes the RAFTK protein and the target polypeptide either by directly quantitating the complex, or by measuring a bioactivity of the RAFTK protein.
  • a statistically significant change, such as a decrease, in the interaction of the RAFTK and target molecule in the presence of a test compound (relative to what is detected in the absence of the test compound) is indicative of a modulation (e.g., inhibition or potentiation of the interaction between the RAFTK protein and the target molecule).
  • the ability of a compound to affect the interaction between and one or more of the RAFTK binding-proteins selected from the group consisting of paxillin, protein kinase C (PKC)- ⁇ , PKC- ⁇ , src, fyn, Grb2, PI3 kinase, the c-fms receptor, and calpain is detected.
  • the phosphorylation state of RAFTK or a RAFTK binding protein is measured as a readout of protein-protein interaction.
  • the reaction mixture can be a reconstituted protein mixture or a cell lysate.
  • the RAFTK protein can be a recombinant protein.
  • either the RAFTK protein or the ⁇ -T ⁇ T-binding protein is a fusion protein and in preferred embodiments, at least one of the proteins includes a label group for detection.
  • the reaction mixture is a whole cell and the interaction of RAFTK and a RAFTK binding protein is detected in a two hybrid assay.
  • the invention provides for compounds identified using the subject assay, whether agonists or antagonists (inhibitors) of RAFTK activity.
  • the compounds identified in the subject screening assays are included in a pharmaceutical preparation.
  • the invention provides for a method of modulating cell growth, differentiation or survival by contacting a cell with a pharmaceutical preparation including a compound identified in one of the subject drug screening assays.
  • Figure 1 is a schematic representation and restriction enzyme map of the RAFTK cDNA.
  • the various cDNA clones, obtained from the Human Hippocampus cDNA Library (in Zap II vector) and the CMK/PMA cDNA library (in ⁇ -gtl 0 vector) are shown as indicated. Restriction enzyme sites are indicated along the length of the cDNA.
  • Figure 2 shows a comparison of the deduced amino acid sequence of RAFTK with those of m-ppl25F AK* , src, c-fyn, htk and fgfr. Gaps (indicated by dashes) are introduced to optimize the alignment. Amino acid residues found to be conserved are boxed.
  • Figure 3 shows an alignment of the predicted amino acid sequences (single- letter code) of the mouse RAFTK, human RAFTK and the mouse ppl25 ⁇ A *" gene translated product. Amino acid residues found to be conserved are boxed.
  • Figure 4 shows haplotype analysis of Chromosome 14 genetic markers in
  • Figure 5 shows co-segregation of RAFTK and Gnrh in BXD RI lines and localization to Chromosome 14. Strain distribution patterns are depicted for RAFTK in the BXD RI lines. The RI line distribution pattern is compared with that of the Gnrh locus. Map units are indicated between RAFTK and Gnrh, as are 95% confidence limits.
  • PTKs Protein tyrosine kinases
  • the novel RAFTK proteins of the present invention were identified using PCR primers based on conserved sequences of protein-tyrosine kinases.
  • the human RAFTK gene was cloned from the CM cell line, which has properties of cells of the megakaryocytic lineage.
  • the 3.6 kb RAFTK human cDNA is shown in SEQ ID NO: 1.
  • the full length cDNA contains an open reading frame with the first in-frame ATG codon located at nucleotides 294-296, followed by a stop codon at positions 3260-3262.
  • RAFTK is 51 % homologous to focal adhesion kinase, FAK at the nucleic acid level.
  • the murine homolog was subsequently cloned, based on the ability of a probe derived from the human sequence to hybridize to the mouse gene under high stringency conditions.
  • the murine RAFTK homolog encodes a protein of 1009 amino acids.
  • the amino acid sequences of the human and murine RAFTK proteins are 95% homologous and the nucleic acid sequences are 90% homologous.
  • the RAFTK gene was mapped to human chromosome 8 and to chromosome 14 in the mouse.
  • the open reading frame of the RAFTK nucleic acid encodes a predicted protein of 1009 amino acid residues.
  • the RAFTK protein migrates with a molecular weight of approximately 115-125 kD. In preferred embodiments, the RAFTK protein of the present invention is approximately about 123 kD.
  • the RAFTK proteins of the present invention can be activated by phosphorylation , and it will be understood that other post-translational modifications can alter the apparent molecular weight of the protein.
  • the RAFTK polypeptide contains several structural motifs common to all protein kinases, including the putative ATP-binding site (G 4 32-X-G434_ ⁇ _ ⁇ _G437, where X is any amino acid) and three residues that are predicted to interact with the ⁇ phosphate group of the bound ATP molecule (at amino acids 402, 529, and 655).
  • the amino acid sequences at positions 549-554 and 588-592 are also conserved among protein-tyrosine kinases.
  • the kinase domain consists primarily of the catalytic domain including the putative ATP-binding site (amino acids 432-437).
  • Amino acid residues 880-887 are important in mediating association of RAFTK with src and/or fyn, particularly when the tyrosine residue at 881 is phosphorylated.
  • the kinase domain of RAFTK is flanked by N-terminal and C-terminal regions; the N-terminal region of the protein (amino acids 1-39) is unique and the C-terminal region contains a proline-rich stretch (residues 690-767) in which the proline content exceeds 20%.
  • RAFTK lacks myristilation sites and SH2 and SH3 domains.
  • RAFTK was found to be expressed in fetal brain, lung, and liver, and to have a less restricted pattern of expression in adults. Expression was detected in a variety of adult tissues, including: CD34+ bone marrow cells, megakaryocytes, platelets, brain (particularly in the amygdala and hippocampus), macrophages, peripheral blood lymphocytes, spleen, thymus, B lymphocytes, T lymphocytes, and certain cancer cells.
  • certain aspects of the present invention relate to nucleic acid molecules encoding a vertebrate, e.g., mammalian RAFTK polypeptides, the RAFTK polypeptides, antibodies immunoreactive with RAFTK polypeptides, and preparations of such compositions.
  • drug discovery assays are provided for identifying agents which can modulate the biological function of RAFTK proteins. Such agents can be useful therapeutically, therefore, to alter the growth and/or differentiation of a cell.
  • the present invention provides diagnostic and therapeutic assays and reagents for detecting and treating disorders involving, for example, aberrant expression (or loss thereof) of mammalian RAFTK genes.
  • Other aspects of the invention are described below or will be apparent to those skilled in the art in light of the present disclosure.
  • binding as used herein is meant to include detectable interactions between molecules, such as can be detected using, for example, a yeast two hybrid assay. Also encompassed by this term are enzyme/substrate interactions (e.g. phosphorylation). Interactions between a RAFTK protein and a RAFTK-bvrv ⁇ ng protein can be constituative, or induced upon stimulation of a cell.
  • RAFTK biologically active protein
  • RAFTK has been shown to have broad involvement in numerous signaling pathways, and to be activated by: stem cell factor, thrombin stimulation, fibronectin, CSF-l/M- CSF, T cell receptor stimulation, bFGF, oncoprotein M, IL-6, and TNFa.
  • RAFTK is also activated by changes inracellular calcium levels, and by activation of protein kinases ⁇ and ⁇ .
  • RAFTK is capable of modulating the growth, differentiation, survival, and motility of numerous cell types, including megakaryocytes, T cells, B cells, monocytes, hematopoietic stem cells (e.g., CD34 + bone marrow cells).
  • melanocytes e.g., CD34 + bone marrow cells.
  • macrophages e.g., peripheral blood lymphocytes, spleen, thymus, B lymphocytes, T lymphocytes, and certain cancer cells (e.g., Kaposi's sarcoma cells).
  • the subject RAFTK polypeptides are also capable of modulating platelet function.
  • RAFTK also modulates the formation of focal adhesions and actin stress fibers, and is thus important in the control of metastatic growth and in the normal cell growth and integrity, and in processes which involve cell motility, such as, for example, phagocytosis.
  • Other bioactivities of the subject RAFTK polypeptides are described in more detail herein.
  • Cells “host cells” or “recombinant host cells” are terms used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications can occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
  • a "chimeric protein” or “fusion protein” is a fusion of a first amino acid sequence encoding * one of the subject mammalian RAFTK polypeptides with a second amino acid sequence defining a domain (e.g.
  • a chimeric protein may present a foreign domain which is found (albeit in a different protein) in an organism which also expresses the first protein, or it may be an "interspecies", "intergenic”, etc. fusion of protein structures expressed by different kinds of organisms.
  • a fusion protein can be represented by the general formula X-RAFTK-Y, wherein RAFTK represents a portion of the protein which is derived from one of the mammalian RAFTK proteins, and X and Y are independently absent or represent amino acid sequences which are not related to one of the mammalian RAFTK sequences in an organism, including naturally occurring mutants.
  • Targets refer to sequences which have sufficient complementarity to be able to hybridize, forming a stable duplex.
  • a “delivery complex” as used herein refers to a targeting means (e.g. a molecule that results in higher affinity binding of a gene, protein, polypeptide or peptide to a target cell surface and/or increased cellular uptake by a target cell).
  • targeting means include: sterols (e.g. cholesterol), lipids (e.g. a cationic lipid, virosome or liposome), viruses (e.g. adenovirus, adeno-associated virus, and retrovirus) or target cell specific binding agents (e.g.
  • genes for a particular polypeptide may exist in single or multiple copies within the genome of an individual. Such duplicate genes may be identical or may have certain modifications, including nucleotide substitutions, additions or deletions, which all still code for polypeptides having substantially the same activity.
  • the term "DNA sequence encoding a mammalian RAFTK polypeptide" can refer to one or more genes within a particular individual.
  • certain differences in nucleotide sequences can exist between individual organisms, which are called alleles. Such allelic differences can result in differences in amino acid sequence of the encoded polypeptide yet still encode a protein with the same biological activity.
  • the term "gene” or “recombinant gene” refers to a nucleic acid molecule comprising an open reading frame encoding one of the mammalian RAFTK polypeptides of the present invention, including both exon and (optionally) intron sequences.
  • a “recombinant gene” refers to nucleic acid encoding a mammalian RAFTK polypeptide and comprising mammalian &4 7 -encoding exon sequences, though it may optionally include intron sequences which are either derived from a chromosomal mammalian RAFTK gene or from an unrelated chromosomal gene.
  • RAFTK polypeptides Exemplary recombinant genes encoding the subject mammalian RAFTK polypeptides are represented in the appended Sequence Listing.
  • the term "intron” refers to a DNA sequence present in a given mammalian RAFTK gene which is not translated into protein and is generally found between exons.
  • Homology refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous or identical at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An "unrelated" or “non-homologous” sequence shares less than 40% identity, though preferably less than 25% identity, with one of the mammalian RArFTK sequences of the present invention.
  • an isolated nucleic acid encoding one of the subject mammalian .RAFTK polypeptides preferably includes no more than 10 kilobases (kb) of nucleic acid sequence which naturally immediately flanks the mammalian RAFTK gene in genomic DNA, more preferably no more than 5kb of such naturally occurring flanking sequences, and most preferably less than 1.5kb of such naturally occurring flanking sequence.
  • an "isolated" nucleic acid includes nucleic acid fragments which are not naturally occurring as fragments and would not be found in the natural state.
  • isolated as used herein also refers to a polypeptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized.
  • isolated nucleic acid is meant to include nucleic acid fragments which are not naturally occurring as fragments and would not be found in the natural state.
  • isolated is also used herein to refer to polypeptides which are isolated from other cellular proteins and is meant to encompass both purified and recombinant polypeptides.
  • non-human animals include mammalians such as rodents, non-human primates, sheep, dog, cow, chickens, amphibians, reptiles, etc.
  • Preferred non-human animals are selected from the rodent family including rat and mouse, most preferably mouse, though transgenic amphibians, such as members of the Xenopus genus, and transgenic chickens are also contemplated herein.
  • chimeric animal is used herein to refer to animals in which the recombinant gene is found, or in which the recombinant is expressed in some but not all cells of the animal.
  • tissue-specific chimeric animal indicates that one of the recombinant mammalian RAFTK genes is present and/or expressed or disrupted in some tissues but not others.
  • nucleic acid refers to polynucleotides such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA).
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • the term should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single (sense or antisense) and double-stranded polynucleotides.
  • protein protein
  • polypeptide and peptide
  • recombinant protein refers to a polypeptide of the present invention which is produced by recombinant DNA techniques, wherein generally, DNA encoding a mammalian RAFTK polypeptide is inserted into a suitable expression vector which is in turn used to transform a host cell to produce the heterologous protein.
  • derived from is meant to include within the meaning of "recombinant protein” those proteins having an amino acid sequence of a native RAFTK protein, or an amino acid sequence similar thereto which is generated by mutations including substitutions and deletions (including truncation) of a naturally occurring form of the protein.
  • the term “specifically hybridizes” or “specifically detects” refers to the ability of a nucleic acid molecule of the invention to hybridize to at least approximately 12, 20, 30, 50, 100, 150, 200, or 300 consecutive nucleotides of a vertebrate, preferably mammalian, RAFTK gene, such as a RAFTK sequence designated in one of SEQ ID NOs:l or 3, or a sequence complementary thereto, or naturally occurring mutants thereof, such that it shows more than 10 times more hybridization, preferably more than 100 times more hybridization, and even more preferably more than 100 times more hybridization than it does to to a cellular nucleic acid (e.g., mRNA or genomic DNA) encoding a protein other than a vertebrate, preferably mammalian, RAFTK protein as defined herein.
  • a cellular nucleic acid e.g., mRNA or genomic DNA
  • tissue-specific promoter means a DNA sequence that serves as a promoter, i.e., regulates expression of a selected DNA sequence operably linked to the promoter, and which effects expression of the selected DNA sequence in specific cells of a tissue, such as cells of hepatic or pancreatic origin, neuronal cells, or immune cells.
  • tissue-specific promoter i.e., regulates expression of a selected DNA sequence operably linked to the promoter, and which effects expression of the selected DNA sequence in specific cells of a tissue, such as cells of hepatic or pancreatic origin, neuronal cells, or immune cells.
  • the term also covers so-called “leaky” promoters, which regulate expression of a selected DNA primarily in one tissue, but cause expression in other tissues as well.
  • Transcriptional regulatory sequence is a generic term used throughout the specification to refer to DNA sequences, such as initiation signals, enhancers, and promoters, which induce or control transcription of protein coding sequences with which they are operably linked.
  • transcription of one of the recombinant mammalian RAFTK genes is under the control of a promoter sequence (or other transcriptional regulatory sequence) which controls the expression of the recombinant gene in a cell-type in which expression is intended.
  • a promoter sequence or other transcriptional regulatory sequence
  • the recombinant gene can be under the control of transcriptional regulatory sequences which are the same or which are different from those sequences which control transcription of the naturally-occurring forms of RAFTK proteins.
  • transfection means the introduction of a nucleic acid, e.g., an expression vector, into a recipient cell by nucleic acid-mediated gene transfer.
  • Transformation refers to a process in which a cell's genotype is changed as a result of the cellular uptake of exogenous DNA or RNA, and, for example, the transformed cell expresses a recombinant form of a mammalian RAFTK polypeptide or, in the case of anti-sense expression from the transferred gene, the expression of a naturally-occurring form of the RAFTK protein is disrupted.
  • transgene means a nucleic acid sequence (encoding, e.g., one of the mammalian RAFTK polypeptides, or an transcript which is antisense to a RAFTK nucleic acid sequence), which is partly or entirely heterologous, i.e., foreign, to the transgenic animal or cell into which it is introduced, or, is homologous to an endogenous gene of the transgenic animal or cell into which it is introduced, but which is designed to be inserted, or is inserted, into the animal's genome in such a way as to alter the genome of the cell into which it is inserted (e.g., it is inserted at a location which differs from that of the natural gene or its insertion results in a knockout).
  • a transgene can include one or more transcriptional regulatory sequences and any other nucleic acid, such as introns, that may be necessary for optimal expression of a selected nucleic acid.
  • a "transgenic animal” refers to any animal, preferably a non-human mammal, bird or an amphibian, in which one or more of the cells of the animal contain heterologous nucleic acid introduced by way of human intervention, such as by transgenic techniques well known in the art.
  • the nucleic acid is introduced into the cell, directly or indirectly by introduction into a precursor of the cell, by way of deliberate genetic manipulation, such as by microinjection or by infection with a recombinant virus.
  • the term genetic manipulation does not include classical crossbreeding, or in vitro fertilization, but rather is directed to the introduction of a recombinant DNA molecule. This molecule can be integrated within a chromosome, or it can be extrachromosomally replicating DNA.
  • transgenic animal In the typical transgenic animals described herein, the transgene causes cells to express a recombinant form of one of the mammalian RAFTK proteins, e.g. either agonistic or antagonistic forms.
  • transgenic animals in which the recombinant RAFTK gene is silent are also contemplated, as for example, the FLP or CRE recombinase dependent constructs described below.
  • transgenic animal also includes those recombinant animals in which gene disruption of one or more RAFTK genes is caused by human intervention, including both recombination and antisense techniques.
  • vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • a preferred vector is an episome, i.e., a nucleic acid capable of extra-chromosomal replication.
  • Preferred vectors are those capable of autonomous replication and/expression of nucleic acids to which they are linked.
  • Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors”.
  • expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids" which refer generally to circular double stranded DNA loops which, in their vector form are not bound to the chromosome.
  • plasmid and "vector” are used interchangeably as the plasmid is the most commonly used form of vector.
  • vector is intended to include such other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto.
  • one aspect of the invention pertains to isolated nucleic acids comprising nucleotide sequences encoding RAFTK polypeptides, and/or equivalents of such nucleic acids.
  • the term "equivalent” includes nucleotide sequences encoding functionally equivalent RAFTK polypeptides or functionally equivalent peptides having a bioactivity of a vertebrate RAFTK protein such as described herein.
  • Equivalent nucleotide sequences include sequences that differ by one or more nucleotide substitutions, additions or deletions, such as allelic variants; and, therefore, include sequences that differ from the nucleotide sequence of the RAFTK gene shown in one of SEQ ID NOs:l or 3 due to the degeneracy of the genetic code.
  • Preferred nucleic acids are vertebrate RAFTK nucleic acids. Particularly preferred vertebrate RAFTK nucleic acids are mammalian. Regardless of species, RAFTK nucleic acids encode polypeptides that are at least 60% similar to an amino acid sequence of a vertebrate RAFTK. Preferred nucleic acids encode a RAFTK polypeptide comprising an amino acid sequence at least 60%, at least 70% homologous, preferably at least 80% homologous, more preferably at least 90% homologous with an amino acid sequence of a vertebrate RAFTK, e.g., such as a sequence shown in one of SEQ ID NOs:2 or 4.
  • Nucleic acids which encode polypeptides at least about 95%, and even more preferably at least about 98-99% similarity with an amino acid sequence represented in one of SEQ ID NOs:2 or 4 are most preferred. Still other preferred nucleic acids of the present invention encode a RAFTK polypeptide which includes a polypeptide sequence corresponding to all or a portion of amino acid residues of one of SEQ ID NOs:2 or 4, e.g., at least 5, 10, 25, 50, 100, 150 or 200 amino acid residues of that region.
  • Another aspect of the invention provides a nucleic acid which hybridizes under stringent conditions to a nucleic acid represented by one of SEQ ID NOs: 1 or 3.
  • Appropriate stringency conditions which promote DNA hybridization for example, 6.0 x sodium chloride/sodium citrate (SSC) at about 45°C, followed by a wash of 2.0 x SSC at 50°C, are known to those skilled in the art or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
  • the salt concentration in the wash step can be selected from a low stringency of about 2.0 x SSC at 50°C to a high stringency of about 0.2 x SSC at 50°C.
  • the temperature in the wash step can be increased from low stringency conditions at room temperature, about 22°C, to high stringency conditions at about 65°C.
  • a RAFTK nucleic acid of the present invention binds to one of SEQ ID NOs: 1 or 3 under stringent conditions.
  • nucleic acids have a sequence at least 60%, at least 70% homologous and more preferably 80% and even more preferably at least 85% homologous with an amino acid sequence of a mammalian RAFTK, e.g., such as a sequence shown in SEQ ID NOs: 1.
  • Nucleic acids at least 90%, more preferably 95%, and most preferably at least about 98-99% homologous with a nucleic sequence represented in SEQ ID NOs: 1 are of course also within the scope of the invention.
  • the nucleic acid is a mammalian RAFTK gene and in particularly preferred embodiments, includes all or a portion of the nucleotide sequence corresponding to the coding region of SEQ ID NOs: 1 or 3.
  • the nucleic acid is a cDNA encoding a polypeptide having at least one boactivity of the subject RAFTK polypeptide.
  • Nucleic acids having a sequence that differs from the nucleotide sequences shown in one of SEQ ID NOs: 1 or 3 due to degeneracy in the genetic code are also within the scope of the invention.
  • Such nucleic acids encode functionally equivalent peptides (i.e., a peptide having a biological activity of a mammalian RAFTK polypeptide) but differ in sequence from the sequence shown in the sequence listing due to degeneracy in the genetic code. For example, a number of amino acids are designated by more than one triplet.
  • Codons that specify the same amino acid, or synonyms may result in "silent" mutations which do not affect the amino acid sequence of a mammalian RAFTK polypeptide.
  • DNA sequence polymorphisms that do lead to changes in the amino acid sequences of the subject RAFTK polypeptides will exist among mammalians.
  • these variations in one or more nucleotides (e.g., up to about 3-5% of the nucleotides) of the nucleic acids encoding polypeptides having an activity of a mammalian RAFTK polypeptidecan exist among individuals of a given species due to natural allelic variation.
  • RAFTK protein-encoding nucleic acids can be obtained from mRNA present in any of a number of eukaryotic cells. Nucleic acids encoding mammalian RAFTK polypeptides of the present invention can also be obtained from genomic DNA from both adults and embryos. For example, a gene encoding a RAFTK protein can be cloned from either a cDNA or a genomic library in accordance with protocols described herein, as well as those generally known to persons skilled in the art. Examples of tissues and/or libraries suitable for isolation of the subject nucleic acids include brain, thymus, spleen, among others.
  • a cDNA encoding a RAFTK protein can be obtained by isolating total mRNA from a cell, e.g. a vertebrate cell, a mammalian cell, or a human cell, including embryonic cells. Double stranded cDNAs can then be prepared from the total mRNA, and subsequently inserted into a suitable plasmid or bacteriophage vector using any one of a number of known techniques.
  • the gene encoding a mammalian RAFTK protein can also be cloned using established polymerase chain reaction techniques in accordance with the nucleotide sequence information provided by the invention.
  • the nucleic acid of the invention can be DNA or RNA.
  • a preferred nucleic acid is a cDNA represented by a sequence shown in one of SEQ ID NOs:l or 3.
  • This invention also provides expression vectors containing a nucleic acid encoding a RAFTK polypeptide, operably linked to at least one transcriptional regulatory sequence.
  • “Operably linked” is intended to mean that the nucleotide sequence is linked to a regulatory sequence in a manner which allows expression of the nucleotide sequence.
  • Regulatory sequences are art-recognized and are selected to direct expression of the subject mammalian RAFTK proteins. Accordingly, the term “transcriptional regulatory sequence” includes promoters, enhancers and other expression control elements. Such regulatory sequences are described in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
  • the expression vector includes a recombinant gene encoding a peptide having an agonistic activity of a subject RAFTK polypeptide, or alternatively, encoding a peptide which is an antagonistic form of the RAFTK protein.
  • Such expression vectors can be used to transfect cells and thereby produce polypeptides, including fusion proteins, encoded by nucleic acids as described herein.
  • the gene constructs of the present invention can also be used as a part of a gene therapy protocol to deliver nucleic acids encoding either an agonistic or antagonistic form of one of the subject mammalian RAFTK proteins.
  • another aspect of the invention features expression vectors for in vivo or in vitro transfection and expression of a mammalian RAFTK polypeptide in particular cell types so as to reconstitute the function of, or alternatively, abrogate the function of RAFTK in a tissue. This is desirable, for example, when the naturally-occurring form of the protein is misexpressed; or to deliver a form of the protein which alters survival of tissue.
  • Expression vectors can also be employed to inhibit neoplastic transformation.
  • non-viral methods can also be employed to cause expression of a subject RAFTK polypeptide in the tissue of an animal.
  • non-viral targeting means of the present invention rely on endocytic pathways for the uptake of the subject RAFTK polypeptide gene by the targeted cell.
  • exemplary targeting means of this type include liposomal derived systems, poly-lysine conjugates, and artificial viral envelopes.
  • nucleotide sequences determined from the cloning of RAFTK genes from mammalian organisms allow for the generation of probes and primers designed for use in identifying and/or cloning RAFTK homologs in other cell types, e.g. from other tissues, as well as RAFTK homologs from other mammalian organisms.
  • the present invention also provides a probe/primer comprising a substantially purified oligonucleotide, which oligonucleotide comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least approximately 12, preferably 25, more preferably 40, 50 or 75 consecutive nucleotides of sense or anti-sense sequence of one of SEQ ID NOs:l or 3, or naturally occurring mutants thereof.
  • primers based on the nucleic acid represented in one of SEQ ID NOs: 1 or 3 can be used in PCR reactions to clone RAFTK homologs.
  • probes based on the subject RAFTK sequences can be used to detect transcripts or genomic sequences encoding the same or homologous proteins.
  • the probe further comprises a label group attached thereto and able to be detected, e.g. the label group is selected from amongst radioisotopes, fluorescent compounds, enzymes, and enzyme co-factors.
  • probes can also be used as a part of a diagnostic test kit for identifying cells or tissue which misexpress a RAFTK protein, such as by measuring a level of a RAFTK-enco ⁇ in ⁇ , nucleic acid in a sample of cells from a patient; e.g. detecting RAFTK mRNA levels or determining whether a genomic RAFTK gene has been mutated or deleted.
  • nucleotide probes can be generated from the subject RAFTK genes which facilitate histological screening of intact tissue and tissue samples for the presence (or absence) of RAFTK-encoding transcripts.
  • the use of probes directed to RAFTK messages, or to genomic RAFTK sequences can be used for both predictive and therapeutic evaluation of allelic mutations which might be manifest in, for example, degenerative, neoplastic or hyperplastic disorders (e.g. unwanted cell growth) or abnormal differentiation of tissue.
  • the oligonucleotide probes can help facilitate the determination of the molecular basis for a disorder which may involve some abnormality associated with expression (or lack thereof) of a RAFTK protein. For instance, variation in polypeptide synthesis can be differentiated from a mutation in a coding sequence.
  • antisense therapy refers to administration or in situ generation of oligonucleotide molecules or their derivatives which specifically hybridize (e.g. bind) under cellular conditions, with the cellular mRNA and/or genomic DNA encoding one or more of the subject RAFTK proteins so as to inhibit expression of that protein, e.g. by inhibiting transcription and/or translation.
  • the binding can be by conventional base pair complementarity, or, for example, in the case of binding to DNA duplexes, through specific interactions in the major groove of the double helix.
  • antisense therapy refers to the range of techniques generally employed in the art, and includes any therapy which relies on specific binding to oligonucleotide sequences.
  • An antisense construct of the present invention can be delivered, for example, as an expression plasmid which, when transcribed in the cell, produces RNA which is complementary to at least a unique portion of the cellular mRNA which encodes a mammalian RAFTK protein.
  • the antisense construct is an oligonucleotide probe which is generated ex vivo and which, when introduced into the cell causes inhibition of expression by hybridizing with the mRNA and/or genomic sequences of a mammalian RAFTK gene.
  • Such oligonucleotide probes are preferably modified oligonucleotides which are resistant to endogenous nucleases, e.g. exonucleases and/or endonucleases, and are therefore stable in vivo.
  • Exemplary nucleic acid molecules for use as antisense oligonucleotides are phosphoramidate, phosphothioate and methylphosphonate analogs of DNA (see also U.S. Patents 5,176,996; 5,264,564; and 5,256,775). Additionally, general approaches to constructing oligomers useful in antisense therapy have been reviewed, for example, by Van der Krol et al. (1988) Biotechniques 6, 958-976; and Stein et al. (1988) Cancer Res 48, 2659-2668.
  • Antisense approaches involve the design of oligonucleotides (either DNA or RNA) that are complementary to RAFTK mRNA.
  • the antisense oligonucleotides bind to the RAFTK mRNA transcripts and prevent translation. Absolute complementarity, although preferred, is not required.
  • a sequence "complementary" to a portion of an RNA, as referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double-stranded antisense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed.
  • the ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid. Generally, the longer the hybridizing nucleic acid, the more base mismatches with an RNA it can contain and still form a stable duplex (or triplex, as the case may be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.
  • Oligonucleotides that are complementary to the 5' end of the message should work most efficiently at inhibiting translation.
  • sequences complementary to the 3' untranslated sequences of mRNAs have recently been shown to be effective at inhibiting translation of mRNAs as well. (Wagner, R. (1994) Nature 372, 333). Therefore, oligonucleotides complementary to either the 5' or 3' untranslated, non- coding regions of a RAFTK gene could be used in an antisense approach to inhibit translation of endogenous RAFTK mRNA.
  • Oligonucleotides complementary to the 5' untranslated region of the mRNA should include the complement of the AUG start codon.
  • Antisense oligonucleotides complementary to mRNA coding regions are less efficient inhibitors of translation but could be used in accordance with the invention. Whether designed to hybridize to the 5', 3' or coding region of RAFTK mRNA, antisense nucleic acids should be at least six nucleotides in length, and are preferably oligonucleotides ranging from 6 to about 50 nucleotides in length.
  • the oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides, or at least 50 nucleotides. Oligodeoxyribonucleotides derived from the translation initiation site, e.g., between the -10 and +10 regions of the RAFTK nucleotide sequence of interest, are preferred.
  • the oligonucleotides can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded.
  • the oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc.
  • the oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al. (1989) Proc. Natl. Acad. Sci. U.S.A. 86. 6553-6556; Lemaitre et al.
  • the oligonucleotide can be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
  • the antisense oligonucleotide can comprise at least one modified base moiety which is selected from the group including but not limited to 5-fluorouracil, 5- bromouracil, 5-chlorouraciI, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1 -methylguanine, 1 -methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosy
  • the antisense oligonucleotide comprises at least one modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
  • the antisense oligonucleotide is an ⁇ -anomeric oligonucleotide.
  • An ⁇ -anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual ⁇ -units, the strands run parallel to each other (Gautier et al. (1987) Nucl. Acids Res. 15, 6625-6641).
  • the oligonucleotide is a 2'-0-methylribonucleotide (Inoue et al. (1987) Nucl. Acids Res. 15, 6131-6148), or a chimeric RNA-DNA analogue (Inoue et al. (1987) FEBS Lett. 215, 327-330).
  • Oligonucleotides of the invention can be synthesized by standard methods known in the art, e.g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.).
  • an automated DNA synthesizer such as are commercially available from Biosearch, Applied Biosystems, etc.
  • phosphorothioate oligonucleotides can be synthesized by the method of Stein et al. (1988, Nucl. Acids Res. 16, 3209)
  • methylphosphonatc olgonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al. (1988) Proc. Natl. Acad. Sci. U.S.A. 85, 7448-7451), etc.
  • antisense nucleotides complementary to the RAFTK coding region sequence can be used, those complementary to the transcribed untranslated region are most preferred.
  • the antisense molecules are delivered to cells which express the RAFTK in vivo.
  • a number of methods described herein and known in the art can be used for delivering the subject nucleic acids into to cells.
  • a preferred approach utilizes a recombinant DNA construct in which the antisense oligonucleotide is placed under the control of a strong pol III or pol II promoter.
  • the use of such a construct to transfect target cells in the patient results in the transcription of sufficient amounts of single stranded RNAs that forms complementary base pairs with the endogenous RAFTK transcripts and thereby prevent translation of the RAFTK mRNA.
  • a vector can be introduced in vivo such that it is taken up by a cell and directs the transcription of an antisense RNA.
  • Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA.
  • Such vectors can be constructed by recombinant DNA technology methods standard in the art.
  • Vectors can be plasmid, viral, or others known in the art, used for replication and expression in mammalian cells.
  • Expression of the sequence encoding the antisense RNA can be by any promoter known in the art to act in mammalian, preferably human cells. Such promoters can be inducible or constitutive.
  • Such promoters include but are not limited to: the SV40 early promoter region (Bernoist and Chambon (1981) Nature 290, 304-310), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al. (1980) Cell 22, 787-797), the herpes thymidine kinase promoter (Wagner et al. (1981) Proc. Natl. Acad. Sci. U.S.A. 78, 1441-1445), the regulatory sequences of the metallothionein gene (Brinster et al. (1982) Nature 296, 39-42), etc. Any type of plasmid, cosmid,
  • YAC or viral vector can be used to prepare the recombinant DNA construct which can be introduced directly into the tissue site; e.g., the choroid plexus or hypothalamus.
  • viral vectors can be used which selectively infect the desired tissue; (e.g., for brain, herpesvirus vectors may be used), in which case administration may be accomplished by another route (e.g., systematically).
  • Ribozyme molecules designed to catalytically cleave RAFTK mRNA transcripts can also be used to prevent translation of RAFTK mRNA and expression of RAFTK.
  • RAFTK mRNA See, e.g., PCT International Publication WO90/1 1364, published October 4, 1990; Sarver et al. (1990) Science 247, 1222-1225.
  • ribozymes that cleave mRNA at site specific recognition sequences can be used to destroy RAFTK mRNAs
  • the use of hammerhead ribozymes is preferred.
  • Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA.
  • hammerhead ribozymes The construction and production of hammerhead ribozymes is well known in the art and is described more fully in Haseloff and Gerlach, 1988 Nature, 334, 585-591. There are numerous potential hammerhead ribozyme cleavage sites within the nucleotide sequence of human RAFTK cDNA. Preferably the ribozyme is engineered so that the cleavage recognition site is located near the 5' end of the RAFTK mRNA; i.e., to increase efficiency and minimize the intracellular accumulation of non-functional mRNA transcripts.
  • the ribozymes of the present invention also include RNA endoribonucleases
  • Cech-type ribozymes such as the one which occurs naturally in Tetrahymena Thermophila (known as the IVS, or L-l 9 IVS RNA) and which has been extensively described by Thomas Cech and collaborators (Zaug, et al. (1984) Science, 224. 574-578; Zaug and Cech (1986) Science, 231, 470-475; Zaug, et al. (1986) Nature, 324, 429-433; published International patent application No. WO 88/04300 by University Patents Inc.; Been and Cech (1986) Cell, 47, 207-216).
  • the Cech-type ribozymes have an eight base pair active site which hybridizes to a target RNA sequence whereafter cleavage of the target RNA takes place.
  • the invention encompasses those Cech-type ribozymes which target eight base-pair active site sequences that are present in RAFTK.
  • the ribozymes can be composed of modified oligonucleotides (e.g. for improved stability, targeting, etc.) and are delivered to cells which express the RAFTK in vivo e.g., T cells.
  • a preferred method of delivery involves using a DNA construct "encoding" the robozyme under the control of a strong constitutive pol III or pol II promoter, so that transfected cells produce sufficient quantities of the ribozyme to destroy endogenous RAFTK and inhibit translation. Because ribozymes unlike antisense molecules, are catalytic, a lower intracellular concentration is required for efficiency.
  • Endogenous RAFTK gene expression can also be reduced by inactivating or "knocking out” the RAFTK gene or its promoter using targeted homologous recombination.
  • endogenous RAFTK gene expression can also be reduced by inactivating or "knocking out” the RAFTK gene or its promoter using targeted homologous recombination.
  • RAFTK RAFTK
  • a mutant, nonfunctional RAFTK flanked by DNA homologous to the endogenous RAFTK gene (either the coding regions or regulatory regions of the RAFTK gene) can be used, with or without a selectable marker and/or a negative selectable marker, to transfect cells that express RAFTK in vivo. Insertion of the DNA construct, via targeted homologous recombination, results in inactivation of the RAFTK gene.
  • ES embryonic stem
  • RAFTK gene expression can be reduced by targeting deoxyribonucleotide sequences complementary to the regulatory region of the RAFTK gene (i.e., the RAFTK promoter and/or enhancers) to form triple helical structures that prevent transcription of the RAFTK gene in target cells in the body.
  • deoxyribonucleotide sequences complementary to the regulatory region of the RAFTK gene i.e., the RAFTK promoter and/or enhancers
  • Nucleic acid molecules to be used in triple helix formation for the inhibition of transcription are preferably single stranded and composed of deoxyribonucleotides.
  • the base composition of these oligonucleotides promotes triple helix formation via Hoogsteen base pairing rules, which generally require sizable stretches of either purines or pyrimidines to be present on one strand of a duplex.
  • Nucleotide sequences may be pyrimidine-based, which result in TAT and CGC triplets across the three associated strands of the resulting triple helix.
  • the pyrimidine-rich molecules provide base complementarity to a purine-rich region of a single strand of the duplex in a parallel orientation to that strand.
  • nucleic acid molecules can be chosen that are purine-rich, for example, containing a stretch of g residues. These molecules will form a triple helix with a DNA duplex that is rich in GC pairs, in which the majority of the purine residues are located on a single strand of the targeted duplex, resulting in CGC triplets across the three strands in the triplex.
  • the potential sequences that can be targeted for triple helix formation may be increased by creating a so called “switchback" nucleic acid molecule.
  • Switchback molecules are synthesized in an alternating 5'-3', 3'-5' manner, such that they base pair with first one strand of a duplex and then the other, eliminating the necessity for a sizable stretch of either purines or pyrimidines to be present on one strand of a duplex.
  • Antisense RNA and DNA, ribozyme, and triple helix molecules of the invention may be prepared by any method known in the art for the synthesis of DNA and RNA molecules. These include techniques for chemically synthesizing oligodeoxyribonucleotides and oligoribonucleotides well known in the art such as for example solid phase phosphoramidite chemical synthesis. Alternatively, RNA molecules may be generated by in vitro and in vivo transcription of DNA sequences encoding the antisense RNA molecule. Such DNA sequences may be inco ⁇ orated into a wide variety of vectors which inco ⁇ orate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters.
  • antisense cDNA constructs that synthesize antisense RNA constitutively or inducibly, depending on the promoter used, can be introduced stably into cell lines.
  • various well-known modifications to nucleic acid molecules may be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and/or 3' ends of the molecule or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the oligodeoxyribonucleotide backbone.
  • the antisense constructs of the present invention by antagonizing the normal biological activity of one of the RAFTK proteins, can be used in the manipulation of tissue survival, growth, migration, or differentiation, both in vivo and ex vivo.
  • the anti-sense techniques e.g. microinjection of antisense molecules, or transfection with plasmids whose transcripts are anti-sense with regard to a RAFTK mRNA or gene sequence
  • Such techniques can be utilized in cell culture, but can also be used in the creation of transgenic animals, as detailed below.
  • the present invention also makes available isolated RAFTK polypeptides which are isolated from, or otherwise substantially free of other cellular proteins, especially other signal transduction factors and/or transcription factors which may normally be associated with the RAFTK polypeptide.
  • the term "substantially free of other cellular proteins" (also referred to herein as "contaminating proteins") or “substantially pure or purified preparations” are defined as encompassing preparations of RAFTK polypeptides having less than about 20% (by dry weight) contaminating protein, and preferably having less than about 5% contaminating protein.
  • Functional forms of the subject polypeptides can be prepared, for the first time, as purified preparations by using a cloned gene as described herein.
  • purified when referring to a polypeptide or nucleic acid means that the polypeptide or nucleic acid is present in the substantial absence of other biological macromolecules, such as other proteins.
  • purified as used herein preferably means at least 80% by dry weight, more preferably in the range of 95-99% by weight, and most preferably at least 99.8% by weight, of biological macromolecules of the same type present (but water, buffers, and other small molecules, especially molecules having a molecular weight of less than 5000, can be present).
  • pure as used herein preferably has the same numerical limits as “purified” immediately above. "Isolated” and
  • purified RAFTK preparations lack any contaminating proteins from the same animal from which RAFTK is normally produced, as can be accomplished by recombinant expression of, for example, a human RAFTK protein in a non-human cell.
  • Full length proteins or fragments corresponding to one or more particular motifs and/or domains or to arbitrary sizes, for example, at least 5, 10, 25, 50, 75, 100, 125, 150 amino acids in length are within the scope of the present invention.
  • isolated RAFTK polypeptides can include all or a portion of an amino acid sequences corresponding to a RAFTK polypeptide represented in one or more of one of SEQ ID NOs:2 or 4 and 4.
  • Isolated peptidyl portions of RAFTK proteins can be obtained by screening peptides recombinantly produced from the corresponding fragment of the nucleic acid encoding such peptides.
  • fragments can be chemically synthesized using techniques known in the art such as conventional Merrifield solid phase f-Moc or t-Boc chemistry.
  • a RAFTK polypeptide of the present invention can be arbitrarily divided into fragments of desired length with no overlap of the fragments, or preferably divided into overlapping fragments of a desired length.
  • the fragments can be produced (recombinantly or by chemical synthesis) and tested to identify those peptidyl fragments which can function as either agonists or antagonists of a wild-type (e.g., "authentic") RAFTK protein.
  • RAFTK proteins are at least 60% homologous, preferably at least 70% and more preferably at least 80% homologous and even more preferably at least 90 % homologous with an amino acid sequence represented by one of SEQ ID NOs: 2 or 4. Polypeptides which are at least about 95% homologous with a sequence selected from the group consisting of SEQ ID NOs: 2 and 4 are also within the scope of the invention.
  • a RAFTK protein of the present invention is a mammalian RAFTK protein.
  • a RAFTK protein comprises the coding sequence of one of SEQ ID NOs:2 or 4.
  • a RAFTK protein has a RAFTK bioactivity.
  • the invention features a purified or recombinant RAFTK polypeptide having a molecular weight of approximately 1 15- 125kD.
  • the subject RAFTK polypeptide has a molecular weight of 123 kD. It will be understood that certain post-translational modifications, such as phosphorylation, can increase the apparent molecular weight of the RAFTK protein relative to the unmodified polypeptide chain.
  • the present invention further pertains to recombinant forms of one of the subject RAFTK polypeptides which are encoded by genes derived from a mammalian organism, and which have amino acid sequences evolutionarily related to the RAFTK proteins represented in one of SEQ ID NOs:2 or 4.
  • Such recombinant RAFTK polypeptides preferably are capable of functioning in one of either role of an agonist or antagonist of at least one biological activity of a wild-type ("authentic") RAFTK protein of the appended sequence listing.
  • the term "evolutionarily related to”, with respect to amino acid sequences of mammalian RAFTK proteins, refers to both polypeptides having amino acid sequences which have arisen naturally, and also to mutational variants of mammalian RAFTK polypeptides which are derived, for example, by combinatorial mutagenesis.
  • Such evolutionarily derived RAFTK polypeptides preferred by the present invention have a RAFTK bioactivity and are at least 60% homologous, preferably at least 70% homologous, and more preferably at least 80% homologous and even more preferably at least 90% homologous with the amino acid sequence shown in one of SEQ ID NOs:2 or 4. Polypeptides at least 95- 98% homologous are also within the scope of the invention.
  • a RAFTK protein comprises the amino acid coding sequence of one of SEQ ID NOs:2 or 4.
  • polypeptides referred to herein as having a bioactivity of a mammalian RAFTK protein are defined as polypeptides which include an amino acid sequence corresponding (e.g., identical or homologous) to all or a portion of the amino acid sequences of a mammalian RAFTK proteins shown in one of SEQ ID NOs:2 or 4 and which mimic or antagonize all or a portion of the biological/biochemical activities of a naturally occurring RAFTK protein.
  • Other biological activities of the subject RAFTK proteins are described herein or will be reasonably apparent to those skilled in the art.
  • a polypeptide has biological activity if it is a specific agonist or antagonist of a naturally-occurring form of a mammalian RAFTK protein.
  • the present invention further pertains to methods of producing the subject RAFTK polypeptides.
  • a host cell transfected with a nucleic acid vector directing expression of a nucleotide sequence encoding the subject polypeptides can be cultured under appropriate conditions to allow expression of the peptide to occur.
  • the cells may be harvested, lysed and the protein isolated.
  • a cell culture includes host cells, media and other byproducts. Suitable media for cell culture are well known in the art.
  • the recombinant RAFTK polypeptide can be isolated from cell culture medium, host cells, or both, using techniques known in the art for purifying proteins including ion-exchange chromatography, gel filtration chromatography, ultrafiltration, electrophoresis, and immunoaffinity purification with antibodies specific for such peptide.
  • the recombinant RAFTK polypeptide is a fusion protein containing a domain which facilitates its purification, such as GST fusion protein or poly(His) fusion protein.
  • homologs of one of the subject RAFTK polypeptides which function in a limited capacity as one of either a RAFTK agonist (mimetic) or a RAFTK antagonist, in order to promote or inhibit only a subset of the biological activities of the naturally-occurring form of the protein.
  • RAFTK agonist mimetic
  • RAFTK antagonist a RAFTK antagonist
  • specific biological effects can be elicited by treatment with a homolog of limited function, and with fewer side effects relative to treatment with agonists or antagonists which are directed to all of the biological activities of naturally occurring forms of RAFTK proteins.
  • Homologs of each of the subject RAFTK proteins can be generated by mutagenesis, such as by discrete point mutation(s), or by truncation.
  • mutation can give rise to homologs which retain substantially the same, or merely a subset, of the biological activity of the RAFTK polypeptide from which it was derived.
  • antagonistic forms of the protein can be generated which are able to inhibit the function of the naturally occurring form of the protein, such as by competitively binding to a downstream or upstream member of the RAFTK cascade which includes the RAFTK protein.
  • agonistic forms of the protein may be generated which are constituatively active.
  • the mammalian RAFTK protein and homologs thereof provided by the subject invention may be either positive or negative regulators of RAFTK activity.
  • the recombinant RAFTK polypeptides of the present invention also include homologs of the authentic RAFTK proteins, such as versions of those protein which are resistant to proteolytic cleavage, as for example, due to mutations which alter ubiquitination or other enzymatic targeting associated with the protein.
  • RAFTK polypeptides may also be chemically modified to create RAFTK derivatives by forming covalent or aggregate conjugates with other chemical moieties, such as glycosyl groups, lipids, phosphate, acetyl groups and the like.
  • Covalent derivatives of RAFTK proteins can be prepared by linking the chemical moieties to functional groups on amino acid sidechains of the protein or at the N-terminus or at the C-terminus of the polypeptide.
  • Modification of the structure of the subject mammalian RAFTK polypeptides can be for such pu ⁇ oses as enhancing therapeutic or prophylactic efficacy, stability (e.g., ex vivo shelf life and resistance to proteolytic degradation in vivo), or post- translational modifications (e.g., to alter phosphorylation pattern of protein).
  • Such modified peptides when designed to retain at least one activity of the naturally- occurring form of the protein, or to produce specific antagonists thereof, are considered functional equivalents of the RAFTK polypeptides described in more detail herein.
  • Such modified peptides can be produced, for instance, by amino acid substitution, deletion, or addition.
  • polypeptides in which more than one replacement has taken place can readily be tested in the same manner.
  • This invention further provides a method for generating sets of combinatorial mutants of the subject RAFTK proteins as well as truncation mutants, and is especially useful for identifying potential variant sequences (e.g. homologs) that modulate a RAFTK bioactivity.
  • the pu ⁇ ose of screening such combinatorial libraries is to generate, for example, novel RAFTK homologs which can act as either agonists or antagonist, or alternatively, possess novel activities all together.
  • combinatorially-derived homologs can be generated to have an increased potency relative to a naturally occurring form of the protein.
  • RAFTK homologs can be generated by the present combinatorial approach to selectively inhibit (antagonize) an authentic RAFTK.
  • mutagenesis can provide RAFTK homologs which are able to bind other proteins in a RAFTK signaling pathwayyet prevent propagation of the signal, e.g. the homologs can be dominant negative mutants.
  • manipulation of certain domains of RAFTK by the present method can provide domains more suitable for use in fusion proteins.
  • the variegated library of RAFTK variants is generated by combinatorial mutagenesis at the nucleic acid level, and is encoded by a variegated gene library.
  • a mixture of synthetic oligonucleotides can be enzymatically ligated into gene sequences such that the degenerate set of potential RAFTK sequences are expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e.g. for phage display) containing the set of RAFTK sequences therein.
  • libraries of potential RAFTK homologs can be generated from a degenerate oligonucleotide sequence. Chemical synthesis of a degenerate gene sequence can be carried out in an automatic DNA synthesizer, and the synthetic genes then ligated into an appropriate expression vector.
  • the pu ⁇ ose of a degenerate set of genes is to provide, in one mixture, all of the sequences encoding the desired set of potential RAFTK sequences.
  • the synthesis of degenerate oligonucleotides is well known in the art (see for example, Narang, S. A. (1983) Tetrahedron 39, 3; Itakura et al. (1981) Recombinant DNA, Proc 3rd Cleveland Sympos. Macromolecules, ed. AG Walton, Amsterdam: Elsevier pp 273-289; Itakura et al. (1984) Annu. Rev. Biochem. 53, 323.
  • Such techniques have been employed in the directed evolution of other proteins (see, for example, Scott et al. (1990) Science 249, 386-390; Roberts et al. (1992) PNAS 89, 2429-2433; Devlin et al. (1990) Science 249, 404-406).
  • a library of coding sequence fragments can be provided for a RAFTK clone in order to generate a variegated population of RAFTK fragments for screening and subsequent selection of bioactive fragments.
  • a variety of techniques are known in the art for generating such libraries, including chemical synthesis.
  • a library of coding sequence fragments can be generated by (i) treating a double stranded PCR fragment of a RAFTK coding sequence with a nuclease under conditions wherein nicking occurs only about once per molecule; (ii) denaturing the double stranded DNA; (iii) renaturing the DNA to form double stranded DNA which can include sense/antisense pairs from different nicked products; (iv) removing single stranded portions from reformed duplexes by treatment with SI nuclease; and (v) ligating the resulting fragment library into an expression vector.
  • an expression library can be derived which codes for N- terminal, C-terminal and internal fragments of various sizes.
  • a wide range of techniques are known in the art for screening gene products of combinatorial libraries made by point mutations or truncation, and for screening cDNA libraries for gene products having a certain property. Such techniques aregenerally adaptable for rapid screening of the gene libraries generated by the combinatorial mutagenesis of RAFTK homologs.
  • the most widely used techniques for screening large gene libraries typically comprise cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates relatively easy isolation of the vector encoding the gene whose product was detected.
  • Each of the illustrative assays described below are amenable to high through-put analysis as necessary to screen large numbers of degenerate RAFTK sequences created by combinatorial mutagenesis techniques.
  • cell based assays can be exploited to analyze the variegated RAFTK library.
  • the library of expression vectors can be transfected into a cell line ordinarily responsive to a ligand which transduces signals via a pathway involving RAFTK, such as, for example, stem cell factor, thrombin, fibronectin, CSF-1/M-CSF, T cell receptor stimulation, bFGF, oncoprotein M, IL-6, or TNFa.
  • the transfected cells are then contacted with a ligand ahd the and the effect of the RAFTK mutant can be detected, e.g. on cell viability.
  • Plasmid DNA can then be recovered from the cells which score for inhibition, or alternatively, potentiation of a RAFTK activity, and the individual clones further characterized.
  • Combinatorial mutagenesis has a potential to generate very large libraries of mutant proteins, e.g., in the order of 1026 molecules. Combinatorial libraries of this size may be technically challenging to screen even with high throughput screening assays.
  • recrusive ensemble mutagenesis REM
  • REM recrusive ensemble mutagenesis
  • the invention also provides for reduction of the mammalian RAFTK proteins to generate mimetics, e.g. peptide or non-peptide agents, which are able to disrupt binding of a mammalian RAFTK polypeptide of the present invention with either upstream or downstream components of a TGFb signaling cascade, such as binding proteins or interactors.
  • mimetics e.g. peptide or non-peptide agents
  • mutagenic techniques as described above are also useful to map the determinants of the RAFTK proteins which participate in protein- protein interactions involved in, for example, binding of the subject mammalian RAFTK polypeptide to proteins which may function upstream (including both activators and repressors of its activity) or to proteins or nucleic acids which may function downstream of the RAFTK polypeptide, whether they are positively or negatively regulated by it.
  • the critical residues of a subject RAFTK polypeptide which are involved in molecular recognition of binding proteins upstream or downstream of a RAFTK can be determined and used to generate RAFTK-derive ⁇ peptidomimetics which competitively inhibit binding of the authentic RAFTK protein with that moiety.
  • peptidomimetic compounds By employing, for example, scanning mutagenesis to map the amino acid residues of each of the subject RAFTK proteins which are involved in binding other extracellular proteins, peptidomimetic compounds can be generated which mimic those residues of the RAFTK protein which facilitate the interaction. Such mimetics may then be used to interfere with the normal function of a RAFTK protein.
  • non-hydrolyzable peptide analogs of such residues can be generated using benzodiazepine (e.g., see Freidinger et al. in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), azepine (e.g., see Huffman et al.
  • This invention also pertains to a host cell transfected to express a recombinant form of the subject RAFTK polypeptides.
  • the host cell can be any prokaryotic or eukaryotic cell.
  • a nucleotide sequence derived from the cloning of mammalian RAFTK proteins, encoding all or a selected portion of the full-length protein can be used to produce a recombinant form of a mammalian RAFTK polypeptide via microbial or eukaryotic cellular processes.
  • a gene construct such as an expression vector
  • transforming or transfecting into hosts either eukaryotic (yeast, avian, insect or mammalian) or prokaryotic (bacterial cells) are standard procedures used in producing other well-known proteins, e.g. MAP kinase, p53, WT1, PTP phosphotases, SRC, and the like. Similar procedures, or modifications thereof, can be employed to prepare recombinant RAFTK polypeptides by microbial means or tissue-culture technology in accord with the subject invention.
  • the recombinant RAFTK genes can be produced by ligating nucleic acid encoding a RAFTK protein, or a portion thereof, into a vector suitable for expression in either prokaryotic cells, eukaryotic cells, or both.
  • Expression vectors for production of recombinant forms of the subject RAFTK polypeptides include plasmids and other vectors.
  • suitable vectors for the expression of a RAFTK polypeptide include plasmids of the types: pBR322-derived plasmids, pEMBL- derived plasmids, pEX-derived plasmids, pBTac-derived plasmids and pUC-derived plasmids for expression in prokaryotic cells, such as E. coli.
  • YEP24, YIP5, YEP51, YEP52, pYES2, and YRP17 are cloning and expression vehicles useful in the introduction of genetic constructs into S. cerevisiae (see, for example, Broach et al. (1983) in Experimental Manipulation of Gene Expression, ed. M. Inouye Academic Press, p. 83, inco ⁇ orated by reference herein).
  • These vectors can replicate in E. coli due the presence of the pBR322 ori. and in S. cerevisiae due to the replication determinant of the yeast 2 micron plasmid.
  • RAFTK polypeptide is produced recombinantly utilizing an expression vector generated by sub-cloning the coding sequence of one of the RAFTK genes represented in one of SEQ ID NOs: 1 or 3.
  • the preferred mammalian expression vectors contain both prokaryotic sequences, to facilitate the propagation of the vector in bacteria, and one or more eukaryotic transcription units that are expressed in eukaryotic cells.
  • the pcDNAI/amp, pcDNAI/neo, pRc/CMV, pSV2gpt, pSV2neo, pSV2-dhfr, pTk2, pRSVneo, pMSG, pSVT7, pko-neo and pHyg derived vectors are examples of mammalian expression vectors suitable for transfection of eukaryotic cells.
  • vectors are modified with sequences from bacterial plasmids, such as pBR322, to facilitate replication and drug resistance selection in both prokaryotic and eukaryotic cells.
  • derivatives of viruses such as the bovine papillomavirus (BPV-1), or Epstein-Barr virus (pHEBo, pREP-derived and p205) can be used for transient expression of proteins in eukaryotic cells.
  • BBV-1 bovine papillomavirus
  • pHEBo Epstein-Barr virus
  • the various methods employed in the preparation of the plasmids and transformation of host organisms are well known in the art.
  • suitable expression systems for both prokaryotic and eukaryotic cells, as well as general recombinant procedures see Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989) Chapters 16 and 17.
  • baculovirus expression systems include pVL-derived vectors (such as pVL1392, pVL1393 and pVL941), pAcUW-derived vectors (such as pAcUWl), and pBlueBac- derived vectors (such as the ⁇ -gal containing pBlueBac III). Fusion proteins and Immunogens.
  • the coding sequences for the polypeptide can be inco ⁇ orated as a part of a fusion gene including a nucleotide sequence encoding a different polypeptide.
  • This type of expression system can be useful under conditions where it is desirable to produce an immunogenic fragment of a RAFTK protein.
  • the VP6 capsid protein of rotavirus can be used as an immunologic carrier protein for portions of the RAFTK polypeptide, either in the monomeric form or in the form of a viral particle.
  • the nucleic acid sequences corresponding to the portion of a subject RAFTK protein to which antibodies are to be raised can be inco ⁇ orated into a fusion gene construct which includes coding sequences for a late vaccinia virus structural protein to produce a set of recombinant viruses expressing fusion proteins comprising RAFTK epitopes as part of the virion. It has been demonstrated with the use of immunogenic fusion proteins utilizing the Hepatitis B surface antigen fusion proteins that recombinant Hepatitis B virions can be utilized in this role as well.
  • chimeric constructs coding for fusion proteins containing a portion of a RAFTK protein and the poliovirus capsid protein can be created to enhance immunogenicity of the set of polypeptide antigens (see, for example. EP Publication No: 0259149; and Evans et al. (1989) Nature 339, 385; Huang et al. (1988) J. Virol. 62, 3855; and Schlienger et al. (1992) J. Virol. 66, 2).
  • the Multiple Antigen Peptide system for peptide-based immunization can also be utilized to generate an immunogen, wherein a desired portion of a RAFTK polypeptide is obtained directly from organo-chemical synthesis of the peptide onto an oligomeric branching lysine core (see, for example, Posnett et al. (1988) JBC 263, 1719 and Nardelli et al. (1992) J. Immunol. 148, 914).
  • Antigenic determinants of RAFTK proteins can also be expressed and presented by bacterial cells.
  • fusion proteins can also facilitate the expression of proteins, and accordingly, can be used in the expression of the mammalian RAFTK polypeptides of the present invention.
  • RAFTK polypeptides can be generated as glutathione-S-transferase (GST-fusion) proteins.
  • GST-fusion proteins can enable easy purification of the RAFTK polypeptide, as for example by the use of glutathione-derivatized matrices (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al. (N.Y.: John Wiley & Sons, 1991)).
  • a fusion gene coding for a purification leader sequence such as a poly-(His)/enterokinase cleavage site sequence at the N-terminus of the desired portion of the recombinant protein, can allow purification of the expressed fusion protein by affinity chromatography using a Ni2+ metal resin.
  • the purification leader sequence can then be subsequently removed by treatment with enterokinase to provide the purified protein (e.g., see Hochuli et al. (1987) J Chromatography 41 1 , 177; and Janknecht et al. PNAS 88, 8972). Techniques for making fusion genes are known to those skilled in the art.
  • the joining of various DNA fragments coding for different polypeptide sequences is performed in accordance with conventional techniques, employing blunt- ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation.
  • the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers.
  • PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al. John Wiley & Sons: 1992).
  • Another aspect of the invention pertains to antibodies specifically reactive with a vertebrate RAFTK protein, preferably a mammalian RAFTK protein.
  • a vertebrate RAFTK protein preferably a mammalian RAFTK protein.
  • immunogens derived from a RAFTK protein e.g. based on the cDNA sequences
  • anti-protein/anti-peptide antisera or monoclonal antibodies can be made by standard protocols (See, for example, Antibodies: A Laboratory Manual ed. by Harlow and Lane (Cold Spring Harbor Press: 1988)).
  • a mammal such as a mouse, a hamster or rabbit can be immunized with an immunogenic form of the peptide (e.g., a mammalian RAFTK polypeptide or an antigenic fragment which is capable of eliciting an antibody response, or a fusion protein as described above).
  • an immunogenic form of the peptide e.g., a mammalian RAFTK polypeptide or an antigenic fragment which is capable of eliciting an antibody response, or a fusion protein as described above.
  • Techniques for conferring immunogenicity on a protein or peptide include conjugation to carriers or other techniques well known in the art.
  • An immunogenic portion of a RAFTK protein can be administered in the presence of adjuvant.
  • the progress of immunization can be monitored by detection of antibody titers in plasma or serum. Standard ELISA or other immunoassays can be used with the immunogen as antigen to assess the levels of antibodies.
  • the subject antibodies are immunospecific for antigenic determinants of a RAFTK protein of a mammal, e.g. antigenic determinants of a protein represented by one of SEQ ID NOs:2 or 4.
  • anti- RAFTK antisera can be obtained and, if desired, polyclonal anti- RAFTK antibodies isolated from the serum.
  • antibody-producing cells lymphocytes
  • immortalizing cells such as myeloma cells to yield hybridoma cells.
  • Hybridoma cells can be screened immunochemically for production of antibodies specifically reactive with a mammalian RAFTK polypeptide of the present invention and monoclonal antibodies isolated from a culture comprising such hybridoma cells.
  • antibody as used herein is intended to include fragments thereof which are also specifically reactive with one of the subject mammalian RAFTK polypeptides.
  • Antibodies can be fragmented using conventional techniques and the fragments screened for utility in the same manner as described above for whole antibodies. For example, F(ab)2 fragments can be generated by treating antibody with pepsin. The resulting F(ab)2 fragment can be treated to reduce disulfide bridges to produce Fab fragments.
  • the antibody of the present invention is further intended to include bispecific and chimeric molecules having affinity for a RAFTK protein conferred by at least one CDR region of the antibody.
  • Antibodies which specifically bind RAFTK epitopes can also be used in immunohistochemical staining of tissue samples in order to evaluate the abundance and pattern of expression of each of the subject RAFTK polypeptides.
  • An ⁇ -RAFTK antibodies can be used diagnostically in immuno-precipitation and immuno-blotting to detect and evaluate RAFTK protein levels in tissue as part of a clinical testing procedure.
  • the ability to monitor RAFTK protein levels in an individual can allow determination of the efficacy of a given treatment regimen for an individual afflicted with such a disorder.
  • Diagnostic assays using anti- RAFTK antibodies can include, for example, immunoassays designed to aid in early diagnosis of a degenerative disorder, particularly ones which are manifest at birth.
  • Diagnostic assays using anti- RAFTK polypeptide antibodies can also include immunoassays designed to aid in early diagnosis and phenotyping neoplastic or hype ⁇ lastic disorders.
  • anti-RAFTK antibodies of the present invention is in the immunological screening of cDNA libraries constructed in expression vectors such as ⁇ gtl 1 , ⁇ gtl 8-23, ⁇ ZAP, and ⁇ ORF8.
  • Messenger libraries of this type having coding sequences inserted in the correct reading frame and orientation, can produce fusion proteins.
  • ⁇ gtl 1 will produce fusion proteins whose amino termini consist of ⁇ -galactosidase amino acid sequences and whose carboxy termini consist of a foreign polypeptide.
  • Antigenic epitopes of a RAFTK protein e.g.
  • RAFTK homologs can then be detected with antibodies, as, for example, reacting nitrocellulose filters lifted from infected plates with an ⁇ -RAFTK antibodies. Positive phage detected by this assay can then be isolated from the infected plate.
  • RAFTK homologs can be detected and cloned from other animals, as can alternate isoforms (including splicing variants) from humans.
  • RAFTK therapeutics which modulate RAFTK activity in B cells, T cells, and monocytes can be used to treat immune-mediated disorders and mediate both cell mediated and humoral immune responses.
  • RAFTK is modulated to treat cancers of hematopoietic cells.
  • malignancy can be suppressed in certain cells e.g., leukemic cells, by modulating RAFTK to induce cellular differentiation in "differentiation therapy", for example, in the treatment of leukemia, as has been demonstrated with cytokines or other compounds (Sachs (1996) Proc. Natl.
  • the subject RAFTK proteins can also be modulated to either induce or inhibit apoptosis in a cell.
  • the subject RAFTK proteins can be manipulated to induce apoptosis in cancer cells.
  • RAFTK can be modulated in a patient in conjunction with other cancer therapies.
  • RAFTK may be modulated to inhibit apoptosis.
  • RAFTK bioactivity is modulated to reduce metastasis of a cancer cell.
  • Yet another aspect of the present invention pertains to the therapeutic application of a RAFTK therapeutic to enhance survival of neurons and other neuronal cells in both the central nervous system and the peripheral nervous system.
  • the expression of RAFTK in neuronal cells and their role in signaling pathways involved in apoptosis indicates that certain of the RAFTK proteins participate in control of adult neurons with regard to maintenance, functional performance, and aging of normal cells; repair and regeneration processes in chemically or mechanically lesioned cells; and prevention of degeneration and premature death which result from loss of differentiation in certain pathological conditions.
  • the present invention specifically contemplates applications of the subject method to the treatment of (prevention and/or reduction of the severity of) neurological conditions deriving from: (i) acute, subacute, or chronic injury to the nervous system, including traumatic injury, chemical injury, vasal injury and deficits (such as the ischemia resulting from stroke), together with infectious/ inflammatory and tumor-induced injury; (ii) aging of the nervous system including Alzheimer's disease; (iii) chronic neurodegenerative diseases of the nervous system, including Parkinson's disease, Huntington's chorea, amylotrophic lateral sclerosis and the like, as well as spinocerebellar degenerations; and (iv) chronic immunological diseases of the nervous system or affecting the nervous system, including multiple sclerosis.
  • Alzheimer's disease is associated with deficits in several neurotransmitter systems, both those that project to the neocortex and those that reside with the cortex.
  • the nucleus basalis in patients with Alzheimer's disease have been observed to have a profound (75%) loss of neurons compared to age-matched controls.
  • Alzheimer's disease is by far the most common form of dementia, several other disorders can produce dementia.
  • Several of these are degenerative diseases characterized by the death of neurons in various parts of the central nervous system, especially the cerebral cortex.
  • some forms of dementia are associated with degeneration of the thalmus or the white matter underlying the cerebral cortex.
  • the cognitive dysfunction results from the isolation of cortical areas by the degeneration of efferents and afferents.
  • Huntington's disease involves the degeneration of intrastraital and cortical cholinergic neurons and GABAergic neurons.
  • Pick's disease is a severe neuronal degeneration in the neocortex of the frontal and anterior temporal lobes, sometimes accompanied by death of neurons in the striatum.
  • Treatment of patients suffering from such degenerative conditions can include the application of RAFTK therapeutics, in order to control, for example, differentiation and apoptotic events which give rise to loss of neurons (e.g. to enhance survival of existing neurons) as well as promote differentiation and repopulation by progenitor cells in the area affected.
  • RAFTK therapeutics can be applied opportunely in the treatment of neurodegenerative disorders which have manifestations of tremors and involuntary movements.
  • Parkinson's disease for example, primarily affects subcortical structures and is characterized by degeneration of the nigrostriatal pathway, raphe nuclei, locus cereleus, and the motor nucleus of vagus. Ballism is typically associated with damage to the subthalmic nucleus, often due to acute vascular accident.
  • ALS amyotrophic lateral sclerosis
  • ALS is a name given to a complex of disorders that comprise upper and lower motor neurons. Patients may present with progressive spinal muscular atrophy, progressive bulbar palsy, primary lateral sclerosis, or a combination of these conditions.
  • the major pathological abnormality is characterized by a selective and progressive degeneration of the lower motor neurons in the spinal cord and the upper motor neurons in the cerebral cortex.
  • the therapeutic application of a RAFTK therapeutic can be used alone, or in conjunction with neurotrophic factors such as CNTF, BDNF or NGF to prevent and/or reverse motor neuron degeneration in ALS patients.
  • Another aspect of the present invention relates to a method of inducing and/or maintaining a differentiated state or enhancing survival by contacting the cells with an agent which modulates RAFTK-dependent signaling by a growth factor.
  • an agent which modulates RAFTK-dependent signaling by a growth factor for instance, it is contemplated by the invention that, in light of the present finding of a broad involvement of RAFTK proteins in signal transduction in a variety of different cell types, the subject RAFTK signaling molecules can be used in a wide range of therapeutic regimens both in vitro and in vivo.
  • a "RAFTK therapeutic” can be, as appropriate, any of the preparations described above, including isolated polypeptides, gene therapy constructs, antisense molecules, peptidomimetics or agents identified in the drug assays provided herein.
  • the RAFTK proteins of the present invention can modulate the differentiation or maturation of hematopoietic cells; the subject RAFTK polypeptides are capable of influencing both the differentiation and maturation of pluripotent stem cells and the proliferation of differentiated cells.
  • RAFTK bioactivity is modulated in CD34+ bone marrow cells; the presence of the cell-surface marker CD34 in humans has been found to correlate with bone marrow progenitors which proliferate to hematopoietic cytokines.
  • Hematopoiesis can be modulated either in vitro or in vivo and the subject RAFTK therapeutics can be used alone or in combination with cytokines and/or colony stimulating factors.
  • a growth factor for example, G-CSF and/or IL-3 (Lemoli et al. Experimental Hematology 1995, 23:1520) or SCF which has been shown to act with other cytokines to stimulate hematopoietic colony formation Martin et al. (1990) Cell 63, 203), stimulate hematopoiesis (Andrews et al.
  • RAFTK RAFTK
  • stem cells When stem cells are induced to mature and/or proliferate in vitro, the subject RAFTK therapeutics can be combined with culture of the stem cells on feeder cells.
  • Stem cells in which RAFTK is modulated can be useful, for example in the expansion of cells for autologous of allogeneic transplantation of stem cells or differentiated cells.
  • RAFTK can be modulated to enhance engraftment and/or hematopoiesis after allogeneic bone marrow transplantation.
  • RAFTK can be modulated to control megakaryocyte development and to ameliorate diseases caused by abnormalities in megakaryocytic cells, for example, thrombocytopenia, myelodysplastic syndrome, myeloproliferative disorder, aplastic anemia, chronic myelogenous leukemia.
  • Platelets are derived from megakaryocytes, and the subject RAFTK molecules can be used to correct abnormalities in platelet number or function. Platelets are important in numerous hemorrhagic and thrombotic disorders.
  • RAFTK bioactivity can be modulated to control platelet aggregation.
  • the subject RAFTK therapeutics can play a role in the maturation of cells of the erythroid lineage.
  • RAFTK RAFTK gene
  • antisense ribozyme
  • triple helix molecules Compounds that compete with an RAFTK protein for binding with an actove portion of RAFTK will antagonize a RAFTK protein, thereby inducing a therapeutic effect.
  • suitable compounds include the antagonists or homologues described in detail above.
  • the increased expression or bioactivity of a RAFTK protein may be desirable and may be accomplished by, for example the use of the RAFTK agonists or mimetics or by gene replacement therapy, as described herein.
  • the therapeutically effective dose can be estimated initially from cell culture assays.
  • a dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans.
  • compositions for use in accordance with the present invention can be formulated in conventional manner using one or more physiologically acceptable carriers or excipients.
  • the compounds e.g., RAFTK polypeptides or RAFTK nucleic acids
  • their physiologically acceptable salts and solvates may be formulated for administration by, for example, injection, inhalation or insufflation (either through the mouth or the nose) or oral, buccal, parenteral or rectal administration.
  • the oligomers of the invention can be formulated for a variety of loads of administration, including systemic and topical or localized administration. Techniques and formulations generally can be found in Remmington's Pharmaceutical Sciences, Meade Publishing Co., Easton, PA. For systemic administration, injection is preferred, including intramuscular, intravenous, intraperitoneal, and subcutaneous.
  • the pharmaceutical compositions can take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulphate).
  • binding agents e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose
  • fillers e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate
  • lubricants e.g., magnesium stearate, talc or silica
  • disintegrants e.g., potato starch
  • Preparations for oral administration may be suitably formulated to give controlled release of the active compound.
  • the compounds can be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampules or in multi-dose containers, with an added preservative.
  • the compositions can take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen- free water, before use.
  • Systemic administration can also be by transmucosal or transdermal means.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art, and include, for example, for transmucosal administration bile salts and fusidic acid derivatives.
  • detergents may be used to facilitate permeation.
  • Transmucosal administration may be through nasal sprays or using suppositories.
  • the oligomers of the invention are formulated into ointments, salves, gels, or creams as generally known in the art.
  • the gene delivery systems for the therapeutic RAFTK gene can be introduced into a patient by any of a number of methods, each of which is familiar in the art.
  • a pharmaceutical preparation of the gene delivery system can be introduced systemically, e.g. by intravenous injection, and specific transduction of the protein in the target cells occurs predominantly from specificity of transfection provided by the gene delivery vehicle, cell-type or tissue-type expression due to the transcriptional regulatory sequences controlling expression of the receptor gene, or a combination thereof.
  • initial delivery of the recombinant gene is localized.
  • the gene delivery vehicle can be introduced by catheter (see U.S. Patent 5,328,470) or by stereotactic injection (e.g. Chen et al.
  • a mammalian RAFTK gene such as any one of the sequences represented in one of SEQ ID NOS.T or 3, or a sequence homologous thereto can be delivered in a gene therapy construct by electroporation using techniques described, for example, by Dev et al. ((1994) Cancer Treat Rev 20, 105-115).
  • the pharmaceutical preparation of the gene therapy construct can include the gene delivery system in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded.
  • the pharmaceutical preparation can comprise one or more cells which produce the gene delivery system.
  • compositions can, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient.
  • the pack may for example comprise metal or plastic foil, such as a blister pack.
  • the pack or dispenser device can be accompanied by instructions for administration.
  • the present method provides a method for determining if a subject is at risk for a disorder characterized by aberrant cell proliferation and/or differentiation.
  • the methods can be characterized as comprising detecting, in a sample of cells from the subject, the presence or absence of a genetic lesion characterized by at least one of (i) an alteration affecting the integrity of a gene encoding a RAFTK-p ⁇ otem ' , or (ii) the mis-expression of the RAFTK gene.
  • such genetic lesions can be detected by ascertaining the existence of at least one of (i) a deletion of one or more nucleotides from a RAFTK gene, (ii) an addition of one or more nucleotides to a RAFTK gene, (iii) a substitution of one or more nucleotides of a RAFTK gene, (iv) a gross chromosomal rearrangement of a RAFTK gene, (v) a gross alteration in the level of a messenger RNA transcript of a RAFTK gene, (vii) aberrant modification of a RAFTK gene, such as of the methylation pattern of the genomic DNA, (vii) the presence of a non-wild type splicing pattern of a messenger RNA transcript of a RAFTK gene, (viii) a non-wild type level of a RAFTK- protein, (ix) allelic loss of a RAFTK gene, and (x) inappropriate post-translational modification of a RAFTK-pvot
  • a nucleic acid composition comprising a (purified) oligonucleotide probe including a region of nucleotide sequence which is capable of hybridizing to a sense or antisense sequence of a RAFTK gene, such as represented by one of SEQ ID NOs:l or 3, or naturally occurring mutants thereof, or 5' or 3' flanking sequences or intronic sequences naturally associated with the subject RAFTK genes or naturally occurring mutants thereof.
  • the nucleic acid of a cell is rendered accessible for hybridization, the probe is exposed to nucleic acid of the sample, and the hybridization of the probe to the sample nucleic acid is detected.
  • Such techniques can be used to detect lesions at either the genomic or mRNA level, including deletions, substitutions, etc., as well as to determine mRNA transcript levels.
  • detection of the lesion comprises utilizing the probe/primer in a polymerase chain reaction (PCR) (see, e.g. U.S. Patent Nos. 4,683,195 and 4,683,202), such as anchor PCR or RACE PCR, or, alternatively, in a ligation chain reaction (LCR) (see, e.g., Landegran et al. (1988) Science 241, 1077- 1080; and Nakazawa et al. (1994) PNAS 91 , 360-364), the latter of which can be particularly useful for detecting point mutations in the RAFTK-gene (see Abravaya et al. (1995) Nuc Acid Res 23, 675-682).
  • PCR polymerase chain reaction
  • LCR ligation chain reaction
  • the method includes the steps of (i) collecting a sample of cells from a patient, (ii) isolating nucleic acid (e.g., genomic, mRNA or both) from the cells of the sample, (iii) contacting the nucleic acid sample with one or more primers which specifically hybridize to a RAFTK gene under conditions such that hybridization and amplification of the RAFTK-gene (if present) occurs, and (iv) detecting the presence or absence of an amplification product, or detecting the size of the amplification product and comparing the length to a control sample.
  • nucleic acid e.g., genomic, mRNA or both
  • PCR and/or LCR may be desirable to use as a preliminary amplification step in conjunction with any of the techniques used for detecting mutations described herein.
  • Alternative amplification methods include: self sustained sequence replication (Guatelli, J.C. et al. (1990) Proc. Natl. Acad. Sci. USA 87, 1874-1878), transcriptional amplification system (Kwoh, D.Y. et al. (1989) Proc. Natl. Acad Sci. USA 86, 1173-1177), Q-Beta Replicase (Lizardi, P.M. et al.
  • mutations in a RAFTK gene from a sample cell are identified by alterations in restriction enzyme cleavage patterns.
  • sample and control DNA is isolated, amplified (optionally), digested with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis.
  • sequence specific ribozymes see, for example, U.S. Patent No. 5,498,531 can be used to score for the presence of specific mutations by development or loss of a ribozyme cleavage site.
  • any of a variety of sequencing reactions known in the art can be used to directly sequence the RAFTK gene and detect mutations by comparing the sequence of the sample RAFTK with the corresponding wild-type (control) sequence.
  • Exemplary sequencing reactions include those based on techniques developed by Maxim and Gilbert (Proc. Natl Acad Sci USA ( 1977) 74, 560) or Sangcr (Sanger et al (1977) Proc. Nat. Acad. Sci 74, 5463). It is also contemplated that any of a variety of automated sequencing procedures may be utilized when performing the subject assays ((1995) Biotechniques 19, 448), including by sequencing by mass spectrometry (see, for example PCT publication WO 94/16101 ; Cohen et al.
  • RNA/DNA duplexes can be treated with RNase and DNA/DNA hybrids treated with SI nuclease to enzymatically digesting the mismatched regions.
  • either DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium tetroxide and with piperidine in order to digest mismatched regions. After digestion of the mismatched regions, the resulting material is then separated by size on denaturing polyacrylamide gels to determine the site of mutation. See, for example, Cotton et al (1988) Proc. Natl Acad Sci USA 85, 4397; Saleeba et al ( 1992) Methods Enzymod. 217, 286-295.
  • the control DNA or RNA can be labeled for detection.
  • the mismatch cleavage reaction employs one or more proteins that recognize mismatched base pairs in double-stranded DNA (so called "DNA mismatch repair" enzymes) in defined systems for detecting and mapping point mutations in RAFTK cDNAs obtained from samples of cells.
  • DNA mismatch repair enzymes
  • the mutY enzyme of E. coli cleaves A at G/A mismatches and the thymidine DNA glycosylase from HeLa cells cleaves T at G/T mismatches (Hsu et al. (1994) Carcinogenesis 15, 1657-1662).
  • a probe based on a RAFTK sequence e.g., a wild-type RAFTK sequence
  • a cDNA or other DNA product from a test cell(s).
  • the duplex is treated with a DNA mismatch repair enzyme, and the cleavage products, if any, can be detected from electrophoresis protocols or the like. See, for example, U.S. Patent No. 5,459,039.
  • alterations in electrophoretic mobility is used to identify mutations in RAFTK genes.
  • single strand conformation polymo ⁇ hism may be used to detect differences in electrophoretic mobility between mutant and wild type nucleic acids (Orita et al. (1989) Proc Natl. Acad. Sci USA 86, 2766, see also Cotton (1993) Mutat Res 285, 125-144; and Hayashi (1992) Genet Anal Tech Appl 9, 73-79). Single-stranded DNA fragments of sample and control RAFTK nucleic acids is denatured and allowed to renature.
  • the secondary structure of single-stranded nucleic acids varies according to sequence, the resulting alteration in electrophoretic mobility enables the detection of even a single base change.
  • the DNA fragments may be labelled or detected with labelled probes.
  • the sensitivity of the assay may be enhanced by using RNA (rather than DNA), in which the secondary structure is more sensitive to a change in sequence.
  • the subject method utilizes heteroduplex analysis to separate double stranded heteroduplex molecules on the basis of changes in electrophoretic mobility (Keen et al. (1991) Trends Genet 1, 5).
  • the movement of mutant or wild-type fragments in polyacrylamide gels containing a gradient of denaturant is assayed using denaturing gradient gel electrophoresis (DGGE) (Myers et al (1985) Nature 313, 495).
  • DGGE denaturing gradient gel electrophoresis
  • DNA will be modified to insure that it does not completely denature, for example by adding a GC clamp of approximately 40 bp of high-melting GC-rich DNA by PCR.
  • a temperature gradient is used in place of a denaturing agent gradient to identify differences in the mobility of control and sample DNA (Rosenbaum and Reissner (1987) Biophys Chem 265, 12753).
  • oligonucleotide primers may be prepared in which the known mutation is placed centrally and then hybridized to target DNA under conditions which permit hybridization only if a perfect match is found (Saiki et al. (1986) Nature 324, 163); Saiki et al (1989) Proc. Nail Acad. Sci USA 86, 6230).
  • Such allele speicific oligonucleotide hybridization techniques may be used to test one mutation per reaction when oligonucleotides are hybridized to PCR amplified target DNA or a number of different mutations when the oligonucleotides are attached to the hybridizing membrane and hybridized with labelled target DNA.
  • Oligonucleotides used as primers for specific amplification may carry the mutation of interest in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al (1989) Nucleic Acids Res. 17, 2437-2448) or at the extreme 3' end of one primer where, under appropriate conditions, mismatch can prevent, or reduce polymerase extension (Prossner ( 1993) Tibtech 1 1 , 238.
  • amplification may also be performed using Taq ligase for amplification (Barany (1991) Proc. Natl. Acad. Sci USA 88, 189). In such cases, ligation will occur only if there is a perfect match at the 3' end of the 5' sequence making it possible to detect the presence of a known mutation at a specific site by looking for the presence or absence of amplification.
  • nucleic acid composition comprising a (purified) oligonucleotide probe including a region of nucleotide sequence which is capable of hybridizing to a sense or antisense sequence of a
  • RAFTK-gene or naturally occurring mutants thereof, or 5' or 3' flanking sequences or intronic sequences naturally associated with the subject RAFTK-genes or naturally occurring mutants thereof.
  • the nucleic acid of a cell is rendered accessible for hybridization, the probe is exposed to nucleic acid of the sample, and the hybridization of the probe to the sample nucleic acid is detected.
  • Such techniques can be used to detect lesions at either the genomic or mRNA level, including deletions, substitutions, etc., as well as to determine mRNA transcript levels.
  • Such oligonucleotide probes can be used for both predictive and therapeutic evaluation of allelic mutations which might be manifest in, for example, neoplastic or hype ⁇ lastic disorders (e.g. aberrant cell growth).
  • the methods described herein may be performed, for example, by utilizing pre-packaged diagnostic kits comprising at least one probe nucleic acid or antibody reagent described herein, which may be conveniently used, e.g., in clinical settings to diagnose patients exhibiting symptoms or family history of a disease or illness involving a RAFTK gene.
  • Diagnostic procedures may also be performed in situ directly upon tissue sections (fixed and/or frozen) of patient tissue obtained from biopsies or resections, such that no nucleic acid purification is necessary.
  • Nucleic acid reagents may be used as probes and/or primers for such in situ procedures (see, for example, Nuovo, G.J., 1992, PCR in situ hybridization: protocols and applications, Raven Press, NY).
  • mutant RAFTK proteins can be detected using the protein truncation test (PTT) (Dowton and Salugh. 1995, Clin. Chem 41:785).
  • PTT protein truncation test
  • RNA is initially isolated and reverse-transcribed, and the segment of interest is amplified by PCR.
  • the PCR products are then used as a template for nested PCR amplification with a primer containing an RNA polymerase promoter and a translation initiation sequence. After amplification, the unique motifs inco ⁇ orated into the primer permit sequential in vitro transcription and translation of the PCR products.
  • Protein products are analyzed by electrophoresis and mutantations which cause truncation of the protein are identified by a change in the molecular weight of the protein. DNA may also be used.
  • profiles may also be assessed in such detection schemes.
  • Finge ⁇ rint profiles may be generated, for example, by utilizing a differential display procedure, Northern analysis and/or RT-PCR.
  • Antibodies directed against wild type or mutant RAFTK proteins may also be used indisease diagnostics and prognostics. Such diagnostic methods, may be used to detect abnormalities in the level of RAFTK protein expression, or abnormalities in the structure and/or tissue, cellular, or subcellular location of RAFTK protein. Structural differences may include, for example, differences in the size, electronegativity, or antigenicity of the mutant RAFTK protein relative to the normal RAFTK protein. Protein from the tissue or cell type to be analyzed may easily be detected or isolated using techniques which are well known to one of skill in the art, including but not limited to western blot analysis.
  • the antibodies (or fragments thereof) useful in the present invention may, additionally, be employed histologically, as in immunofluorescence or immunoelectron microscopy, for in situ detection of RAFTK proteins.
  • In situ detection may be accomplished by removing a histological specimen from a patient, and contacting it with a labeled antibody of the present invention.
  • the antibody (or fragment) is preferably applied by overlaying the labeled antibody (or fragment) onto a biological sample.
  • a solid phase support or carrier is used as a support capable of binding an antigen or an antibody.
  • supports or carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, gabbros, and magnetite.
  • the nature of the carrier can be either soluble to some extent or insoluble for the pu ⁇ oses of the present invention.
  • the support material may have virtually any possible structural configuration so long as the coupled molecule is capable of binding to an antigen or antibody.
  • the support configuration may be spherical, as in a bead, or cylindrical, as in the inside surface of a test tube, or the external surface of a rod.
  • the surface may be flat such as a sheet, test strip, etc.
  • Preferred supports include polystyrene beads. Those skilled in the art will know many other suitable carriers for binding antibody or antigen, or will be able to ascertain the same by use of routine experimentation.
  • EIA enzyme immunoassay
  • the enzyme which is bound to the antibody will react with an appropriate substrate, preferably a chromogenic substrate, in such a manner as to produce a chemical moiety which can be detected, for example, by spectrophotometric, fluorimetric or by visual means.
  • Enzymes which can be used to detectably label the antibody include, but are not limited to, malate dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate, dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6- phosphate dehydrogenase, glucoamylase and acetylcholinesterase.
  • the detection can be accomplished by colorimetric methods which employ a chromogenic substrate for the enzyme. Detection may also be accomplished by visual comparison of the extent of enzymatic reaction of a substrate in comparison with similarly prepared standards. Detection may also be accomplished using any of a variety of other immunoassays. For example, by radioactively labeling the antibodies or antibody fragments, it is possible to detect finge ⁇ rint gene wild type or mutant peptides through the use of a radioimmunoassay (RIA) (see, for example, Weintraub, B., Principles of Radioimmunoassay s, Seventh Training Course on Radioligand Assay Techniques, The Endocrine Society, March, 1986, which is inco ⁇ orated by reference herein).
  • the radioactive isotope can be detected by such means as the use of a gamma counter or a scintillation counter or by autoradiography.
  • the antibody can also be labeled with a fluorescent compound.
  • fluorescent labeling compounds are fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine.
  • the antibody can also be labeled using fluorescence emitting metals such as 152Eu, or others of the lanthanide series. These metals can be attached to the antibody using such metal chelating groups as diethylenetriaminepentacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA).
  • DTPA diethylenetriaminepentacetic acid
  • EDTA ethylenediaminetetraacetic acid
  • the antibody also can be detectably labeled by coupling it to a chemiluminescent compound.
  • the presence of the chemiluminescent-tagged antibody is then determined by detecting the presence of luminescence that arises during the course of a chemical reaction.
  • particularly useful chemiluminescent labeling compounds are luminol, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester.
  • a bioluminescent compound may be used to label the antibody of the present invention. Bioluminescence is a type of chemiluminescence found in biological systems in which a catalytic protein increases the efficiency of the chemiluminescent reaction.
  • bioluminescent protein The presence of a bioluminescent protein is determined by detecting luminescence.
  • Important bioluminescent compounds for pu ⁇ oses of labeling are luciferin, luciferase and aequorin.
  • any of the above methods for detecting alterations in a RAFTK gene or gene product can be used to monitor the course of treatment or therapy.
  • the present invention facilitates the development of assays which can be used to screen for compounds, including RAFTK homologs, which are either agonists or antagonists of the normal cellular function of the subject RAFTK polypeptides, or of their role in the pathogenesis of cellular differentiation and/or proliferation and disorders related thereto.
  • assay formats can be utilized and, in light of the present inventions, will be comprehended by a skilled artisan.
  • Cell-free assays In many drug screening programs which test libraries of compounds and natural extracts, high throughput assays are desirable in order to maximize the number of compounds surveyed in a given period of time. Assays which are performed in cell-free systems, such as may be derived with purified or semi-purified proteins, are often preferred as "primary" screens in that they can be generated to permit rapid development and relatively easy detection of an alteration in a molecular target which is mediated by a test compound. Moreover, the effects of cellular toxicity and/or bioavailability of the test compound can be generally ignored in the in vitro system, the assay instead can be focused primarily on the effect of the drug on the molecular target as may be manifest in an alteration of binding affinity with upstream or downstream elements.
  • the compound of interest is contacted with proteins which may function upstream (including both activators and repressors of its activity) or to proteins or nucleic acids which may function downstream of the RAFTK polypeptide, whether they are positively or negatively regulated by it.
  • proteins which may function upstream including both activators and repressors of its activity
  • proteins or nucleic acids which may function downstream of the RAFTK polypeptide, whether they are positively or negatively regulated by it.
  • RAFTK polypeptide Detection and quantification of complexes of RAFTK with it's upstream or downstream elements provide a means for determining a compound's efficacy at inhibiting (or potentiating) complex formation between RAFTK and the RAFTK-bmding elements.
  • the efficacy of the compound can be assessed by generating dose response curves from data obtained using various concentrations of the test compound.
  • a control assay can also be performed to provide a baseline for comparison. In the control assay, isolated and purified RAFTK polypeptide is added to a composition containing the -/64 -T ⁇ !-binding element, and the formation of a complex is quantitated in the absence of the test compound.
  • Complex formation between the RAFTK polypeptide and a RAFTK binding element may be detected by a variety of techniques. Modulation of the formation of complexes can be quantitated using, for example, detectably labeled proteins such as radiolabeled, fluorescently labeled, or enzymatically labeled RAFTK polypeptides, by immunoassay, or by chromatographic detection.
  • detectably labeled proteins such as radiolabeled, fluorescently labeled, or enzymatically labeled RAFTK polypeptides
  • RAFTK RAFTK
  • binding protein to facilitate separation of complexes from uncomplexed forms of one or both of the proteins, as well as to accommodate automation of the assay. Binding of RAFTK to an upstream or downstream element, in the presence and absence of a candidate agent, can be accomplished in any vessel suitable for containing the reactants. Examples include microtitre plates, test tubes, and micro-centrifuge tubes.
  • a fusion protein can be provided which adds a domain that allows the protein to be bound to a matrix.
  • glutathione-S-transferase/i ⁇ / ⁇ : (GST/RAFTK) fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, MO) or glutathione derivatized microtitre plates, which are then combined with the cell lysates (e.g. 35S-labeled) and the test compound, and the mixture incubated under conditions conducive to complex formation, for example at physiological conditions for salt and pH, though slightly more stringent conditions may be desired. Following incubation, the beads are washed to remove any unbound label, and the matrix immobilized and radiolabel determined directly (e.g.
  • the complexes can be dissociated from the matrix, separated by SDS- PAGE, and the level of RAFTK-bm ' ding protein found in the bead fraction quantitated from the gel using standard electrophoretic techniques.
  • RAFTK or its cognate binding protein can be immobilized utilizing conjugation of biotin and streptavidin.
  • biotinylated RAFTK molecules can be prepared from biotin-NHS (N-hydroxysuccinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, IL), and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical).
  • antibodies reactive with RAFTKbv ⁇ which do not interfere with binding of upstream or downstream elements can be derivatized to the wells of the plate, and RAFTK trapped in the wells by antibody conjugation.
  • preparations of a &4/*T ⁇ >binding protein and a test compound are incubated in the &-4.F7X-presenting wells of the plate, and the amount of complex trapped in the well can be quantitated.
  • Exemplary methods for detecting such complexes include immunodetection of complexes using antibodies reactive with the RAFTK binding element, or which are reactive with RAFTK protein and compete with the binding element; as well as enzyme-linked assays which rely on detecting an enzymatic activity associated with the binding element, either intrinsic or extrinsic activity.
  • the enzyme can be chemically conjugated or provided as a fusion protein with the RAFTK-BP.
  • the RAFTK-BP can be chemically cross-linked or genetically fused with horseradish peroxidase, and the amount of polypeptide trapped in the complex can be assessed with a chromogenic substrate of the enzyme, e.g. 3,3'-diamino-benzadine terahydrochloride or 4-chloro-l-napthol.
  • a fusion protein comprising the polypeptide and glutathione-S-transferase can be provided, and complex formation quantitated by detecting the GST activity using 1 -chloro-2,4-dinitrobenzene (Habig et al (1974) J Biol Chem 249, 7130).
  • the protein to be detected in the complex can be "epitope tagged" in the form of a fusion protein which includes, in addition to the RAFTK sequence, a second polypeptide for which antibodies are readily available (e.g. from commercial sources).
  • the GST fusion proteins described above can also be used for quantification of binding using antibodies against the GST moiety.
  • Other useful epitope tags include myc-epitopes (e.g., sec Ellison et al.
  • the readily available source of mammalian RAFTK proteins provided by the present invention also facilitates the generation of cell-based assays for identifying small molecule agonists/antagonists and the like.
  • cells which are sensitive to ligands which transduce signals via a pathway involving RAFTK can be caused to overexpress a recombinant RAFTK protein in the presence and absence of a test agent of interest, with the assay scoring for modulation of RAFTK responses by the target cell mediated by the test agent.
  • agents which produce a statistically significant change in &4 7 ⁇ ' -dependent responses can be identified.
  • the expression or activity of a RAFTK is modulated in cells and the effects of compounds of interest on the readout of interest (such as apoptosis, proliferation or differentiation) are measured.
  • the expression of genes which are up- or down-regulated in response to a -/L4.F7 ⁇ --dependent signal cascade can be assayed.
  • the regulatory regions of such genes e.g., the 5' flanking promoter and enhancer regions, are operably linked to a detectable marker (such as luciferase) which encodes a gene product that can be readily detected.
  • Phosphorylation of RAFTK or RAFTK binding proteins can also be measured, for example by immunoblotting as described in the appended examples. Monitoring the influence of compounds on cells may be applied not only in basic drug screening, but also in clinical trials. In such clinical trials, the expression of a panel of genes may be used as a "read out" of a particular drug's therapeutic effect.
  • the subject RAFTK polypeptides can be used to generate a "two hybrid" assay (see, for example, U.S. Patent No. 5,283,317; Zervos et al. (1993) Cell 72, 223-232; Madura et al. (1993) J 5 o/ Chem 268, 12046- 12054; Bartel et al. (1993) Biotechniques 14, 920-924; Iwabuchi et al. (1993) Oncogene 8, 1693-1696; and Brent WO94/10300), for isolating coding sequences for other cellular proteins which bind to or interact with RAFTK (" RAFTK-b ' d ⁇ ng proteins" or "RAFTK-bp". Such i 4 TA:-binding proteins would likely also be involved in the propagation of signals by the RAFTK proteins as, for example, the upstream or downstream elements of the RAFTK pathway.
  • the two hybrid assay relies on reconstituting in vivo a functional transcriptional activator protein from two separate fusion proteins.
  • the method makes use of chimeric genes which express hybrid proteins.
  • a first hybrid gene comprises the coding sequence for a DN A-binding domain of a transcriptional activator fused in frame to the coding sequence for a RAFTK polypeptide.
  • the second hybrid protein encodes a transcriptional activation domain fused in frame to a sample gene from a cDNA library. If the bait and sample hybrid proteins are able to interact, e.g., form a RAFTK-dependent complex, they bring into close proximity the two domains of the transcriptional activator. This proximity is sufficient to cause transcription of a reporter gene which is operably linked to a transcriptional regulatory site responsive to the transcriptional activator, and expression of the reporter gene can be detected and used to score for the interaction of the RAFTK and sample proteins.
  • the cell- and animal-based model systems may be used to further characterize RAFTK genes and proteins.
  • assays may be utilized as part of screening strategies designed to identify compounds which are capable of ameliorating disease symptoms.
  • the animal- and cell-based models may be used to identify drugs, pharmaceuticals, therapies and interventions which may be effective in treating disease.
  • transgenic animals comprising of cells which contain a transgene of the present invention and which preferably (though optionally) express an exogenous RAFTK protein in one or more cells in the animal.
  • a RAFTK transgene can encode the wild-type form of the protein, or can encode homologs thereof, including both agonists and antagonists, as well as antisense constructs.
  • the expression of the transgene is restricted to specific subsets of cells, tissues or developmental stages utilizing, for example, cis- acting sequences that control expression in the desired pattern.
  • such mosaic expression of a RAFTK protein can be essential for many forms of lineage analysis and can additionally provide a means to assess the effects of, for example, lack of RAFTK expression which might grossly alter development in small patches of tissue within an otherwise normal embryo.
  • tissue-specific regulatory sequences and conditional regulatory sequences can be used to control expression of the transgene in certain spatial patterns.
  • temporal patterns of expression can be provided by, for example, conditional recombination systems or prokaryotic transcriptional regulatory sequences. Genetic techniques which allow for the expression of transgenes can be regulated via site-specific genetic manipulation in vivo are known to those skilled in the art.
  • target sequence refers to a nucleotide sequence that is genetically recombined by a recombinase.
  • the target sequence is flanked by recombinase recognition sequences and is generally either excised or inverted in cells expressing recombinase activity.
  • Recombinase catalyzed recombination events can be designed such that recombination of the target sequence results in either the activation or repression of expression of one of the subject RAFTK proteins.
  • excision of a target sequence which interferes with the expression of a recombinant RAFTK gene can be designed to activate expression of that gene.
  • This interference with expression of the protein can result from a variety of mechanisms, such as spatial separation of the RAFTK gene from the promoter element or an internal stop codon.
  • the transgene can be made wherein the coding sequence of the gene is flanked by recombinase recognition sequences and is initially transfected into cells in a 3' to 5' orientation with respect to the promoter element. In such an instance, inversion of the target sequence will reorient the subject gene by placing the 5' end of the coding sequence in an orientation with respect to the promoter element which allow for promoter driven transcriptional activation.
  • transgenic animals of the present invention all include within a plurality of their cells a transgene of the present invention, which transgene alters the phenotype of the "host cell” with respect to regulation of cell growth, death and/or differentiation. Since it is possible to produce transgenic organisms of the invention utilizing one or more of the transgene constructs described herein, a general description will be given of the production of transgenic organisms by referring generally to exogenous genetic material. This general description can be adapted by those skilled in the art in order to inco ⁇ orate specific transgene sequences into organisms utilizing the methods and materials described below.
  • cre/loxP recombinase system of bacteriophage PI Lakso et al. (1992) PNAS 89, 6232-6236; Orban et al. (1992) PNAS 89, 6861-6865) or the FLP recombinase system of Saccharomyces cerevisiae
  • Cre recombinase catalyzes the site-specific recombination of an intervening target sequence located between loxP sequences.
  • loxP sequences are 34 base pair nucleotide repeat sequences to which the Cre recombinase binds and are required for Cre recombinase mediated genetic recombination.
  • the orientation of loxP sequences determines whether the intervening target sequence is excised or inverted when Cre recombinase is present (Abremski et al. (1984) J. Biol. Chem. 259, 1509-1514); catalyzing the excision of the target sequence when the loxP sequences are oriented as direct repeats and catalyzes inversion of the target sequence when loxP sequences are oriented as inverted repeats.
  • genetic recombination of the target sequence is dependent on expression of the Cre recombinase.
  • Expression of the recombinase can be regulated by promoter elements which are subject to regulatory control, e.g., tissue-specific, developmental stage-specific, inducible or repressible by externally added agents.
  • cre/loxP recombinase system to regulate expression of a recombinant RAFTK protein requires the construction of a transgenic animal containing transgenes encoding both the Cre recombinase and the subject protein. Animals containing both the Cre recombinase and a recombinant RAFTK gene can be provided through the construction of "double" transgenic animals. A convenient method for providing such animals is to mate two transgenic animals each containing a transgene, e.g., a RAFTK gene and recombinase gene.
  • transgenic animals containing a RAFTK transgene in a recombinase-mediated expressible format derives from the likelihood that the subject protein, whether agonistic or antagonistic, can be deleterious upon expression in the transgenic animal.
  • a founder population in which the subject transgene is silent in all tissues, can be propagated and maintained. Individuals of this founder population can be crossed with animals expressing the recombinase in, for example, one or more tissues and/or a desired temporal pattern.
  • a founder population in which, for example, an antagonistic RAFTK transgene is silent will allow the study of progeny from that founder in which disruption of RAFTK mediated induction in a particular tissue or at certain developmental stages would result in, for example, a lethal phenotype.
  • prokaryotic promoter sequences which require prokaryotic proteins to be simultaneous expressed in order to facilitate expression of the RAFTK transgene.
  • Exemplary promoters and the corresponding trans-activating prokaryotic proteins are given in U.S. Patent No. 4,833,080.
  • conditional transgenes can be induced by gene therapy-like methods wherein a gene encoding the trans-activating protein, e.g. a recombinase or a prokaryotic protein, is delivered to the tissue and caused to be expressed, such as in a cell-type specific manner.
  • a RAFTK transgene could remain silent into adulthood until "turned on” by the introduction of the trans- activator.
  • the "transgenic non-human animals" of the invention are produced by introducing transgenes into the germline of the non-human animal.
  • Embryonal target cells at various developmental stages can be used to introduce transgenes. Different methods are used depending on the stage of development of the embryonal target cell.
  • the specific line(s) of any animal used to practice this invention are selected for general good health, good embryo yields, good pronuclear visibility in the embryo, and good reproductive fitness.
  • the haplotype is a significant factor. For example, when transgenic mice are to be produced, strains such as C57BL/6 or FVB lines are often used (Jackson Laboratory, Bar Harbor, ME).
  • Preferred strains are those with H-2b, H-2d or H-2q haplotypes such as C57BL/6 or DBA 1.
  • the line(s) used to practice this invention may themselves be transgenics, and/or may be knockouts (i.e., obtained from animals which have one or more genes partially or completely suppressed) .
  • the transgene construct is introduced into a single stage embryo.
  • the zygote is the best target for micro-injection.
  • the male pronucleus reaches the size of approximately 20 micrometers in diameter which allows reproducible injection of l-2pl of DNA solution.
  • the use of zygotes as a target for gene transfer has a major advantage in that in most cases the injected DNA will be inco ⁇ orated into the host gene before the first cleavage (Brinster et al. (1985) PNAS 82, 4438-4442). As a consequence, all cells of the transgenic animal will carry the inco ⁇ orated transgene. This will in general also be reflected in the efficient transmission of the transgene to offspring of the founder since 50% of the germ cells will harbor the transgene.
  • the nucleotide sequence comprising the transgene is introduced into the female or male pronucleus as described below. In some species such as mice, the male pronucleus is preferred. It is most preferred that the exogenous genetic material be added to the male DNA complement of the zygote prior to its being processed by the ovum nucleus or the zygote female pronucleus.
  • ovum nucleus or female pronucleus release molecules which affect the male DNA complement, perhaps by replacing the protamines of the male DNA with histones, thereby facilitating the combination of the female and male DNA complements to form the diploid zygote.
  • the exogenous genetic material be added to the male complement of DNA or any other complement of DNA prior to its being affected by the female pronucleus.
  • the exogenous genetic material is added to the early male pronucleus, as soon as possible after the formation of the male pronucleus, which is when the male and female pronuclei are well separated and both are located close to the cell membrane.
  • the exogenous genetic material could be added to the nucleus of the sperm after it has been induced to undergo decondensation.
  • Sperm containing the exogenous genetic material can then be added to the ovum or the decondensed sperm could be added to the ovum with the transgene constructs being added as soon as possible thereafter.
  • transgene nucleotide sequence into the embryo may be accomplished by any means known in the art such as, for example, microinjection, electroporation, or lipofection.
  • the embryo may be incubated in vitro for varying amounts of time, or reimplanted into the surrogate host, or both. In vitro incubation to maturity is within the scope of this invention.
  • a zygote is essentially the formation of a diploid cell which is capable of developing into a complete organism.
  • the zygote will be comprised of an egg containing a nucleus formed, either naturally or artificially, by the fusion of two haploid nuclei from a gamete or gametes.
  • the gamete nuclei must be ones which are naturally compatible, i.e., ones which result in a viable zygote capable of undergoing differentiation and developing into a functioning organism.
  • a euploid zygote is preferred. If an aneuploid zygote is obtained, then the number of chromosomes should not vary by more than one with respect to the euploid number of the organism from which either gamete originated.
  • the biological limit of the number and variety of DNA sequences will vary depending upon the particular zygote and functions of the exogenous genetic material and will be readily apparent to one skilled in the art, because the genetic material, including the exogenous genetic material, of the resulting zygote must be biologically capable of initiating and maintaining the differentiation and development of the zygote into a functional organism.
  • the number of copies of the transgene constructs which are added to the zygote is dependent upon the total amount of exogenous genetic material added and will be the amount which enables the genetic transformation to occur. Theoretically only one copy is required; however, generally, numerous copies are utilized, for example, 1,000-20,000 copies of the transgene construct, in order to insure that one copy is functional. As regards the present invention, there will often be an advantage to having more than one functioning copy of each of the inserted exogenous DNA sequences to enhance the phenotypic expression of the exogenous DNA sequences.
  • exogenous genetic material is preferentially inserted into the nucleic genetic material by microinjection. Microinjection of cells and cellular structures is known and is used in the art.
  • Reimplantation is accomplished using standard methods. Usually, the surrogate host is anesthetized, and the embryos are inserted into the oviduct. The number of embryos implanted into a particular host will vary by species, but will usually be comparable to the number of off spring the species naturally produces.
  • Transgenic offspring of the surrogate host may be screened for the presence and/or expression of the transgene by any suitable method. Screening is often accomplished by Southern blot or Northern blot analysis, using a probe that is complementary to at least a portion of the transgene. Western blot analysis using an antibody against the protein encoded by the transgene may be employed as an alternative or additional method for screening for the presence of the transgene product.
  • DNA is prepared from tail tissue and analyzed by Southern analysis or PCR for the transgene.
  • the tissues or cells believed to express the transgene at the highest levels are tested for the presence and expression of the transgene using Southern analysis or PCR, although any tissues or cell types may be used for this analysis.
  • Alternative or additional methods for evaluating the presence of the transgene include, without limitation, suitable biochemical assays such as enzyme and/or immunological assays, histological stains for particular marker or enzyme activities, flow cytometric analysis, and the like. Analysis of the blood may also be useful to detect the presence of the transgene product in the blood, as well as to evaluate the effect of the transgene on the levels of various types of blood cells and other blood constituents.
  • suitable biochemical assays such as enzyme and/or immunological assays, histological stains for particular marker or enzyme activities, flow cytometric analysis, and the like.
  • Analysis of the blood may also be useful to detect the presence of the transgene product in the blood, as well as to evaluate the effect of the transgene on the levels of various types of blood cells and other blood constituents.
  • Progeny of the transgenic animals may be obtained by mating the transgenic animal with a suitable partner, or by in vitro fertilization of eggs and/or sperm obtained from the transgenic animal.
  • the partner may or may not be transgenic and/or a knockout; where it is transgenic, it may contain the same or a different transgene, or both.
  • the partner may be a parental line.
  • in vitro fertilization is used, the fertilized embryo may be implanted into a surrogate host or incubated in vitro, or both. Using either method, the progeny may be evaluated for the presence of the transgene using methods described above, or other appropriate methods.
  • the transgenic animals produced in accordance with the present invention will include exogenous genetic material.
  • the exogenous genetic material will, in certain embodiments, be a DNA sequence which results in the production of a RAFTK protein (either agonistic or antagonistic), and antisense transcript, or a RAFTK mutant.
  • the sequence will be attached to a transcriptional control element, e.g., a promoter, which preferably allows the expression of the transgene product in a specific type of cell.
  • Retroviral infection can also be used to introduce transgene into a non-human animal.
  • the developing non-human embryo can be cultured in vitro to the blastocyst stage.
  • the blastomeres can be targets for retroviral infection (Jaenich, R. (1976) PNAS 73, 1260-1264).
  • Efficient infection of the blastomeres is obtained by enzymatic treatment to remove the zona pellucida (Manipulating the Mouse Embryo, Hogan eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1986).
  • the viral vector system used to introduce the transgene is typically a replication-defective retrovirus carrying the transgene (Jahner et al.
  • the founder may contain various retroviral insertions of the transgene at different positions in the genome which generally will segregate in the offspring.
  • transgenes into the germ line by intrauterine retroviral infection of the midgestation embryo (Jahner et al. (1982) supra).
  • a third type of target cell for transgene introduction is the embryonal stem cell
  • ES cells are obtained from pre-implantation embryos cultured in vitro and fused with embryos (Evans et al. (1981) Nature 292, 154-156; Bradley et al. (1984) Nature 309, 255-258; Gossler et al. (1986) PNAS 83, 9065-9069; and Robertson et al. (1986) Nature 322, 445-448).
  • Transgenes can be efficiently introduced into the ES cells by DNA transfection or by retrovirus-mediated transduction.
  • Such transformed ES cells can thereafter be combined with blastocysts from a non-human animal. The ES cells thereafter colonize the embryo and contribute to the germ line of the resulting chimeric animal.
  • Jaenisch, R. (1988) Science 240, 1468-1474 For review see Jaenisch, R. (1988) Science 240, 1468-1474.
  • gene targeting which is a method of using homologous recombination to modify an animal's genome, can be used to introduce changes into cultured embryonic stem cells.
  • RAFTK gene of interest
  • ES cells By targeting a RAFTK gene of interest in ES cells, these changes can be introduced into the germlines of animals to generate chimeras.
  • the gene targeting procedure is accomplished by introducing into tissue culture cells a DNA targeting construct that includes a segment homologous to a target RAFTK locus, and which also includes an intended sequence modification to the RAFTK genomic sequence (e.g., insertion, deletion, point mutation). The treated cells are then screened for accurate targeting to identify and isolate those which have been properly targeted.
  • Gene targeting in embryonic stem cells is in fact a scheme contemplated by the present invention as a means for disrupting a RAFTK gene function through the use of a targeting transgene construct designed to undergo homologous recombination with one or more RAFTK genomic sequences.
  • the targeting construct can be arranged so that, upon recombination with an element of a RAFTK gene, a positive selection marker is inserted into (or replaces) coding sequences of the targeted siganlin gene.
  • the inserted sequence functionally disrupts the RAFTK gene, while also providing a positive selection trait.
  • Exemplary RAFTK targeting constructs are described in more detail below.
  • the embryonic stem cells (ES cells ) used to produce the knockout animals will be of the same species as the knockout animal to be generated.
  • mouse embryonic stem cells will usually be used for generation of knockout mice.
  • Embryonic stem cells are generated and maintained using methods well known to the skilled artisan such as those described by Doetschman et al. (1985) J. Embryol. Exp. Morphol. 87, 27-45). Any line of ES cells can be used, however, the line chosen is typically selected for the ability of the cells to integrate into and become part of the germ line of a developing embryo so as to create germ line transmission of the knockout construct. Thus, any ES cell line that is believed to have this capability is suitable for use herein.
  • One mouse strain that is typically used for production of ES cells is the 129J strain.
  • Another ES cell line is murine cell line D3 (American Type Culture Collection, catalog no.
  • Still another preferred ES cell line is the WW6 cell line (loffe et al. (1995) PNAS 92, 7357-7361 ).
  • the cells are cultured and prepared for knockout construct insertion using methods well known to the skilled artisan, such as those set forth by Robertson in: Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E.J. Robertson, ed. IRL Press, Washington, D.C. [1987]); by Bradley et al. (1986) Current Topics in Devel. Biol. 20, 357-371); and by Hogan et al. (Manipulating the Mouse Embryo: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY [1986]) .
  • Insertion of the knockout construct into the E.S cells can be accomplished using a variety of methods well known in the art including for example, electroporation, microinjection, and calcium phosphate treatment. A preferred method of insertion is electroporation .
  • Each knockout construct to be inserted into the cell must first be in the linear form. Therefore, if the knockout construct has been inserted into a vector (described infra), linearization is accomplished by digesting the DNA with a suitable restriction endonuclease selected to cut only within the vector sequence and not within the knockout construct sequence.
  • the knockout construct is added to the ES cells under appropriate conditions for the insertion method chosen, as is known to the skilled artisan. Where more than one construct is to be introduced into the ES cell, each knockout construct can be introduced simultaneously or one at a time.
  • the ES cells and knockout construct DNA are exposed to an electric pulse using an electroporation machine and following the manufacturer's guidelines for use. After electroporation, the ES cells are typically allowed to recover under suitable incubation conditions. The cells are then screened for the presence of the knockout construct.
  • the marker gene is an antibiotic resistance gene
  • the ES cells may be cultured in the presence of an otherwise lethal concentration of antibiotic. Those ES cells that survive have presumably integrated the knockout construct.
  • the marker gene is other than an antibiotic resistance gene
  • a Southern blot of the ES cell genomic DNA can be probed with a sequence of DNA designed to hybridize only to the marker sequence Alternatively, PCR can be used.
  • the marker gene is a gene that encodes an enzyme whose activity can be detected (e.g., b-galactosidase)
  • the enzyme substrate can be added to the cells under suitable conditions, and the enzymatic activity can be analyzed.
  • the knockout construct may integrate into several locations in the ES cell genome, and may integrate into a different location in each ES cell's genome due to the occurrence of random insertion events.
  • the desired location of insertion is in a complementary position to the DNA sequence to be knocked out, e.g., the RAFTK coding sequence, transcriptional regulatory sequence, etc.
  • total DNA can be extracted from the ES cells using standard methods.
  • the DNA can then be probed on a Southern blot with a probe or probes designed to hybridize in a specific pattern to genomic DNA digested with particular restriction enzyme(s).
  • the genomic DNA can be amplified by PCR with probes specifically designed to amplify DNA fragments of a particular size and sequence (i.e., only those cells containing the knockout construct in the proper position will generate DNA fragments of the proper size).
  • the cells can be inserted into an embryo. Insertion may be accomplished in a variety of ways known to the skilled artisan, however a preferred method is by microinjection. For microinjection, about 10-30 cells are collected into a micropipet and injected into embryos that are at the proper stage of development to permit integration of the foreign ES cell containing the knockout construct into the developing embryo. For instance, as the appended Examples describe, the transformed ES cells can be microinjected into blastocytes.
  • the suitable stage of development for the embryo used for insertion of ES cells is very species dependent, however for mice it is about 3.5 days.
  • the embryos are obtained by perfusing the uterus of pregnant females. Suitable methods for accomplishing this are known to the skilled artisan, and are set forth by, e.g., Bradley et al. (supra).
  • preferred embryos are male.
  • the preferred embryos also have genes coding for a coat color that is different from the coat color encoded by the ES cell genes.
  • the offspring can be screened easily for the presence of the knockout construct by looking for mosaic coat color (indicating that the ES cell was inco ⁇ orated into the developing embryo).
  • the embryo selected will carry genes for black or brown fur.
  • the embryo may be implanted into the uterus of a pseudopregnant foster mother for gestation. While any foster mother may be used, the foster mother is typically selected for her ability to breed and reproduce well, and for her ability to care for the young. Such foster mothers are typically prepared by mating with vasectomized males of the same species.
  • the stage of the pseudopregnant foster mother is important for successful implantation, and it is species dependent. For mice, this stage is about 2-3 days pseudopregnant.
  • Offspring that are born to the foster mother may be screened initially for mosaic coat color where the coat color selection strategy (as described above, and in the appended examples) has been employed.
  • DNA from tail tissue of the offspring may be screened for the presence of the knockout construct using Southern blots and/or PCR as described above. Offspring that appear to be mosaics may then be crossed to each other, if they are believed to carry the knockout construct in their germ line, in order to generate homozygous knockout animals. Homozygotes may be identified by Southern blotting of equivalent amounts of genomic DNA from mice that are the product of this cross, as well as mice that are known heterozygotes and wild type mice. Other means of identifying and characterizing the knockout offspring are available. For example, Northern blots can be used to probe the mRNA for the presence or absence of transcripts encoding either the gene knocked out, the marker gene, or both.
  • Western blots can be used to assess the level of expression of the RAFTK gene knocked out in various tissues of the offspring by probing the Western blot with an antibody against the particular RAFTK protein, or an antibody against the marker gene product, where this gene is expressed.
  • in situ analysis such as fixing the cells and labeling with antibody
  • FACS fluorescence activated cell sorting
  • knock-out or disruption transgenic animals are also generally known. See, for example, Manipulating the Mouse Embryo (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986).
  • Recombinase dependent knockouts can also be generated, e.g. by homologous recombination to insert target sequences, such that tissue specific and/or temporal control of inactivation of a RAFTK-gene can be controlled by recombinase sequences (described infra).
  • Animals containing more than one knockout construct and/or more than one transgene expression construct are prepared in any of several ways.
  • the preferred manner of preparation is to generate a series of mammals, each containing one of the desired transgenic phenotypes. Such animals are bred together through a series of crosses, backcrosses and selections, to ultimately generate a single animal containing all desired knockout constructs and/or expression constructs, where the animal is otherwise congenic (genetically identical) to the wild type except for the presence of the knockout construct(s) and/or transgene(s) .
  • RAFTIC Adhesion Focal Tyrosine Kinase
  • RAFTK for a related adhesion focal tyrosine kinase
  • the murine homolog of the human RAFTK cDNA was also cloned and characterized. Comparison of the deduced amino acid sequences of human and murine RAFTK cDNAs revealed 95% homology, indicating that RAFTK is highly conserved between these species.
  • RAFTK cDNA clone encoding a polypeptide of 1009 amino acids, has closest homology (48% identity, 65% similarity) to the focal adhesion kinase ( HS ⁇ A Comparison of the deduced amino acid sequences also indicates that RAFTK like ppl25 ⁇ AK lacks a transmembrane region, myristylation sites and SH2 and SH3 domains. In addition, like ppl25 ⁇ , RAFTK contains a kinase domain flanked by large N-terminal (426 residues) and C-terminal (331 residues) domains, and the C-terminal region contains a predicted proline-rich stretch of residues.
  • RAFTK expression was abundant in brain and low levels were observed in lung and liver. In adult tissues, it was less restricted indicating that RAFTK expression is developmentally upregulated. Expression of RAFTK was also observed in human CD34 + marrow cells, primary bone marrow megakaryocytes, platelets and various areas of brain.
  • the human RAFTK gene was assigned to human Chromosome 8 using genomic DNAs from human/rodent somatic cell hybrid lines. The mouse RAFTK gene was mapped to Chromosome 14 closely linked to gonadotropin releasing hormone. Using specific antibodies for RAFTK, an approximately 123 Kd protein from the human CMK megakaryocyte cell line was immunoprecipitated.
  • RAFTK RAFTK protein
  • the structural features of RAFTK suggest that it is a member of the focal adhesion kinase gene family and may participate in signal transduction in human megakaryocytes and brain as well as other cell types.
  • the predicted amino acid sequence of the RAFTK protein shares consensus motifs in the central catalytic domain common to protein tyrosine kinases.
  • the RAFTK cDNA encoding a polypeptide of 1009 amino acids, has the closest homology (48% identity, 65% similarity) to FAK. Analysis of their deduced amino acid sequences also indicates that RAFTK, like FAK, lacks a transmembrane region, myristylation sites, and SH2 and SH3 domains.
  • the RAFTK C- terminal domain contains a predicted proline-rich stretch of residues. RAFTK was reported to be highly expressed in the central nervous system (Avraham, S. et al. (1995) J. Biol. Chem.
  • RAFTK expression is abundant in primary bone marrow megakaryocytes and their progeny, blood platelets (Avraham, S. et al. (1995) J Biol. Chem. 270, 1-10).
  • experiments were performed using the model CMK megakaryocytic cell line (Sakaguchi, M. et al. (1991) Blood 77, 481-485).
  • the c-kit receptor and its cognate ligand SCF were investigated since they play a critical role in the adhesion, migration, motility, proliferation and maturation of a number of hematopoietic cells, including megakaryocytes and platelets (See, e.g., Dastych, j. and Metcalfe, D. D. (1994) J. Immunol. 152, 213-219; Kinashi, T. et al. (1995) Blood 86, 2086-2090; Scott, G. et al. (1994) Pigment Cell Res. 7, 44-51). Since SCF effects appear to be modulated by PKC (Blume-Jensen, P. et al.
  • PCR polymerase chain reaction
  • RNA-PCR RNA-PCR
  • sequencing were synthesized by an automated DNA synthesizer (Applied Biosystems, model 394).
  • the PCR and RNA-PCR reagents were obtained from Perkin-Elmer Cetus (Norwalk, CT) and random primed labeling kits were obtained from Stratagene (La Jolla, CA).
  • Human marrow megakaryocytes were isolated by a method employing immunomagnetic beads using anti-human glycoprotein GpIIIa monoclonal antibody, as previously described (Tanaka, H. et al. (1989) Br. J. Haematol. 73, 18-22; Avraham, H. et al. (1992) Blood 80, 1679-1684).
  • CD34 bearing marrow progenitor cells were purified from heparinized bone marrow aspirates using immunomagnetic beads coated with an anti-CD34 monoclonal antibody as previously described (Avraham, H. et al. (1992) Blood 80, 1679-1684).
  • the CMK cell line provided by Dr. T.
  • CMK cell lineage was cultured in RPMI 1640 medium with 10% fetal calf serum. Additional permanent human megakaryocytic cell lines were studied.
  • DAMI cells were obtained from Dr. S. Greenberg, (Brigham and Women's Hospital, Boston, MA), Mo7e and erythroid-megakaryocytic HEL cells were obtained from Dr. L. Zon, (Children's Hospital, Boston, MA).
  • Each cell line was cultured as previously described (Avraham, H. et al. (1992) Blood 80, 1679-1684; Avraham, H. et al. (1992) Blood l9, 365-371 ; Avraham, H. et al. (1992) Int. J. Cell Cloning 10, 70-75).
  • Other permanent human cell lines such as Ramos (human B-cells) were obtained from the American Type Tissue Culture Collection and maintained in liquid culture according to the specifications in the catalog.
  • Human platelets were isolated by gel filtration from freshly drawn blood anticoagulated with 0.15 vol NIH formula A acid-citrate-dcxtrose solution supplemented with 1 ⁇ M prostaglandin E, (PGE,) as previously described (Lipfert, L. et al. ( 1992) J. Cell Biol. 1 19, 905-912).
  • PGE prostaglandin E
  • RNA derived from CMK cells was prepared by a standard protocol of lysis in guanidinium isothiocyanate followed by cesium chloride gradient centrifugation (Maniatis, T. et al. (1992) Molecular Cloning, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY). Protein-tyrosine kinase sequences were amplified with degenerate oligonucleotide primers as previously described (Wilks, A.F. (1989) Proc. Natl. Acad. Sci. USA 86, 1603-1607).
  • RNA (10 ⁇ g) was used as a template for synthesis of complementary DNA (cDNA).
  • the PTK3 oligonucleotide "SDVWSF/YG” (SEQ ID NO:5) 5'- (C/G)(T/A)(A/G)TC(A/C/G/T)ACCCA(A C/G/T)(C/G)(T/A)(A/G)(T/A)A (A/C/G/T)CC - 3' (SEQ ID NO:6) was designed in our lab and was used as a primer.
  • PCR was performed on one quarter of the cDNA synthesis reaction mixture (original volume-20 ⁇ l), using PTK1 "DLAARN” (SEQ ID NO:7) 5'- CGACGA(T/C)CT(A/C/G/T)GC(A/C/G/T) (A/G)C(A/C/G/T)AA - 3 * (SEQ ID NO:8) and PTK2 "WMAPE” (SEQ ID NO:9) 5' -
  • PCR products of the amplified tyrosine kinase domains were purified from the agarose gel, digested with EcoRI and BamHI, ligated into pUC19, and transformed into Escherichia coli DH5 ⁇ . Sequencing was carried out by the dideoxy chain termination method using version 2.0 sequenase kit (USB, Cleveland, OH). Sequences were compared with known sequences in GenBank and EMBL data bases using the Autosearch computer program. A novel clone was identified. This 160-base pair (bp) PCR product, designated JJ3, was radiolabeled using the "Prime It II" random priming protocol (Stratagene) and used as a probe to screen human cDNA libraries.
  • Hybridization to nylon filters was performed in 50% formamide, 6 x SSC, 10 mM sodium phosphate, 5 x Denhardt's solution, 0.1% sodium dodecyl sulfate (SDS), and 1 mg/ml Herring sperm DNA (Boehringer Mannheim, Germany) at 43°C overnight.
  • the filters were washed at room temperature in 2 x SSC, 1% SDS, and then in 0.2 x SSC, 0.1% SDS at 63°C three times for 30 min., UV crosslinked (Stratagene Stratal inker), and exposed to Kodak X-OMAT AR film (Eastman Kodak). Twelve clones were isolated and processed.
  • Plasmid DNA was prepared using Exassist Helper Phage and the SolR System according to the manufacturer's instructions (Stratagene). Of these twelve clones, two were sequenced on both strands. A human CMK-PMA cDNA library oligo dT (Avraham, H. et al. (1992) Blood 79, 365-371) ( ⁇ 3 x 10 5 recombinants/screening) in ⁇ -gtl 0 vector was screened with the -- ⁇ P-labeled JJ3 fragment. Four clones were isolated and the recombinant DNAs of 2 positive phages were digested with EcoRI, and the cDNA insert was subcloned into pBSK (Stratagene) and thereafter sequenced.
  • a 340 bp probe was prepared from the 5'- end of one of the CMK cDNA clones (termed 2-1) and used to screen the human brain (hippocampus) cDNA library. Twelve clones were isolated and two clones were sequenced on both strands. In addition, a 248 bp probe was prepared from the 5'- end of one of the clones (termed 4C) and the human hippocampus cDNA library was rescreened. Twelve clones were identified and isolated and of these, 1 clone (termed 3B) was sequenced on both strands.
  • the mouse brain cDNA library (cat # ML 1042b, Clontech, Palo Alto, CA) in ⁇ -gtl 1 vector was screened ( ⁇ 5 x 10 * ⁇ recombinants/screening) using 381 bp 5'- Kpn I fragment or 764 bp Apal -3'- fragment of human RAFTK cDNA as a probe and the filters were hybridized and washed under high stringency conditions. Six clones were isolated. The DNA was isolated as previously described (Maniatis, T. et al. (1992) Molecular Cloning, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) and subcloned into pBSK and thereafter sequenced. Nucleotide sequences were determined by the Automated Laser Fluorescent
  • Genomic DNAs from the NIGMS Hybrid Mapping Panels #1 and #2 were obtained from the NIGMS Genetic Mutant Cell Repository (Coriel Cell Institute for Medical Research, Camden, NJ).
  • both mapping panels included DNA samples isolated from human and rodent parental cell lines (mouse and Chinese hamster). Approximately 5 ⁇ g of DNA from human, hamster, and mouse genomic DNAs were digested with BamHI, Hindlll and Pstl to find a suitable restriction fragment length polymo ⁇ hism (RFLP) or unique genomic fragment for use in mapping. Subsequently, genomic DNAs from each panel were cut with BamHI.
  • Southern blots were probed with a human 1.4 kb RAFTK cDNA and hybridizations were carried out as previously described (Rowe, L.B. et al. (1994) Mamm. Genome 5, 253-274; White, R.A. et al. (1992) Nature Genet. 2, 80-83). Hybrids were scored for the appropriate human-specific restriction endonuclease fragment on the autoradiographs. The results were compared with the chromosome contents of the hybrid cell lines and the concordance between restriction fragments and specific chromosome content was used to establish the localization of human RAFTK.
  • Genomic DNAs from C57BL/6J, Mus spretus and a (M. spretus x C57BL/6J) M. spretus BSS type backcross DNA panel were obtained from The Jackson Laboratory (Bar Harbor, Maine) (Rowe, L.B. et al. (1994) Mamm. Genome 5, 253- 274). Southern blots and hybridizations were performed as previously described
  • RAFTK and Gnrh co-segregated in BXD RI lines and mapped to chromosome 14.
  • Genomic DNAs isolated from the progenitors of BXD RI lines C57BL/6J and DBA/2J were digested with 29 different restriction enzymes to identify a RFLP genetic marker for mapping.
  • genomic DNAs isolated from the BXD RI lines were digested with Sad.
  • Conditions for Southern blots and hybridizations were the same as previously described (White, R.A. et al. (1992) Nature Genet. 2, 80-83) and the 1.4 kb human RAFTK cDNA was used as a probe.
  • Data were compared with strain distribution patterns (SPDs) recorded in GBASE (1993) (Yang-Feng, T.L. et al. (1986) Somatic Cell. Mol. Genet. 12, 95-100).
  • the human adult and fetal tissue Northern blots, the brain regions and the human tissue II blots were obtained from Clontech (Palo Alto, CA). Hybridization was carried out according to the manufacturer's instructions.
  • Each RNA blot was probed with a 146 bp, 3'- gene-specific RAFTK cDNA radiolabeled to a high specific activity (10 - 10 ⁇ cpm/ ⁇ g) with [ ⁇ - P]dCTP.
  • the level of expression for each mRNA was also determined densitometrically (EC Apparatus Co ⁇ . Densitometer; St. Russia, FL). The radioactivity associated with each band was also assayed with a Betascope 603 blot analyzer (Betagen, Mountain View, CA). The same blot was assessed for the presence of the actin or GAPDH specific probes; Actin and GAPDF1 were used as controls to assure uniform loading.
  • PCR blots cDNA was prepared from platelets (10 x 10°), CD34 + marrow cells (10° cells) and bone marrow megakaryocytes (10" cells) and amplified by PCR using specific RAFTK primers as previously described (Bennett, B.D. et al. (1994) J. Biol. Chem. 269, 1068-1074).
  • the sequence of the RAFTK upstream primer was 5'- CGGGCCGTGCTGGAGCTCAA - 3' (SEQ ID NO:l l)(position 2958 - 2977).
  • the nucleotide sequence of the RAFTK downstream primer was 5'- GTCCGTGAAGATGACGGCAA - 3' (SEQ ID NO: 12) (position 3084 - 3103).
  • the sequence of the FAK upstream primer was 5'- AAAGCTGTCATCGAGATGTCC -3' (SEQ ID NO: 13) (position 2292-2312).
  • the nucleotide sequence of the downstream primer was 5'- TCGGTGGGTGCTGGCTGGTAGG - 3' (SEQ ID NO: 14) (position 2417-2438)( Andre, E., and Becker- Andre, M. (1993) Biochem. Biophys. Res. Commun. 190, 140-147).
  • the sequence of the actin upstream primer was 5'- ATCTGGCACCACACCTTCTACAATGAGCTGCG - 3' (SEQ ID NO: 15).
  • the nucleotide sequence of the downstream primer was 5'-
  • CGTCATACTCCTGCTTGCTGATCCACATCTGC -3' (SEQ ID NO: 16) (Clontech, Palo Alto, CA).
  • the PCR products were electrophoresed on a 1.5% agarose gel, denatured, neutralized, transferred to filters, and vacuum blotted.
  • the probes used were the RAFTK, FAK and actin gene-specific probes, which were labeled by random priming as described above. Prehybridization and hybridization were carried out as previously described (Bennett, B.D. et al. (1994) J. Biol. Chem. 269, 1068-1074).
  • CMK cells Metabolic labeling, immunoprecipitation, and Western blot analysis were performed in CMK cells as previously described (Laemmli, U.K. (1970) Nature 227, 680-685; Yarden, Y et al. (1987) EMBOJ. 6, 3341 -3351 ; Konopka, J. B., and Witte, O.N. (1985) Mol. Cell Biol. 5, 31 16-3123; Konopka, J. B. et al. (1984) J. Virol. 51 , 223-232).
  • CMK cells untreated or stimulated with ⁇ -thrombin (1 U/ml or 2 U/ml as indicated)(ChromoLog Co ⁇ ., Havertown, PA) for 5 min were prepared as previously described (Yarden, Y et al. (1987) EMBOJ. 6, 3341-3351). Relative protein concentrations were determined with a colorimetric assay kit (Bio-Rad Laboratories, Inc., Hercules, CA) with bovine serum albumin as the standard.
  • lysate containing approximately 0.05 mg of protein was mixed with an equal volume of 2 x SDS sample buffer containing ⁇ - mercaptoethanol, boiled for 5 min., fractionated on 8% polyacrylamide-SDS gels (Laemmli, U.K. (1970) Nature 227, 680-685) and transferred to Immobilon polyvinylidene difluoride (Millipore Co ⁇ ., Bedford, MA) filters. Protein blots were treated with specific RAFTK antibodies (R-4250) (see below).
  • RAFTK antibodies Primary binding of the RAFTK antibodies (see below) was detected using anti-IgG second antibodies conjugated to horseradish peroxidase and subsequent chemiluminescence development using the ECL Western blotting system (Amersham Life Sciences, Arlington Heights, IL).
  • RAFTK protein For metabolic labeling, 10" cells were labeled with 100 ⁇ Ci of [- ⁇ S] methionine in 1 ml of Dulbecco's modified Eagle's medium minus methionine (Amersham Life Sciences) for 16 h. Immunoprecipitation of RAFTK protein from labeled cells with RAFTK antiserum or with normal rabbit serum (NRS) was performed as previously described (Bennett, B.D. et al. (1994) J. Biol. Chem. 269, 1068-1074; Yarden, Y et al. (1987) EMBOJ. 6, 3341-3351).
  • An -RAFTK antiserum was obtained from New Zealand white rabbits immunized with a bacterially expressed fusion protein consisting of the GST-C- terminal (681-1009 amino acid residues) of human RAFTK cDNA subcloned into the pGEX-2T expression vector.
  • the sera were titered against the GST-RAFTK C- terminus fusion protein by ELISA (Dymecki, S. M. et al. ( 1992) J. Biol. Chem. 267, 4815-4823; Bennett, B.D. et al. (1991 ) J. Biol. Chem. 266, 23060-23067) and the serum (R-4250) exhibiting the highest titer (1 :256,000) was used in subsequent experiments.
  • PCR primers based on conserved sequences of PTKs were used (Wilks, A.F. (1989) Proc. Natl. Acad. Sci. USA 86, 1603-1607).
  • RNA from the human megakaryocytic CMK cell line was used as a template to synthesize CMK cDNA.
  • the cDNA was amplified by using the PTK primers. Fragments of the expected size (-160 bp) were isolated and subcloned for sequence analysis.
  • JJ3 One clone that appeared to represent a novel tyrosine kinase was used as a probe to screen the human hippocampus cDNA library.
  • S2-3) A partial cDNA clone containing an ⁇ 2.0 kb insert was isolated.
  • a homology analysis of this clone to human ppl25 ⁇ was performed and regions were chosen to design specific primers to generate an RAFTK gene-specific probe.
  • the JJ3 fragment was used to screen the human hippocampus cDNA library to obtain overlapping cDNAs.
  • the 5'- end of each of these clones was in turn used as probes to obtain the full-length RAFTK cDNA.
  • Eight different overlapping sequences were obtained of the coding region of RAFTK.
  • Figure 1 is a schematic representation along with a restriction map of the sequence showing the pattern of overlapping cDNAs.
  • the 3.6 kb length of the RAFTK cDNA contains an open reading frame with the first in frame ATG codon located at nucleotide 294-296, followed by a stop codon at position 3260-3262.
  • This open reading frame encodes a predicted protein of 1009 amino acid residues with a calculated molecular weight of -123 Kd and has been given the name RAFTK (for a related adhesion focal tyrosine kinase). Analysis of the hydrophobicity of the predicted protein revealed lack of a transmembrane region and no recognizable sites for acylation.
  • the kinase domain is flanked by large N-terminal (426 residues) and C-terminal (331 residues) domains.
  • the predicted amino acid sequence of ppl20 * ⁇ ' ⁇ contains the structural motifs common to all protein kinases, including the putative ATP-binding site (432-437a.a, Gly 43 ⁇ - Xaa - Gly 434 - Xaa - Xaa - Gly 437 ), and three residues that are predicted to interact with the ⁇ - phosphate group of the bound ATP molecule (in positions 402a.a, 529a. a and 655a.a).
  • RAFTK contains two peptide sequences that are highly conserved among PTKs (Asp 549 - He 550 - Ala 551 - Val 552 - Arg 553 - Asn 554 and Pro 588 - He 589 - Lys 590 .
  • X 591 . M e t592 * interestingly, like chicken ppl25 FAK *, the C-terminal region of RAFTK contains a proline-rich stretch (residues 690-767) where the proline content exceeds 20%.
  • a unique domain is found at the NH terminus of RAFTK (amino acids 1-39) ( Figure 3).
  • RAFTK does not contain SH2 or SH3 domains.
  • the kinase domain (amino acid 427 - 679) of RAFTK shares 60% identical homology with the mouse ppl25 ⁇ * ⁇ , 54% with human ppl25 ⁇ * ⁇ , and 36% with src ( Figure 2).
  • the kinase domain consists primarily of the catalytic domain including the putative ATP binding site (amino acids 432 - 437).
  • RAFTK shares 42% homology in the NH 2 domain and about 39% in the C-terminal domain with mouse ppl25 * FA T e overall amino acid homology of RAFTK is 48% identity (65% similarity) with mouse ppl25 FAK .
  • the 4.5 kb full length cDN A has an open reading frame of 1009 amino acid residues and possesses 95.6% identical homology with the human RAFTK gene.
  • hybrid cell line #20 (Fig. 4) which, although it contained an intact human Chromosome #20, also carried a gene from human Chromosome #8 (NEFL, neurofilament light polypeptide, 8p21) as determined by Southern blot hybridization (Coriel Cell Institute for Medical Research, Camden, NJ). All other hybrid cell lines were negative for the human-specific BamHI RFLP. Additionally, when the human 1.4 kb RAFTK cDNA was used to probe Coriel Panel #1, the human-specific fragment was detected in all hybrids containing greater than 4% of human Chromosome 8 and was absent in every hybrid that lacked Chromosome 8.
  • results of the haplotype analysis from this mapping data indicate that the RAFTK gene co-localizes with D14Birl0 (DNA segment-Birkenmeier 10) and is linked to Nfl (neurofilament, light polypeptide) on mouse Chromosome 14 ( Figure 5).
  • the RAFTK locus mapped between Xmvl 9 (xenotropic-MCF leukemia virus- 19) and Nfl and the calculated map distances for these loci are: Xmvl 9, 7.1 ⁇ 5.3 cM, RAFTK, 3.5 ⁇ 2.0 cM, Nfl.
  • the position of RAFTK on mouse Chromosome 14 was confirmed by determining the segregation of a Sad RFLP for RAFTK DNAs from BXD recombinant inbred (RI) lines.
  • the Sad RFLP for RAFTK was indicated by the presence of a 16.5 kb genomic DNA band in C57BL/6J or a 6.2 kb fragment in DBA/2J. These alleles were characterized for 26 DNAs from the BXD RI line.
  • the strain distribution patterns of RAFTK and the locus coding for gonadotropin releasing hormone, Gnrh (Hearne, CM. et al. (1991) M ⁇ mm. Genome 1 , 273-282), indicate close linkage between these two loci on Chromosome 14.
  • RAFTK probe was designed (nucleotide 2958 bp - 3103 bp). This sequence is present in RAFTK and not in human ppl25* A . This probe was used for hybridization of all Northern blots described here.
  • RNA from human fetal heart, brain, lung, liver and kidney revealed a weak single major species of mRNA of 4.5 kb in brain and it appears to be expressed at low levels in the lung and liver. Expression in human adult tissues was assessed by hybridization of the cDNA probe to a Northern blot of poly (A + ) RNA from heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas. While heart and skeletal muscle RNA samples were negative for RAFTK, a single mRNA was observed in all other tissues with the highest levels expressed in brain.
  • Northern blot analysis of spleen, thymus, prostate, testes, ovary, intestine, colon and peripheral blood leukocytes revealed high expression of RAFTK in thymus, spleen and peripheral blood leukocytes.
  • Northern blot analysis of different human brain regions revealed that the highest expression of RAFTK was in amygdala and hippocampus.
  • the level of expression of RAFTK mRNA is similar to FAK in CD34 + cells, and is higher than FAK in bone marrow megakaryocytes. In platelets, the level of expression of RAFTK mRNA is lower than FAK, as observed by PCR under the same experimental conditions. RAFTK mRNA expression in bone marrow megakaryocytes is higher than that in CD34 + cells. Taken together, these results demonstrate that RAFTK is abundantly expressed in brain and hematopoietic cells. The restricted expression observed in fetal versus adult tissues indicates its expression is upregulated during development.
  • the fusion protein GST-C-terminus of RAFTK (residues 681 -1009) was chosen for rabbit immunizations in order to obtain specific antibodies for RAFTK protein.
  • These polyclonal antibodies (R-4250) do not cross react with ppl25 ⁇ ** ⁇ .
  • the monoclonal antibody 2A7 against FAK does not cross react with the C-terminal GST-RAFTK fusion protein, indicating that RAFTK might be antigenically different from FAK.
  • FAK immunoprecipitated by the monoclonal antibody 2A7 from megakaryocytes was not recognized by polyclonal antiserum 4250.
  • RAFTK immunoprecipitated by antiserum 4250 also was not recognized by the monoclonal antibody 2A7.
  • CMK cell line was metabolically labeled with [ S] methionine, and extracts were immunoprecipitated with an -RAFTK antiserum.
  • a major protein species of -123 Kd was detected in CMK cells.
  • a similar species was observed in other human megakaryocytic cell lines such as DAMI. This band was not observed when normal rabbit serum or pre-immune rabbit serum was used for immunoprecipitation.
  • RAFTK intracytoplasmic tyrosine kinase in human megakaryocytic cells. Sequence analysis of RAFTK revealed -48% identity (65% similarity) to ppl25 ⁇ ** * suggesting that RAFTK belongs to this subfamily of cytoplas ic tyrosine kinases. RAFTK does not appear to be the recently described FAKB protein (Kanner, S.B. et al. (1994) Proc. Natl. Acad. Sci.
  • RAFTK protein did not form stable complexes with the TCR/CD3 linked tyrosine kinase ZAP 70 in T-cells indicating that RAFTK and FAKB are different proteins.
  • RAFTK RAFTK
  • the deduced 1009 amino acid sequence of RAFTK contains a kinase domain and lacks a transmembrane region, myristylation sites, and SH2 and SH3 domains.
  • the murine homolog of the human RAFTK cDNA was cloned.
  • the sequence identity between the human and murine RAFTK cDN As is 90% at the nucleotide level and 95.6% at the predicted amino acid level. In the kinase domain, 98.5% of the amino acids are identical.
  • the RAFTK gene is highly conserved in human and rodent, again suggesting an important role in cell signalling functions.
  • the RAFTK has an insertion of an additional 4 amino acids between 76-81 (G'"R 7 'I ' 8 G'")compared to chicken, murine, and human ppl25 * ⁇ A ⁇ * sequences (Schaller, M.D. et al. (1992) Proc. Natl. Acad. Sci. USA 89, 5192-5196; Schaller, M.D., and Parsons, J.T. (1993) Trends Cell Biol. 3, 258-262; Clark, E.A., and Brugge, J.S. (1995) Science 268, 233-239).
  • proteins containing proline-rich peptide motifs could serve as SH3 domain ligands, and that the binding of these proteins to the Src SH3 domain was inhibited with a proline-rich peptide ligand (Weng, Z. et al. (1994) Mol. Cell. Biol. 14, 4509-4521).
  • the predicted RAFTK protein like the ppl25 FA ⁇ protein, displays several unique features among the known tyrosine kinases. The primary sequence of RAFTK does not contain a signal peptide or a membrane-spanning region and the protein is therefore presumed to be located in the cytoplasm.
  • RAFTK lacks SH2 and SH3 domains, which are structural elements involved in protein-protein interactions (Pawson, T., and Gish, G.D. (1992) Cell 71 , 359-362; Konopka. J. B. et al. (1984) J. Virol. 51, 223-232; Waksman, G. et al. (1992) Nature 358, 646-653; Taylor, S.J., and Shalloway, D. (1993) Current Opin. Genet. & Dev. 3, 26-34; Yu, H. et al. (1992) Science 258, 1665-1668), and does not exhibit significant homology with any known PTK beyond ppl25 A* ⁇ outside of the catalytic domain.
  • RAFTK specific mRNA expression was observed in human fetal tissues most abundant in brain (predominantly in amygdala and hippocampus regions) and appeared to be developmentally upregulated as demonstrated in the pattern of adult tissue expression.
  • a high level of specific mRNA expression of RAFTK was detected in B- cells and various megakaryocytic cell lines.
  • the specific mRNA expression of RAFTK was also detected in primary bone marrow CD34 + progenitor cells, primary bone marrow megakaryocytes and platelets.
  • RAFTK is phosphorylated after thrombin treatment of CMK cells.
  • FAK protein was also found phosphorylated on tyrosine after thrombin or collagen treatment of platelets (Lipfert, L. et al. (1992) J. Cell Biol. 1 19, 905-912).
  • thrombin receptors There is considerable homology in the thrombin receptors and considerable signal similarities in transduction mechanisms between platelets and megakaryocytes (Vittet, D., and Chevillard, C. (1993) Blood Coagulation & Fibrinolysis 4, 759-768).
  • the human RAFTK gene was found on Chromosome 8 using DNAs from the somatic cell hybrid lines.
  • the signal observed in cell line #20 in mapping panel #2 suggested that a fragment of Chromosome 8 is in the Chromosome #20 cell line.
  • cell line #20 contained the human NEFL gene, there was no evidence for Chromosome 20 or a fragment of Chromosome 20 in cell line #8 (Coriel Cell Institute for Medical Research, Camden, NJ).
  • the localization of RAFTK to Chromosome 8 was confirmed using mapping panel #1.
  • the human NEFL gene has been localized to Chromosome 8p21 (Hurst, J. et al. (1987) Cytogenet. Cell Genet. 45, 30-32).
  • Nfl the murine homolog of human NEFL
  • Nfl the murine homolog of human NEFL
  • Nfl the murine homolog of human NEFL
  • the close linkage of the mouse RAFTK gene to Nfl suggested that the human RAFTK gene may be mapped to Chromosome 8 based on homology between human and mouse chromosomes (Hurst, J. et al. (1987) Cytogenet. Cell Genet. 45, 30-32). Therefore, the human RAFTK gene is localized to Chromosome 8p21.
  • the mouse RAFTK gene has been mapped to Chromosome 14 using a (C57BL/6J) x M.
  • RAFTK appears to be a member of the Focal Adhesion Kinase (FAK) family, and is involved in Ca 2+ -mediated signalling events in PC-12 cells.
  • FAM Focal Adhesion Kinase
  • PMA Phorbol Myristate Acetate
  • PKC Protein Kinase C
  • RAFTK is a down-stream signalling protein of PKC and that paxillin is a down-stream associated protein of RAFTK. Furthermore, RAFTK association with the cytoskeleton was critical for its phosphorylation. These observations show the manner in which RAFTK participates in megakaryocyte proliferation and differentiation.
  • Recombinant SCF/KL and polyclonal anti-c-kit antibodies were generously provided by Dr. Keith E. Langley and Dr. L. Bennett, Amgen Inc. (Thousand Oaks, CA).
  • Monoclonal anti-phosphotyrosine antibody (PY-20) and monoclonal anti- paxillin were obtained from ICN (Costa Mesa, CA ); monoclonal antibodies anti-p85, anti-She, anti-Grb2, anti-FAK, anti-PKC- , anti-PKC- ⁇ , and anti-PKC- ⁇ were obtained from Transduction Laboratories (Lexington, KY).
  • Calphostin C, staurosporine, calcium ionophore A23187, EGTA and Phorbol 12-Myristate 13- Acetate (PMA) were obtained from Calbiochem (La Jolla, CA ). Electrophoresis reagents were obtained from Bio-Rad Laboratories (Hercules, CA). All other reagents were purchased from Sigma Co. (St. Louis, MO). CMK cells
  • CMK cell line The CMK cell line, provided by Dr. T. Sato (Chiba University, Japan), was maintained in RPMI 1640 with 10% fetal calf serum (FCS) as described previously (Sato, T. et al. (1989) Br. J. Hematol. 72, 184-190).
  • FCS fetal calf serum
  • the CMK cell line was derived from a child with megakaryoblastic leukemia and has properties of cells of the megakaryocytic lineage, including the surface expression of glycoproteins lb and Ilb/IIIa, synthesis of platelet factor 4, PDGF and von Willebrand factor.
  • CMK cells can proliferate in response to cytokines and have been used by us and other investigators in studies of megakaryocyte growth and maturation.
  • CMK cells also differentiate upon induction with PMA (Sakaguchi, M. et al. (1991 ) Blood 11, 481-485; Cowley, S. A. et al. (1992) Int. J. Cell Cloning 10, 223-231 ; Avraham, H. et al. (1992) Int. J. Cell Cloning 10, 70-79; Namciu, S. et al. (1994) Oncogen 9, 1407-1416).
  • PMA was dissolved in dimethyl sulfoxide and stored at -20°C until use, when it was diluted in RPMI 1640 medium.
  • Anti -RAFTK antiserum was obtained from New Zealand White rabbits immunized with a bacterially expressed fusion protein consisting of GST and the C- terminus (amino acids 681-1009) of human RAFTK cDNA subcloned into the pGEX- 2T expression vector as described (Avraham, S. et al. (1995)J. Biol. Chem. 270, 1- 10).
  • the sera were titered against the GST-RAFTK C-terminus fusion protein by an enzyme-linked immunosorbent assay, and the serum (R-4250) exhibiting the highest titer (1 :256,000) was used in subsequent experiments.
  • anti-phosphotyrosine antibodies were used (PY20) or an ⁇ -RAFTK (1 :1000) or antibodies for FAK-2A7 (1 : 1000).
  • CMK cells were starved overnight in RPMI- 1640 with 0.5% FCS.
  • Cells (106/ml) were stimulated for 0 to 30 min at RT with either SCF (100 to 500 ng/ml) or PMA ( 10- 100 nM).
  • SCF 100 to 500 ng/ml
  • PMA 10- 100 nM
  • the stimulation was terminated by adding ice-cold RPMI- 1640 containing sodium vanadate followed by centrifugation.
  • the cells were lysed in odified-RIPA buffer (50 mM Tris-HCl, pH 7.4, 1% NP-40, 0.25% sodium deoxycholate, 150 mM NaCl, 1 mM PMSF, 2 (g/ml of aprotinin, leupeptin and pepstatin, and 1 mM Na3VO4).
  • Total cell lysates were clarified by centrifugation at 10,000 x g for 10 min. Protein concentrations were determined by using a protein assay (Bio-Rad Laboratories) and were standardized to equal concentrations of protein prior to immunoprecipitation. Identical amounts of protein from each sample were precleared by incubation with Protein G-Sepharose CL-4B (Sigma Co., St. Louis, MO) for 1 h at 4°C. After the removal of Protein G-Sepharose by brief centrifugation, the solution was incubated with different primary antibodies as described below for each experiment for 4 h or overnight at 4°C.
  • Protein G-Sepharose CL-4B Sigma Co., St. Louis, MO
  • Immunoprecipitation of the antigen-antibody complex was accomplished by incubation for 1 h at 4°C with 40 ⁇ l of protein G-Sepharose as described (Huang, E. et al. (1990) Cell 63, 225-233). Normal rabbit serum was used as a control in immunoprecipitations. Bound proteins were solubilized in 20 ⁇ l of 2 X Laemmli buffer. Samples were separated and analyzed by 7.5% SDS-PAGE, and then transferred to nitrocellulose membranes. The membranes were blocked with 5% bovine serum albumin (BSA) (Boehringer Mannheim Co., Indianapolis, IN) and probed with primary antibody for 1 h at RT. Immunoreactive bands were visualized using HRP-conjugated secondary antibody and the enhanced chemiluminescent (ECL) reagents (Amersham Co ⁇ ., Arlington Heights, IL).
  • BSA bovine serum albumin
  • SCF induces the tyrosine phosphorylation of RAFTK in CMK megakaryocytic cells.
  • CMK megakaryocytic cells were studied with a focus on the c-kit/SCF pathway which is known to be important in the proliferation of this lineage (Briddell, R. A. et al. (1991) Blood lZ, 2854-2859; Avraham, H. et al. (1992) Blood 79, 365-371 ; Avraham, H. et al. (1992) Blood 80, 1679-1684).
  • the CMK cells were starved in RPMI- 1640 medium followed by stimulation with SC, and then harvested at different time intervals as indicated.
  • Tyrosine phosphorylation of RAFTK peaked at a concentration of SCF of 500 ng/ml at 5 min. No phosphorylation of FAK was observed under these conditions. Maximum stimulation of RAFTK in CMK cells was observed within 1 min and peaked at 5 min.
  • SCF treatment is known to increase cytoplasmic calcium levels (Columbo, M. et al. (1994) Biochemical Pharmacology 47, 2137-2145) as well as to stimulate phosphorylation of components of c-kit associated signalling pathways (.Lev, S. et al. (1992) Journal of Biological Chemistry 267, 15970-15977; Rottapel, R. et al. (1991) Molecular & Cellular Biology 11, 3043-3051). Since SCF effects are modulated by PKC (Blume-Jensen, P. et al. (1995) Journal of Biological Chemistry 270, 14192- 14200; Na ciu, S. et al. (1994) Oncogene 9, 1407-1416; Grabarek, J.
  • PMA induces tyrosine phosphorylation of RAFTK in CMK megakaryotic cells.
  • the activated c-kit receptor can recruit Grb2 by tyrosine phosphorylation of She (Liu, L. et al. (1994) Mole, and Cell Biol. 14, 6926-6935; Tauchi, T. et al. (1994) J. Exp. Med. 179, 167-175). It was then investigated whether SCF could induce tyrosine phosphorylation of She and whether it associates with Grb2 in CMK cells. CMK cells stimulated by SCF (500 ng/ml) or PMA (50 nM) were lysed and immunoprecipitated with monoclonal anti-human She antibody and the precipitates were then immunoblotted with monoclonal anti-phosphotyrosine antibody PY-20. SCF induced She phosphorylation and association with Grb2 while PMA has no effect on Shc-Grb2 association, suggesting differences in proliferative versus maturational pathways with regard to these molecules in megakaryocytes.
  • PKC ⁇ and PKC ⁇ isoforms are involved in RAFTK phosphorylation.
  • an analysis of PKC isozymes present in CMK cells was performed.
  • PKC ⁇ and PKC ⁇ isoforms were expressed in megakaryocytes as observed by immunoprecipitation using specific antibodies for PKC ⁇ and PKC ⁇ , while no expression of PKC ⁇ or PKC ⁇ was observed.
  • CMK cell lysates unstimulatcd or after PMA or SCF treatment were immunoprecipitated with either PKC ⁇ or PKC ⁇ specific antibodies.
  • the immunoprecipitates were resolved on 7.5% SDS-PAGE, immunoblotted with PY-20 antibodies or anti-phosphoserine/threonine or PKC ⁇ or PKC ⁇ or RAFTK specific antibodies. Constitutive association of PKC ⁇ with RAFTK was demonstrated by co-immunoprecipitation studies as shown in. An increase in phosphorylation of PKC ⁇ upon PMA treatment was observed. A similar observation of augmented PKC ⁇ phosphorylation was made in CMK cells stimulated with SCF.
  • PKC ⁇ was found only to be associated with RAFTK after stimulation with SCF or PMA, but changes in the degree of phosphorylation of PKC ⁇ upon such activation by SCF or PMA using phosphoserine/threonine antibodies were not detected. These results show that PKC ⁇ and PKC ⁇ isozymes are involved in RAFTK activation, that PKC ⁇ is constitutively associated with RAFTK while association of RAFTK with PKC ⁇ is inducible, and may be increased in activation upon certain stimuli but may not alter the phosphorylation status of this species.
  • RAFTK association with a known focal adhesion protein paxillin was investigated.
  • Cell lysates of CMK cells treated with PMA were immunoprecipitated with either RAFTK specific antibodies or anti-paxillin antibodies.
  • the immunoprecipitates were resolved and immunoblotted with PY-20 antibodies.
  • An increase in phosphorylation of paxillin was observed upon PMA stimulation which peaked by 5 min.
  • Constitutive association of paxillin and RAFTK was observed in untreated CMK cells.
  • Treatment with the PKC inhibitor calphostin C abolished RAFTK activation and decreased its association with paxillin.
  • CMK cells stimulated with SCF were immunoprecipitated with RAFTK antibodies, and the immunoprecipitates were then resolved and immunoblotted with PY-20 antibodies, RAFTK or paxillin antibodies.
  • RAFTK constitutively associated with paxillin and was not altered in its degree of phosphorylation upon activation with SCF.
  • Constitutive association of PKC ⁇ with RAFTK was also observed.
  • RAFTK activation is inhibited by BAPTA, calphostin C and cytochalasin-D.
  • CMK cells treated with calcium ionophore A23187 showed tyrosine phosphorylation of RAFTK, which was inhibited by the intracellular calcium chelator, BAPTA.
  • BAPTA the intracellular calcium chelator
  • induction of RAFTK phosphorylation by the calcium ionophore A23187 was inhibited, indicating that calcium regulation of this PKC isoform was involved in RAFTK phosphorylation.
  • RAFTK activation was completely inhibited in the presence of cytochalasin-D, indicating that RAFTK is associated with the cytoskeleton and this association is essential for its activation following changes in intracellular calcium.
  • SCF treatment of CMK cells induced rapid, transient tyrosine phosphorylation of RAFTK which was inhibited in the presence of BAPTA, suggesting that SCF may induce RAFTK phosphorylation through elevating intracellular calcium levels.
  • SCF induction of RAFTK phosphorylation was inhibited completely, indicating again that the integrity of the cytoskeleton is required for RAFTK phosphorylation. Since SCF stimulation of RAFTK in the presence of calphostin C was also completely inhibited, this mechanism of RAFTK activation appears to be mediated through PKC.
  • PKC plays an important role in cellular responses to various hormones, growth factors, neurotransmitters and cytokines, and transduces signals promoting lipid hydrolysis (See, e.g., Dekker. L. V. and Parker, P. J. (1994) Trends in Biochemical Sciences 19, 73-77; Nishizuka, Y. (1992) Science 258, 607-614; Nishizuka, Y. (1986) Science 233, 305-312).
  • PKC regulates the action of a variety of ion channels, G- protein coupled receptors, tyrosine kinase receptors or non-receptor tyrosine kinases (See, e.g., Ohtani, K. et al.
  • PKC- ⁇ and PKC- ⁇ isoforms are known to be expressed in megakaryocytes while PKC- ⁇ and PKC- ⁇ have not been found (Grabarek, J. et al. ( 1992) Journal of Biological Chemistry 267, 1001 1 - 10017). Constitutive association in vivo of PKC- ⁇ with RAFTK was observed while association of PKC- ⁇ and RAFTK was inducible. No increase in the level of PKC- ⁇ or PKC- ⁇ with RAFTK after SCF or PMA stimulation was observed by co-immunoprecipitation techniques.
  • PKC isoenzymes do not possess intrinsic tyrosine kinase activity
  • activation of PKC by phorbol esters such as PMA has been demonstrated to indirectly induce tyrosine phosphorylation in different cells types (See, e.g., Li, W. et al. (1994) Journal of Biological Chemistry 269, 2349-2352; Einspahr, K. J. et al. (1990) Journal of Immunology 145, 1490-1497; Nel, A. E et al. (1990) Journal of Immunology 145, 971-979).
  • RAFTK phosphorylation was inhibited following treatment by the PKC inhibitors Calphostin C or Staurosporine as well as BAPTA (an intracellular Ca2+ chelator).
  • PKC is directly involved in RAFTK phosphorylation.
  • BAPTA blocked PMA or SCF induced RAFTK phosphorylation, indicating that calcium was essential for PKC mediated RAFTK activation.
  • the calcium-ionophore (A23187) also stimulated RAFTK phosphorylation and was inhibited by PKC inhibitors Calphostin C and Staurosporine or by BAPTA, indicating again a role for PKC as a mediator of several signalling pathways including Ca2+ in RAFTK phosphorylation.
  • the cytoskeleton is essential for many cellular functions including regulation of cell shape, flexibility, and adhesive properties (Hynes, R. O. (1992) Cell 69, 11-25; Juliano, R. L. and Haskill, S. (1993) J. Cell Biol. 120, 577-585).
  • Part of the cytoskeleton and plasma membrane form a region known as the focal adhesion (Lo, S. H. et al. (1994) Bioessays 16, 817-823).
  • Focal adhesions are structures that form adherent contacts with the extracellular matrix. Proteins contained in the focal adhesion include talin, (-actinin, vinculin, paxillin, and other proteins (See, e.g., Tachibana, K. et al.
  • RAFTK is tyrosine phosphorylated upon fibronectin stimulation and co- localized with vinculin at "focal adhesion like structures" in CMK cells.
  • RAFTK activation upon calcium ionophore (A23187) treatment or SCF or PMA stimulation of CMK cells is completely abolished in the presence of cytochalasin-D, which disrupts the cytoskeleton.
  • RAFTK The tyrosine kinase PYK2, which is identical to RAFTK, has been shown to be involved in calcium signalling and MAP kinases function in PC- 12 neuronal cells (Lev, S. et al. (1995) Nature 376, 737). Stimulation of megakaryocytes with thrombin leads to tyrosine phosphorylation of RAFTK (Avraham, S. et al. (1995) J. Biol. Chem. 270, 1-10). The evidence that RAFTK is involved in the c-kit growth factor signalling pathway in megakaryocytic cells as described in this study further supports the broad function of this kinase in a variety of signalling pathways. EXAMPLE 3: Characterization of RAFTK, a Novel Focal Adhesion
  • RAFTK protein Biochemical characterization and functional analysis of the RAFTK protein was performed. Coexpression of RAFTK and FAK proteins in megakaryocytic cells and blood platelets was observed. Using a specific antibody to RAFTK and the monoclonal antibody 2A7 to FAK, FAK and RAFTK could be distinguished antigenically.
  • RAFTK had intrinsic tyrosine kinase and auto-kinase activities. It was phosphorylated on tyrosine in growing cultures of COS cells transfected with the pCDNAUVf ⁇ ag-RAFTK expression vector containing the RAFTK cDNA ligated with the eight amino acid flag peptide sequence. Similar to FAK, dephosphorylation of RAFTK was observed when adherent transfected COS cells were detached.
  • RAFTK protein colocalization of RAFTK protein with vinculin, a focal adhesion protein, was observed in "focal adhesion-like structures" in adherent CMK cells and in transfected pCDNAIII/flag-/ f FTK COS cells upon fibronectin activation, by confocal microscopy.
  • RAFTK is a novel member of the FAK family, that it localizes to "focal adhesion-like structures" in CMK megakaryocytic cells, participates in integrin-mediated signaling pathways in megakaryocytes and is able to associate with the tyrosine kinases Src and Fyn as well as the adaptor protein Grb2 via SH2-phosphotyrosine interactions.
  • Monoclonal antibody M5 to the flag peptide was purchased from Eastman Kodak Co. (New Haven, CT).
  • rhGM-CSF was purchased from R & D Systems (Minneapolis, MN).
  • Monoclonal anti-human antibody to vinculin was purchased from Sigma (St. Louis, MO).
  • COS cells were obtained from the American Type Tissue Culture (Rockville, MD). The cells were maintained in Dulbecco's modified Eagle's medium (DMEM) (Mediatech Co., Washington, D.C.) supplemented with 10% fetal calf serum (FCS) (Sigma), 2 mM glutamine, 100 U/ml of penicillin and 100 mg/ml of streptomycin. Megakaryocytic cell lines CMK, DAMI, CMS, Meg-01 and CMK1 1-5 were maintained in RPMI-1640 supplemented with 10% FCS, 2 mM glutamine, 100 U/ml of penicillin and 100 mg/ml of streptomycin as described previously (Sakaguchi M et al.
  • DMEM Dulbecco's modified Eagle's medium
  • FCS fetal calf serum
  • CMK, DAMI, CMS, Meg-01 and CMK1 1-5 were maintained in RPMI-1640 supplemented with 10% FCS, 2 mM
  • Oligonucleotides flanking various RAFTK domains and containing appropriate restriction sites were synthesized.
  • the polymerase chain reaction (PCR) was used with RAFTK cDNA as a template to amplify the appropriate fragments.
  • the DNA fragments encoding amino acid (a.a) residues 26-286 (N-RAFTK), 375-680 (KA- RAFTK), 375-1009 (KC-RAFTK) and 681-1009 (C-RAFTK) of RAFTK were amplified by the PCR technique and the sequences for these encoding regions were confirmed by DNA sequencing.
  • PCR products were precleaved with BamHI and EcoRI and were ligated into the pGEX-2T expression vector (Pharmacia Biotech, Inc., Piscataway, NJ) which had also been cleaved with BamHI and EcoRI.
  • Competent Escherichia coli (E. coli) DH5a were transformed, and recombinant bacterial clones were screened by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS- PAGE) analysis of overexpressed fusion proteins and restriction enzyme analysis.
  • GST-fusion proteins were produced by 1 mM isopropyl b-thiogalactopyranoside induction and purified by affinity chromatography on Glutathione-Sepharose beads (Pharmacia Biotech, Inc., Piscataway, NJ). Construction of pCDNAIII/flag and pCDNAIII/flag-&4Fr#
  • the pCDNAIII/flag expression vector was constructed by inserting a short DNA fragment encoding a starting codon and an 8-a.a flag peptide into a pCDNAIII expression vector (Invitrogen Co., San Diego, CA) at Hindlll and EcoRI sites.
  • the two oligonucleotides used were: sense primer: 5 -AGC TTA TGG ACT AC A AGG ACG ACG ATG ACA GGG G-3' (SEQ ID NO: 17); antisense primer: 5' AAT TCC CTT GTC ATC GTC GTC CTT ATG GTC CAT A-3' (SEQ ID NO: 18).
  • the cDNA encoding 1009 amino acids of human RAFTK was then subcloned in an EcoRI site located downstream of the flag sequences of the pCDNAIII/flag vector. The orientation and DNA sequences of the RAFTK cDN A were confirmed by DNA sequencing.
  • COS cells were transfected by the calcium phosphate method using pCDNAIII/flag--&4F7X or pCDNAIII/flag expression vectors according to the manufacturer's protocol (Invitrogen Co., San Diego, CA).
  • the transfected cells were starved in serum-free DMEM for 4-6 hr, harvested by phosphate-buffered saline (PBS) containing 2 mM EDTA and washed with PBS twice.
  • PBS phosphate-buffered saline
  • the cells (1.5 x ⁇ per 60 mm dish) were then plated onto fibronectin (5.0 ⁇ g/ml) or Poly-L-Lysine (5.2 ⁇ g/ml) coated dishes at 37°C for various times (20 or 40 min).
  • Adherent cells were lysed in 1 ml of RIPA buffer (50 mM Tris-HCl, pH 7.4, 1% NP-40, 0.25% sodium deoxycholate, 150 mM NaCl, 1 mM PMSF, 10 ⁇ g/ml of aprotinin, leupeptin and pepstatin, and 1 mM Na3VO4). Analysis of RAFTK phosphorylation was performed as described further.
  • Total cell lysates were clarified by centrifugation at 10,000 x g for 10 min. Protein concentrations were determined by the protein assay (Bio-Rad Laboratories, Hercules, CA) and were standardized to equal concentrations of protein prior to immunoprecipitation. Identical amounts of protein from each sample were precleared by incubation with protein G-Sepharose CL-4B (Sigma Co., St. Louis, MO) for 1 hr at 4°C. After the removal of protein G-Sepharose by brief centrifugation, the solution was incubated with different primary antibodies as described below for each experiment for 4 hr or overnight at 4°C.
  • protein G-Sepharose CL-4B Sigma Co., St. Louis, MO
  • Immunoprecipitation of the antigen-antibody complex was accomplished by incubation for 2 hr at 4°C with 25 ⁇ l of protein G-Sepharose. Non-specific bound proteins were removed by washing the Sepharose beads three times with HNTG buffer (20 mM Hepes, pH 7.4, 150 mM NaCl, 10% glycerol and 0.1% Triton X-100). Bound proteins were solubilized in 20 ⁇ l of 2 x Laemmli buffer and further analyzed by immunoblotting.
  • 20 x l ⁇ 6 CMK cells were starved in serum-free RPMI- 1640 culture medium overnight.
  • the cells were divided into 4 parts: one portion was replated onto fibronectin-coated (8 ⁇ g/cm 2 ) dishes; one portion onto collagen-coated (8 ⁇ g/cm-2) dishes; one portion onto Poly-L-Lysine (5 ⁇ g/cm 2 ) dishes; and one portion was kept in suspension. After 1 hr replating, the medium was aspirated and adherent cells were gently and quickly washed with ice-cold PBS. The cells were lysed in 1 ml RIPA buffer and cleared by centrifugation for 10 min at 10,000 rpm.
  • Immunoprecipitated complexes were washed twice with RIPA buffer and once in kinase buffer (20 mM Hepes; pH 7.4, 50 mM NaCl, 5 mM MgCl2, 5 mM MnCl2, and 100 ⁇ M Na3 VO4).
  • the washed immune complexes or a defined amount of purified GST-fusion proteins were suspended in 20 ⁇ l of kinase buffer and then [g- 32 P]ATP was added up to 250 ⁇ Ci/ml in the presence of 25 ⁇ g of poly (Glu:Tyr) (4:1, 20 to 50 Kd) (Sigma Chemical Co., St. Louis, MO), at RT for 15 min.
  • the reaction was stopped by the addition of 10 mM Hepes (pH 7.4)/10 mM EDTA.
  • the labeled substrates were analyzed by SDS-PAGE and autoradiography.
  • Antibodies antiserum was obtained from New Zealand white rabbits immunized with a bacterially expressed GST-fusion protein containing the C-terminal (681 - 1009 amino acid residues) of human RAFTK cDNA.
  • the sera were titered by ELISA against the GST-RAFTK C-ter inus fusion protein.
  • the serum R-4250 exhibited the highest titer (1 :256,000) and was found to react specifically with the GST-fusion proteins containing the C-terminus of RAFTK. This serum was used in subsequent experiments.
  • CMK megakaryocytes or transfected COS cells were plated overnight on glass coverslips coated with fibronectin (5-8 ⁇ g/cm 2 ).
  • Adherent cells were fixed with 2% paraformaldehyde in PBS, pH 7.4 for at least 15 min, permeabilized in PBS containing 0.2% Triton X-100 for 2 min, washed in PBS, and placed in a blocking buffer containing PBS, 3% BSA and 1% normal goat serum for 1 hr.
  • Adherent cells were incubated with anti-vinculin (IgGl mouse anti-human, 1 :200 dilution) and RAFTK (rabbit an ⁇ -RAFTK, 1 : 100 dilution) antibodies for 1 hr.
  • Cells were washed in PBS, incubated with FITC conjugated (anti-mouse IgG), and Texas red conjugated (anti-rabbit IgG) antibodies for 1 hr.
  • Short wavelength light ( ⁇ 595 nm) emitted from the vinculin-labeled focal adhesion plaques (FITC) was directed to a second photomultiplier tube fitted with a 540 ⁇ 15 nm band pass filter and simultaneously recorded. Image pairs were subjected to a 2-D median filter to reduce background noise, then examined as color composite images with RAFTK appearing red, and vinculin green. Focal adhesion plaques expressing both RAFTK and vinculin appeared yellow-orange.
  • the pixel intensity range corresponding to the cell cytoplasm was determined separately for each image.
  • Cell background was found to be within a range of 4-73 pixel intensity units.
  • the noncellular background composed of surrounding media and slide surface was determined to be 0-3 pixel intensity units.
  • Cells containing fluorescent stained RAFTK were observed to have pixel intensities from 74-255, whereas pixel intensities for vinculin ranged between 86-254 units.
  • Pixel intensities corresponding to either RAFTK or vinculin were applied to a 2-D histogram of pixel intensities with RAFTK (X-axis), plotted against vinculin (Y-axis). Pixels unique to each either RAFTK or vinculin were identified on the 2-D histogram and converted into a binary section. This section was applied as a mask over the original image to produce area measurements on a per cell basis. This procedure was repeatedly used to measure the area occupied by both RAFTK and vinculin for both cell types.
  • the RAFTK gene is highly conserved during species evolution and is coexpressed with FAK in several hematopoietic cells.
  • RAFTK shares about 65% similarity of its amino acid sequence with that of FAK, suggesting that RAFTK and FAK may have some common features.
  • total RNA from different megakaryocytic cell lines was prepared and Northern blot analysis was performed using a human &4 F7 -specific probe and a human FAK-specific probe. Northern blot analysis showed that all tested megakaryocytic cell lines coexpressed both RAFTK- and FAK- specific transcripts of 4.5 Kb.
  • RAFTK and FAK proteins were detected by Western blot analysis in the CMK megakaryocytic cell line and in blood platelets using the polyclonal antibody 4250 to the C-terminal RAFTK and the monoclonal antibody 2A7 to FAK.
  • Total lysates from 5 x 10 8 platelets of 10 ⁇ CMK cells were prepared and protein concentrations were determined.
  • An equal amount of protein was immunoprecipitated by polyclonal antiserum 4250 for RAFTK or normal rabbit serum (NRS) or immunoprecipitated with the monoclonal antibody 2A7 to FAK or control irrelevant monoclonal antibody with the same isotype.
  • the immunocomplexcs were resolved by SDS-PAGE and then immunoblotted with antibody 4250 (1 : 1000) or immunoblotted with 2A7 (1 :500)- Antibodies 4250 and 2A7 were shown to be specific to RAFTK and FAK, respectively, as described below. Taken together, these results demonstrated that RAFTK and FAK were coexpressed in these hematopoietic cells.
  • RAFTK is antigenically distinct from, but related to FAK.
  • N-RAFTK N-terminal
  • KA- RAFTK kinase catalytic
  • C-RAFTK C-terminal domains of RAFTK
  • a polyclonal antiserum 4250 by rabbit immunization with the C-terminal RAFTK GST-fusion protein was generated.
  • This antiserum like the monoclonal antibody M5 to the flag peptide and polyclonal Ab BC3, specifically recognized the M5-immunoprecipitated flag-RAFTK protein expressed in transfected COS cells.
  • antibody 2A7 but not 4250 or M5 was shown to recognize a 2A7-immunoprecipitated 125 Kd protein in either vector alone or f ⁇ ag-RAFTK transfected COS cells; this protein appears to represent the endogenous FAK.
  • RAFTK has intrinsic protein tyrosine kinase and auto-ki ⁇ asc activities.
  • Enzymatic activity of a protein tyrosine kinase is essential for its role in signal transduction.
  • kinase activity of the purified N-RAFTK, KA-RAFTK, KC-RAFTK, and C-RAFTK GST-fusion proteins in in vitro assays in which poly (Glu:Tyr) (4:1) was used as an exogenous substrate was tested. The results showed that the KC-RAFTK fusion protein possessed kinase activity.
  • RAFTK is involved in integrin-mediated signaling in transiently transfected COS cells and CMK megakaryocytic cells. Since RAFTK is structurally similar to FAK which plays a central role in integrin-mediated signaling pathways, RAFTK phosphorylation upon integrin engagement was studied. Tyrosine phosphorylation and kinase activity of flag- RAFTK in transiently transfected COS cells were analyzed. When transfected COS cells were grown on plastic culture dishes, flag-RAFTK protein was phosphorylated.
  • flag-RAFTK from fibronectin-coated dishes was markedly increased in its kinase activity, no increased kinase activity was found in flag-RAFTK from Poly-L-Lysine coated dishes.
  • the flag-RAFTK in the detached cells retained a very low level of activity.
  • endogenous RAFTK is responsive to integrin activation (like FAK)
  • CMK cells were lysed in RIPA buffer as a control, or replated onto fibronectin, collagen or Poly-L-Lysine coated dishes for 1 hr.
  • the adherent cells were quickly washed and lysed in RIPA buffer. A total of 1.2 mg TCL for each sample was immunoprecipitated with an ⁇ -RAFTK serum (R-4250). After washing, the immunocomplexes were divided into three parts: equivalent of 1 mg TCL for phosphorylation analysis; equivalent of 180 ug TCL for autophosphorylation assay; and equivalent of 20 ug TCL for kinase assay.
  • the phosphorylation of RAFTK was significantly increased in CMK megakaryocytic cells adherent to fibronectin or collagen coated dishes, while no phosphorylation of RAFTK was observed in nonadherent CMK cells or CMK cells grown onto Poly-L-Lysine dishes. These data show that RAFTK can be activated by integrin engagement in CMK cells.
  • RAFTK auto-kinase activity of RAFTK was stimulated by integrin activation
  • endogenous RAFTK in CMK cells untreated or stimulated with collagen, fibronectin, or Poly-L-Lysine was analyzed.
  • a very low level of autophosphorylation in CMK cells adherent to Poly-L-Lysine and no autophosphorylation activity in untreated CMK cells was observed.
  • RAFTK protein from transfected COS cells in suspension was compared to that of transfected COS cells adherent on fibronectin in its association with SrcSH2, FynSH2 and Grb2SH2 GST- fusion proteins. Cells adherent on fibronectin significantly increased the association of RAFTK with SrcSH2, FynSH2 and Grb2SH2 GST proteins.
  • RAFTK endogenous RAFTK in CMK cells was localized to focal adhesion structures or to cell-cell contacts.
  • a detailed analysis using confocal microscopy was performed.
  • localization of RAFTK in transfected COS cells was determined.
  • Purified R-4250 antibodies which specifically detect RAFTK were used. Confocal image analysis of immunostained CMK cells and transfected COS cells adherent to the fibronectin substrate reveal "focal adhesion-like structures" adjacent to the glass coverslip surface. Confocal image analysis showed greater than 90% of the RAFTK was colocalized with vinculin under these conditions.
  • RAFTK novel signaling molecule
  • RAFTK Phosphorylated RAFTK was able to specifically bind to Src- family kinases and the Grb2 adaptor protein via an apparent phosphotyrosine-SH2 interaction.
  • Fibronectin stimulation increased RAFTK tyrosine phosphorylation when an epitope tagged RAFTK was expressed into COS cells.
  • the phosphorylation of RAFTK was significantly increased in CMK cells adherent onto fibronectin or collagen coated dishes, while no phosphorylation of RAFTK was observed in untreated CMK cells or CMK cells grown onto Poly-L-Lysine coated dishes.
  • F-7 COS cells following double-staining with vinculin and RAFTK revealed colocalization of the RAFTK protein with vinculin in "focal adhesion-like structures" in CMK and transfected COS cells treated with fibronectin.
  • adherent cells such as 3T3 cells
  • CMK cells are cells grown in suspension and lack the typical focal adhesion structures. Therefore, these confocal studies were done in transfected COS cells as well as CMK cells grown in fibronectin and the stained structures are called "focal adhesion-like structures”.
  • RAFTK RAFTK
  • vinculin a well-known focal adhesion protein
  • RAFTK localization was performed in transfected COS cells (with a flag-RAFTK construct) and in CMK cells.
  • the plane of focus was set to be within the focal adhesion plaque region at 0.2 microns above the coverslip surface to exclude cell-cell contact.
  • the tyrosine phosphorylation of endogenous RAFTK was observed upon collagen stimulation of platelets.
  • RAFTK was not phosphorylated upon collagen treatment.
  • RAFTK is most closely related to FAK, sharing 65% similarity (Avraham S et al. (1995) J Biol Chem 270, 27742). Such high similarity between the proteins suggested that RAFTK and FAK may have similar molecular structural conformations. This prediction was supported by antigenic crossreactivity studies in which two polyclonal antibodies to FAK recognized the C-terminal GST-fusion protein of RAFTK as well as flag- RAFTK. RAFTK appears to be structurally distinct from FAK. A further comparison of RAFTK and FAK in different regions indicated that NH2 and COOH terminal domains have more divergence than the kinase domain. Such divergence may account for the failure of monoclonal antibody 2A7 to FAK and polyclonal antibody 4250 to RAFTK to recognize common epitopes.
  • FAK-family kinases lack SH2 and SH3 domains, the regulation of tyrosine phosphorylation plays a critical role in protein-protein interactions during signal transduction. More than half (20/35) of the tyrosine residues of RAFTK axe highly conserved in the FAK molecule (Avraham S et al. (1995) J Biol Chem 270, 27742). Importantly, two of these residues in FAK were identified as being phosphorylated and sequentially bound to the SH2 domains of the Src-family kinases and the Grb2 adaptor protein: Tyr 397 (Schaller M D et al. (1994) Mol Cell Biol 14, 1680) and Tyr 925 (Schlaepfer D.D. et al.
  • RAFTK contains more than one potential binding site for Src-family tyrosine kinases. These results show that RAFTK, like FAK, is a substrate for Src kinases which are required for FAK family kinase mediated signaling pathway(s). Tyrosine kinase and auto-kinase activities are essential for FAK to initiate its downstream signaling pathway. Because RAFTK has very large NH2 and COOH domains, it is important to preclude the possibility that any other kinase(s) may contribute to the enzymatic activity in the in vitro kinase assay.
  • RAFTK is rapidly tyrosine phosphorylated in thrombin-stimulated platelets.
  • thrombin tyrosine phosphorylation in platelets.
  • Thrombin induced a dose and time dependent phosphorylation of RAFTK in platelets.
  • Treatment of platelets with 0.05, 0.1 or 0.25 U/ml of thrombin induced a basal level of RAFTK phosphorylation similar to the resting or unstimulated platelets.
  • RAFTK phosphorylation The resting or unstimulated platelets showed very low basal level of phosphorylation. Activation was observed as early as 10 seconds post- thrombin stimulation, reaching a maximum at 2 minutes and tapering off by 10 minutes. These results showed that thrombin stimulation of platelets induces RAFTK phosphorylation in a time and concentration dependent manner.
  • RAFTK is an endogenous substrate for Calpain.
  • Calpain constitutes most of the calcium dependent protease activity in platelets (Fox, J. E. B. et al. (1990) Blood 16, 2510-2519; Oda, A. et al. (1993) J. Biol. Chem. 268, 12603-12608).
  • Thrombin is one of the agonists that causes activation of calpain in platelets.
  • RAFTK protein levels were examined on the same immunoblot, thrombin treated sample showed cleavage of RAFTK where as calpeptin treated platelets showed a complete blockage in RAFTK degradation.
  • the level of the RAFTK protein in calpeptin treated platelets was equal to the level in the resting or unstimulated platelets.
  • RAFTK processing was observed in a time dependent manner in response to the pharmacological activator of calpain, A23187, and to the physiological activator of calpain collagen.
  • the characteristics of inhibition of degradation of RAFTK were consistent with the involvement of calcium dependent neutral cysteine protease, since degradation of RAFTK occurred at neutral pH and was inhibited by cysteine protease inhibitor, calpeptin.
  • RAFTK phosphorylation is independent of aggregation and occurs early, during platelet shape change.
  • the earliest platelet response induced by physiological agonists involves a change in shape from flat discs into compact spheres followed by secretion of granular contents.
  • the later phase of platelet response is aggregation when large platelet aggregates are formed. Since RAFTK phosphorylation is induced early (10 seconds) after thrombin stimulation, it was investigated if aggregation is a prerequisite for
  • RAFTK phosphorylation In order to prevent aggregation, platelets were activated by thrombin in the absence of stirring. A time course of thrombin induced platelets showed that RAFTK is rapidly phosphorylated as early as 10 seconds in the presence or absence of stirring (aggregation). However, the signal declined faster upon stirring, where as it persisted longer in the absence of stirring (10 min). The levels of RAFTK protein remained equal in the absence of stirring and the levels decreased only in the presence of stirring, indicating that RAFTK cleavage is dependent on aggregation, while RAFTK phosphorylation does not require aggregation. However some aggregation can occur in the absence of stirring because of the close proximity of the platelets (5 X 10 8 /ml).
  • RAFTK phosphorylation does not require aggregation
  • platelets were pretreated with an aggregation inhibitor, RDGS tetrapeptide, before activation by an agonist.
  • Treatment with RGDS peptide allows shape change but prevents aggregation by blocking the interaction of fibrinogen with the integrin GpIIb/IIIa.
  • Addition of thrombin to platelets pretreated with increasing concentrations of RGDS or RGES (mock) peptides showed no change in the levels of tyrosine phosphorylation of RAFTK.
  • RAFTK proteolytic processing of RAFTK was inhibited by RGDS treatment (absence of aggregation), but it was not inhibited when platelets were treated by RGES (presence of aggregation) or with thrombin alone.
  • the phosphorylation of RAFTK correlated well with an early wave of tyrosine phosphorylation especially of proteins pp60 src and pp72 s k (Clark, E. A., and Brugge, J. S. (1993) Mol. Cell. Biol. 13, 1863-1871 ; Clark, E.A. et al. (1994) J.Biol.Chem.
  • Activation oi RAFTK is not dependent on the integrin, GplIb/IIIa.
  • GplIb/IIIa is a major integrin receptor which plays an important role in adhesive events critical in clot formation by binding to fibrinogen and von Willebrand factor matrix proteins (Fox, J. E. B. et al. (1993) J. Biol. Chem. 268, 25973-25984). Activation of FAK was found to be mediated through the integrin GplIb/IIIa (Lipfert, L. et al. (1992) J. Cell Biol. 1 19, 905-912). Since RAFTK is a member of FAK subfamily, whether RAFTK and FAK have similar mechanisms of regulation was investigated. Tyrosine phosphorylation of RAFTK was studied under conditions that specifically induce or inhibit fibrinogen binding to this receptor.
  • the monoclonal antibody 7E3 binds to GplIb/IIIa and blocks fibrinogen binding (Coller, B. S. et al. (1989) Circulation 80, 1766-1774). Incubation of platelets with 7E3 for 20 minutes prior to stirring, followed by addition of thrombin did not inhibit tyrosine phosphorylation of RAFTK while tyrosine phosphorylation of FAK was inhibited under the same conditions. Pretreatment with a (control) monoclonal antibody 6D1 , specific for collagen receptor GpIa IIb did not alter thrombin induced phosphorylation of RAFTK or FAK.
  • RAFTK was not phosphorylated when platelets were stirred or unstirred with anti-LIBS6 and fibrinogen, in platelets treated with fibrinogen alone or in resting platelets despite containing the protein. RAFTK was however activated when platelets were treated with thrombin (positive contol). Thus these studies indicate that activation of RAFTK does not require crosslinking of GplIb/IIIa receptors on the platelet surface.
  • RAFTK activation is regulated by actin polymerization.
  • Thrombin stimulation in platelets leads to actin polymerization and causes dramatic rearrangements of the cytoskeleton thereby inducing the formation of focal- contact like areas (Furman, M. I. et al. (1993) Thromb. Haemostasis 70, 229-232). It was also examined whether phosphorylation of RAFTK was affected by agents that disrupt the actin cytoskeleton. Platelets pretreated with cytochalasin D block agonist induced actin polymerization but do not inhibit platelet aggregation. Pretreatment with cytochalasin D inhibited tyrosine phosphorylation of RAFTK in thrombin stimulated platelets. However the level of inhibition was not 100%, suggesting that the actin-dependent cytoskeletal interactions effected partially phosphorylation of RAFTK. Furthermore proteolytic processsing of RAFTK is not inhibited in cytochalasin D treated platelets.
  • RAFTK is activated by multiple platelet agonists.
  • RAFTK has been found to be activated by thrombin, calcium ionophore, collagen, and the combination of ADP plus epinepherine.
  • RAFTK Adhesion Focal Tyrosine Kinase
  • RA.FTK a novel non-receptor protein kinase
  • focal adhesions may modulate cytoskeleton function and thereby alter phagocytosis, cell migration, and adhesion in macrophages
  • RAFTK was abundantly expressed in THP1 monocytic cells as well as primary alveolar and peripheral blood derived macrophages. Phorbol diester stimulation of THP1 cells increased tyrosine phosphorylation of RAFTK by 2.5 minutes. Similar increases in phosphorylation were detected within 1 minute after CSF-1/MCSF stimulation.
  • RAFTK was phosphorylated with similar kinetics in peripheral blood derived macrophages
  • alveolar macrophages showed high constitutive phosphorylation levels which decreased over increased time after treatment with either PMA or CSF-1/M-CSF.
  • Immunoprecipitation analysis identified constitutive associations between RAFTK and the cytoskeleton protein paxillin and the signaling molecule PI-3 kinase. However, both these molecules appear disassociate from RAFTK at the peak time of phosphorylation after PMA or CSF-1/M-CSF stimulation.
  • RAFTK was also found to preferentially associate with the amino terminus-SH3 domain of the Grb2 adaptor protein in THPl cells.
  • CSF-1/M-CSF receptor ftns and RAFTK appear to associate in response to CSF-1/M-CSF treatment of THPl cells. These data demonstrate that RAFTK participates in macrophage signal transduction pathways mediated by CSF-1/M-CSF.
  • the permanent human monocyte-macrophage cell line THP-1 was obtained from the American Type Culture Collection (ATCC) and shown to be mycoplasma free prior to expansion in culture.
  • the cells were carried in Dulbecco's Modified Eagel's Medium (DMEM) supplemented with 10% fetal calf serum (FCS), 2mM glutamine, sodium pyruvate, non-essential amino acids and 50 ⁇ g/ml penicillin and 50ug/ml streptomycin.
  • DMEM Dulbecco's Modified Eagel's Medium
  • FCS fetal calf serum
  • FCS fetal calf serum
  • FCS fetal calf serum
  • FCS fetal calf serum
  • FCS fetal calf serum
  • FCS fetal calf serum
  • FCS fetal calf serum
  • FCS fetal calf serum
  • FCS fetal calf serum
  • FCS fetal calf
  • Phorbol 12-myristate 13-acetate was obtained from Sigma (St. Louis, MO) and dissolved in dimethyl sulfoxide and stored at -20°C until use. Recombinant human CSF-1/M-CSF was kindly provided by Genetics Institute.
  • the monoclonal antibodies against phosphotyrosine (4G10), PI-3 kinase p85 regulatory subunit, Grb2, and paxillin and the polyclonal rabbit antisera antibody to the human c-fms receptor were obtained from Upstate Biotechnology.
  • Specific polyclonal antibodies to RAFTK were generated by immunizing New Zealand White rabbits with a bacterially expressed fusion protein consisting of GST and the carboxy terminus (amino acids 681-1009) of human RAFTK cDN A subcloned into the pGEX- 2T expression vector as described (Avraham, S. et al. (1995) J. Biol. Chem. 270, 27742-27751 ).
  • the Grb2 and PI-3 kinase GST fusion proteins were obtained from Santa Cruz Biotechnology. Electrophoresis reagents and nitrocellulose membranes were obtained from Bio-Rad Laboratories (Hercules, CA). All other chemicals including the protease inhibitors pepstatin, antipain, chymostatin, leupeptin, aprotinin, and alpha 1 antitrypsin were obtained from Sigma (St. Louis, MO). Because endotoxin is known to alter monocyte-macrophage function, all media and reagents were shown to be free of endotoxin contamination by Limulus endotoxinassay (Sigma Chemical) prior to using in cell cultures.
  • Cells were initially starved in DMEM with 0.5% FCS and stimulated in HBSS at density of 5 x 106/ml for varying time periods at 37°C with PMA (2nM-200nM/mI) or CSF-l/M-CSF(10U-10,000U/ml).
  • Bound proteins were solubilized in 30 ⁇ l of 2 X Laemmli buffer and further analyzed by immunoblotting. Samples were separated on 7.5% SDS-PAGE and then transferred to nitrocellulose membranes. The membranes were blocked with 5% non-fat milk protein and probed with primary antibody for 3 h at RT or 4°C overnight. Immunoreactive bands were visualized using FIRP-conjugated secondary antibody and the enhanced chemiluminescent (ECL) system (Amersham Co ⁇ ., Arlington Heights, IL). Blots were stripped (2% SDS, 62.5mM Tris, lOOmM Beta Mercaptoethanol) for 30 minutes at 50oC and washed in TBS-T for 60 minutes before blocking and re-probing with primary antibodies.
  • ECL enhanced chemiluminescent
  • GST-fusion protein Grb2-SH3 N-terminal domain, Grb2-SH3 C-terminal domain, Grb2-SH2 domain, and PI-3 Kinase-SH3 domain of the p85 regulatory subunit were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).
  • 1 mg of cell lysate was mixed with 5 g of GST-fusion protein and incubated for 1 h at 4°C on a rotatory shaker.
  • 50 ⁇ l of glutathione Sepharose 4B beads (Pharmacia Biotech) were added to preabsorb the complex. Following incubation for 3 h at 4°C on a rotatory shaker, the beads were centrifuged and washed three times with modified RIPA buffer. The bound proteins were eluted by boiling in Laemmli sample buffer and subjected to SDS-PAGE on 7.5% gel and Western Blot analysis.
  • RAFTK is expressed and phosphorylated in human monocyte-macrophages.
  • the permanent monocyte-macrophage cell line THP-1 as well as primary peripheral blood derived MMs or AMs were used as a model. Analysis by immunoprecipitation revealed abundant RAFTK protein in these cells. There appeared to be low levels of constitutive phosphorylation of RAFTK in these cells under unstimulated culture conditions.
  • RAFTK tyrosine phosphorylation of RAFTK
  • THPl cells were stimulated with PMA or CSF- 1 /M-CSF.
  • Phosphotyrosine levels in RAFTK immunoprecipitates peaked at 2.5 minutes and declined by 5 minutes. However, phosphotyrosine levels again increase by 7.5 minutes and decline after 10 minutes. There were not any changes in RAFTK protein levels to explain these fluctuations in phophotyrosine levels.
  • the membrane was then stripped and reprobed with anti- RAFTK antibody to confirm that equivalent amounts of RAFTK were loaded in each lane.
  • CSF- 1 /M-CSF stimulation of MM resulted in peak tyrosine phosphorylation on RAFTK by 1 minute which gradually decreased over time.
  • RAFTK in AM appeared to have a high constitutive degree of phosphorylation which, in response to CSF- 1 /M-CSF stimulation, increased slightly by 1 minute and gradually decreased over time.
  • Anti-RAFTK immunoblotting of RAFTK immunoprecipitates showed the ⁇ 120Kd phosphoprotein corresponded to the RAFTK protein. Depending on the resolution of the gels, RAFTK was seen to migrate either as a single band or as a doublet.
  • RAFTK associates with the signaling molecules PI-3 kinase and Grb-2. Because RAFTK, like FAK, acts as a platform kinase site for the coalescence of signaling and adaptor molecules at sites of focal adhesions, RAFTK immunoblots were examined for associating co-precipitating proteins. A specific association of RAFTK with PI-3 kinase, an important enzyme in modulating of phosphoinositol signaling (Auger, K. R., and Cantley, L. C. (1991) Cancer Cells 3, 263-270) was observed.
  • Grb2 is generally capable of associating with signaling molecules either through one of its two SH3 or through its SH2 domain. Studies were thus performed to determine which of the Grb2 regions may mediate its interaction with RAFTK.
  • RAFTK strongly associates with the Grb2 amino terminus-SH3 domain. There was some intermediate interactions between the SH2 domain and RAFTK molecule in CSF- 1 /M-CSF stimulated THPl cells.
  • RAFTK associates with the c-fms receptor upon mononuclear phagocyte cell activation with CSF-1/M-CSF.
  • RAFTK associates with the cytoskeletal protein paxillin in mononculear phagocyte.
  • RAFTK may be coimmunoprecipitated with molecules previously characterized as components of MM signaling pathways
  • the strength of paxillin's constitutive association with RAFTK transiently fluctuated after 1 minute stimulation by either CSF- 1 /M-CSF or PMA stimulation.
  • the paxillin RAFTK association appeared to return to constitutive levels after 5 minutes stimulation.
  • RAFTK a recently identified signaling molecule that is a member of the FAK family. RAFTK appeared to participate in certain previously described signaling pathways following activation of these cells.
  • Grb2 is an adaptor protein that has the capacity to link with a number of kinases and substrates and functions to facilitate signaling through creation of physical associations of such partners in enzymatic reactions (Pawson, T. (1995) Nature 373, 573-580).
  • PI-3 kinase appears to modulate phosphoinositol metabolism in a variety of cell types, including mononuclear phagocytes, and appears to be an important component of tyrosine kinase-regulated signaling pathways that lead to cell proliferation (Gold, M. R. et al.
  • CSF- 1 /M-CSF has been reported to induce the direct association of the p85a subunit of PI-3 kinase with the SH2 domain of Grb2 and Grb2-Sos complexes, supporting its role upstream of the Ras signaling pathway in monocytes (Saleem, A., et al. (1995) J. Biol Chem. 270, 10380-10388).
  • PI-3 kinase activation and the production of its metabolites has been suggested to be an upstream activator of calcium-independent form of PKC (Herrera-Velit, P. and Reiner, N. E. ( 1996) J. Immunology 156, 1157- 1 165).
  • RAFTK associated with c-Fms in CSF-1/M-CSF stimulated THPl cells shows that c-Fms also signals through focal adhesion contacts in concert with intergrin binding.
  • macrophages like megakaryocytes, prominently utilize RAFTK in cytokine mediated pathways of activation that are linked to focal contact formation.
  • the confluence of RAFTK and other kinases and cytoskeletal molecules provides a platform for the interactions of signaling molecules and adaptor proteins that regulate cell mo ⁇ hology to finely control certain components of the immune response such as adhesion or migration.
  • EXAMPLE 6 RAFTK, a Novel Member of the Focal Adhesion Kinase Family, Participates in T-Cell Receptor Signal
  • RAFTK is constitutively expressed in human T-cells and is rapidly phosphorylated upon the activation of the T-cell receptor (TCR) for antigen. This activation results in an increase in the association of RAFTK with the Src cytoplasmic tyrosine kinase Fyn. RAFTK also associates with the SH2 domain of Grb2 and with the cytoskeletal protein paxillin. The tyrosine phosphorylation of RAFTK following T-cell receptor-mediated stimulation was reduced by the pretreatment of cells with cytochalasin D, indicating the role of the cytoskeleton in this process. These observations show that RAFTK participates in T-cell receptor signaling and acts to link signals from the cell surface to the cytoskeleton and thereby effect the host immune response.
  • TCR T-cell receptor
  • RAFTK is phosphorylated in response to the activation of certain integrins in megakaryocytes (Li, J. et al. (1996) Blood 88, 417-428) and B- lymphocytes.
  • the induced phosphorylation of RAFTK via calcium-mediated ion channel pathways was shown first in PC- 12 pheochro ocytoma cells (Lev, S. et al. (1995) Nature 376, 737-745) and subsequently in megakaryocytes.
  • RAFTK is expressed in human T-lymphocytes and participates in signaling events triggered by the ligation of the TCR CD3 complex.
  • TCR CD3 complex Several of the interacting molecules that associate with RAFTK in human T-cells, including the cytoskeletal protein paxillin have been characterized. The following materials and methods were used to determine the participation of RAFTK in T-cell receptor signal transduction:
  • AATCC American Type Culture Collection
  • FCS fetal calf serum
  • PBLs Primary human peripheral blood lymphocytes (PBLs) were obtained by phlebotomy of normal volunteers after obtaining their informed consent and isolated by ficoll hypaque density centrifugation as previously described (Boyum, A. (1968) Scand. J. Lab Invest. 21 , (Suppl. 97)).
  • the anti-CD3 producing hybridoma was obtained from ATCC and grown in Iscove's modified Dulbecco's medium with 20% FCS.
  • cells were grown in serum-free and protein-free hybridoma medium (Sigma, St. Louis, MO) containing Nutridoma-HU 1% (Boehringer Mannheim, Indianapolis, IN).
  • the lectin phytohemagglutinin (PHA) was obtained from Pharmacia Biotech (Piscataway, NJ).
  • the nitrocellulose membrane was obtained from Bio-Rad
  • the anti-phosphotyrosine monoclonal antibody (4G10, IgG2a) was obtained from Upstate Biotechnology Inc. (Lake Placid, NY).
  • the anti- CD3 antibody X35 was obtained from Immunotech (Marseille, France), and OKT-3 was purified from OKT-3 producing hybridoma supernatants on protein A-Sepharose columns.
  • Antibodies to Fyn were obtained from Santa Cruz Biotechnology (Santa Cruz, CA) and Transduction Laboratories (Lexington, KY).
  • Anti-paxillin antibody was obtained from ICN Biomedical Inc. (Costa Mesa, CA).
  • Electrophoresis reagents were obtained from Bio-Rad Laboratories (Hercules, CA). The protease inhibitors leupeptin, aprotinin, and alpha 1 antitrypsin and all other reagents were obtained from Sigma Co. (St. Louis, MO).
  • Cells were washed twice with Hanks Balanced Salt Solution, Gibco (Grand Island, NY) and resuspended at 5 x 10 ⁇ cells/ml in DMEM medium. Cells were stimulated with either PHA (10 g/ml) or CD3 antibodies X35 (10 g/ml) or OKT-3 (10 g/ml) at 37°C for various time periods. In some experiments, cells were pretreated with cytochalasin D (2 m) for 60 min at 37°C before stimulation. After stimulation, 20 x l ⁇ 6 cells were microfuged for 10 seconds and lysed in 1 ml of modified RIPA buffer (50 mM Tris-HCl, pH 7.4, 1% NP-40.
  • modified RIPA buffer 50 mM Tris-HCl, pH 7.4, 1% NP-40.
  • TCL Total cell lysates
  • Bound proteins were solubilized in 40 ⁇ l of 2 X Laemmli buffer and further analyzed by immunoblotting. Samples were separated on 7.5% SDS-PAGE and then transferred to nitrocellulose membranes. The membranes were blocked with 5% non-fat milk protein and probed with primary antibody for 3 h at room temperature or 4°C overnight. Immunoreactive bands were visualized using HRP-conjugated secondary antibody and the enhanced chemiluminescent (ECL) system (Amersham Co ⁇ ., Arlington Heights, IL).
  • ECL enhanced chemiluminescent
  • GST-fusion protein Grb2-SH3 N-terminal domain, Grb2-SH3 C-terminal domain, Grb2-SH2 domain, and Fyn-SH2 and -SH3 domains were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).
  • 1 mg of cell lysate was mixed with 5 g of GST-fusion protein and incubated for 1 h at 4°C on a rotatory shaker.
  • 50 ⁇ l of glutathione Sepharose 4B beads (Pharmacia Biotech) were added to preabsorb the complex.
  • the beads were centrifuged and washed three times with modified RIPA buffer.
  • the bound proteins were eluted by boiling in Laemmli sample buffer and subjected to SDS-PAGE on 7.5% gel and Western Blot analysis.
  • RAFTK is expressed in human T-lymphocytes and is phosphorylated upon T-cell activation.
  • T-cell lines Two permanent T-cell lines, Jurkat and 119, were utilized as well as primary circulating PBLs. Analysis by immunoblot or immunoprecipitation revealed abundant RAFTK protein in these cells.
  • the stimulation of human T-cell lines with T-cell receptor ligation induces the tyrosine phosphorylation of a phosphoprotein around 1 15 Kd (Motto, D. G. et al. (1994) Journal of Biological Chemistry 269, 21608-21613; Hsi, E. D. et al. (1988) The Journal of Biological Chemistry 264, 10836-10842).
  • RAFTK tyrosine phosphorylation of RAFTK
  • Jurkat cells were stimulated with anti-T-cell receptor antibody X35 or OKT-3 or with the lectin PHA.
  • Ligation of the TCR/CD3 by monoclonal antibody X35 or OKT-3 reached a maximum by 2.5-5 min, and declined thereafter.
  • PHA stimulation resulted in an increased tyrosine phosphorylation by 5 min which declined slightly thereafter with substantial phosphorylation still detectable at 20 min.
  • Anti-RAFTK immunoblotting of anti-RAFTK immunoprecipitates showed that the -1 15 Kd phosphotyrosine polypeptide corresponds to the RAFTK protein.
  • RAFTK was seen to migrate either as a single band or as a doublet.
  • RAFTK associates with the signaling molecules Fyn and Grb-2.
  • RAFTK plays in T-cell signaling following activation via TCR/CD3 ligation, as well as the other stimulatory pathways activated by the lectin PHA.
  • coimmunoprecipitation studies followed by immunoblotting were performed.
  • a specific association of RAFTK with Fyn, a src family kinase which is known to be capable of associating with TCR was observed.
  • a small fraction of Fyn was readily detected as associating with RAFTK prior to the TCR/CD3 activation of Jurkat cells and this association increased following stimulation.
  • RAFTK ability of RAFTK to form in vitro complexes with various SH2 and SH3 domain-containing proteins was then examined.
  • GST-fusion proteins were added to the lysates of the stimulated Jurkat cells, the complexes were immunoprecipitated with glutathione-conjugated beads and the bound proteins were detected by anti-RAFTK immunoblotting.
  • Sepharose beads containing the GST-Grb2- SH2 domain and the GST-Fyn-SH2 domain bound RAFTK from the activated T-cell lysates.
  • RAFTK associates with the cytoskeletal protein paxillin.
  • RAFTK may be coimmunoprecipitated with molecules previously characterized as components of the TCR signaling pathways. It was desirable to determine whether certain cytoskeletal molecules in T-cells may also associate with this novel kinase. Using specific antibodies to RAFTK or paxillin, a constitutive association of these two molecules was found.
  • RAFTK a novel signaling molecule that appears to be a member of the FAK family, is present in human T-Iymphocytes and participates in signaling pathways following T-cell activation. Following the ligation of the TCR/CD3 there was a robust phosphorylation of RAFTK in both the model permanent T-cell lines, Jurkat and H9, as well as in primary PBLs. Parallel studies using other T-cell activators, specifically the lectin PHA, revealed a similar activation of RAFTK in a time and concentration dependent manner. It is noteworthy that following activation, RAFTK was found to be associated with several well-characterized components of TCR/CD3 signaling pathways, including Fyn and Grb2.
  • Fyn is known to be capable of associating with the TCR/CD3 complex, and is believed to play an important role in initiating the changes in phosphorylation that lead to further downstream signaling. This role has been most clearly demonstrated in studies showing the impaired development of CD4+CD8+ thymocytes from double mutant mice rendered null for Fyn and FAK through homologous recombination (Kanazawa, S. et al. (1996) Blood 87, 865-870). Also, transgenic thymocytes from mice overexpressing Fyn were hyperstimulatable, and overexpression of a catalytically inactive form of Fyn substantially inhibited TCR- mediated activation in otherwise normal thymocytes (Cooke, M. P.
  • Grb2 is a well-characterized adaptor molecule that seems capable of associating with a number of kinases and substrates and may also act to facilitate signaling through the enhancement of the physical association of such partners in enzymatic reactions (See, e.g., Li, N. et al. (1993) Nature 363, 85-88; Koch, C. A. et al. (1991) Science 252, 668-674; Pawson, T., and Gish, G. D. (1992) Cell 71, 359- 362). She and Grb2 have also been shown to play important roles in T-cell signaling (Motto, D. G. et al.
  • FAK B Another member of the FAK family, termed FAK B, was identified. Initial studies indicated that FAK B may associate with ZAP-70, an intracytoplasmic protein tyrosine kinase also capable of associating with TCR (Kanner, S. B. et al. (1994)
  • RAFTK co-associates with paxillin, a major component of the cytoskeleton.
  • cytochalasin D results in the reduced tyrosine phosphorylation of RAFTK upon T-cell receptor activation.
  • This response shows that RAFTK phosphorylation requires the formation of a cytoskeletal complex which provides a foundation for the interactions and compartmentalization of kinases and substrates.
  • EXAMPLE 7 Cytokine Signalling Through the Novel Tyrosine Kinase RAFTK in Kaposi's Sarcoma Cells
  • KS Kaposi's sarcoma
  • VEGF basic FGF
  • OSM oncostatin M
  • IL-6 IL-6
  • TNF- ⁇ TNF- ⁇
  • KS cells expressed a recently identified focal adhesion kinase termed RAFTK which is believed to coordinate surface signals from cytokine and integrin receptors with the cytoskeleton.
  • RAFTK was phosphorylated in KS cells following treatment with b- FGF, OSM, IL-6, VEGF, VRP, or TNF- ⁇ . Following RAFTK activation by these cytokines, there was enhanced association of RAFTK with the cytoskeletal protein paxillin. This association appeared to be mediated through the C-terminal domain of RAFTK based on studies using GST-fusion proteins of different RAFTK domains.
  • a novel surface receptor FLT-4 expressed on KS cells, as well as a novel intracytoplasmic tyrosine kinase RAFTK have been identified.
  • Treatment with diverse cytokines previously reported to potentiate KS cell growth all led to phosphorylation of RAFTK and its association with the cytoskeletal protein paxillin.
  • Kaposi's sarcoma is the most frequent neoplasm arising among patients with the acquired immune deficiency syndrome (AIDS).
  • the cell of origin of the tumor is believed to be from lymphatic endothelium (Dictor, M. (1988) Lymphology. 21, 53-60; Dorfman, R. F. (1988) Lymphology. 21, 45-52).
  • Etiological factors implicated in KS include the recently discovered human he ⁇ es virus 8 (HHV- 8)/Kaposi's sarcoma he ⁇ es virus (KSIIV) and TAT, the soluble transcriptional activator of HIV (See, e.g., Chang, Y. et al. ( 1994) Science. 266, 1865-1869; Zhong, W.
  • b-FGF basic fibroblast growth factor
  • VEGF vascular endothelial growth factor
  • IL-6 interleukin-6
  • TNF-a tumor necrosis factor alpha
  • VEGF and b-FGF receptors are of the protein tyrosine kinase family
  • oncostatin M and IL-6 utilize a common gpl30 subunit
  • TNF-a receptors are of the Fas/apoptosis CD95 family.
  • KS cells express RAFTK.
  • RAFTK is found to associate with the cytoskeletal protein paxillin. This observation has been extended and focused on the tyrosine kinase receptor termed FLT-4, which has been found in fetal and adult lymphatic endothelium
  • KS cells express the FLT-4 receptor, and treatment with its newly discovered ligand called VEGF related protein (VRP or VEGF-C) (Lee, J. et al. (1996) Proc. Natl. Acad. Sci. USA. 93, 1988-1992; Joukov V., et al. (1996) EMBOJ. 15, 290-298) again results in RAFTK phosphorylation.
  • VRP VEGF related protein
  • VEGF-C VEGF related protein
  • KS 38 Human Kaposi's sarcoma cells lines KS 38 were derived from cutaneous biopsy of an AIDS patient as previously described (Lunardi-Iskandar, Y. et al. (1995) J. Natl. Cancer. Inst. 87, 974-981; Masood R. et al. (1994) Human Retroviruses. 10, 969-975).
  • the cells were grown on 1.5% gelatin-coated flasks and were carried in RPMI 1640 with 15% fetal calf serum (FCS), 2mM glutamine, ImM MEM Sodium Pyruvate, 0.05mM MEM Non-Essential Amino Acids, lx MEM Amino Acids, 1% Nutridoma-HU (Boehringer Mannheim) and 50 mg/mL penicillin and 50 mg/ml streptomycin. Cultures were carried until near confluent prior to different treatments in the signaling studies described below. 293 cells were transfected with the FLT-4 gene and used as controls for detection of receptor protein as described (Lee, J. et al. ( 1996) Proc. Natl. Acad. Sci. USA . 93 , 1988- 1992).
  • RAFTK antibodies were generated using GST fusion proteins to various domains of the molecule and immunizing New Zealand rabbits as previously described (Avraham S. et al. (1995) J. Biol. Chem. 270, 27742-27751; Li J. et al. (1996) Blood. 88, 417-428). Using an ELISA assay, sera were screened for specific binding to RAFTK. Serum R4520 was chosen for further studies based on its titer in the ELISA. Serum R4520 did not cross react with FAK and was specific for RAFTK. Antibodies to the VEGF receptor FLK-1 and to the receptor FLT-4 were obtained from Genentech Inc. Antibodies to paxillin were obtained from Santa Cruz
  • Monoclonal anti-phosphotyrosine antibody (4G10) was obtained from Upstate Biotechnology Inc. (Lake Placid, NY). Electrophoresis reagents were obtained from Bio-Rad Laboratories (Hercules, CA). The Phorbol 12-myristate 13- acetate (PMA) and protease inhibitors leupeptin, aprotinin and alpha 1 antitrypsin and all other reagents were obtained from Sigma Co. (St.Louis, MO). The recombinant cytokines b-FGF, TNF-a ,and IL-6 were obtained from R&D systems.
  • VRP the ligand for the FLT-4 receptor
  • VEGF was obtained from Genentech, Inc. (South San Francisco, CA).
  • Recombinant oncostatin M was obtained from the AIDS Reagent Bank (Bethesda, MD).
  • KS 38 cells were cultured in Chamber Slides (Lab Tek) to 90% confluency. Cells were washed twice with cold PBS and then fixed for 30 min in 4% paraformaldehyde. Cells were washed 3X PBS and blocked for non-specific staining using 10% FCS in PBS for 30 minute on ice. FLT-4 and FLK-1 expression were determined using purified antiserum at a dilution 1 :100 for one hour on ice. Normal rabbit serum was used as a control for non-specific staining. After washing cells 3X with PBS, cells were stained with secondary antibody conjugated to FITC (Boehringer Mannheim) at 1 :500 dilution for one hour on ice. Proteins were visualized and photographed after washing 3X PBS using an inverted fluorescence microscope.
  • KS cells grown to 80% confluence, were serum-starved for 16-18 hrs and washed twice with Hank's balanced salt solution (Gibco BRL) prior to PMA or cytokine treatments.
  • KS cells were first treated with PMA to assess the effects of a chemical stimulus known to phosphorylate RAFTK in other cell systems (Avraham S. et al. (1995) J. Biol. Chem. 270, 27742-27751). After a time course of stimulation with PMA was established, the effects of cytokines were studied.
  • VEGF, VRP, TNF- ⁇ , oncostatin M, IL-6, or b-FGF were added to cultures at a range of concentrations for different time periods in vitro.
  • cell lysates were directly prepared within the culture dish by lysis in 500 ⁇ L modified RIPA (50 mM Tris-HCl, pH 7.4, l% NP-40, 0.25%> sodium deoxycholate, 150 mM NaCl, 1 mM PMSF, 10 (g/ml of aprotinin, leupeptin and pepstatin, 10 mM sodium vanadate, 10 mM sodium fluoride and 10 mM sodium pyrophosphate) per dish at varying timepoints.
  • Total cell lysates (TCL) were clarified by centrifugation at 10,000 x g for 10 min. Protein concentrations were determined by protein assay (Bio-Rad Laboratories).
  • Immunoprecipitation and Western blot analysis For immunoprecipitation studies, identical amounts of protein from each sample were clarified by incubation with protein A-Sepharose CL-4B (Pharmacia Biotech) for 1 h at 4°C. Following the removal of protein A-Sepharose by brief centrifugation, the solution was incubated with different primary antibodies as detailed below for each experiment for 4 h or overnight at 4°C. Immunoprecipitations of the antibody-antigen complexes were performed by incubation for 2 h at 4°C with 75 ⁇ l of protein A-Sepharose (10% suspension).
  • Non-specific bound proteins were removed by washing the Sepharose beads three times with modified RIPA buffer and one time with Phosphate buffered saline (PBS). Bound proteins were solubilized in 40 ⁇ l of 2 X Laemmli buffer and further analyzed by immunoblotting. Samples were separated on 7.5% SDS-PAGE and then transferred to nitrocellulose membranes. The membranes were blocked with 5% non-fat milk protein and probed with primary antibody for 2 h at RT or 4°C overnight. Immunoreactive bands were visualized using HRP-conjugated secondary antibody and the enhanced chemiluminescent (ECL) -system (Amersham Co ⁇ ., Arlington Heights, IL).
  • ECL enhanced chemiluminescent
  • Kaposi sarcoma cells express Flk-I and Flt-4 receptors. To characterize the effects of different cytokines on KS cell signalling the KS
  • KS spindle cells appear to be derived from lymphatic endothelium.
  • IFA indirect immunofluorescence
  • RAFTK is expressed in Kaposi sarcoma cells and phosphorylated upon cytokine treatment.
  • KS 38 cells were further characterized for expression of RAFTK.
  • KS 38 cells expressed significant amounts of RAFTK protein as detected by Western blot and immunoprecipitation.
  • PMA treatment of KS 38 cells resulted in a time dependent phosphorylation of RAFTK.
  • RAFTK is expressed in KS 38 cells, whether or not treatment of these cells with VEGF or VRP, respective ligands for the FLK-1 and FLT-4 receptors, resulted in activation of signalling pathways that included RAFTK was investigated. There was a clear time dependent phosphorylation of RAFTK in response to VRP. Similar changes were observed following treatment with VEGF.
  • cytokines such as b-FGF, oncostatin M, IL-6 and TNF-a have been reported to promote in vitro proliferation of KS cells.
  • Cytokine treatment of Kaposi sarcoma cells results in RAFTK association with the cytoskeletal protein paxillin.
  • RAFTK was phosphorylated by cytokines like oncostatin M, IL-6, b-FGF and TNF- ⁇ known to stimulate KS cell growth, as well as the endothelial growth factors VEGF and VRP, whether this phosphorylation might modulate the association of RAFTK with certain cytoskeletal molecules was investigated. Using specific antibodies to RAFTK or paxillin, significantly increased association of these two molecules following cytokine treatments was found. The development of authentic permanent KS cell lines has afforded the opportunity to characterize the surface structures of these cells and to examine which cytokines may modulate proliferation of the neoplasm.
  • KS 38 cell line was derived from a patient with cutaneous KS as a model because of its previously characterized properties that closely correspond to those of primary pathological KS specimens (Lunardi-Iskandar, Y. et al. (1995) ./ Natl Cancer. Inst. 87, 974-981).
  • the expression of novel receptors on KS 38 cells which are preferentially expressed in normal lymphatic endothelium was investigated, and characterization made of signalling pathways that may link surface receptor activation to the cytoskeleton in these cells.
  • tyrosine kinase FLT-4 receptor is relatively restricted in expression in normal tissues, with prior studies indicating its presence on the surface of lymphatic endothelium (Kaipainen A. et al. (1995) Proc. Natl. Acad. Sci. USA. 92, 3566-3570; Kaipainen A. et al. (1993) J. Exp. Med. 178, 2077-2088; Pajusola K. et al. (1993) Oncogene. 8, 2931-2937).
  • KS 38 cells express FLT-4 as well as the related FLK-1 receptor.
  • the recently identified ligand VRP specifically binds to the FLT-4 receptor (Lee, J. et al. (1996) Proc. Natl.
  • cytokines To survey this range of cytokines, representative cytokines from each family was chosen and a comparative analysis was made of b-FGF, TNF- ⁇ , oncostatin M, and IL-6 with VEGF and VRP. They all signalled via the recently identified RAFTK molecule.
  • RAFTK functions as a "platform kinase" upon which a number of intracytoplasmic kinases and adaptor molecules converge. The convergence of such molecules facilitates transmission of surface signals to the cytoskeleton.
  • b-FGF, VEGF and VRP signal through receptor tyrosine kinases, OSM and IL-6 bind to a dual receptor with a specific chain and a shared gpl30 chain, and TNF-a binds to the CD95 receptor family linked to apoptosis.
  • RAFTK may participate in each of these diverse receptor activated pathways.
  • RAFTK functions in KS cells to transduce receptor signals via association with cytoskeletal molecules such as paxillin.
  • RAFTK activation likely participates in a final common pathway for KS cell growth.
  • specific inhibitors of RAFTK are particularly useful in treatment of this disorder.
  • GAG AAA ATC AAT GTA GCT GTC AAG ACC TGC AAG AAA GAC TGC ACT CTG 1688 Glu Lys He Asn Val Ala Val Lys Thr Cys Lys Lys Asp Cys Thr Leu 450 455 460 465
  • GCCACTTTGC ACGACGCCCT CTCCCCACCC CTACCCCTGG CTGTACTGCT CAGGCTGCAG 3501
  • Trp Met Phe Ala Val Cys Met Trp Glu He Leu Ser Phe Gly Lys Gin 610 615 620
  • GTC AAA TGC ACA GTG CAG ACA GAG ATC CAG GAG ATC ATC ACC TCC ATC 423 Val Lys Cys Thr Val Gin Thr Glu He Gin Glu He He Thr Ser He 60 65 70
  • ATC CCC ACA CTA AAC CTG GAG GCT CGG CGG TCG CAC CTC TCA GAA AGC 1383 He Pro Thr Leu Asn Leu Glu Ala Arg Arg Ser His Leu Ser Glu Ser 380 385 390
  • GGC ATC ATT GAA GAG GAA CCC ACC TGG ATT ATC ATG GAA CTG TAT CCT 1719 Gly He He Glu Glu Pro Thr Trp He He Met Glu Leu Tyr Pro
  • Trp Met Phe Ala Val Cys Met Trp Glu He Leu Ser Phe Gly Lys Gin 610 615 620

Abstract

The present invention relates to the discovery of novel 'RAFTK' genes and polypeptides. Therapeutics, diagnostics and screening assays based on these molecules are also disclosed.

Description

NOVEL RAFTK SIGNALING MOLECULES AND USES THEREFOR
Government Funding
This work was supported, in part, by National Institutes of Health grants: HL 46668, HL 53745-02, HL 55187-01, HL 43510-06A, HL 43510-07, HL 51456-02 and HL 55445-01. The U.S. Government may, therefore, have certain rights to this invention.
Background of the Invention Signal transduction is triggered by stimulation of a cell surface receptor which either has kinase activity itself or is physically and/or functionally linked to an intracellular protein tyrosine kinase (PTK) (Cantley, L.C. et al. (1991) Cell 64, 281- 302; Shattil, S.J., and Brugge, J.S. (1991) Curr. Opin. Cell Biol. 3, 869-879; Weiss, A. (1993) Cell 73, 209-212). PTKs participate in a variety of signal transduction pathways which modulate cell growth and differentiation (Ullrich, A., and
Schlessinger, J. (1990) Cell 61, 203-212; Pawson, T., and Gish, G.D. (1992) Cell 71, 359-362; Fantl, W.J., et al. (1993) Ann. Rev. Biochem. 62, 453-481). Through a series of inducible and reversible protein-protein interactions and phosphorylation-mediated enzymatic activities, protein-tyrosine kinases are recruited to relay signals throughout the cell. Such interactions are involved in all stages of the intracellular signal transduction process - at the plasma membrane, where the signal is initiated; in the cytoplasm, where the signals are disseminated to different cellular locations; and in the nucleus, where other proteins involved in transcriptional control form complexes to regulate transcription of particular genes. Protein kinase cascades allow for amplification, feedback, cross-talk, and branching in signal transduction pathways.
The integrin cell surface receptors are also capable of transducing cytoplasmic signals (Hynes, R.O. (1992) Cell 69, 11-25; Juliano, R.L., and Haskill, S. (1993) J. Cell Biol. 120, 577-585; Schwartz, M.A. (1992) Trends Cell Biol. 2, 304-308) and activation of this pathway is linked to one or more PTKs (Guan, J.-L., et al. (1991) Cell Regul. 2, 951 -964; Kornberg, L.J.et al. ( 1991 ) Proc. Natl. Acad. Sci. USA 88, 8392-8396). Integrins are the major family of cell surface receptors that mediate adhesive interactions (Albelda, S. M. and Buck, C. A. (1990) FASEB J4, 2868). Integrin receptor engagement and subsequent clustering of integrins lead to the formation of focal adhesion sites. Protein assemblies of integrins, linked to intracellular cytoskeletal complexes and to bundles of actin filaments in focal adhesions, play critical roles in modulating adhesion and inducing shape changes involved in cell spreading and locomotion (Hynes R O. (1992) Cell 69, 1 1). Such cellular adhesive interactions, mediated by cell surface receptors that bind to ligands on adjacent cells or in the extracellular matrix, participate in the processes of cell migration, proliferation and differentiation (Gumbiner. B. M. (1993) Neuron 1 1 , 551 ). A large number of cytoplasmic proteins have been identified as components of focal adhesion structures (Burridge K, et al. (1998) Ann Rev Cell Biol 4, 487; Turner. C. E. and Burridge, K. (1991) Curr Opin Cell Biol 3, 849). These arc classified as either structural proteins or signaling molecules. Vinculin, a-actinin and talin are well known as the major structural proteins at focal adhesion sites (Turner, C. E. and Burridge, K. ( 1991 ) Curr Opin Cell Biol 3, 849). In vitro and in vivo studies have shown that these proteins serve as bridge-like linkages between the integrins and actin filaments, and as a dock for the association of signaling proteins that leads to integrin- induced changes in cell function (Clark, E. A. and Brugge, J.S. (1995) Science 268, 233). Several PTKs have been implicated in integrin signaling events by virtue of either their integrin-dependent activation or their localization to these focal contacts (Clark, E. A. and Brugge, J. S. (1995) Science 268, 233; Richardson, A. and Parsons, J. T. (1995) Bioessays 17, 229). Two focal adhesion proteins that demonstrate a high stoichiometry of tyrosine phosphorylation upon integrin activation are the focal adhesion kinase (FAK) and paxillin (Schaller, M. D. et al. ( 1992) Proc Natl Acad Sci USA 89, 5192; Hanks, S. K. et al. (1992) Proc Natl Acad Sci USA 89, 8487; Burridge, K. et al. (1992) J Cell Biol 1 19, 893). The tyrosine phosphorylation of these two proteins has been suggested as being involved in both the formation of focal adhesions and the assembly of actin stress fibers (Burridge, K. et al. (1992) J Cell Biol 1 19, 893). In addition, the association of FAK with the cytoskeletal protein talin in NIH3T3 cells was observed (Chen, H-C et al. (1995) J Biol Chem 270, 16995). ppl25 is phosphorylated in response to cdlbβ3- integrin-mediated cell adhesion iSe,e e.g., Juliano, R.L., and Haskill, S. (1993) J. Cell Biol. 120, 577-585; Hanks, S.K.et al. (1992) Proc. Natl. Acad. Sci. USA 89, 8487-8489; Schaller, M.D., et al. (1992) Proc. Natl. Acad. Sci. USA 89, 5192-5196). Induction of the kinase activity and the tyrosine phosphorylation of pp^*^**^ were observed following the adherence of fibroblasts to fibronectin (See, e.g., Guan, J.-L.et al. (1991) Cell Regul. 2, 951-964; Kornberg, L.J.et al. (1991) Proc. Natl. Acad. Sci. USA 88, 8392-8396; Hanks, S.K.et al. (1992) Proc. Natl. Acad. Sci. USA 89, 8487-8489; Schaller, M.D., et al. ( 1992) Proc. Natl. Acad. Sci. USA 89, 5192-5196), the adherence of epidermal carcinoma cells to fibronectin, laminin, or collagen type IV (Kornberg, L., et al. (1992) J Biol. Chem. 267, 23439-23442), and the aggregation of platelets in the presence of fibrinogen, a ligand for αllbβ3- integrin (glycoprotein Ilb IIIa) (Lipfert, L., et al. (1992) J. Cell Biol. 1 19, 905-912). Phosphorylated ppl25FAK is localized in focal adhesion contacts.
Src tyrosine kinases are capable of interacting with components of focal adhesions upon kinase activation (Weng, Z. et al. (1993) J Biol Chem 268, 14956; Schaller, M. D. et al. (1994) Mol Cell Biol 14, 1680). The Tyr*39? of FAK is autophosphorylated upon integrin-mediated stimulation. This phosphotyrosine then provides a binding site for the SH2 domain of pόOSrc and its family members, e.g. p59Fyn (Cobb, B. S. et al. (1994) Mol Cell Biol 14, 147 Eide, B. L. et al. (1995) Mol Cell Biol 15, 2819). Integrin-mediated signal transduction was found to be linked to the Ras pathway by Grb2 binding to FAK (Schlaepfer, D. D. et al. (1994) Nature 372, 786; Kharbanda, S. et al. (1995) Proc Natl Acad Sci USA 92, 6132). Phosphatidylinositol 3-kinase (PI-3 kinase) was also associated with the activated FAK (Chen, H-C et al. (1994) Proc Natl Acad Sci USA 91 , 10148; Guinebault, C. et al. (1995) J Cell Biol 129, 831). In addition, FAK phosphorylation is stimulated by a number of other substances, including small peptide mitogens such as vasopressin, bombesin, endothelin (Zachary, I. et al. (1992) J Biol Chem 267, 19031; Sinnett- Smith, J, et al. (1993) . / Biol Chem 268, 14261), and bradykinin (Leeb-Lundberg, L. M. F et al. (1994) J Biol Chem 269, 24328); bioactive lipids such as Alzheimer's Ab peptide (Zhang C et al. J Biol Chem 269, 25247, 1994); antigens for immunoglobulin E receptors (Hamawy, M. M. et al. (1993) J Biol Chem 268, 6851); neuropeptide receptors (Zhang, C. et al. (1994) J. Biol. Chem. 269, 25247-25250), growth factors such as hepatocyte growth factor, platelet-derived growth factor and M-CSF-1 ; (Kharbanda, S. et al. (1995) Proc Natl Acad Sci USA 92, 6132; Matsumoto, K. et al. (1994) Jβ / Chem 269, 31807; Rankin, S. and Rozengurt, E. (1994) J Biol Chem 269, 704) and upon oncogenic transformation (Guan, J.-L., and Shalloway, D. (1992) Nature 358, 690-692) in adherent cells. ppHS^ *** has been cloned from Xenopus (X. Laevis), avian, rodent, and human species and is expressed in a wide range of cell types (See, e.g., Schaller, M.D.et al. (1992) Proc. Natl. Acad. Sci. USA 89, 5192-5196; Schaller, M.D., and Parsons, J.T. (1993) Trends Cell Biol. 3, 258-262; Clark, E.A., and Brugge, J.S. (1995) Science 268, 233-239).
Summary of the Invention The present invention is based on the discovery of novel molecules, referred to herein as "related adhesion focal tyrosine kinase" or "RAFTK" polypeptide molecules and the nucleic acid molecules coding therefore. The RAFTK molecules of the present invention are useful in regulating a variety of cellular processes. The RAFTK polypeptide is an intracytoplasmic protein tyrosine kinase.
In one aspect, the invention features isolated vertebrate RAFTK nucleic acid molecules. In a preferred embodiment a RAFTK nucleic acid has a nucleic acid sequence shown in one of SEQ ID NOs: 1 or 3, or a complement or fragment thereof. The disclosed molecules can be non-coding, (e.g. probe, antisense or ribozyme molecules) or can encode a polypeptide with RAFTK bioactivity. In a preferred embodiment a RAFTK nucleic acid of the present invention comprises the coding region of one of SEQ ID NOs: 1 or 3. In another preferred embodiment the subject RAFTK nucleic acids encode a polypeptide with a RAFTK bioactivity. In a particularly preferred embodiment the nucleic acid of the present invention encodes a polypeptide shown in one of SEQ ID NOs: 2 or 4.
In one embodiment, the nucleic acids of the present invention can hybridize to a vertebrate RAFTK gene or to the complement of a vertebrate RAFTK gene. In a further embodiment, a RAFTK nucleic acid hybridizes with the coding sequence designated in one of SEQ ID NOs: l or 3 or to the complement to the coding sequence designated in one of SEQ ID NOs:l or 3. In a preferred embodiment, the hybridization is conducted under stringent conditions.
In futher embodiments, the nucleic acid molecule is a RAFTK nucleic acid molecule that is at least 60%, at least 70%, preferably 80%, more preferably 85%, and even more preferably at least 95% homologous in sequence to the nucleic acids shown in one of SEQ ID NOs: 1 or 3 or to the complement of the nucleic acid shown in one of SEQ ID NOs:l or 3. In another embodiment, the RAFTK nucleic acid molecule encodes a polypeptide that is at least 60%, preferably at least 70%, preferably 80%, and more preferably at least 85%, and even more preferably at least 95% homologous in sequence to the polypeptide shown in one of SEQ ID NOs: 2 or 4.
The invention also provides probes and primers comprising substantially purified oligonucleotides, which correspond to a region of nucleotide sequence which hybridizes to at least 6 consecutive nucleotides of the sequence set forth in one of SEQ ID NOs:l or 3. the complement of one of SEQ ID NOs: 1 or 3, or naturally occurring mutants thereof. In a preferred embodiment a probe or primer of the present invention hybridizes under stringent conditions to a nucleic acid corresponding to at least 12 consecutive nucleotides of either sense or antisense sequence of one or more of SEQ ID NOs:l or 3; preferably to at least 25 consecutive nucleotides; and more preferably to at least 40, 50 or 75 consecutive nucleotides of either sense or antisense sequence of one or more of SEQ ID NOs: 1 or 3. In a preferred embodiment, a probe of the present invention comprises all or a portion of nucleotides 1595-2974 of one of SEQ ID NOs: l or 3. In preferred embodiments, the probe/primer further includes a label group, which is capable of being detected. For expression, the subject RAFTK nucleic acids can include a transcriptional regulatory sequence, e.g. at least one of a transcriptional promoter (e.g., for constitutive expression or inducible expression) or transcriptional enhancer sequence, which regulatory sequence is operably linked to the RAFTK gene sequence. Such regulatory sequences in conjunction with a RAFTK nucleic acid molecules can be useful vectors for gene expression. This invention also features host cells transfected with such an expression vector whether prokaryotic or eukaryotic and m vitro (e.g. cell culture) and in vivo (e.g. transgenic) methods for producing RAFTK polypeptides by employing the expression vectors.
The invention also features transgenic non-human animals which include a heterologous form of a RAFTK gene described herein, or which misexpress an endogenous RAFTK gene (e.g., an animal in which expression of one or more of the subject RAFTK proteins is disrupted). Such a transgenic animal can serve as an animal model for studying cellular and tissue disorders comprising mutated or mis- expressed RAFTK alleles or can be used in drug screening. Alternatively, such a transgenic animal can be useful for expressing recombinant RAFTK polypeptides. In another aspect, the invention features isolated RAFTK polypeptides, preferably substantially pure preparations e.g., of plasma purified or recombinantly produced RAFTK polypeptides. In preferred embodiments, the polypeptide has a RAFTK bioactivity. In addition, RAFTK polypeptides which specifically antagonize the activity of a native RAFTK polypeptide, such as can be provided by truncation mutants or other dominant negative mutants, are also specifically contemplated by the present invention.
In one embodiment, the polypeptide is identical to or homologous to a RAFTK protein represented in one of SEQ ID NOs: 2 or 4. Related members of the vertebrate and particularly the mammalian RAFTK family are also within the scope of the invention. Preferably, a RAFTK polypeptide has an amino acid sequence at least 60%, at least 70% homologous, preferably at least 80%, more preferably at least 90%, and even more preferably at least 95% homologous to the polypeptide represented by one of SEQ ID NOs: 2 or 4. In a preferred embodiment, the RAFTK polypeptide is encoded by a nucleic acid which hybridizes with a nucleic acid sequence represented in one of SEQ ID NOs: 1 or 3. The subject RAFTK polypeptides also include modified polypeptides, which are resistant to post-translation modification, as for example, due to mutations which alter modification sites (such as tyrosine, threonine, serine or aspargine residues), or which prevent glycosylation of the protein, or which prevent interaction of the protein with intracellular proteins.
The RAFTK polypeptide can comprise a full length protein, such as represented in one of SEQ ID NOs: 2 or 4, or it can comprise a fragment corresponding to one or more particular motifs/domains, or to arbitrary sizes, e.g., at least 5, 10, 25, 50, 100, 150 or 200 amino acids in length. In preferred embodiments, the RAFTK polypeptide includes at least a portion of an RAFTK kinase domain and has a RAFTK bioactivity. In preferred embodiments the subject RAFTK polypeptides have a molecular weight of approximately 123kD.
Another aspect of the invention features chimeric molecules (e.g. fusion proteins) comprised of a RAFTK polypeptides. For instance, the RAFTK polypeptides can be provided as a recombinant fusion protein which includes a second polypeptide portion, e.g., a second polypeptide having an amino acid sequence unrelated (heterologous) to the RAFTK polypeptide, (e.g. the second polypeptide portion is glutathione-S-transferase, an enzymatic activity such as alkaline phosphatase or an epitope tag).
A further aspect of the invention features pharmaceutical preparations including RAFTK polypeptides or homologues, or the nucleic acids encoding RAFTK polypeptides and a pharmaceutically acceptable carrier.
Yet another aspect of the present invention pertains to an immunogen comprising a RAFTK polypeptide in an immunogenic preparation, the immunogen being capable of eliciting an immune response specific for a RAFTK polypeptide, e.g., a humoral response, an antibody response and/or cellular response. In preferred embodiments, the immunogen comprises an antigenic determinant, e.g. a unique determinant, from the protein represented by one of SEQ ID NOs: 2 or 4.
A still further aspect of the present invention features antibodies and antibody preparations specifically reactive with an epitope of the RAFTK protein. In preferred embodiments the antibody specifically binds to an epitope represented in one of SEQ ID NOs:2 or 4. In a particularly preferred embodiment, an antibody of the present specifically recognizes amino acids 68-1009 from the RAFTK c-terminus.
Yet another aspect of the present invention concerns a method for modulating the growth, migration, differentiation, and/or survival of a cell, e.g., a mast cell, a melanocyte, or a megakaryocyte, by modulating RAFTK bioactivity (e.g., by potentiating or disrupting certain protein-protein interactions in a RAFTK signaling pathway). In general, whether carried out in vivo, in vitro, or in situ, the method comprises treating the cell with an effective amount of a RAFTK therapeutic so as to alter, relative to the cell in the absence of treatment, at least one of (i) rate of growth, (ii) differentiation, (iii) hematopoiesis or (iv) survival of the cell. In preferred embodiments the cells are selected from a group incouding mast cells, melanocytes, and megakaryocytic cells. In another embodiment a RAFTK therapeutic can be used in a method of modulatin cell adhesion, migration, phagocytosis, or motility. In preferred embodiments, the method can be used to modulate focal adhesion formation or to treat metastasis by a tumor cell.
Accordingly, the method can be carried out with RAFTK therapeutics such as peptide and peptidomimetics or other molecules identified in the above-referenced drug screens which agonize or antagonize the effects of signaling from a RAFTK protein or ligand binding of a RAFTK protein. Other RAFTK therapeutics include antisense constructs for inhibiting expression of RAFTK proteins, and dominant negative mutants of RAFTK proteins which competitively inhibit ligand interactions upstream and signal transduction downstream of the wild-type RAFTK protein. In a preferred embodiment the subject RAFTK peptides are capable of modulating signal transduction in a pathway involving stem cell factor, thrombin, fibronectin, CSF-l/M- CSF, T cell receptor stimulation, bFGF, oncoprotein M, IL-6, or TNFa.
A further aspect of the present invention provides a method of determining if a subject is at risk for a disorder characterized by unwanted cell proliferation or aberrant control of differentiation. The method includes detecting, in a tissue of the subject, the presence or absence of a genetic lesion characterized by at least one of (i) a mutation of a gene encoding a RAFTK protein, e.g. represented in one of SEQ ID NOs: 1 or 3, or a homolog thereof; or (ii) the mis-expression of a RAFTK gene. In preferred embodiments, detecting the genetic lesion includes ascertaining the existence of at least one of: a deletion of one or more nucleotides from a RAFTK gene; an addition of one or more nucleotides to the gene, a substitution of one or more nucleotides of the gene, a gross chromosomal rearrangement of the gene; an alteration in the level of a messenger RNA transcript of the gene; the presence of a non- wild type splicing pattern of a messenger RNA transcript of the gene; a non- wild type level of the protein; and/or an aberrant level of RAFTK protein.
For example, detecting the genetic lesion can include (i) providing a probe/primer comprised of an oligonucleotide which hybridizes to a sense or antisense sequence of a RAFTK gene or naturally occurring mutants thereof, or 5' or 3' flanking sequences naturally associated with the RAFTK gene; (ii) contacting the probe/primer with an appropriate nucleic acid containing sample; and (iii) detecting, by hybridization of the probe/primer to the nucleic acid, the presence or absence of the genetic lesion; e.g., wherein detecting the lesion comprises utilizing the probe/primer to determine the nucleotide sequence of the RAFTK gene and, optionally, of the flanking nucleic acid sequences. For example, the primer can be employed in a polymerase chain reaction (PCR) or in a ligation chain reaction (LCR). In alternate embodiments, the level of a RAFTK protein is detected in an immunoassay using an antibody which is specifically immunoreactive with the RAFTK protein. In a further aspect the invention provides for methods of preparing differentiated blood cells by modulating the activity of a RAFTK protein in a progenitor stem cell. In a preferred embodiment the subject method can be used to prepare megakaryocytes. Platelets can also be prepared using the subject method. In yet another aspect, the invention provides assays, e.g., for screening test compounds to identify inhibitors, or alternatively, potentiators, of an interaction between a RAFTK protein and, for example, an intracellular protein which binds to the RAFTK protein. An exemplary method includes the steps of (i) combining a RAFTK polypeptide or bioactive fragments thereof, a RAFTK target molecule, and a test compound, e.g., under conditions wherein, but for the test compound, the RAFTK protein and target molecule arc able to interact; and (ii) detecting the formation of a complex which includes the RAFTK protein and the target polypeptide either by directly quantitating the complex, or by measuring a bioactivity of the RAFTK protein. Several RAFTK binding-proteins have been identified and any of these novel interactions can be exploited in the subject drug screening assays. A statistically significant change, such as a decrease, in the interaction of the RAFTK and target molecule in the presence of a test compound (relative to what is detected in the absence of the test compound) is indicative of a modulation (e.g., inhibition or potentiation of the interaction between the RAFTK protein and the target molecule). In preferred embodiments the ability of a compound to affect the interaction between and one or more of the RAFTK binding-proteins selected from the group consisting of paxillin, protein kinase C (PKC)-α, PKC-δ, src, fyn, Grb2, PI3 kinase, the c-fms receptor, and calpain, is detected. In certain embodiments the phosphorylation state of RAFTK or a RAFTK binding protein is measured as a readout of protein-protein interaction. In certain embodiments the reaction mixture can be a reconstituted protein mixture or a cell lysate. In certain embodiments the RAFTK protein can be a recombinant protein. In certain embodiments either the RAFTK protein or the ΛΛ -TΛT-binding protein is a fusion protein and in preferred embodiments, at least one of the proteins includes a label group for detection. In yet another embodiment the reaction mixture is a whole cell and the interaction of RAFTK and a RAFTK binding protein is detected in a two hybrid assay. In yet another aspect the invention provides for compounds identified using the subject assay, whether agonists or antagonists (inhibitors) of RAFTK activity. In one embodiment the compounds identified in the subject screening assays are included in a pharmaceutical preparation. In yet another embodiment the invention provides for a method of modulating cell growth, differentiation or survival by contacting a cell with a pharmaceutical preparation including a compound identified in one of the subject drug screening assays.
Other features and advantages of the invention will be apparent from the following detailed description and claims.
Brief Description of the Drawings
Figure 1 is a schematic representation and restriction enzyme map of the RAFTK cDNA. The various cDNA clones, obtained from the Human Hippocampus cDNA Library (in Zap II vector) and the CMK/PMA cDNA library (in λ-gtl 0 vector) are shown as indicated. Restriction enzyme sites are indicated along the length of the cDNA.
Figure 2 shows a comparison of the deduced amino acid sequence of RAFTK with those of m-ppl25FAK*, src, c-fyn, htk and fgfr. Gaps (indicated by dashes) are introduced to optimize the alignment. Amino acid residues found to be conserved are boxed.
Figure 3 shows an alignment of the predicted amino acid sequences (single- letter code) of the mouse RAFTK, human RAFTK and the mouse ppl25^ A*" gene translated product. Amino acid residues found to be conserved are boxed. Figure 4 shows haplotype analysis of Chromosome 14 genetic markers in
(C57BL/6J) x M. spretus)F| x M. spretus (BSS type) backcross mice showing linkage and relative position of RAFTK. Closed boxes indicate the inheritance of the C57BL/6J (B) allele and open boxes indicate the inheritance of the M. spretus (S) allele from the (C57BL/6J) x M. spretus)F] parent. Gene names and references to these loci can be found in GBASE. The first two columns indicate the number of backcross progeny with no recombinations. The following columns indicate recombinational events between adjacent loci (signified by a change from open box to closed box). The number of recombinants are listed below each column and the recombination frequency (REC %) between adjacent loci is indicated. Figure 5 shows co-segregation of RAFTK and Gnrh in BXD RI lines and localization to Chromosome 14. Strain distribution patterns are depicted for RAFTK in the BXD RI lines. The RI line distribution pattern is compared with that of the Gnrh locus. Map units are indicated between RAFTK and Gnrh, as are 95% confidence limits.
Detailed Description of the Invention Protein tyrosine kinases (PTKs) play salient roles in a variety of signal transduction pathways which modulate cell growth and differentiation (Ullrich, A., and Schlessinger, J. (1990) Cell 61, 203-212; Pawson, T., and Gish, G.D. (1992) Cell 71 , 359-362; Fantl, W.J., et al. (1993) Ann. Rev. Biochem. 62, 453-481). The novel RAFTK proteins of the present invention were identified using PCR primers based on conserved sequences of protein-tyrosine kinases.
The human RAFTK gene was cloned from the CM cell line, which has properties of cells of the megakaryocytic lineage. The 3.6 kb RAFTK human cDNA is shown in SEQ ID NO: 1. The full length cDNA contains an open reading frame with the first in-frame ATG codon located at nucleotides 294-296, followed by a stop codon at positions 3260-3262. RAFTK is 51 % homologous to focal adhesion kinase, FAK at the nucleic acid level.
The murine homolog was subsequently cloned, based on the ability of a probe derived from the human sequence to hybridize to the mouse gene under high stringency conditions. The murine RAFTK homolog encodes a protein of 1009 amino acids. The amino acid sequences of the human and murine RAFTK proteins are 95% homologous and the nucleic acid sequences are 90% homologous. The RAFTK gene was mapped to human chromosome 8 and to chromosome 14 in the mouse.
The open reading frame of the RAFTK nucleic acid encodes a predicted protein of 1009 amino acid residues. The RAFTK protein migrates with a molecular weight of approximately 115-125 kD. In preferred embodiments, the RAFTK protein of the present invention is approximately about 123 kD. The RAFTK proteins of the present invention can be activated by phosphorylation , and it will be understood that other post-translational modifications can alter the apparent molecular weight of the protein. The RAFTK polypeptide contains several structural motifs common to all protein kinases, including the putative ATP-binding site (G432-X-G434_χ_χ_G437, where X is any amino acid) and three residues that are predicted to interact with the γ phosphate group of the bound ATP molecule (at amino acids 402, 529, and 655). The amino acid sequences at positions 549-554 and 588-592 are also conserved among protein-tyrosine kinases. The kinase domain consists primarily of the catalytic domain including the putative ATP-binding site (amino acids 432-437). Amino acid residues 880-887 are important in mediating association of RAFTK with src and/or fyn, particularly when the tyrosine residue at 881 is phosphorylated. The kinase domain of RAFTK is flanked by N-terminal and C-terminal regions; the N-terminal region of the protein (amino acids 1-39) is unique and the C-terminal region contains a proline-rich stretch (residues 690-767) in which the proline content exceeds 20%. RAFTK lacks myristilation sites and SH2 and SH3 domains.
RAFTK was found to be expressed in fetal brain, lung, and liver, and to have a less restricted pattern of expression in adults. Expression was detected in a variety of adult tissues, including: CD34+ bone marrow cells, megakaryocytes, platelets, brain (particularly in the amygdala and hippocampus), macrophages, peripheral blood lymphocytes, spleen, thymus, B lymphocytes, T lymphocytes, and certain cancer cells.
Accordingly, certain aspects of the present invention relate to nucleic acid molecules encoding a vertebrate, e.g., mammalian RAFTK polypeptides, the RAFTK polypeptides, antibodies immunoreactive with RAFTK polypeptides, and preparations of such compositions. In addition, drug discovery assays are provided for identifying agents which can modulate the biological function of RAFTK proteins. Such agents can be useful therapeutically, therefore, to alter the growth and/or differentiation of a cell. Moreover, the present invention provides diagnostic and therapeutic assays and reagents for detecting and treating disorders involving, for example, aberrant expression (or loss thereof) of mammalian RAFTK genes. Other aspects of the invention are described below or will be apparent to those skilled in the art in light of the present disclosure.
Definitions For convenience, the meaning of certain terms and phrases employed in the specification, examples, and appended claims are provided below.
The term "binding" as used herein is meant to include detectable interactions between molecules, such as can be detected using, for example, a yeast two hybrid assay. Also encompassed by this term are enzyme/substrate interactions (e.g. phosphorylation). Interactions between a RAFTK protein and a RAFTK-bvrvάϊng protein can be constituative, or induced upon stimulation of a cell.
The term "bioactivity" of a RAFTK protein is intended to include effects on growth, differentiation, survival, and motility, e.g., migration or adhesion of cells. RAFTK has been shown to have broad involvement in numerous signaling pathways, and to be activated by: stem cell factor, thrombin stimulation, fibronectin, CSF-l/M- CSF, T cell receptor stimulation, bFGF, oncoprotein M, IL-6, and TNFa. RAFTK is also activated by changes inracellular calcium levels, and by activation of protein kinases α and δ. Thus, RAFTK is capable of modulating the growth, differentiation, survival, and motility of numerous cell types, including megakaryocytes, T cells, B cells, monocytes, hematopoietic stem cells ( e.g., CD34+ bone marrow cells). melanocytes, neural cells (particularly in the amygdala and hippocampus), macrophages, peripheral blood lymphocytes, spleen, thymus, B lymphocytes, T lymphocytes, and certain cancer cells (e.g., Kaposi's sarcoma cells). The subject RAFTK polypeptides are also capable of modulating platelet function.
RAFTK also modulates the formation of focal adhesions and actin stress fibers, and is thus important in the control of metastatic growth and in the normal cell growth and integrity, and in processes which involve cell motility, such as, for example, phagocytosis. Other bioactivities of the subject RAFTK polypeptides are described in more detail herein.
"Cells," "host cells" or "recombinant host cells" are terms used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications can occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein. A "chimeric protein" or "fusion protein" is a fusion of a first amino acid sequence encoding* one of the subject mammalian RAFTK polypeptides with a second amino acid sequence defining a domain (e.g. polypeptide portion) foreign to and not substantially homologous with any domain of one of the mammalian RAFTK polypeptides. A chimeric protein may present a foreign domain which is found (albeit in a different protein) in an organism which also expresses the first protein, or it may be an "interspecies", "intergenic", etc. fusion of protein structures expressed by different kinds of organisms. In general, a fusion protein can be represented by the general formula X-RAFTK-Y, wherein RAFTK represents a portion of the protein which is derived from one of the mammalian RAFTK proteins, and X and Y are independently absent or represent amino acid sequences which are not related to one of the mammalian RAFTK sequences in an organism, including naturally occurring mutants.
"Complementary" sequences as used herein refer to sequences which have sufficient complementarity to be able to hybridize, forming a stable duplex. A "delivery complex" as used herein refers to a targeting means (e.g. a molecule that results in higher affinity binding of a gene, protein, polypeptide or peptide to a target cell surface and/or increased cellular uptake by a target cell). Examples of targeting means include: sterols (e.g. cholesterol), lipids (e.g. a cationic lipid, virosome or liposome), viruses (e.g. adenovirus, adeno-associated virus, and retrovirus) or target cell specific binding agents (e.g. ligands recognized by target cell specific receptors). As is well known, genes for a particular polypeptide may exist in single or multiple copies within the genome of an individual. Such duplicate genes may be identical or may have certain modifications, including nucleotide substitutions, additions or deletions, which all still code for polypeptides having substantially the same activity. The term "DNA sequence encoding a mammalian RAFTK polypeptide" can refer to one or more genes within a particular individual. Moreover, certain differences in nucleotide sequences can exist between individual organisms, which are called alleles. Such allelic differences can result in differences in amino acid sequence of the encoded polypeptide yet still encode a protein with the same biological activity. As used herein, the term "gene" or "recombinant gene" refers to a nucleic acid molecule comprising an open reading frame encoding one of the mammalian RAFTK polypeptides of the present invention, including both exon and (optionally) intron sequences. A "recombinant gene" refers to nucleic acid encoding a mammalian RAFTK polypeptide and comprising mammalian &4 7 -encoding exon sequences, though it may optionally include intron sequences which are either derived from a chromosomal mammalian RAFTK gene or from an unrelated chromosomal gene. Exemplary recombinant genes encoding the subject mammalian RAFTK polypeptides are represented in the appended Sequence Listing. The term "intron" refers to a DNA sequence present in a given mammalian RAFTK gene which is not translated into protein and is generally found between exons.
"Homology" or "identity" refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous or identical at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An "unrelated" or "non-homologous" sequence shares less than 40% identity, though preferably less than 25% identity, with one of the mammalian RArFTK sequences of the present invention. The term "isolated" as used herein with respect to nucleic acids, such as DNA or RNA, refers to molecules separated from other DNAs, or RNAs, respectively, that are present in the natural source of the nucleic acids. For example, an isolated nucleic acid encoding one of the subject mammalian .RAFTK polypeptides preferably includes no more than 10 kilobases (kb) of nucleic acid sequence which naturally immediately flanks the mammalian RAFTK gene in genomic DNA, more preferably no more than 5kb of such naturally occurring flanking sequences, and most preferably less than 1.5kb of such naturally occurring flanking sequence. Moreover, an "isolated" nucleic acid" includes nucleic acid fragments which are not naturally occurring as fragments and would not be found in the natural state. The term "isolated" as used herein also refers to a polypeptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. Moreover, an "isolated nucleic acid" is meant to include nucleic acid fragments which are not naturally occurring as fragments and would not be found in the natural state. The term "isolated" is also used herein to refer to polypeptides which are isolated from other cellular proteins and is meant to encompass both purified and recombinant polypeptides.
The term "modulation" as used herein refers to both upregulation, i.e., stimulation or potentiation, and downregulation, i.e. suppression, of a response. The "non-human animals" of the invention include mammalians such as rodents, non-human primates, sheep, dog, cow, chickens, amphibians, reptiles, etc. Preferred non-human animals are selected from the rodent family including rat and mouse, most preferably mouse, though transgenic amphibians, such as members of the Xenopus genus, and transgenic chickens are also contemplated herein. The term "chimeric animal" is used herein to refer to animals in which the recombinant gene is found, or in which the recombinant is expressed in some but not all cells of the animal. The term "tissue-specific chimeric animal" indicates that one of the recombinant mammalian RAFTK genes is present and/or expressed or disrupted in some tissues but not others.
As used herein, the term "nucleic acid" refers to polynucleotides such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). The term should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single (sense or antisense) and double-stranded polynucleotides.
The terms "protein", "polypeptide" and "peptide" are used interchangably herein. The term "recombinant protein" refers to a polypeptide of the present invention which is produced by recombinant DNA techniques, wherein generally, DNA encoding a mammalian RAFTK polypeptide is inserted into a suitable expression vector which is in turn used to transform a host cell to produce the heterologous protein. Moreover, the phrase "derived from", with respect to a recombinant RAFTK gene, is meant to include within the meaning of "recombinant protein" those proteins having an amino acid sequence of a native RAFTK protein, or an amino acid sequence similar thereto which is generated by mutations including substitutions and deletions (including truncation) of a naturally occurring form of the protein.
As used herein, the term "specifically hybridizes" or "specifically detects" refers to the ability of a nucleic acid molecule of the invention to hybridize to at least approximately 12, 20, 30, 50, 100, 150, 200, or 300 consecutive nucleotides of a vertebrate, preferably mammalian, RAFTK gene, such as a RAFTK sequence designated in one of SEQ ID NOs:l or 3, or a sequence complementary thereto, or naturally occurring mutants thereof, such that it shows more than 10 times more hybridization, preferably more than 100 times more hybridization, and even more preferably more than 100 times more hybridization than it does to to a cellular nucleic acid (e.g., mRNA or genomic DNA) encoding a protein other than a vertebrate, preferably mammalian, RAFTK protein as defined herein.
As used herein, the term "tissue-specific promoter" means a DNA sequence that serves as a promoter, i.e., regulates expression of a selected DNA sequence operably linked to the promoter, and which effects expression of the selected DNA sequence in specific cells of a tissue, such as cells of hepatic or pancreatic origin, neuronal cells, or immune cells. The term also covers so-called "leaky" promoters, which regulate expression of a selected DNA primarily in one tissue, but cause expression in other tissues as well. "Transcriptional regulatory sequence" is a generic term used throughout the specification to refer to DNA sequences, such as initiation signals, enhancers, and promoters, which induce or control transcription of protein coding sequences with which they are operably linked. In preferred embodiments, transcription of one of the recombinant mammalian RAFTK genes is under the control of a promoter sequence (or other transcriptional regulatory sequence) which controls the expression of the recombinant gene in a cell-type in which expression is intended. It will also be understood that the recombinant gene can be under the control of transcriptional regulatory sequences which are the same or which are different from those sequences which control transcription of the naturally-occurring forms of RAFTK proteins. As used herein, the term "transfection" means the introduction of a nucleic acid, e.g., an expression vector, into a recipient cell by nucleic acid-mediated gene transfer. "Transformation", as used herein, refers to a process in which a cell's genotype is changed as a result of the cellular uptake of exogenous DNA or RNA, and, for example, the transformed cell expresses a recombinant form of a mammalian RAFTK polypeptide or, in the case of anti-sense expression from the transferred gene, the expression of a naturally-occurring form of the RAFTK protein is disrupted. As used herein, the term "transgene" means a nucleic acid sequence (encoding, e.g., one of the mammalian RAFTK polypeptides, or an transcript which is antisense to a RAFTK nucleic acid sequence), which is partly or entirely heterologous, i.e., foreign, to the transgenic animal or cell into which it is introduced, or, is homologous to an endogenous gene of the transgenic animal or cell into which it is introduced, but which is designed to be inserted, or is inserted, into the animal's genome in such a way as to alter the genome of the cell into which it is inserted (e.g., it is inserted at a location which differs from that of the natural gene or its insertion results in a knockout). A transgene can include one or more transcriptional regulatory sequences and any other nucleic acid, such as introns, that may be necessary for optimal expression of a selected nucleic acid.
A "transgenic animal" refers to any animal, preferably a non-human mammal, bird or an amphibian, in which one or more of the cells of the animal contain heterologous nucleic acid introduced by way of human intervention, such as by transgenic techniques well known in the art. The nucleic acid is introduced into the cell, directly or indirectly by introduction into a precursor of the cell, by way of deliberate genetic manipulation, such as by microinjection or by infection with a recombinant virus. The term genetic manipulation does not include classical crossbreeding, or in vitro fertilization, but rather is directed to the introduction of a recombinant DNA molecule. This molecule can be integrated within a chromosome, or it can be extrachromosomally replicating DNA. In the typical transgenic animals described herein, the transgene causes cells to express a recombinant form of one of the mammalian RAFTK proteins, e.g. either agonistic or antagonistic forms. However, transgenic animals in which the recombinant RAFTK gene is silent are also contemplated, as for example, the FLP or CRE recombinase dependent constructs described below. Moreover, "transgenic animal" also includes those recombinant animals in which gene disruption of one or more RAFTK genes is caused by human intervention, including both recombination and antisense techniques.
As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. A preferred vector is an episome, i.e., a nucleic acid capable of extra-chromosomal replication. Preferred vectors are those capable of autonomous replication and/expression of nucleic acids to which they are linked. Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors". In general, expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids" which refer generally to circular double stranded DNA loops which, in their vector form are not bound to the chromosome. In the present specification, "plasmid" and "vector" are used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto.
Nucleic Acids of the Present Invention
As described below, one aspect of the invention pertains to isolated nucleic acids comprising nucleotide sequences encoding RAFTK polypeptides, and/or equivalents of such nucleic acids. The term "equivalent" includes nucleotide sequences encoding functionally equivalent RAFTK polypeptides or functionally equivalent peptides having a bioactivity of a vertebrate RAFTK protein such as described herein. Equivalent nucleotide sequences include sequences that differ by one or more nucleotide substitutions, additions or deletions, such as allelic variants; and, therefore, include sequences that differ from the nucleotide sequence of the RAFTK gene shown in one of SEQ ID NOs:l or 3 due to the degeneracy of the genetic code.
Preferred nucleic acids are vertebrate RAFTK nucleic acids. Particularly preferred vertebrate RAFTK nucleic acids are mammalian. Regardless of species, RAFTK nucleic acids encode polypeptides that are at least 60% similar to an amino acid sequence of a vertebrate RAFTK. Preferred nucleic acids encode a RAFTK polypeptide comprising an amino acid sequence at least 60%, at least 70% homologous, preferably at least 80% homologous, more preferably at least 90% homologous with an amino acid sequence of a vertebrate RAFTK, e.g., such as a sequence shown in one of SEQ ID NOs:2 or 4. Nucleic acids which encode polypeptides at least about 95%, and even more preferably at least about 98-99% similarity with an amino acid sequence represented in one of SEQ ID NOs:2 or 4 are most preferred. Still other preferred nucleic acids of the present invention encode a RAFTK polypeptide which includes a polypeptide sequence corresponding to all or a portion of amino acid residues of one of SEQ ID NOs:2 or 4, e.g., at least 5, 10, 25, 50, 100, 150 or 200 amino acid residues of that region. Another aspect of the invention provides a nucleic acid which hybridizes under stringent conditions to a nucleic acid represented by one of SEQ ID NOs: 1 or 3. Appropriate stringency conditions which promote DNA hybridization, for example, 6.0 x sodium chloride/sodium citrate (SSC) at about 45°C, followed by a wash of 2.0 x SSC at 50°C, are known to those skilled in the art or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. For example, the salt concentration in the wash step can be selected from a low stringency of about 2.0 x SSC at 50°C to a high stringency of about 0.2 x SSC at 50°C. In addition, the temperature in the wash step can be increased from low stringency conditions at room temperature, about 22°C, to high stringency conditions at about 65°C. Both temperature and salt may be varied, or temperature of salt concentration may be held constant while the other variable is changed. In a particularly preferred embodiment, a RAFTK nucleic acid of the present invention binds to one of SEQ ID NOs: 1 or 3 under stringent conditions.
Preferred nucleic acids have a sequence at least 60%, at least 70% homologous and more preferably 80% and even more preferably at least 85% homologous with an amino acid sequence of a mammalian RAFTK, e.g., such as a sequence shown in SEQ ID NOs: 1. Nucleic acids at least 90%, more preferably 95%, and most preferably at least about 98-99% homologous with a nucleic sequence represented in SEQ ID NOs: 1 are of course also within the scope of the invention. In preferred embodiments, the nucleic acid is a mammalian RAFTK gene and in particularly preferred embodiments, includes all or a portion of the nucleotide sequence corresponding to the coding region of SEQ ID NOs: 1 or 3.
In preferred embodiments, the nucleic acid is a cDNA encoding a polypeptide having at least one boactivity of the subject RAFTK polypeptide.
Nucleic acids having a sequence that differs from the nucleotide sequences shown in one of SEQ ID NOs: 1 or 3 due to degeneracy in the genetic code are also within the scope of the invention. Such nucleic acids encode functionally equivalent peptides (i.e., a peptide having a biological activity of a mammalian RAFTK polypeptide) but differ in sequence from the sequence shown in the sequence listing due to degeneracy in the genetic code. For example, a number of amino acids are designated by more than one triplet. Codons that specify the same amino acid, or synonyms (for example, CAU and CAC each encode histidine) may result in "silent" mutations which do not affect the amino acid sequence of a mammalian RAFTK polypeptide. However, it is expected that DNA sequence polymorphisms that do lead to changes in the amino acid sequences of the subject RAFTK polypeptides will exist among mammalians. One skilled in the art will appreciate that these variations in one or more nucleotides (e.g., up to about 3-5% of the nucleotides) of the nucleic acids encoding polypeptides having an activity of a mammalian RAFTK polypeptidecan exist among individuals of a given species due to natural allelic variation. As indicated by the examples set out below, RAFTK protein-encoding nucleic acids can be obtained from mRNA present in any of a number of eukaryotic cells. Nucleic acids encoding mammalian RAFTK polypeptides of the present invention can also be obtained from genomic DNA from both adults and embryos. For example, a gene encoding a RAFTK protein can be cloned from either a cDNA or a genomic library in accordance with protocols described herein, as well as those generally known to persons skilled in the art. Examples of tissues and/or libraries suitable for isolation of the subject nucleic acids include brain, thymus, spleen, among others. A cDNA encoding a RAFTK protein can be obtained by isolating total mRNA from a cell, e.g. a vertebrate cell, a mammalian cell, or a human cell, including embryonic cells. Double stranded cDNAs can then be prepared from the total mRNA, and subsequently inserted into a suitable plasmid or bacteriophage vector using any one of a number of known techniques. The gene encoding a mammalian RAFTK protein can also be cloned using established polymerase chain reaction techniques in accordance with the nucleotide sequence information provided by the invention. The nucleic acid of the invention can be DNA or RNA. A preferred nucleic acid is a cDNA represented by a sequence shown in one of SEQ ID NOs:l or 3.
Vectors. This invention also provides expression vectors containing a nucleic acid encoding a RAFTK polypeptide, operably linked to at least one transcriptional regulatory sequence. "Operably linked" is intended to mean that the nucleotide sequence is linked to a regulatory sequence in a manner which allows expression of the nucleotide sequence. Regulatory sequences are art-recognized and are selected to direct expression of the subject mammalian RAFTK proteins. Accordingly, the term "transcriptional regulatory sequence" includes promoters, enhancers and other expression control elements. Such regulatory sequences are described in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). In one embodiment, the expression vector includes a recombinant gene encoding a peptide having an agonistic activity of a subject RAFTK polypeptide, or alternatively, encoding a peptide which is an antagonistic form of the RAFTK protein. Such expression vectors can be used to transfect cells and thereby produce polypeptides, including fusion proteins, encoded by nucleic acids as described herein. Moreover, the gene constructs of the present invention can also be used as a part of a gene therapy protocol to deliver nucleic acids encoding either an agonistic or antagonistic form of one of the subject mammalian RAFTK proteins. Thus, another aspect of the invention features expression vectors for in vivo or in vitro transfection and expression of a mammalian RAFTK polypeptide in particular cell types so as to reconstitute the function of, or alternatively, abrogate the function of RAFTK in a tissue. This is desirable, for example, when the naturally-occurring form of the protein is misexpressed; or to deliver a form of the protein which alters survival of tissue. Expression vectors can also be employed to inhibit neoplastic transformation. In addition to viral transfer methods, such as those illustrated above, non-viral methods can also be employed to cause expression of a subject RAFTK polypeptide in the tissue of an animal. Most nonviral methods of gene transfer rely on normal mechanisms used by mammalian cells for the uptake and intracellular transport of macromolecules. In preferred embodiments, non-viral targeting means of the present invention rely on endocytic pathways for the uptake of the subject RAFTK polypeptide gene by the targeted cell. Exemplary targeting means of this type include liposomal derived systems, poly-lysine conjugates, and artificial viral envelopes.
Probes and Primers
Moreover, the nucleotide sequences determined from the cloning of RAFTK genes from mammalian organisms allow for the generation of probes and primers designed for use in identifying and/or cloning RAFTK homologs in other cell types, e.g. from other tissues, as well as RAFTK homologs from other mammalian organisms. For instance, the present invention also provides a probe/primer comprising a substantially purified oligonucleotide, which oligonucleotide comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least approximately 12, preferably 25, more preferably 40, 50 or 75 consecutive nucleotides of sense or anti-sense sequence of one of SEQ ID NOs:l or 3, or naturally occurring mutants thereof. For instance, primers based on the nucleic acid represented in one of SEQ ID NOs: 1 or 3 can be used in PCR reactions to clone RAFTK homologs.
Likewise, probes based on the subject RAFTK sequences can be used to detect transcripts or genomic sequences encoding the same or homologous proteins. In preferred embodiments, the probe further comprises a label group attached thereto and able to be detected, e.g. the label group is selected from amongst radioisotopes, fluorescent compounds, enzymes, and enzyme co-factors.
As discussed in more detail below, such probes can also be used as a part of a diagnostic test kit for identifying cells or tissue which misexpress a RAFTK protein, such as by measuring a level of a RAFTK-encoάin^, nucleic acid in a sample of cells from a patient; e.g. detecting RAFTK mRNA levels or determining whether a genomic RAFTK gene has been mutated or deleted. Briefly, nucleotide probes can be generated from the subject RAFTK genes which facilitate histological screening of intact tissue and tissue samples for the presence (or absence) of RAFTK-encoding transcripts. Similar to the diagnostic uses of anύ-RAFTK antibodies, the use of probes directed to RAFTK messages, or to genomic RAFTK sequences, can be used for both predictive and therapeutic evaluation of allelic mutations which might be manifest in, for example, degenerative, neoplastic or hyperplastic disorders (e.g. unwanted cell growth) or abnormal differentiation of tissue. Used in conjunction with immunoassays as described herein, the oligonucleotide probes can help facilitate the determination of the molecular basis for a disorder which may involve some abnormality associated with expression (or lack thereof) of a RAFTK protein. For instance, variation in polypeptide synthesis can be differentiated from a mutation in a coding sequence.
Antisense, Ribozyme and Triplex techniques
One aspect of the invention relates to the use of the isolated nucleic acid in "antisense" therapy. As used herein, "antisense" therapy refers to administration or in situ generation of oligonucleotide molecules or their derivatives which specifically hybridize (e.g. bind) under cellular conditions, with the cellular mRNA and/or genomic DNA encoding one or more of the subject RAFTK proteins so as to inhibit expression of that protein, e.g. by inhibiting transcription and/or translation. The binding can be by conventional base pair complementarity, or, for example, in the case of binding to DNA duplexes, through specific interactions in the major groove of the double helix. In general, "antisense" therapy refers to the range of techniques generally employed in the art, and includes any therapy which relies on specific binding to oligonucleotide sequences. An antisense construct of the present invention can be delivered, for example, as an expression plasmid which, when transcribed in the cell, produces RNA which is complementary to at least a unique portion of the cellular mRNA which encodes a mammalian RAFTK protein. Alternatively, the antisense construct is an oligonucleotide probe which is generated ex vivo and which, when introduced into the cell causes inhibition of expression by hybridizing with the mRNA and/or genomic sequences of a mammalian RAFTK gene. Such oligonucleotide probes are preferably modified oligonucleotides which are resistant to endogenous nucleases, e.g. exonucleases and/or endonucleases, and are therefore stable in vivo. Exemplary nucleic acid molecules for use as antisense oligonucleotides are phosphoramidate, phosphothioate and methylphosphonate analogs of DNA (see also U.S. Patents 5,176,996; 5,264,564; and 5,256,775). Additionally, general approaches to constructing oligomers useful in antisense therapy have been reviewed, for example, by Van der Krol et al. (1988) Biotechniques 6, 958-976; and Stein et al. (1988) Cancer Res 48, 2659-2668.
Antisense approaches involve the design of oligonucleotides (either DNA or RNA) that are complementary to RAFTK mRNA. The antisense oligonucleotides bind to the RAFTK mRNA transcripts and prevent translation. Absolute complementarity, although preferred, is not required. A sequence "complementary" to a portion of an RNA, as referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double-stranded antisense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed. The ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid. Generally, the longer the hybridizing nucleic acid, the more base mismatches with an RNA it can contain and still form a stable duplex (or triplex, as the case may be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.
Oligonucleotides that are complementary to the 5' end of the message, e.g., the 5' untranslated sequence up to and including the AUG initiation codon, should work most efficiently at inhibiting translation. However, sequences complementary to the 3' untranslated sequences of mRNAs have recently been shown to be effective at inhibiting translation of mRNAs as well. (Wagner, R. (1994) Nature 372, 333). Therefore, oligonucleotides complementary to either the 5' or 3' untranslated, non- coding regions of a RAFTK gene could be used in an antisense approach to inhibit translation of endogenous RAFTK mRNA. Oligonucleotides complementary to the 5' untranslated region of the mRNA should include the complement of the AUG start codon. Antisense oligonucleotides complementary to mRNA coding regions are less efficient inhibitors of translation but could be used in accordance with the invention. Whether designed to hybridize to the 5', 3' or coding region of RAFTK mRNA, antisense nucleic acids should be at least six nucleotides in length, and are preferably oligonucleotides ranging from 6 to about 50 nucleotides in length. In preferred embodiments, the oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides, or at least 50 nucleotides. Oligodeoxyribonucleotides derived from the translation initiation site, e.g., between the -10 and +10 regions of the RAFTK nucleotide sequence of interest, are preferred.
The oligonucleotides can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded. The oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc. The oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al. (1989) Proc. Natl. Acad. Sci. U.S.A. 86. 6553-6556; Lemaitre et al. (1987) Proc. Natl. Acad. Sci. 84, 648-652; PCT Publication No. WO 88/09810, published December 15, 1988) or the blood-brain barrier (see, e.g., PCT Publication No. WO 89/10134, published April 25, 1988), hybridization-triggered cleavage agents. (See, e.g., Krol et al. (1988) BioTechniques 6, 958-976) or intercalating agents. (See, e.g., Zon (1988) Pharm. Res. 5, 539-549). To this end, the oligonucleotide can be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
The antisense oligonucleotide can comprise at least one modified base moiety which is selected from the group including but not limited to 5-fluorouracil, 5- bromouracil, 5-chlorouraciI, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1 -methylguanine, 1 -methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2- methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4- thiouracil, 5-methyluracil, uracil-5- oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. The antisense oligonucleotide can also comprise at least one modified sugar moiety selected from the group including but not limited to arabinose, 2- fluoroarabinose, xylulose, and hexose.
In yet another embodiment, the antisense oligonucleotide comprises at least one modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
In yet another embodiment, the antisense oligonucleotide is an α-anomeric oligonucleotide. An α-anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual β-units, the strands run parallel to each other (Gautier et al. (1987) Nucl. Acids Res. 15, 6625-6641). The oligonucleotide is a 2'-0-methylribonucleotide (Inoue et al. (1987) Nucl. Acids Res. 15, 6131-6148), or a chimeric RNA-DNA analogue (Inoue et al. (1987) FEBS Lett. 215, 327-330).
Oligonucleotides of the invention can be synthesized by standard methods known in the art, e.g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate oligonucleotides can be synthesized by the method of Stein et al. (1988, Nucl. Acids Res. 16, 3209), methylphosphonatc olgonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al. (1988) Proc. Natl. Acad. Sci. U.S.A. 85, 7448-7451), etc.
While antisense nucleotides complementary to the RAFTK coding region sequence can be used, those complementary to the transcribed untranslated region are most preferred.
The antisense molecules are delivered to cells which express the RAFTK in vivo. A number of methods described herein and known in the art can be used for delivering the subject nucleic acids into to cells. A preferred approach utilizes a recombinant DNA construct in which the antisense oligonucleotide is placed under the control of a strong pol III or pol II promoter. The use of such a construct to transfect target cells in the patient results in the transcription of sufficient amounts of single stranded RNAs that forms complementary base pairs with the endogenous RAFTK transcripts and thereby prevent translation of the RAFTK mRNA. For example, a vector can be introduced in vivo such that it is taken up by a cell and directs the transcription of an antisense RNA. Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA. Such vectors can be constructed by recombinant DNA technology methods standard in the art. Vectors can be plasmid, viral, or others known in the art, used for replication and expression in mammalian cells. Expression of the sequence encoding the antisense RNA can be by any promoter known in the art to act in mammalian, preferably human cells. Such promoters can be inducible or constitutive. Such promoters include but are not limited to: the SV40 early promoter region (Bernoist and Chambon (1981) Nature 290, 304-310), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al. (1980) Cell 22, 787-797), the herpes thymidine kinase promoter (Wagner et al. (1981) Proc. Natl. Acad. Sci. U.S.A. 78, 1441-1445), the regulatory sequences of the metallothionein gene (Brinster et al. (1982) Nature 296, 39-42), etc. Any type of plasmid, cosmid,
YAC or viral vector can be used to prepare the recombinant DNA construct which can be introduced directly into the tissue site; e.g., the choroid plexus or hypothalamus. Alternatively, viral vectors can be used which selectively infect the desired tissue; (e.g., for brain, herpesvirus vectors may be used), in which case administration may be accomplished by another route (e.g., systematically).
Ribozyme molecules designed to catalytically cleave RAFTK mRNA transcripts can also be used to prevent translation of RAFTK mRNA and expression of RAFTK. (See, e.g., PCT International Publication WO90/1 1364, published October 4, 1990; Sarver et al. (1990) Science 247, 1222-1225). While ribozymes that cleave mRNA at site specific recognition sequences can be used to destroy RAFTK mRNAs, the use of hammerhead ribozymes is preferred. Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. The sole requirement is that the target mRNA have the following sequence of two bases: 5'-UG-3'. The construction and production of hammerhead ribozymes is well known in the art and is described more fully in Haseloff and Gerlach, 1988 Nature, 334, 585-591. There are numerous potential hammerhead ribozyme cleavage sites within the nucleotide sequence of human RAFTK cDNA. Preferably the ribozyme is engineered so that the cleavage recognition site is located near the 5' end of the RAFTK mRNA; i.e., to increase efficiency and minimize the intracellular accumulation of non-functional mRNA transcripts. The ribozymes of the present invention also include RNA endoribonucleases
(hereinafter "Cech-type ribozymes") such as the one which occurs naturally in Tetrahymena Thermophila (known as the IVS, or L-l 9 IVS RNA) and which has been extensively described by Thomas Cech and collaborators (Zaug, et al. (1984) Science, 224. 574-578; Zaug and Cech (1986) Science, 231, 470-475; Zaug, et al. (1986) Nature, 324, 429-433; published International patent application No. WO 88/04300 by University Patents Inc.; Been and Cech (1986) Cell, 47, 207-216). The Cech-type ribozymes have an eight base pair active site which hybridizes to a target RNA sequence whereafter cleavage of the target RNA takes place. The invention encompasses those Cech-type ribozymes which target eight base-pair active site sequences that are present in RAFTK.
As in the antisense approach, the ribozymes can be composed of modified oligonucleotides (e.g. for improved stability, targeting, etc.) and are delivered to cells which express the RAFTK in vivo e.g., T cells. A preferred method of delivery involves using a DNA construct "encoding" the robozyme under the control of a strong constitutive pol III or pol II promoter, so that transfected cells produce sufficient quantities of the ribozyme to destroy endogenous RAFTK and inhibit translation. Because ribozymes unlike antisense molecules, are catalytic, a lower intracellular concentration is required for efficiency.
Endogenous RAFTK gene expression can also be reduced by inactivating or "knocking out" the RAFTK gene or its promoter using targeted homologous recombination. (E.g., see Smithies et al. ( 1985) Nature 317, 230-234; Thomas & Capecchi ( 1987) Cell 51 , 503-512; Thompson et al. ( 1989) Cell 5, 313-321 ; each of which is incoφorated by reference herein in its entirety). For example, a mutant, nonfunctional RAFTK (or a completely unrelated DNA sequence) flanked by DNA homologous to the endogenous RAFTK gene (either the coding regions or regulatory regions of the RAFTK gene) can be used, with or without a selectable marker and/or a negative selectable marker, to transfect cells that express RAFTK in vivo. Insertion of the DNA construct, via targeted homologous recombination, results in inactivation of the RAFTK gene. Such approaches are particularly suited in the agricultural field where modifications to ES (embryonic stem) cells can be used to generate animal offspring with an inactive RAFTK (e.g., see Thomas & Capecchi ( 1987) and
Thompson ( 1989), supra). However this approach can be adapted for use in humans provided the recominant DNA constructs are directly administered or targeted to the required site in vivo using appropriate viral vectors, e.g., herpes virus vectors for delivery to brain tissue; e.g., the hypothalamus and/or choroid plexus. Alternatively, endogenous RAFTK gene expression can be reduced by targeting deoxyribonucleotide sequences complementary to the regulatory region of the RAFTK gene (i.e., the RAFTK promoter and/or enhancers) to form triple helical structures that prevent transcription of the RAFTK gene in target cells in the body. (See generally, Helene, C. (1991) Anticancer Drug Des. 6(6), 569-84; Helene, C, et al. (1992), Ann. NY. Acad. Sci. 660, 27-36; and Maher, L. J. (1992) Bioassays 14(12), 807-15).
Nucleic acid molecules to be used in triple helix formation for the inhibition of transcription are preferably single stranded and composed of deoxyribonucleotides. The base composition of these oligonucleotides promotes triple helix formation via Hoogsteen base pairing rules, which generally require sizable stretches of either purines or pyrimidines to be present on one strand of a duplex. Nucleotide sequences may be pyrimidine-based, which result in TAT and CGC triplets across the three associated strands of the resulting triple helix. The pyrimidine-rich molecules provide base complementarity to a purine-rich region of a single strand of the duplex in a parallel orientation to that strand. In addition, nucleic acid molecules can be chosen that are purine-rich, for example, containing a stretch of g residues. These molecules will form a triple helix with a DNA duplex that is rich in GC pairs, in which the majority of the purine residues are located on a single strand of the targeted duplex, resulting in CGC triplets across the three strands in the triplex.
Alternatively, the potential sequences that can be targeted for triple helix formation may be increased by creating a so called "switchback" nucleic acid molecule. Switchback molecules are synthesized in an alternating 5'-3', 3'-5' manner, such that they base pair with first one strand of a duplex and then the other, eliminating the necessity for a sizable stretch of either purines or pyrimidines to be present on one strand of a duplex.
Antisense RNA and DNA, ribozyme, and triple helix molecules of the invention may be prepared by any method known in the art for the synthesis of DNA and RNA molecules. These include techniques for chemically synthesizing oligodeoxyribonucleotides and oligoribonucleotides well known in the art such as for example solid phase phosphoramidite chemical synthesis. Alternatively, RNA molecules may be generated by in vitro and in vivo transcription of DNA sequences encoding the antisense RNA molecule. Such DNA sequences may be incoφorated into a wide variety of vectors which incoφorate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters. Alternatively, antisense cDNA constructs that synthesize antisense RNA constitutively or inducibly, depending on the promoter used, can be introduced stably into cell lines. Moreover, various well-known modifications to nucleic acid molecules may be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and/or 3' ends of the molecule or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the oligodeoxyribonucleotide backbone.
The antisense constructs of the present invention, by antagonizing the normal biological activity of one of the RAFTK proteins, can be used in the manipulation of tissue survival, growth, migration, or differentiation, both in vivo and ex vivo. Furthermore, the anti-sense techniques (e.g. microinjection of antisense molecules, or transfection with plasmids whose transcripts are anti-sense with regard to a RAFTK mRNA or gene sequence) can be used to investigate role of RAFTK in developmental events, as well as the normal cellular function of RAFTK in adult tissue. Such techniques can be utilized in cell culture, but can also be used in the creation of transgenic animals, as detailed below. Polypeptides of the Present Invention
The present invention also makes available isolated RAFTK polypeptides which are isolated from, or otherwise substantially free of other cellular proteins, especially other signal transduction factors and/or transcription factors which may normally be associated with the RAFTK polypeptide. The term "substantially free of other cellular proteins" (also referred to herein as "contaminating proteins") or "substantially pure or purified preparations" are defined as encompassing preparations of RAFTK polypeptides having less than about 20% (by dry weight) contaminating protein, and preferably having less than about 5% contaminating protein. Functional forms of the subject polypeptides can be prepared, for the first time, as purified preparations by using a cloned gene as described herein. The term "purified" when referring to a polypeptide or nucleic acid means that the polypeptide or nucleic acid is present in the substantial absence of other biological macromolecules, such as other proteins. The term "purified" as used herein preferably means at least 80% by dry weight, more preferably in the range of 95-99% by weight, and most preferably at least 99.8% by weight, of biological macromolecules of the same type present (but water, buffers, and other small molecules, especially molecules having a molecular weight of less than 5000, can be present). The term "pure" as used herein preferably has the same numerical limits as "purified" immediately above. "Isolated" and
"purified" do not encompass either natural materials in their native state or natural materials that have been separated into components (e.g., in an acrylamide gel) but not obtained either as pure (e.g. lacking contaminating proteins, or chromatography reagents such as denaturing agents and polymers, e.g. acrylamide or agarose) substances or solutions. In preferred embodiments, purified RAFTK preparations lack any contaminating proteins from the same animal from which RAFTK is normally produced, as can be accomplished by recombinant expression of, for example, a human RAFTK protein in a non-human cell.
Full length proteins or fragments corresponding to one or more particular motifs and/or domains or to arbitrary sizes, for example, at least 5, 10, 25, 50, 75, 100, 125, 150 amino acids in length are within the scope of the present invention.
For example, isolated RAFTK polypeptides can include all or a portion of an amino acid sequences corresponding to a RAFTK polypeptide represented in one or more of one of SEQ ID NOs:2 or 4 and 4. Isolated peptidyl portions of RAFTK proteins can be obtained by screening peptides recombinantly produced from the corresponding fragment of the nucleic acid encoding such peptides. In addition, fragments can be chemically synthesized using techniques known in the art such as conventional Merrifield solid phase f-Moc or t-Boc chemistry. For example, a RAFTK polypeptide of the present invention can be arbitrarily divided into fragments of desired length with no overlap of the fragments, or preferably divided into overlapping fragments of a desired length. The fragments can be produced (recombinantly or by chemical synthesis) and tested to identify those peptidyl fragments which can function as either agonists or antagonists of a wild-type (e.g., "authentic") RAFTK protein.
Another aspect of the present invention concerns recombinant forms of the RAFTK proteins. Recombinant polypeptides preferred by the present invention, in addition to native RAFTK proteins, are at least 60% homologous, preferably at least 70% and more preferably at least 80% homologous and even more preferably at least 90 % homologous with an amino acid sequence represented by one of SEQ ID NOs: 2 or 4. Polypeptides which are at least about 95% homologous with a sequence selected from the group consisting of SEQ ID NOs: 2 and 4 are also within the scope of the invention. In a preferred embodiment, a RAFTK protein of the present invention is a mammalian RAFTK protein. In a particularly preferred embodiment a RAFTK protein comprises the coding sequence of one of SEQ ID NOs:2 or 4. In particularly preferred embodiments, a RAFTK protein has a RAFTK bioactivity.
In certain preferred embodiments, the invention features a purified or recombinant RAFTK polypeptide having a molecular weight of approximately 1 15- 125kD. In a preferred embodiment, the subject RAFTK polypeptide has a molecular weight of 123 kD. It will be understood that certain post-translational modifications, such as phosphorylation, can increase the apparent molecular weight of the RAFTK protein relative to the unmodified polypeptide chain. The present invention further pertains to recombinant forms of one of the subject RAFTK polypeptides which are encoded by genes derived from a mammalian organism, and which have amino acid sequences evolutionarily related to the RAFTK proteins represented in one of SEQ ID NOs:2 or 4. Such recombinant RAFTK polypeptides preferably are capable of functioning in one of either role of an agonist or antagonist of at least one biological activity of a wild-type ("authentic") RAFTK protein of the appended sequence listing. The term "evolutionarily related to", with respect to amino acid sequences of mammalian RAFTK proteins, refers to both polypeptides having amino acid sequences which have arisen naturally, and also to mutational variants of mammalian RAFTK polypeptides which are derived, for example, by combinatorial mutagenesis. Such evolutionarily derived RAFTK polypeptides preferred by the present invention have a RAFTK bioactivity and are at least 60% homologous, preferably at least 70% homologous, and more preferably at least 80% homologous and even more preferably at least 90% homologous with the amino acid sequence shown in one of SEQ ID NOs:2 or 4. Polypeptides at least 95- 98% homologous are also within the scope of the invention. In a particularly preferred embodiment, a RAFTK protein comprises the amino acid coding sequence of one of SEQ ID NOs:2 or 4.
In general, polypeptides referred to herein as having a bioactivity of a mammalian RAFTK protein are defined as polypeptides which include an amino acid sequence corresponding (e.g., identical or homologous) to all or a portion of the amino acid sequences of a mammalian RAFTK proteins shown in one of SEQ ID NOs:2 or 4 and which mimic or antagonize all or a portion of the biological/biochemical activities of a naturally occurring RAFTK protein. Other biological activities of the subject RAFTK proteins are described herein or will be reasonably apparent to those skilled in the art. According to the present invention, a polypeptide has biological activity if it is a specific agonist or antagonist of a naturally-occurring form of a mammalian RAFTK protein.
The present invention further pertains to methods of producing the subject RAFTK polypeptides. For example, a host cell transfected with a nucleic acid vector directing expression of a nucleotide sequence encoding the subject polypeptides can be cultured under appropriate conditions to allow expression of the peptide to occur. The cells may be harvested, lysed and the protein isolated. A cell culture includes host cells, media and other byproducts. Suitable media for cell culture are well known in the art. The recombinant RAFTK polypeptide can be isolated from cell culture medium, host cells, or both, using techniques known in the art for purifying proteins including ion-exchange chromatography, gel filtration chromatography, ultrafiltration, electrophoresis, and immunoaffinity purification with antibodies specific for such peptide. In a preferred embodiment, the recombinant RAFTK polypeptide is a fusion protein containing a domain which facilitates its purification, such as GST fusion protein or poly(His) fusion protein.
Moreover, it will be generally appreciated that, under certain circumstances, it is advantageous to provide homologs of one of the subject RAFTK polypeptides which function in a limited capacity as one of either a RAFTK agonist (mimetic) or a RAFTK antagonist, in order to promote or inhibit only a subset of the biological activities of the naturally-occurring form of the protein. Thus, specific biological effects can be elicited by treatment with a homolog of limited function, and with fewer side effects relative to treatment with agonists or antagonists which are directed to all of the biological activities of naturally occurring forms of RAFTK proteins. Homologs of each of the subject RAFTK proteins can be generated by mutagenesis, such as by discrete point mutation(s), or by truncation. For example, mutation can give rise to homologs which retain substantially the same, or merely a subset, of the biological activity of the RAFTK polypeptide from which it was derived. Alternatively, antagonistic forms of the protein can be generated which are able to inhibit the function of the naturally occurring form of the protein, such as by competitively binding to a downstream or upstream member of the RAFTK cascade which includes the RAFTK protein. In addition, agonistic forms of the protein may be generated which are constituatively active. Thus, the mammalian RAFTK protein and homologs thereof provided by the subject invention may be either positive or negative regulators of RAFTK activity.
The recombinant RAFTK polypeptides of the present invention also include homologs of the authentic RAFTK proteins, such as versions of those protein which are resistant to proteolytic cleavage, as for example, due to mutations which alter ubiquitination or other enzymatic targeting associated with the protein.
RAFTK polypeptides may also be chemically modified to create RAFTK derivatives by forming covalent or aggregate conjugates with other chemical moieties, such as glycosyl groups, lipids, phosphate, acetyl groups and the like. Covalent derivatives of RAFTK proteins can be prepared by linking the chemical moieties to functional groups on amino acid sidechains of the protein or at the N-terminus or at the C-terminus of the polypeptide.
Modification of the structure of the subject mammalian RAFTK polypeptides can be for such puφoses as enhancing therapeutic or prophylactic efficacy, stability (e.g., ex vivo shelf life and resistance to proteolytic degradation in vivo), or post- translational modifications (e.g., to alter phosphorylation pattern of protein). Such modified peptides, when designed to retain at least one activity of the naturally- occurring form of the protein, or to produce specific antagonists thereof, are considered functional equivalents of the RAFTK polypeptides described in more detail herein. Such modified peptides can be produced, for instance, by amino acid substitution, deletion, or addition.
For example, it is reasonable to expect that an isolated replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar replacement of an amino acid with a structurally related amino acid (i.e. isosteric and/or isoelectric mutations) will not have a major effect on the biological activity of the resulting molecule. Conservative replacements are those that take place within a family of amino acids that are related in their side chains. Genetically encoded amino acids are can be divided into four families: (1) acidic = aspartate, glutamate; (2) basic = lysine, arginine, histidine; (3) nonpolar = alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar = glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. In similar fashion, the amino acid repertoire can be grouped as (1 ) acidic = aspartate, glutamate; (2) basic = lysine, arginine histidine, (3) aliphatic = glycine, alanine. valine, leucine, isoleucine, serine, threonine, with serine and threonine optionally be grouped separately as aliphatic-hydroxyl; (4) aromatic = phenylalanine, tyrosine, tryptophan; (5) amide = asparagine, glutamine; and (6) sulfur -containing = cysteine and methionine. (see, for example, Biochemistry, 2nd ed., Ed. by L. Stryer, WH Freeman and Co.: 1981). Whether a change in the amino acid sequence of a peptide results in a functional RAFTK homolog (e.g. functional in the sense that the resulting polypeptide mimics or antagonizes the wild-type form) can be readily determined by assessing the ability of the variant peptide to produce a response in cells in a fashion similar to the wild-type protein, or competitively inhibit such a response. Polypeptides in which more than one replacement has taken place can readily be tested in the same manner.
This invention further provides a method for generating sets of combinatorial mutants of the subject RAFTK proteins as well as truncation mutants, and is especially useful for identifying potential variant sequences (e.g. homologs) that modulate a RAFTK bioactivity. The puφose of screening such combinatorial libraries is to generate, for example, novel RAFTK homologs which can act as either agonists or antagonist, or alternatively, possess novel activities all together. To illustrate, combinatorially-derived homologs can be generated to have an increased potency relative to a naturally occurring form of the protein. Likewise, RAFTK homologs can be generated by the present combinatorial approach to selectively inhibit (antagonize) an authentic RAFTK. For instance, mutagenesis can provide RAFTK homologs which are able to bind other proteins in a RAFTK signaling pathwayyet prevent propagation of the signal, e.g. the homologs can be dominant negative mutants. Moreover, manipulation of certain domains of RAFTK by the present method can provide domains more suitable for use in fusion proteins. In one embodiment, the variegated library of RAFTK variants is generated by combinatorial mutagenesis at the nucleic acid level, and is encoded by a variegated gene library. For instance, a mixture of synthetic oligonucleotides can be enzymatically ligated into gene sequences such that the degenerate set of potential RAFTK sequences are expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e.g. for phage display) containing the set of RAFTK sequences therein. There are many ways by which such libraries of potential RAFTK homologs can be generated from a degenerate oligonucleotide sequence. Chemical synthesis of a degenerate gene sequence can be carried out in an automatic DNA synthesizer, and the synthetic genes then ligated into an appropriate expression vector. The puφose of a degenerate set of genes is to provide, in one mixture, all of the sequences encoding the desired set of potential RAFTK sequences. The synthesis of degenerate oligonucleotides is well known in the art (see for example, Narang, S. A. (1983) Tetrahedron 39, 3; Itakura et al. (1981) Recombinant DNA, Proc 3rd Cleveland Sympos. Macromolecules, ed. AG Walton, Amsterdam: Elsevier pp 273-289; Itakura et al. (1984) Annu. Rev. Biochem. 53, 323. Such techniques have been employed in the directed evolution of other proteins (see, for example, Scott et al. (1990) Science 249, 386-390; Roberts et al. (1992) PNAS 89, 2429-2433; Devlin et al. (1990) Science 249, 404-406).
Likewise, a library of coding sequence fragments can be provided for a RAFTK clone in order to generate a variegated population of RAFTK fragments for screening and subsequent selection of bioactive fragments. A variety of techniques are known in the art for generating such libraries, including chemical synthesis. In one embodiment, a library of coding sequence fragments can be generated by (i) treating a double stranded PCR fragment of a RAFTK coding sequence with a nuclease under conditions wherein nicking occurs only about once per molecule; (ii) denaturing the double stranded DNA; (iii) renaturing the DNA to form double stranded DNA which can include sense/antisense pairs from different nicked products; (iv) removing single stranded portions from reformed duplexes by treatment with SI nuclease; and (v) ligating the resulting fragment library into an expression vector. By this exemplary method, an expression library can be derived which codes for N- terminal, C-terminal and internal fragments of various sizes.
A wide range of techniques are known in the art for screening gene products of combinatorial libraries made by point mutations or truncation, and for screening cDNA libraries for gene products having a certain property. Such techniques aregenerally adaptable for rapid screening of the gene libraries generated by the combinatorial mutagenesis of RAFTK homologs. The most widely used techniques for screening large gene libraries typically comprise cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates relatively easy isolation of the vector encoding the gene whose product was detected. Each of the illustrative assays described below are amenable to high through-put analysis as necessary to screen large numbers of degenerate RAFTK sequences created by combinatorial mutagenesis techniques.
In one embodiment, cell based assays can be exploited to analyze the variegated RAFTK library. For instance, the library of expression vectors can be transfected into a cell line ordinarily responsive to a ligand which transduces signals via a pathway involving RAFTK, such as, for example, stem cell factor, thrombin, fibronectin, CSF-1/M-CSF, T cell receptor stimulation, bFGF, oncoprotein M, IL-6, or TNFa.. The transfected cells are then contacted with a ligand ahd the and the effect of the RAFTK mutant can be detected, e.g. on cell viability. Plasmid DNA can then be recovered from the cells which score for inhibition, or alternatively, potentiation of a RAFTK activity, and the individual clones further characterized.
Combinatorial mutagenesis has a potential to generate very large libraries of mutant proteins, e.g., in the order of 1026 molecules. Combinatorial libraries of this size may be technically challenging to screen even with high throughput screening assays. To overcome this problem, a new technique has been developed recently, recrusive ensemble mutagenesis (REM), which allows one to avoid the very high proportion of non-functional proteins in a random library and simply enhances the frequency of functional proteins, thus decreasing the complexity required to achieve a useful sampling of sequence space. REM is an algorithm which enhances the frequency of functional mutants in a library when an appropriate selection or screening method is employed (Arkin and Yourvan, 1992, PNAS USA 89, 781 1-7815; Yourvan et al. (1992) Parallel Problem Solving from Nature, 2, In Maenner and Manderick, eds., Elsevir Publishing Co., Amsterdam, pp. 401-410; Delgrave et al. ( 1993) Protein Engineering 6(3), 327-331 ).
The invention also provides for reduction of the mammalian RAFTK proteins to generate mimetics, e.g. peptide or non-peptide agents, which are able to disrupt binding of a mammalian RAFTK polypeptide of the present invention with either upstream or downstream components of a TGFb signaling cascade, such as binding proteins or interactors. Thus, such mutagenic techniques as described above are also useful to map the determinants of the RAFTK proteins which participate in protein- protein interactions involved in, for example, binding of the subject mammalian RAFTK polypeptide to proteins which may function upstream (including both activators and repressors of its activity) or to proteins or nucleic acids which may function downstream of the RAFTK polypeptide, whether they are positively or negatively regulated by it. To illustrate, the critical residues of a subject RAFTK polypeptide which are involved in molecular recognition of binding proteins upstream or downstream of a RAFTK can be determined and used to generate RAFTK-deriveά peptidomimetics which competitively inhibit binding of the authentic RAFTK protein with that moiety. By employing, for example, scanning mutagenesis to map the amino acid residues of each of the subject RAFTK proteins which are involved in binding other extracellular proteins, peptidomimetic compounds can be generated which mimic those residues of the RAFTK protein which facilitate the interaction. Such mimetics may then be used to interfere with the normal function of a RAFTK protein. For instance, non-hydrolyzable peptide analogs of such residues can be generated using benzodiazepine (e.g., see Freidinger et al. in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), azepine (e.g., see Huffman et al. in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), substituted gamma lactam rings (Garvey et al. in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), keto-methylene pseudopeptides (Ewenson et al. (1986) J Med Chem 29, 295; and Ewenson et al. in Peptides: Structure and
Function (Proceedings of the 9th American Peptide Symposium) Pierce Chemical Co. Rockland, IL, 1985), b-turn dipeptide cores (Nagai et al. (1985) Tetrahedron Lett 26, 647; and Sato et al. (1986) J Chem Soc Perkin Trans 1 , 1231), and b-aminoalcohols (Gordon et al. (1985) Biochem Biophys Res Commun 126, 419; and Dann et al. (1986) Biochem Biophys Res Commun 134, 71).
Cells expressing recombinant RAFTK polypeptides.
This invention also pertains to a host cell transfected to express a recombinant form of the subject RAFTK polypeptides. The host cell can be any prokaryotic or eukaryotic cell. Thus, a nucleotide sequence derived from the cloning of mammalian RAFTK proteins, encoding all or a selected portion of the full-length protein, can be used to produce a recombinant form of a mammalian RAFTK polypeptide via microbial or eukaryotic cellular processes. Ligating the polynucleotide sequence into a gene construct, such as an expression vector, and transforming or transfecting into hosts, either eukaryotic (yeast, avian, insect or mammalian) or prokaryotic (bacterial cells), are standard procedures used in producing other well-known proteins, e.g. MAP kinase, p53, WT1, PTP phosphotases, SRC, and the like. Similar procedures, or modifications thereof, can be employed to prepare recombinant RAFTK polypeptides by microbial means or tissue-culture technology in accord with the subject invention. The recombinant RAFTK genes can be produced by ligating nucleic acid encoding a RAFTK protein, or a portion thereof, into a vector suitable for expression in either prokaryotic cells, eukaryotic cells, or both. Expression vectors for production of recombinant forms of the subject RAFTK polypeptides include plasmids and other vectors. For instance, suitable vectors for the expression of a RAFTK polypeptide include plasmids of the types: pBR322-derived plasmids, pEMBL- derived plasmids, pEX-derived plasmids, pBTac-derived plasmids and pUC-derived plasmids for expression in prokaryotic cells, such as E. coli.
A number of vectors exist for the expression of recombinant proteins in yeast. For instance, YEP24, YIP5, YEP51, YEP52, pYES2, and YRP17 are cloning and expression vehicles useful in the introduction of genetic constructs into S. cerevisiae (see, for example, Broach et al. (1983) in Experimental Manipulation of Gene Expression, ed. M. Inouye Academic Press, p. 83, incoφorated by reference herein). These vectors can replicate in E. coli due the presence of the pBR322 ori. and in S. cerevisiae due to the replication determinant of the yeast 2 micron plasmid. In addition, drug resistance markers such as ampicillin can be used. In an illustrative embodiment, a RAFTK polypeptide is produced recombinantly utilizing an expression vector generated by sub-cloning the coding sequence of one of the RAFTK genes represented in one of SEQ ID NOs: 1 or 3.
The preferred mammalian expression vectors contain both prokaryotic sequences, to facilitate the propagation of the vector in bacteria, and one or more eukaryotic transcription units that are expressed in eukaryotic cells. The pcDNAI/amp, pcDNAI/neo, pRc/CMV, pSV2gpt, pSV2neo, pSV2-dhfr, pTk2, pRSVneo, pMSG, pSVT7, pko-neo and pHyg derived vectors are examples of mammalian expression vectors suitable for transfection of eukaryotic cells. Some of these vectors are modified with sequences from bacterial plasmids, such as pBR322, to facilitate replication and drug resistance selection in both prokaryotic and eukaryotic cells. Alternatively, derivatives of viruses such as the bovine papillomavirus (BPV-1), or Epstein-Barr virus (pHEBo, pREP-derived and p205) can be used for transient expression of proteins in eukaryotic cells. The various methods employed in the preparation of the plasmids and transformation of host organisms are well known in the art. For other suitable expression systems for both prokaryotic and eukaryotic cells, as well as general recombinant procedures, see Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989) Chapters 16 and 17.
In some instances, it is desirable to express the recombinant RAFTK polypeptide by the use of a baculovirus expression system. Examples of such baculovirus expression systems include pVL-derived vectors (such as pVL1392, pVL1393 and pVL941), pAcUW-derived vectors (such as pAcUWl), and pBlueBac- derived vectors (such as the β-gal containing pBlueBac III). Fusion proteins and Immunogens.
In another embodiment, the coding sequences for the polypeptide can be incoφorated as a part of a fusion gene including a nucleotide sequence encoding a different polypeptide. This type of expression system can be useful under conditions where it is desirable to produce an immunogenic fragment of a RAFTK protein. For example, the VP6 capsid protein of rotavirus can be used as an immunologic carrier protein for portions of the RAFTK polypeptide, either in the monomeric form or in the form of a viral particle. The nucleic acid sequences corresponding to the portion of a subject RAFTK protein to which antibodies are to be raised can be incoφorated into a fusion gene construct which includes coding sequences for a late vaccinia virus structural protein to produce a set of recombinant viruses expressing fusion proteins comprising RAFTK epitopes as part of the virion. It has been demonstrated with the use of immunogenic fusion proteins utilizing the Hepatitis B surface antigen fusion proteins that recombinant Hepatitis B virions can be utilized in this role as well. Similarly, chimeric constructs coding for fusion proteins containing a portion of a RAFTK protein and the poliovirus capsid protein can be created to enhance immunogenicity of the set of polypeptide antigens (see, for example. EP Publication No: 0259149; and Evans et al. (1989) Nature 339, 385; Huang et al. (1988) J. Virol. 62, 3855; and Schlienger et al. (1992) J. Virol. 66, 2).
The Multiple Antigen Peptide system for peptide-based immunization can also be utilized to generate an immunogen, wherein a desired portion of a RAFTK polypeptide is obtained directly from organo-chemical synthesis of the peptide onto an oligomeric branching lysine core (see, for example, Posnett et al. (1988) JBC 263, 1719 and Nardelli et al. (1992) J. Immunol. 148, 914). Antigenic determinants of RAFTK proteins can also be expressed and presented by bacterial cells.
In addition to utilizing fusion proteins to enhance immunogenicity, it is widely appreciated that fusion proteins can also facilitate the expression of proteins, and accordingly, can be used in the expression of the mammalian RAFTK polypeptides of the present invention. For example, RAFTK polypeptides can be generated as glutathione-S-transferase (GST-fusion) proteins. Such GST-fusion proteins can enable easy purification of the RAFTK polypeptide, as for example by the use of glutathione-derivatized matrices (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al. (N.Y.: John Wiley & Sons, 1991)). In another embodiment, a fusion gene coding for a purification leader sequence, such as a poly-(His)/enterokinase cleavage site sequence at the N-terminus of the desired portion of the recombinant protein, can allow purification of the expressed fusion protein by affinity chromatography using a Ni2+ metal resin. The purification leader sequence can then be subsequently removed by treatment with enterokinase to provide the purified protein (e.g., see Hochuli et al. (1987) J Chromatography 41 1 , 177; and Janknecht et al. PNAS 88, 8972). Techniques for making fusion genes are known to those skilled in the art.
Essentially, the joining of various DNA fragments coding for different polypeptide sequences is performed in accordance with conventional techniques, employing blunt- ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al. John Wiley & Sons: 1992).
Antibodies
Another aspect of the invention pertains to antibodies specifically reactive with a vertebrate RAFTK protein, preferably a mammalian RAFTK protein. For example, by using immunogens derived from a RAFTK protein, e.g. based on the cDNA sequences, anti-protein/anti-peptide antisera or monoclonal antibodies can be made by standard protocols (See, for example, Antibodies: A Laboratory Manual ed. by Harlow and Lane (Cold Spring Harbor Press: 1988)). A mammal, such as a mouse, a hamster or rabbit can be immunized with an immunogenic form of the peptide (e.g., a mammalian RAFTK polypeptide or an antigenic fragment which is capable of eliciting an antibody response, or a fusion protein as described above). Techniques for conferring immunogenicity on a protein or peptide include conjugation to carriers or other techniques well known in the art. An immunogenic portion of a RAFTK protein can be administered in the presence of adjuvant. The progress of immunization can be monitored by detection of antibody titers in plasma or serum. Standard ELISA or other immunoassays can be used with the immunogen as antigen to assess the levels of antibodies. In a preferred embodiment, the subject antibodies are immunospecific for antigenic determinants of a RAFTK protein of a mammal, e.g. antigenic determinants of a protein represented by one of SEQ ID NOs:2 or 4. Following immunization of an animal with an antigenic preparation of a RAFTK polypeptide, anti- RAFTK antisera can be obtained and, if desired, polyclonal anti- RAFTK antibodies isolated from the serum. To produce monoclonal antibodies, antibody-producing cells (lymphocytes) can be harvested from an immunized animal and fused by standard somatic cell fusion procedures with immortalizing cells such as myeloma cells to yield hybridoma cells. Such techniques are well known in the art, an include, for example, the hybridoma technique (originally developed by Kohler and Milstein, (1975) Nature, 256, 495-497), the human B cell hybridoma technique (Kozbar et al., (1983) Immunology Today, 4, 72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., ( 1985) Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. pp. 77-96). Hybridoma cells can be screened immunochemically for production of antibodies specifically reactive with a mammalian RAFTK polypeptide of the present invention and monoclonal antibodies isolated from a culture comprising such hybridoma cells. The term "antibody" as used herein is intended to include fragments thereof which are also specifically reactive with one of the subject mammalian RAFTK polypeptides. Antibodies can be fragmented using conventional techniques and the fragments screened for utility in the same manner as described above for whole antibodies. For example, F(ab)2 fragments can be generated by treating antibody with pepsin. The resulting F(ab)2 fragment can be treated to reduce disulfide bridges to produce Fab fragments. The antibody of the present invention is further intended to include bispecific and chimeric molecules having affinity for a RAFTK protein conferred by at least one CDR region of the antibody.
Antibodies which specifically bind RAFTK epitopes can also be used in immunohistochemical staining of tissue samples in order to evaluate the abundance and pattern of expression of each of the subject RAFTK polypeptides. Anύ-RAFTK antibodies can be used diagnostically in immuno-precipitation and immuno-blotting to detect and evaluate RAFTK protein levels in tissue as part of a clinical testing procedure. Likewise, the ability to monitor RAFTK protein levels in an individual can allow determination of the efficacy of a given treatment regimen for an individual afflicted with such a disorder. Diagnostic assays using anti- RAFTK antibodies can include, for example, immunoassays designed to aid in early diagnosis of a degenerative disorder, particularly ones which are manifest at birth. Diagnostic assays using anti- RAFTK polypeptide antibodies can also include immunoassays designed to aid in early diagnosis and phenotyping neoplastic or hypeφlastic disorders.
Another application of anti-RAFTK antibodies of the present invention is in the immunological screening of cDNA libraries constructed in expression vectors such as λgtl 1 , λgtl 8-23, λZAP, and λORF8. Messenger libraries of this type, having coding sequences inserted in the correct reading frame and orientation, can produce fusion proteins. For instance, λgtl 1 will produce fusion proteins whose amino termini consist of β-galactosidase amino acid sequences and whose carboxy termini consist of a foreign polypeptide. Antigenic epitopes of a RAFTK protein, e.g. other orthologs of a particular RAFTK protein or other paralogs from the same species, can then be detected with antibodies, as, for example, reacting nitrocellulose filters lifted from infected plates with anύ-RAFTK antibodies. Positive phage detected by this assay can then be isolated from the infected plate. Thus, the presence of RAFTK homologs can be detected and cloned from other animals, as can alternate isoforms (including splicing variants) from humans.
Methods of Treating Disease
There are a wide variety of pathological conditions which can be treated using the RAFTK therapeutics of the present invention. For example, RAFTK therapeutics which modulate RAFTK activity in B cells, T cells, and monocytes can be used to treat immune-mediated disorders and mediate both cell mediated and humoral immune responses.
Normal hematopoietic cells are dependent on growth factors for growth and differentiation and the loss of this growth factor dependence can lead to autonomous growth. The involvement of RAFTK in several growth factor signaling pathways indicates that missespression of RAFTK can lead to the development of cancers, and the present invention contemplates modulating RAFTK expression and/or activity to control aberrant cell growth. In a preferred embodiment RAFTK is modulated to treat cancers of hematopoietic cells. In another embodiment malignancy can be suppressed in certain cells e.g., leukemic cells, by modulating RAFTK to induce cellular differentiation in "differentiation therapy", for example, in the treatment of leukemia, as has been demonstrated with cytokines or other compounds (Sachs (1996) Proc. Natl. Acad. Sci. USA 93:4742). The subject RAFTK proteins can also be modulated to either induce or inhibit apoptosis in a cell. In certain embodiments the subject RAFTK proteins can be manipulated to induce apoptosis in cancer cells. In some embodiments RAFTK can be modulated in a patient in conjunction with other cancer therapies. Alternatively, in instances when it is desirable to inhibit apoptosis, such as apoptosis induced by chemotherapeutic compounds and irradiation, RAFTK may be modulated to inhibit apoptosis. Cytoskeletal rearrangement has been correlated with growth control and gene expression and is critical in cell adhesion and migration and the modulation of RAFTK bioactivity can alter cellular functions which depend upon the cytoskeleton, including, for example, normal tissue maintenence and proliferation and tissue remodeling which occur in response to injury (Turner et al. (1995) J. Cell Science 108:333). In a preferred embodiment, RAFTK bioactivity is modulated to reduce metastasis of a cancer cell.
Yet another aspect of the present invention pertains to the therapeutic application of a RAFTK therapeutic to enhance survival of neurons and other neuronal cells in both the central nervous system and the peripheral nervous system. The expression of RAFTK in neuronal cells and their role in signaling pathways involved in apoptosis (Tokiwa et al. (1996) Science 273:792) indicates that certain of the RAFTK proteins participate in control of adult neurons with regard to maintenance, functional performance, and aging of normal cells; repair and regeneration processes in chemically or mechanically lesioned cells; and prevention of degeneration and premature death which result from loss of differentiation in certain pathological conditions. The present invention specifically contemplates applications of the subject method to the treatment of (prevention and/or reduction of the severity of) neurological conditions deriving from: (i) acute, subacute, or chronic injury to the nervous system, including traumatic injury, chemical injury, vasal injury and deficits (such as the ischemia resulting from stroke), together with infectious/ inflammatory and tumor-induced injury; (ii) aging of the nervous system including Alzheimer's disease; (iii) chronic neurodegenerative diseases of the nervous system, including Parkinson's disease, Huntington's chorea, amylotrophic lateral sclerosis and the like, as well as spinocerebellar degenerations; and (iv) chronic immunological diseases of the nervous system or affecting the nervous system, including multiple sclerosis. Many neurological disorders are associated with degeneration of discrete populations of neuronal elements and can be treatable with a therapeutic regimen which includes a RAFTK therapeutic. For example, Alzheimer's disease is associated with deficits in several neurotransmitter systems, both those that project to the neocortex and those that reside with the cortex. For instance, the nucleus basalis in patients with Alzheimer's disease have been observed to have a profound (75%) loss of neurons compared to age-matched controls. Although Alzheimer's disease is by far the most common form of dementia, several other disorders can produce dementia. Several of these are degenerative diseases characterized by the death of neurons in various parts of the central nervous system, especially the cerebral cortex. However, some forms of dementia are associated with degeneration of the thalmus or the white matter underlying the cerebral cortex. Here, the cognitive dysfunction results from the isolation of cortical areas by the degeneration of efferents and afferents. Huntington's disease involves the degeneration of intrastraital and cortical cholinergic neurons and GABAergic neurons. Pick's disease is a severe neuronal degeneration in the neocortex of the frontal and anterior temporal lobes, sometimes accompanied by death of neurons in the striatum. Treatment of patients suffering from such degenerative conditions can include the application of RAFTK therapeutics, in order to control, for example, differentiation and apoptotic events which give rise to loss of neurons (e.g. to enhance survival of existing neurons) as well as promote differentiation and repopulation by progenitor cells in the area affected.
In addition to degenerative-induced dementias, a pharmaceutical preparation of one or more of the subject RAFTK therapeutics can be applied opportunely in the treatment of neurodegenerative disorders which have manifestations of tremors and involuntary movements. Parkinson's disease, for example, primarily affects subcortical structures and is characterized by degeneration of the nigrostriatal pathway, raphe nuclei, locus cereleus, and the motor nucleus of vagus. Ballism is typically associated with damage to the subthalmic nucleus, often due to acute vascular accident.
Also included in the methods of the invention are treatment of neurogenic and myopathic diseases which ultimately affect the somatic division of the peripheral nervous system and are manifest as neuromuscular disorders. In an illustrative embodiment, the subject method is used to treat amyotrophic lateral sclerosis. ALS is a name given to a complex of disorders that comprise upper and lower motor neurons. Patients may present with progressive spinal muscular atrophy, progressive bulbar palsy, primary lateral sclerosis, or a combination of these conditions. The major pathological abnormality is characterized by a selective and progressive degeneration of the lower motor neurons in the spinal cord and the upper motor neurons in the cerebral cortex. The therapeutic application of a RAFTK therapeutic, can be used alone, or in conjunction with neurotrophic factors such as CNTF, BDNF or NGF to prevent and/or reverse motor neuron degeneration in ALS patients.
Another aspect of the present invention relates to a method of inducing and/or maintaining a differentiated state or enhancing survival by contacting the cells with an agent which modulates RAFTK-dependent signaling by a growth factor. For instance, it is contemplated by the invention that, in light of the present finding of a broad involvement of RAFTK proteins in signal transduction in a variety of different cell types, the subject RAFTK signaling molecules can be used in a wide range of therapeutic regimens both in vitro and in vivo. A "RAFTK therapeutic" can be, as appropriate, any of the preparations described above, including isolated polypeptides, gene therapy constructs, antisense molecules, peptidomimetics or agents identified in the drug assays provided herein.
In one embodiment the RAFTK proteins of the present invention can modulate the differentiation or maturation of hematopoietic cells; the subject RAFTK polypeptides are capable of influencing both the differentiation and maturation of pluripotent stem cells and the proliferation of differentiated cells. In a preferred embodiment RAFTK bioactivity is modulated in CD34+ bone marrow cells; the presence of the cell-surface marker CD34 in humans has been found to correlate with bone marrow progenitors which proliferate to hematopoietic cytokines.
Hematopoiesis can be modulated either in vitro or in vivo and the subject RAFTK therapeutics can be used alone or in combination with cytokines and/or colony stimulating factors. For example, in certain embodiments, it may be desirable to coadminister a growth factor, for example, G-CSF and/or IL-3 (Lemoli et al. Experimental Hematology 1995, 23:1520) or SCF which has been shown to act with other cytokines to stimulate hematopoietic colony formation Martin et al. (1990) Cell 63, 203), stimulate hematopoiesis (Andrews et al. (1991) Blood IS, 1975), and rescue from the effects of lethal irradiation (Zsebo et al. (1992) Proc. Natl. Acad. Sci. USA 89, 9464) can be combined with with the subject RAFTK therapeutics. When stem cells are induced to mature and/or proliferate in vitro, the subject RAFTK therapeutics can be combined with culture of the stem cells on feeder cells. Stem cells in which RAFTK is modulated can be useful, for example in the expansion of cells for autologous of allogeneic transplantation of stem cells or differentiated cells. RAFTK can be modulated to enhance engraftment and/or hematopoiesis after allogeneic bone marrow transplantation.
In preferred embodiments RAFTK can be modulated to control megakaryocyte development and to ameliorate diseases caused by abnormalities in megakaryocytic cells, for example, thrombocytopenia, myelodysplastic syndrome, myeloproliferative disorder, aplastic anemia, chronic myelogenous leukemia. Platelets are derived from megakaryocytes, and the subject RAFTK molecules can be used to correct abnormalities in platelet number or function. Platelets are important in numerous hemorrhagic and thrombotic disorders. In a preferred embodiment RAFTK bioactivity can be modulated to control platelet aggregation. In yet another embodiment, the subject RAFTK therapeutics can play a role in the maturation of cells of the erythroid lineage.
Among the approaches which can be used to ameliorate disease symptoms involving the misexpression of a RAFTK gene are, for example, antisense, ribozyme, and triple helix molecules described above. Compounds that compete with an RAFTK protein for binding with an actove portion of RAFTK will antagonize a RAFTK protein, thereby inducing a therapeutic effect. Examples of suitable compounds include the antagonists or homologues described in detail above. In other instances, the increased expression or bioactivity of a RAFTK protein may be desirable and may be accomplished by, for example the use of the RAFTK agonists or mimetics or by gene replacement therapy, as described herein.
Effective Dose It is within the level of ordinary skill in the art to determine dosages of the subject RAFTK therapeutics. The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans.
Formulation and Use
Pharmaceutical compositions for use in accordance with the present invention can be formulated in conventional manner using one or more physiologically acceptable carriers or excipients. Thus, the compounds (e.g., RAFTK polypeptides or RAFTK nucleic acids) and their physiologically acceptable salts and solvates may be formulated for administration by, for example, injection, inhalation or insufflation (either through the mouth or the nose) or oral, buccal, parenteral or rectal administration.
For such therapy, the oligomers of the invention can be formulated for a variety of loads of administration, including systemic and topical or localized administration. Techniques and formulations generally can be found in Remmington's Pharmaceutical Sciences, Meade Publishing Co., Easton, PA. For systemic administration, injection is preferred, including intramuscular, intravenous, intraperitoneal, and subcutaneous. For oral administration, the pharmaceutical compositions can take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulphate). The tablets may be coated by methods well known in the art.
Preparations for oral administration may be suitably formulated to give controlled release of the active compound.
The compounds can be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampules or in multi-dose containers, with an added preservative. The compositions can take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen- free water, before use.
Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration bile salts and fusidic acid derivatives. In addition, detergents may be used to facilitate permeation. Transmucosal administration may be through nasal sprays or using suppositories. For topical administration, the oligomers of the invention are formulated into ointments, salves, gels, or creams as generally known in the art.
In clinical settings, the gene delivery systems for the therapeutic RAFTK gene can be introduced into a patient by any of a number of methods, each of which is familiar in the art. For example, a pharmaceutical preparation of the gene delivery system can be introduced systemically, e.g. by intravenous injection, and specific transduction of the protein in the target cells occurs predominantly from specificity of transfection provided by the gene delivery vehicle, cell-type or tissue-type expression due to the transcriptional regulatory sequences controlling expression of the receptor gene, or a combination thereof. In other embodiments, initial delivery of the recombinant gene is localized. For example, the gene delivery vehicle can be introduced by catheter (see U.S. Patent 5,328,470) or by stereotactic injection (e.g. Chen et al. (1994) PNAS 91 , 3054-3057). A mammalian RAFTK gene, such as any one of the sequences represented in one of SEQ ID NOS.T or 3, or a sequence homologous thereto can be delivered in a gene therapy construct by electroporation using techniques described, for example, by Dev et al. ((1994) Cancer Treat Rev 20, 105-115). The pharmaceutical preparation of the gene therapy construct can include the gene delivery system in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery system can be produced intact from recombinant cells, e.g. retroviral vectors, the pharmaceutical preparation can comprise one or more cells which produce the gene delivery system.
The compositions can, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient. The pack may for example comprise metal or plastic foil, such as a blister pack. The pack or dispenser device can be accompanied by instructions for administration.
Diagnostic and Prognostic Assays
The present method provides a method for determining if a subject is at risk for a disorder characterized by aberrant cell proliferation and/or differentiation. In preferred embodiments, the methods can be characterized as comprising detecting, in a sample of cells from the subject, the presence or absence of a genetic lesion characterized by at least one of (i) an alteration affecting the integrity of a gene encoding a RAFTK-pτotem' , or (ii) the mis-expression of the RAFTK gene. To illustrate, such genetic lesions can be detected by ascertaining the existence of at least one of (i) a deletion of one or more nucleotides from a RAFTK gene, (ii) an addition of one or more nucleotides to a RAFTK gene, (iii) a substitution of one or more nucleotides of a RAFTK gene, (iv) a gross chromosomal rearrangement of a RAFTK gene, (v) a gross alteration in the level of a messenger RNA transcript of a RAFTK gene, (vii) aberrant modification of a RAFTK gene, such as of the methylation pattern of the genomic DNA, (vii) the presence of a non-wild type splicing pattern of a messenger RNA transcript of a RAFTK gene, (viii) a non-wild type level of a RAFTK- protein, (ix) allelic loss of a RAFTK gene, and (x) inappropriate post-translational modification of a RAFTK-pvotein. As described herein, the present invention provides a large number of assay techniques for detecting lesions in a RAFTK gene, and importantly, provides the ability to discern between different molecular causes underlying RAFTK-dependenl aberrant cell growth, proliferation and/or differentiation. In an exemplary embodiment, there is provided a nucleic acid composition comprising a (purified) oligonucleotide probe including a region of nucleotide sequence which is capable of hybridizing to a sense or antisense sequence of a RAFTK gene, such as represented by one of SEQ ID NOs:l or 3, or naturally occurring mutants thereof, or 5' or 3' flanking sequences or intronic sequences naturally associated with the subject RAFTK genes or naturally occurring mutants thereof. The nucleic acid of a cell is rendered accessible for hybridization, the probe is exposed to nucleic acid of the sample, and the hybridization of the probe to the sample nucleic acid is detected. Such techniques can be used to detect lesions at either the genomic or mRNA level, including deletions, substitutions, etc., as well as to determine mRNA transcript levels.
In certain embodiments, detection of the lesion comprises utilizing the probe/primer in a polymerase chain reaction (PCR) (see, e.g. U.S. Patent Nos. 4,683,195 and 4,683,202), such as anchor PCR or RACE PCR, or, alternatively, in a ligation chain reaction (LCR) (see, e.g., Landegran et al. (1988) Science 241, 1077- 1080; and Nakazawa et al. (1994) PNAS 91 , 360-364), the latter of which can be particularly useful for detecting point mutations in the RAFTK-gene (see Abravaya et al. (1995) Nuc Acid Res 23, 675-682). In an illustrative embodiment, the method includes the steps of (i) collecting a sample of cells from a patient, (ii) isolating nucleic acid (e.g., genomic, mRNA or both) from the cells of the sample, (iii) contacting the nucleic acid sample with one or more primers which specifically hybridize to a RAFTK gene under conditions such that hybridization and amplification of the RAFTK-gene (if present) occurs, and (iv) detecting the presence or absence of an amplification product, or detecting the size of the amplification product and comparing the length to a control sample. It is anticipated that PCR and/or LCR may be desirable to use as a preliminary amplification step in conjunction with any of the techniques used for detecting mutations described herein. Alternative amplification methods include: self sustained sequence replication (Guatelli, J.C. et al. (1990) Proc. Natl. Acad. Sci. USA 87, 1874-1878), transcriptional amplification system (Kwoh, D.Y. et al. (1989) Proc. Natl. Acad Sci. USA 86, 1173-1177), Q-Beta Replicase (Lizardi, P.M. et al. (1988) Bio/Technology 6, 1197), or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers.
In a preferred embodiment of the subject assay, mutations in a RAFTK gene from a sample cell are identified by alterations in restriction enzyme cleavage patterns. For example, sample and control DNA is isolated, amplified (optionally), digested with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis. Moreover, the use of sequence specific ribozymes (see, for example, U.S. Patent No. 5,498,531) can be used to score for the presence of specific mutations by development or loss of a ribozyme cleavage site.
In yet another embodiment, any of a variety of sequencing reactions known in the art can be used to directly sequence the RAFTK gene and detect mutations by comparing the sequence of the sample RAFTK with the corresponding wild-type (control) sequence. Exemplary sequencing reactions include those based on techniques developed by Maxim and Gilbert (Proc. Natl Acad Sci USA ( 1977) 74, 560) or Sangcr (Sanger et al (1977) Proc. Nat. Acad. Sci 74, 5463). It is also contemplated that any of a variety of automated sequencing procedures may be utilized when performing the subject assays ((1995) Biotechniques 19, 448), including by sequencing by mass spectrometry (see, for example PCT publication WO 94/16101 ; Cohen et al. (1996) Adv Chromatogr 36, 127-162; and Griffin et al. (1993) Appl Biochem Biotechnol 38, 147-159). It will be evident to one skilled in the art that, for certain embodiments, the occurence of only one, two or three of the nucleic acid bases need be determined in the sequencing reaction. For instance, A-tract or the like, e.g., where only one nucleic acid is detected, can be carried out. In a further embodiment, protection from cleavage agents (such as a nuclease, hydroxylamine or osmium tetroxide and with piperidine) can be used to detect mismatched bases in RNA RNA or RNA/DNA heteroduplexes (Myers, et al. (1985) Science 230, 1242). In general, the art technique of "mismatch cleavage" starts by providing heteroduplexes of formed by hybridizing (labelled) RNA or DNA containing the wild-type RAFTK sequence with potentially mutant RNA or DNA obtained from a tissue sample. The double-stranded duplexes are treated with an agent which cleaves single-stranded regions of the duplex such as which will exist due to basepair mismatches between the control and sample strands. For instance, RNA/DNA duplexes can be treated with RNase and DNA/DNA hybrids treated with SI nuclease to enzymatically digesting the mismatched regions. In other embodiments, either DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium tetroxide and with piperidine in order to digest mismatched regions. After digestion of the mismatched regions, the resulting material is then separated by size on denaturing polyacrylamide gels to determine the site of mutation. See, for example, Cotton et al (1988) Proc. Natl Acad Sci USA 85, 4397; Saleeba et al ( 1992) Methods Enzymod. 217, 286-295. In a preferred embodiment, the control DNA or RNA can be labeled for detection. In still another embodiment, the mismatch cleavage reaction employs one or more proteins that recognize mismatched base pairs in double-stranded DNA (so called "DNA mismatch repair" enzymes) in defined systems for detecting and mapping point mutations in RAFTK cDNAs obtained from samples of cells. For example, the mutY enzyme of E. coli cleaves A at G/A mismatches and the thymidine DNA glycosylase from HeLa cells cleaves T at G/T mismatches (Hsu et al. (1994) Carcinogenesis 15, 1657-1662). According to an exemplary embodiment, a probe based on a RAFTK sequence, e.g., a wild-type RAFTK sequence, is hybridized to a cDNA or other DNA product from a test cell(s). The duplex is treated with a DNA mismatch repair enzyme, and the cleavage products, if any, can be detected from electrophoresis protocols or the like. See, for example, U.S. Patent No. 5,459,039.
In other embodiments, alterations in electrophoretic mobility is used to identify mutations in RAFTK genes. For example, single strand conformation polymoφhism (SSCP) may be used to detect differences in electrophoretic mobility between mutant and wild type nucleic acids (Orita et al. (1989) Proc Natl. Acad. Sci USA 86, 2766, see also Cotton (1993) Mutat Res 285, 125-144; and Hayashi (1992) Genet Anal Tech Appl 9, 73-79). Single-stranded DNA fragments of sample and control RAFTK nucleic acids is denatured and allowed to renature. The secondary structure of single-stranded nucleic acids varies according to sequence, the resulting alteration in electrophoretic mobility enables the detection of even a single base change. The DNA fragments may be labelled or detected with labelled probes. The sensitivity of the assay may be enhanced by using RNA (rather than DNA), in which the secondary structure is more sensitive to a change in sequence. In a preferred embodiment, the subject method utilizes heteroduplex analysis to separate double stranded heteroduplex molecules on the basis of changes in electrophoretic mobility (Keen et al. (1991) Trends Genet 1, 5).
In yet another embodiment the movement of mutant or wild-type fragments in polyacrylamide gels containing a gradient of denaturant is assayed using denaturing gradient gel electrophoresis (DGGE) (Myers et al (1985) Nature 313, 495). When DGGE is used as the method of analysis, DNA will be modified to insure that it does not completely denature, for example by adding a GC clamp of approximately 40 bp of high-melting GC-rich DNA by PCR. In a further embodiment, a temperature gradient is used in place of a denaturing agent gradient to identify differences in the mobility of control and sample DNA (Rosenbaum and Reissner (1987) Biophys Chem 265, 12753).
Examples of other techniques for detecting point mutations include, but are not limited to, selective oligonucleotide hybridization, selective amplification, or selective primer extension. For example, oligonucleotide primers may be prepared in which the known mutation is placed centrally and then hybridized to target DNA under conditions which permit hybridization only if a perfect match is found (Saiki et al. (1986) Nature 324, 163); Saiki et al (1989) Proc. Nail Acad. Sci USA 86, 6230). Such allele speicific oligonucleotide hybridization techniques may be used to test one mutation per reaction when oligonucleotides are hybridized to PCR amplified target DNA or a number of different mutations when the oligonucleotides are attached to the hybridizing membrane and hybridized with labelled target DNA.
Alternatively, allele specific amplification technology which depends on selective PCR amplification may be used in conjunction with the instant invention. Oligonucleotides used as primers for specific amplification may carry the mutation of interest in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al (1989) Nucleic Acids Res. 17, 2437-2448) or at the extreme 3' end of one primer where, under appropriate conditions, mismatch can prevent, or reduce polymerase extension (Prossner ( 1993) Tibtech 1 1 , 238. In addition it may be desirable to introduce a novel restriction site in the region of the mutation to create cleavage-based detection (Gasparini et al (1992) Mol. Cell Probes 6, 1). It is anticipated that in certain embodiments amplification may also be performed using Taq ligase for amplification (Barany (1991) Proc. Natl. Acad. Sci USA 88, 189). In such cases, ligation will occur only if there is a perfect match at the 3' end of the 5' sequence making it possible to detect the presence of a known mutation at a specific site by looking for the presence or absence of amplification.
Another embodiment of the invention provides for a nucleic acid composition comprising a (purified) oligonucleotide probe including a region of nucleotide sequence which is capable of hybridizing to a sense or antisense sequence of a
RAFTK-gene, or naturally occurring mutants thereof, or 5' or 3' flanking sequences or intronic sequences naturally associated with the subject RAFTK-genes or naturally occurring mutants thereof. The nucleic acid of a cell is rendered accessible for hybridization, the probe is exposed to nucleic acid of the sample, and the hybridization of the probe to the sample nucleic acid is detected. Such techniques can be used to detect lesions at either the genomic or mRNA level, including deletions, substitutions, etc., as well as to determine mRNA transcript levels. Such oligonucleotide probes can be used for both predictive and therapeutic evaluation of allelic mutations which might be manifest in, for example, neoplastic or hypeφlastic disorders (e.g. aberrant cell growth).
The methods described herein may be performed, for example, by utilizing pre-packaged diagnostic kits comprising at least one probe nucleic acid or antibody reagent described herein, which may be conveniently used, e.g., in clinical settings to diagnose patients exhibiting symptoms or family history of a disease or illness involving a RAFTK gene.
Diagnostic procedures may also be performed in situ directly upon tissue sections (fixed and/or frozen) of patient tissue obtained from biopsies or resections, such that no nucleic acid purification is necessary. Nucleic acid reagents may be used as probes and/or primers for such in situ procedures (see, for example, Nuovo, G.J., 1992, PCR in situ hybridization: protocols and applications, Raven Press, NY).
In yet another embodiment mutant RAFTK proteins can be detected using the protein truncation test (PTT) (Dowton and Salugh. 1995, Clin. Chem 41:785). For PTT, RNA is initially isolated and reverse-transcribed, and the segment of interest is amplified by PCR. The PCR products are then used as a template for nested PCR amplification with a primer containing an RNA polymerase promoter and a translation initiation sequence. After amplification, the unique motifs incoφorated into the primer permit sequential in vitro transcription and translation of the PCR products. Protein products are analyzed by electrophoresis and mutantations which cause truncation of the protein are identified by a change in the molecular weight of the protein. DNA may also be used.
In addition to methods which focus primarily on the detection of one nucleic acid sequence, profiles may also be assessed in such detection schemes. Fingeφrint profiles may be generated, for example, by utilizing a differential display procedure, Northern analysis and/or RT-PCR.
Antibodies directed against wild type or mutant RAFTK proteins, which are discussed, above, may also be used indisease diagnostics and prognostics. Such diagnostic methods, may be used to detect abnormalities in the level of RAFTK protein expression, or abnormalities in the structure and/or tissue, cellular, or subcellular location of RAFTK protein. Structural differences may include, for example, differences in the size, electronegativity, or antigenicity of the mutant RAFTK protein relative to the normal RAFTK protein. Protein from the tissue or cell type to be analyzed may easily be detected or isolated using techniques which are well known to one of skill in the art, including but not limited to western blot analysis. For a detailed explanation of methods for carrying out western blot analysis, see Sambrook et al, 1989, supra, at Chapter 18. The protein detection and isolation methods employed herein may also be such as those described in Harlow and Lane, for example, (Harlow, E. and Lane, D., 1988, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York), which is incoφorated herein by reference in its entirety. This can be accomplished, for example, by immunofluorescence techniques employing a fluorescently labeled antibody (see below) coupled with light microscopic, flow cytometric, or fluorimetric detection. The antibodies (or fragments thereof) useful in the present invention may, additionally, be employed histologically, as in immunofluorescence or immunoelectron microscopy, for in situ detection of RAFTK proteins. In situ detection may be accomplished by removing a histological specimen from a patient, and contacting it with a labeled antibody of the present invention. The antibody (or fragment) is preferably applied by overlaying the labeled antibody (or fragment) onto a biological sample. Through the use of such a procedure, it is possible to determine not only the presence of the RAFTK protein, but also its distribution in the examined tissue. Using the present invention, one of ordinary skill will readily perceive that any of a wide variety of histological methods (such as staining procedures) can be modified in order to achieve such in situ detection. Often a solid phase support or carrier is used as a support capable of binding an antigen or an antibody. Well-known supports or carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, gabbros, and magnetite. The nature of the carrier can be either soluble to some extent or insoluble for the puφoses of the present invention. The support material may have virtually any possible structural configuration so long as the coupled molecule is capable of binding to an antigen or antibody. Thus, the support configuration may be spherical, as in a bead, or cylindrical, as in the inside surface of a test tube, or the external surface of a rod. Alternatively, the surface may be flat such as a sheet, test strip, etc. Preferred supports include polystyrene beads. Those skilled in the art will know many other suitable carriers for binding antibody or antigen, or will be able to ascertain the same by use of routine experimentation.
One means for labeling an anti- RAFTK protein specific antibody is via linkage to an enzyme and use in an enzyme immunoassay (EIA) (Voller (1978), "The Enzyme Linked Immunosorbent Assay (ELISA)", Diagnostic Horizons 2, 1-7, 1978, Microbiological Associates Quarterly Publication, Walkersville, MD; Voller, et al., J. Clin. Pathol. 31, 507-520 (1978); Butler (1981) Meth. Enzymol. 73, 482-523; Maggio, (ed.) Enzyme Immunoassay, CRC Press, Boca Raton, FL, 1980; Ishikawa, et al., (eds.) Enzyme Immunoassay, Kgaku Shoin, Tokyo, 1981). The enzyme which is bound to the antibody will react with an appropriate substrate, preferably a chromogenic substrate, in such a manner as to produce a chemical moiety which can be detected, for example, by spectrophotometric, fluorimetric or by visual means. Enzymes which can be used to detectably label the antibody include, but are not limited to, malate dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate, dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6- phosphate dehydrogenase, glucoamylase and acetylcholinesterase. The detection can be accomplished by colorimetric methods which employ a chromogenic substrate for the enzyme. Detection may also be accomplished by visual comparison of the extent of enzymatic reaction of a substrate in comparison with similarly prepared standards. Detection may also be accomplished using any of a variety of other immunoassays. For example, by radioactively labeling the antibodies or antibody fragments, it is possible to detect fingeφrint gene wild type or mutant peptides through the use of a radioimmunoassay (RIA) (see, for example, Weintraub, B., Principles of Radioimmunoassay s, Seventh Training Course on Radioligand Assay Techniques, The Endocrine Society, March, 1986, which is incoφorated by reference herein). The radioactive isotope can be detected by such means as the use of a gamma counter or a scintillation counter or by autoradiography.
It is also possible to label the antibody with a fluorescent compound. When the fluorescently labeled antibody is exposed to light of the proper wave length, its presence can then be detected due to fluorescence. Among the most commonly used fluorescent labeling compounds are fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine. The antibody can also be labeled using fluorescence emitting metals such as 152Eu, or others of the lanthanide series. These metals can be attached to the antibody using such metal chelating groups as diethylenetriaminepentacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA).
The antibody also can be detectably labeled by coupling it to a chemiluminescent compound. The presence of the chemiluminescent-tagged antibody is then determined by detecting the presence of luminescence that arises during the course of a chemical reaction. Examples of particularly useful chemiluminescent labeling compounds are luminol, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester. Likewise, a bioluminescent compound may be used to label the antibody of the present invention. Bioluminescence is a type of chemiluminescence found in biological systems in which a catalytic protein increases the efficiency of the chemiluminescent reaction. The presence of a bioluminescent protein is determined by detecting luminescence. Important bioluminescent compounds for puφoses of labeling are luciferin, luciferase and aequorin. Moreover, it will be understood that any of the above methods for detecting alterations in a RAFTK gene or gene product can be used to monitor the course of treatment or therapy.
Drug Screening Assays
Furthermore, by making available purified and recombinant RAFTK polypeptides, the present invention facilitates the development of assays which can be used to screen for compounds, including RAFTK homologs, which are either agonists or antagonists of the normal cellular function of the subject RAFTK polypeptides, or of their role in the pathogenesis of cellular differentiation and/or proliferation and disorders related thereto. A variety of assay formats can be utilized and, in light of the present inventions, will be comprehended by a skilled artisan.
Cell-free assays In many drug screening programs which test libraries of compounds and natural extracts, high throughput assays are desirable in order to maximize the number of compounds surveyed in a given period of time. Assays which are performed in cell-free systems, such as may be derived with purified or semi-purified proteins, are often preferred as "primary" screens in that they can be generated to permit rapid development and relatively easy detection of an alteration in a molecular target which is mediated by a test compound. Moreover, the effects of cellular toxicity and/or bioavailability of the test compound can be generally ignored in the in vitro system, the assay instead can be focused primarily on the effect of the drug on the molecular target as may be manifest in an alteration of binding affinity with upstream or downstream elements. Accordingly, in an exemplary screening assay of the present invention, the compound of interest is contacted with proteins which may function upstream (including both activators and repressors of its activity) or to proteins or nucleic acids which may function downstream of the RAFTK polypeptide, whether they are positively or negatively regulated by it. To the mixture of the compound and the upstream or downstream element is then added a composition containing a
RAFTK polypeptide. Detection and quantification of complexes of RAFTK with it's upstream or downstream elements provide a means for determining a compound's efficacy at inhibiting (or potentiating) complex formation between RAFTK and the RAFTK-bmding elements. The efficacy of the compound can be assessed by generating dose response curves from data obtained using various concentrations of the test compound. Moreover, a control assay can also be performed to provide a baseline for comparison. In the control assay, isolated and purified RAFTK polypeptide is added to a composition containing the -/64 -TΛ!-binding element, and the formation of a complex is quantitated in the absence of the test compound.
Complex formation between the RAFTK polypeptide and a RAFTK binding element may be detected by a variety of techniques. Modulation of the formation of complexes can be quantitated using, for example, detectably labeled proteins such as radiolabeled, fluorescently labeled, or enzymatically labeled RAFTK polypeptides, by immunoassay, or by chromatographic detection.
Typically, it is desirable to immobilize either RAFTK or its binding protein to facilitate separation of complexes from uncomplexed forms of one or both of the proteins, as well as to accommodate automation of the assay. Binding of RAFTK to an upstream or downstream element, in the presence and absence of a candidate agent, can be accomplished in any vessel suitable for containing the reactants. Examples include microtitre plates, test tubes, and micro-centrifuge tubes. In one embodiment, a fusion protein can be provided which adds a domain that allows the protein to be bound to a matrix. For example, glutathione-S-transferase/iϊ / Λ: (GST/RAFTK) fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, MO) or glutathione derivatized microtitre plates, which are then combined with the cell lysates (e.g. 35S-labeled) and the test compound, and the mixture incubated under conditions conducive to complex formation, for example at physiological conditions for salt and pH, though slightly more stringent conditions may be desired. Following incubation, the beads are washed to remove any unbound label, and the matrix immobilized and radiolabel determined directly (e.g. beads placed in scintilant), or in the supernatant after the complexes are dissociated. Alternatively, the complexes can be dissociated from the matrix, separated by SDS- PAGE, and the level of RAFTK-bm' ding protein found in the bead fraction quantitated from the gel using standard electrophoretic techniques.
Other techniques for immobilizing proteins on matrices are also available for use in the subject assay. For instance, either RAFTK or its cognate binding protein can be immobilized utilizing conjugation of biotin and streptavidin. For instance, biotinylated RAFTK molecules can be prepared from biotin-NHS (N-hydroxysuccinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, IL), and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical). Alternatively, antibodies reactive with RAFTKbvΛ which do not interfere with binding of upstream or downstream elements can be derivatized to the wells of the plate, and RAFTK trapped in the wells by antibody conjugation. As above, preparations of a &4/*TΛ>binding protein and a test compound are incubated in the &-4.F7X-presenting wells of the plate, and the amount of complex trapped in the well can be quantitated. Exemplary methods for detecting such complexes, in addition to those described above for the GST-immobilized complexes, include immunodetection of complexes using antibodies reactive with the RAFTK binding element, or which are reactive with RAFTK protein and compete with the binding element; as well as enzyme-linked assays which rely on detecting an enzymatic activity associated with the binding element, either intrinsic or extrinsic activity. In the instance of the latter, the enzyme can be chemically conjugated or provided as a fusion protein with the RAFTK-BP. To illustrate, the RAFTK-BP can be chemically cross-linked or genetically fused with horseradish peroxidase, and the amount of polypeptide trapped in the complex can be assessed with a chromogenic substrate of the enzyme, e.g. 3,3'-diamino-benzadine terahydrochloride or 4-chloro-l-napthol. Likewise, a fusion protein comprising the polypeptide and glutathione-S-transferase can be provided, and complex formation quantitated by detecting the GST activity using 1 -chloro-2,4-dinitrobenzene (Habig et al (1974) J Biol Chem 249, 7130). For processes which rely on immunodetection for quantitating one of the proteins trapped in the complex, antibodies against the protein, such as
Figure imgf000058_0001
antibodies, can be used. Alternatively, the protein to be detected in the complex can be "epitope tagged" in the form of a fusion protein which includes, in addition to the RAFTK sequence, a second polypeptide for which antibodies are readily available (e.g. from commercial sources). For instance, the GST fusion proteins described above can also be used for quantification of binding using antibodies against the GST moiety. Other useful epitope tags include myc-epitopes (e.g., sec Ellison et al. (1991) J Biol Chem 266, 21150-21157) which includes a 10-residue sequence from c-myc, as well as the pFLAG system (International Biotechnologies, Inc.) or the pEZZ-protein A system (Pharamacia, NJ).
Cell based assays
In addition to cell-free assays, such as described above, the readily available source of mammalian RAFTK proteins provided by the present invention also facilitates the generation of cell-based assays for identifying small molecule agonists/antagonists and the like. For example, cells which are sensitive to ligands which transduce signals via a pathway involving RAFTK can be caused to overexpress a recombinant RAFTK protein in the presence and absence of a test agent of interest, with the assay scoring for modulation of RAFTK responses by the target cell mediated by the test agent. As with the cell-free assays, agents which produce a statistically significant change in &4 7Α'-dependent responses (either inhibition or potentiation) can be identified. In an illustrative embodiment, the expression or activity of a RAFTK is modulated in cells and the effects of compounds of interest on the readout of interest (such as apoptosis, proliferation or differentiation) are measured. For example, the expression of genes which are up- or down-regulated in response to a -/L4.F7Α--dependent signal cascade can be assayed. In preferred embodiments, the regulatory regions of such genes, e.g., the 5' flanking promoter and enhancer regions, are operably linked to a detectable marker (such as luciferase) which encodes a gene product that can be readily detected. Phosphorylation of RAFTK or RAFTK binding proteins can also be measured, for example by immunoblotting as described in the appended examples. Monitoring the influence of compounds on cells may be applied not only in basic drug screening, but also in clinical trials. In such clinical trials, the expression of a panel of genes may be used as a "read out" of a particular drug's therapeutic effect.
In yet another aspect of the invention, the subject RAFTK polypeptides can be used to generate a "two hybrid" assay (see, for example, U.S. Patent No. 5,283,317; Zervos et al. (1993) Cell 72, 223-232; Madura et al. (1993) J 5 o/ Chem 268, 12046- 12054; Bartel et al. (1993) Biotechniques 14, 920-924; Iwabuchi et al. (1993) Oncogene 8, 1693-1696; and Brent WO94/10300), for isolating coding sequences for other cellular proteins which bind to or interact with RAFTK (" RAFTK-b' dϊng proteins" or "RAFTK-bp". Such i 4 TA:-binding proteins would likely also be involved in the propagation of signals by the RAFTK proteins as, for example, the upstream or downstream elements of the RAFTK pathway.
Briefly, the two hybrid assay relies on reconstituting in vivo a functional transcriptional activator protein from two separate fusion proteins. In particular, the method makes use of chimeric genes which express hybrid proteins. To illustrate, a first hybrid gene comprises the coding sequence for a DN A-binding domain of a transcriptional activator fused in frame to the coding sequence for a RAFTK polypeptide. The second hybrid protein encodes a transcriptional activation domain fused in frame to a sample gene from a cDNA library. If the bait and sample hybrid proteins are able to interact, e.g., form a RAFTK-dependent complex, they bring into close proximity the two domains of the transcriptional activator. This proximity is sufficient to cause transcription of a reporter gene which is operably linked to a transcriptional regulatory site responsive to the transcriptional activator, and expression of the reporter gene can be detected and used to score for the interaction of the RAFTK and sample proteins. Transgenic animals
These systems may be used in a variety of applications. For example, the cell- and animal-based model systems may be used to further characterize RAFTK genes and proteins. In addition, such assays may be utilized as part of screening strategies designed to identify compounds which are capable of ameliorating disease symptoms. Thus, the animal- and cell-based models may be used to identify drugs, pharmaceuticals, therapies and interventions which may be effective in treating disease.
One aspect of the present invention concerns transgenic animals comprising of cells which contain a transgene of the present invention and which preferably (though optionally) express an exogenous RAFTK protein in one or more cells in the animal. A RAFTK transgene can encode the wild-type form of the protein, or can encode homologs thereof, including both agonists and antagonists, as well as antisense constructs. In preferred embodiments, the expression of the transgene is restricted to specific subsets of cells, tissues or developmental stages utilizing, for example, cis- acting sequences that control expression in the desired pattern. In the present invention, such mosaic expression of a RAFTK protein can be essential for many forms of lineage analysis and can additionally provide a means to assess the effects of, for example, lack of RAFTK expression which might grossly alter development in small patches of tissue within an otherwise normal embryo. Toward this and, tissue- specific regulatory sequences and conditional regulatory sequences can be used to control expression of the transgene in certain spatial patterns. Moreover, temporal patterns of expression can be provided by, for example, conditional recombination systems or prokaryotic transcriptional regulatory sequences. Genetic techniques which allow for the expression of transgenes can be regulated via site-specific genetic manipulation in vivo are known to those skilled in the art. For instance, genetic systems are available which allow for the regulated expression of a recombinase that catalyzes the genetic recombination a target sequence. As used herein, the phrase "target sequence" refers to a nucleotide sequence that is genetically recombined by a recombinase. The target sequence is flanked by recombinase recognition sequences and is generally either excised or inverted in cells expressing recombinase activity. Recombinase catalyzed recombination events can be designed such that recombination of the target sequence results in either the activation or repression of expression of one of the subject RAFTK proteins. For example, excision of a target sequence which interferes with the expression of a recombinant RAFTK gene, such as one which encodes an antagonistic homolog or an antisense transcript, can be designed to activate expression of that gene. This interference with expression of the protein can result from a variety of mechanisms, such as spatial separation of the RAFTK gene from the promoter element or an internal stop codon. Moreover, the transgene can be made wherein the coding sequence of the gene is flanked by recombinase recognition sequences and is initially transfected into cells in a 3' to 5' orientation with respect to the promoter element. In such an instance, inversion of the target sequence will reorient the subject gene by placing the 5' end of the coding sequence in an orientation with respect to the promoter element which allow for promoter driven transcriptional activation.
The transgenic animals of the present invention all include within a plurality of their cells a transgene of the present invention, which transgene alters the phenotype of the "host cell" with respect to regulation of cell growth, death and/or differentiation. Since it is possible to produce transgenic organisms of the invention utilizing one or more of the transgene constructs described herein, a general description will be given of the production of transgenic organisms by referring generally to exogenous genetic material. This general description can be adapted by those skilled in the art in order to incoφorate specific transgene sequences into organisms utilizing the methods and materials described below.
In an illustrative embodiment, either the cre/loxP recombinase system of bacteriophage PI (Lakso et al. (1992) PNAS 89, 6232-6236; Orban et al. (1992) PNAS 89, 6861-6865) or the FLP recombinase system of Saccharomyces cerevisiae
(O'Gorman et al. (1991) Science 251, 1351-1355; PCT publication WO 92/15694) can be used to generate in vivo site-specific genetic recombination systems. Cre recombinase catalyzes the site-specific recombination of an intervening target sequence located between loxP sequences. loxP sequences are 34 base pair nucleotide repeat sequences to which the Cre recombinase binds and are required for Cre recombinase mediated genetic recombination. The orientation of loxP sequences determines whether the intervening target sequence is excised or inverted when Cre recombinase is present (Abremski et al. (1984) J. Biol. Chem. 259, 1509-1514); catalyzing the excision of the target sequence when the loxP sequences are oriented as direct repeats and catalyzes inversion of the target sequence when loxP sequences are oriented as inverted repeats.
Accordingly, genetic recombination of the target sequence is dependent on expression of the Cre recombinase. Expression of the recombinase can be regulated by promoter elements which are subject to regulatory control, e.g., tissue-specific, developmental stage-specific, inducible or repressible by externally added agents.
This regulated control will result in genetic recombination of the target sequence only in cells where recombinase expression is mediated by the promoter element. Thus, the activation expression of a recombinant RAFTK protein can be regulated via control of recombinase expression.
Use of the cre/loxP recombinase system to regulate expression of a recombinant RAFTK protein requires the construction of a transgenic animal containing transgenes encoding both the Cre recombinase and the subject protein. Animals containing both the Cre recombinase and a recombinant RAFTK gene can be provided through the construction of "double" transgenic animals. A convenient method for providing such animals is to mate two transgenic animals each containing a transgene, e.g., a RAFTK gene and recombinase gene. One advantage derived from initially constructing transgenic animals containing a RAFTK transgene in a recombinase-mediated expressible format derives from the likelihood that the subject protein, whether agonistic or antagonistic, can be deleterious upon expression in the transgenic animal. In such an instance, a founder population, in which the subject transgene is silent in all tissues, can be propagated and maintained. Individuals of this founder population can be crossed with animals expressing the recombinase in, for example, one or more tissues and/or a desired temporal pattern. Thus, the creation of a founder population in which, for example, an antagonistic RAFTK transgene is silent will allow the study of progeny from that founder in which disruption of RAFTK mediated induction in a particular tissue or at certain developmental stages would result in, for example, a lethal phenotype.
Similar conditional transgenes can be provided using prokaryotic promoter sequences which require prokaryotic proteins to be simultaneous expressed in order to facilitate expression of the RAFTK transgene. Exemplary promoters and the corresponding trans-activating prokaryotic proteins are given in U.S. Patent No. 4,833,080.
Moreover, expression of the conditional transgenes can be induced by gene therapy-like methods wherein a gene encoding the trans-activating protein, e.g. a recombinase or a prokaryotic protein, is delivered to the tissue and caused to be expressed, such as in a cell-type specific manner. By this method, a RAFTK transgene could remain silent into adulthood until "turned on" by the introduction of the trans- activator.
In an exemplary embodiment, the "transgenic non-human animals" of the invention are produced by introducing transgenes into the germline of the non-human animal. Embryonal target cells at various developmental stages can be used to introduce transgenes. Different methods are used depending on the stage of development of the embryonal target cell. The specific line(s) of any animal used to practice this invention are selected for general good health, good embryo yields, good pronuclear visibility in the embryo, and good reproductive fitness. In addition, the haplotype is a significant factor. For example, when transgenic mice are to be produced, strains such as C57BL/6 or FVB lines are often used (Jackson Laboratory, Bar Harbor, ME). Preferred strains are those with H-2b, H-2d or H-2q haplotypes such as C57BL/6 or DBA 1. The line(s) used to practice this invention may themselves be transgenics, and/or may be knockouts (i.e., obtained from animals which have one or more genes partially or completely suppressed) .
In one embodiment, the transgene construct is introduced into a single stage embryo. The zygote is the best target for micro-injection. In the mouse, the male pronucleus reaches the size of approximately 20 micrometers in diameter which allows reproducible injection of l-2pl of DNA solution. The use of zygotes as a target for gene transfer has a major advantage in that in most cases the injected DNA will be incoφorated into the host gene before the first cleavage (Brinster et al. (1985) PNAS 82, 4438-4442). As a consequence, all cells of the transgenic animal will carry the incoφorated transgene. This will in general also be reflected in the efficient transmission of the transgene to offspring of the founder since 50% of the germ cells will harbor the transgene.
Normally, fertilized embryos are incubated in suitable media until the pronuclei appear. At about this time, the nucleotide sequence comprising the transgene is introduced into the female or male pronucleus as described below. In some species such as mice, the male pronucleus is preferred. It is most preferred that the exogenous genetic material be added to the male DNA complement of the zygote prior to its being processed by the ovum nucleus or the zygote female pronucleus. It is thought that the ovum nucleus or female pronucleus release molecules which affect the male DNA complement, perhaps by replacing the protamines of the male DNA with histones, thereby facilitating the combination of the female and male DNA complements to form the diploid zygote.
Thus, it is preferred that the exogenous genetic material be added to the male complement of DNA or any other complement of DNA prior to its being affected by the female pronucleus. For example, the exogenous genetic material is added to the early male pronucleus, as soon as possible after the formation of the male pronucleus, which is when the male and female pronuclei are well separated and both are located close to the cell membrane. Alternatively, the exogenous genetic material could be added to the nucleus of the sperm after it has been induced to undergo decondensation. Sperm containing the exogenous genetic material can then be added to the ovum or the decondensed sperm could be added to the ovum with the transgene constructs being added as soon as possible thereafter. Introduction of the transgene nucleotide sequence into the embryo may be accomplished by any means known in the art such as, for example, microinjection, electroporation, or lipofection. Following introduction of the transgene nucleotide sequence into the embryo, the embryo may be incubated in vitro for varying amounts of time, or reimplanted into the surrogate host, or both. In vitro incubation to maturity is within the scope of this invention. One common method in to incubate the embryos in vitro for about 1 -7 days, depending on the species, and then reimplant them into the surrogate host.
For the puφoses of this invention a zygote is essentially the formation of a diploid cell which is capable of developing into a complete organism. Generally, the zygote will be comprised of an egg containing a nucleus formed, either naturally or artificially, by the fusion of two haploid nuclei from a gamete or gametes. Thus, the gamete nuclei must be ones which are naturally compatible, i.e., ones which result in a viable zygote capable of undergoing differentiation and developing into a functioning organism. Generally, a euploid zygote is preferred. If an aneuploid zygote is obtained, then the number of chromosomes should not vary by more than one with respect to the euploid number of the organism from which either gamete originated.
In addition to similar biological considerations, physical ones also govern the amount (e.g., volume) of exogenous genetic material which can be added to the nucleus of the zygote or to the genetic material which forms a part of the zygote nucleus. If no genetic material is removed, then the amount of exogenous genetic material which can be added is limited by the amount which will be absorbed without being physically disruptive. Generally, the volume of exogenous genetic material inserted will not exceed about 10 picoliters. The physical effects of addition must not be so great as to physically destroy the viability of the zygote. The biological limit of the number and variety of DNA sequences will vary depending upon the particular zygote and functions of the exogenous genetic material and will be readily apparent to one skilled in the art, because the genetic material, including the exogenous genetic material, of the resulting zygote must be biologically capable of initiating and maintaining the differentiation and development of the zygote into a functional organism.
The number of copies of the transgene constructs which are added to the zygote is dependent upon the total amount of exogenous genetic material added and will be the amount which enables the genetic transformation to occur. Theoretically only one copy is required; however, generally, numerous copies are utilized, for example, 1,000-20,000 copies of the transgene construct, in order to insure that one copy is functional. As regards the present invention, there will often be an advantage to having more than one functioning copy of each of the inserted exogenous DNA sequences to enhance the phenotypic expression of the exogenous DNA sequences.
Any technique which allows for the addition of the exogenous genetic material into nucleic genetic material can be utilized so long as it is not destructive to the cell, nuclear membrane or other existing cellular or genetic structures. The exogenous genetic material is preferentially inserted into the nucleic genetic material by microinjection. Microinjection of cells and cellular structures is known and is used in the art.
Reimplantation is accomplished using standard methods. Usually, the surrogate host is anesthetized, and the embryos are inserted into the oviduct. The number of embryos implanted into a particular host will vary by species, but will usually be comparable to the number of off spring the species naturally produces.
Transgenic offspring of the surrogate host may be screened for the presence and/or expression of the transgene by any suitable method. Screening is often accomplished by Southern blot or Northern blot analysis, using a probe that is complementary to at least a portion of the transgene. Western blot analysis using an antibody against the protein encoded by the transgene may be employed as an alternative or additional method for screening for the presence of the transgene product. Typically, DNA is prepared from tail tissue and analyzed by Southern analysis or PCR for the transgene. Alternatively, the tissues or cells believed to express the transgene at the highest levels are tested for the presence and expression of the transgene using Southern analysis or PCR, although any tissues or cell types may be used for this analysis.
Alternative or additional methods for evaluating the presence of the transgene include, without limitation, suitable biochemical assays such as enzyme and/or immunological assays, histological stains for particular marker or enzyme activities, flow cytometric analysis, and the like. Analysis of the blood may also be useful to detect the presence of the transgene product in the blood, as well as to evaluate the effect of the transgene on the levels of various types of blood cells and other blood constituents.
Progeny of the transgenic animals may be obtained by mating the transgenic animal with a suitable partner, or by in vitro fertilization of eggs and/or sperm obtained from the transgenic animal. Where mating with a partner is to be performed, the partner may or may not be transgenic and/or a knockout; where it is transgenic, it may contain the same or a different transgene, or both. Alternatively, the partner may be a parental line. Where in vitro fertilization is used, the fertilized embryo may be implanted into a surrogate host or incubated in vitro, or both. Using either method, the progeny may be evaluated for the presence of the transgene using methods described above, or other appropriate methods.
The transgenic animals produced in accordance with the present invention will include exogenous genetic material. As set out above, the exogenous genetic material will, in certain embodiments, be a DNA sequence which results in the production of a RAFTK protein (either agonistic or antagonistic), and antisense transcript, or a RAFTK mutant. Further, in such embodiments the sequence will be attached to a transcriptional control element, e.g., a promoter, which preferably allows the expression of the transgene product in a specific type of cell.
Retroviral infection can also be used to introduce transgene into a non-human animal. The developing non-human embryo can be cultured in vitro to the blastocyst stage. During this time, the blastomeres can be targets for retroviral infection (Jaenich, R. (1976) PNAS 73, 1260-1264). Efficient infection of the blastomeres is obtained by enzymatic treatment to remove the zona pellucida (Manipulating the Mouse Embryo, Hogan eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1986). The viral vector system used to introduce the transgene is typically a replication-defective retrovirus carrying the transgene (Jahner et al. (1985) PNAS 82, 6927-6931 ; Van der Putten et al. (1985) PNAS 82, 6148-6152). Transfection is easily and efficiently obtained by culturing the blastomeres on a monolayer of virus-producing cells (Van der Putten, supra; Stewart et al. (1987) EMBOJ. 6, 383-388). Alternatively, infection can be performed at a later stage. Virus or virus-producing cells can be injected into the blastocoele (Jahner et al. (1982) Nature 298, 623-628). Most of the founders will be mosaic for the transgene since incoφoration occurs only in a subset of the cells which formed the transgenic non-human animal. Further, the founder may contain various retroviral insertions of the transgene at different positions in the genome which generally will segregate in the offspring. In addition, it is also possible to introduce transgenes into the germ line by intrauterine retroviral infection of the midgestation embryo (Jahner et al. (1982) supra). A third type of target cell for transgene introduction is the embryonal stem cell
(ES). ES cells are obtained from pre-implantation embryos cultured in vitro and fused with embryos (Evans et al. (1981) Nature 292, 154-156; Bradley et al. (1984) Nature 309, 255-258; Gossler et al. (1986) PNAS 83, 9065-9069; and Robertson et al. (1986) Nature 322, 445-448). Transgenes can be efficiently introduced into the ES cells by DNA transfection or by retrovirus-mediated transduction. Such transformed ES cells can thereafter be combined with blastocysts from a non-human animal. The ES cells thereafter colonize the embryo and contribute to the germ line of the resulting chimeric animal. For review see Jaenisch, R. (1988) Science 240, 1468-1474.
In one embodiment, gene targeting, which is a method of using homologous recombination to modify an animal's genome, can be used to introduce changes into cultured embryonic stem cells. By targeting a RAFTK gene of interest in ES cells, these changes can be introduced into the germlines of animals to generate chimeras. The gene targeting procedure is accomplished by introducing into tissue culture cells a DNA targeting construct that includes a segment homologous to a target RAFTK locus, and which also includes an intended sequence modification to the RAFTK genomic sequence (e.g., insertion, deletion, point mutation). The treated cells are then screened for accurate targeting to identify and isolate those which have been properly targeted.
Gene targeting in embryonic stem cells is in fact a scheme contemplated by the present invention as a means for disrupting a RAFTK gene function through the use of a targeting transgene construct designed to undergo homologous recombination with one or more RAFTK genomic sequences. The targeting construct can be arranged so that, upon recombination with an element of a RAFTK gene, a positive selection marker is inserted into (or replaces) coding sequences of the targeted siganlin gene. The inserted sequence functionally disrupts the RAFTK gene, while also providing a positive selection trait. Exemplary RAFTK targeting constructs are described in more detail below.
Generally, the embryonic stem cells (ES cells ) used to produce the knockout animals will be of the same species as the knockout animal to be generated. Thus for example, mouse embryonic stem cells will usually be used for generation of knockout mice.
Embryonic stem cells are generated and maintained using methods well known to the skilled artisan such as those described by Doetschman et al. (1985) J. Embryol. Exp. Morphol. 87, 27-45). Any line of ES cells can be used, however, the line chosen is typically selected for the ability of the cells to integrate into and become part of the germ line of a developing embryo so as to create germ line transmission of the knockout construct. Thus, any ES cell line that is believed to have this capability is suitable for use herein. One mouse strain that is typically used for production of ES cells, is the 129J strain. Another ES cell line is murine cell line D3 (American Type Culture Collection, catalog no. CKL 1934) Still another preferred ES cell line is the WW6 cell line (loffe et al. (1995) PNAS 92, 7357-7361 ). The cells are cultured and prepared for knockout construct insertion using methods well known to the skilled artisan, such as those set forth by Robertson in: Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E.J. Robertson, ed. IRL Press, Washington, D.C. [1987]); by Bradley et al. (1986) Current Topics in Devel. Biol. 20, 357-371); and by Hogan et al. (Manipulating the Mouse Embryo: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY [1986]) . Insertion of the knockout construct into the E.S cells can be accomplished using a variety of methods well known in the art including for example, electroporation, microinjection, and calcium phosphate treatment. A preferred method of insertion is electroporation .
Each knockout construct to be inserted into the cell must first be in the linear form. Therefore, if the knockout construct has been inserted into a vector (described infra), linearization is accomplished by digesting the DNA with a suitable restriction endonuclease selected to cut only within the vector sequence and not within the knockout construct sequence.
For insertion, the knockout construct is added to the ES cells under appropriate conditions for the insertion method chosen, as is known to the skilled artisan. Where more than one construct is to be introduced into the ES cell, each knockout construct can be introduced simultaneously or one at a time.
If the ES cells are to be electroporated, the ES cells and knockout construct DNA are exposed to an electric pulse using an electroporation machine and following the manufacturer's guidelines for use. After electroporation, the ES cells are typically allowed to recover under suitable incubation conditions. The cells are then screened for the presence of the knockout construct.
Screening can be accomplished using a variety of methods. Where the marker gene is an antibiotic resistance gene, for example, the ES cells may be cultured in the presence of an otherwise lethal concentration of antibiotic. Those ES cells that survive have presumably integrated the knockout construct. If the marker gene is other than an antibiotic resistance gene, a Southern blot of the ES cell genomic DNA can be probed with a sequence of DNA designed to hybridize only to the marker sequence Alternatively, PCR can be used. Finally, if the marker gene is a gene that encodes an enzyme whose activity can be detected (e.g., b-galactosidase), the enzyme substrate can be added to the cells under suitable conditions, and the enzymatic activity can be analyzed. One skilled in the art will be familiar with other useful markers and the means for detecting their presence in a given cell. All such markers are contemplated as being included within the scope of the teaching of this invention. The knockout construct may integrate into several locations in the ES cell genome, and may integrate into a different location in each ES cell's genome due to the occurrence of random insertion events. The desired location of insertion is in a complementary position to the DNA sequence to be knocked out, e.g., the RAFTK coding sequence, transcriptional regulatory sequence, etc. Typically, less than about 1-5 % of the ES cells that take up the knockout construct will actually integrate the knockout construct in the desired location. To identify those ES cells with proper integration of the knockout construct, total DNA can be extracted from the ES cells using standard methods. The DNA can then be probed on a Southern blot with a probe or probes designed to hybridize in a specific pattern to genomic DNA digested with particular restriction enzyme(s). Alternatively, or additionally, the genomic DNA can be amplified by PCR with probes specifically designed to amplify DNA fragments of a particular size and sequence (i.e., only those cells containing the knockout construct in the proper position will generate DNA fragments of the proper size).
After suitable ES cells containing the knockout construct in the proper location have been identified, the cells can be inserted into an embryo. Insertion may be accomplished in a variety of ways known to the skilled artisan, however a preferred method is by microinjection. For microinjection, about 10-30 cells are collected into a micropipet and injected into embryos that are at the proper stage of development to permit integration of the foreign ES cell containing the knockout construct into the developing embryo. For instance, as the appended Examples describe, the transformed ES cells can be microinjected into blastocytes.
The suitable stage of development for the embryo used for insertion of ES cells is very species dependent, however for mice it is about 3.5 days. The embryos are obtained by perfusing the uterus of pregnant females. Suitable methods for accomplishing this are known to the skilled artisan, and are set forth by, e.g., Bradley et al. (supra).
While any embryo of the right stage of development is suitable for use, preferred embryos are male. In mice, the preferred embryos also have genes coding for a coat color that is different from the coat color encoded by the ES cell genes. In this way, the offspring can be screened easily for the presence of the knockout construct by looking for mosaic coat color (indicating that the ES cell was incoφorated into the developing embryo). Thus, for example, if the ES cell line carries the genes for white fur, the embryo selected will carry genes for black or brown fur.
After the ES cell has been introduced into the embryo, the embryo may be implanted into the uterus of a pseudopregnant foster mother for gestation. While any foster mother may be used, the foster mother is typically selected for her ability to breed and reproduce well, and for her ability to care for the young. Such foster mothers are typically prepared by mating with vasectomized males of the same species. The stage of the pseudopregnant foster mother is important for successful implantation, and it is species dependent. For mice, this stage is about 2-3 days pseudopregnant. Offspring that are born to the foster mother may be screened initially for mosaic coat color where the coat color selection strategy (as described above, and in the appended examples) has been employed. In addition, or as an alternative, DNA from tail tissue of the offspring may be screened for the presence of the knockout construct using Southern blots and/or PCR as described above. Offspring that appear to be mosaics may then be crossed to each other, if they are believed to carry the knockout construct in their germ line, in order to generate homozygous knockout animals. Homozygotes may be identified by Southern blotting of equivalent amounts of genomic DNA from mice that are the product of this cross, as well as mice that are known heterozygotes and wild type mice. Other means of identifying and characterizing the knockout offspring are available. For example, Northern blots can be used to probe the mRNA for the presence or absence of transcripts encoding either the gene knocked out, the marker gene, or both. In addition, Western blots can be used to assess the level of expression of the RAFTK gene knocked out in various tissues of the offspring by probing the Western blot with an antibody against the particular RAFTK protein, or an antibody against the marker gene product, where this gene is expressed. Finally, in situ analysis (such as fixing the cells and labeling with antibody) and/or FACS (fluorescence activated cell sorting) analysis of various cells from the offspring can be conducted using suitable antibodies to look for the presence or absence of the knockout construct gene product.
Yet other methods of making knock-out or disruption transgenic animals are also generally known. See, for example, Manipulating the Mouse Embryo (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986). Recombinase dependent knockouts can also be generated, e.g. by homologous recombination to insert target sequences, such that tissue specific and/or temporal control of inactivation of a RAFTK-gene can be controlled by recombinase sequences (described infra).
Animals containing more than one knockout construct and/or more than one transgene expression construct are prepared in any of several ways. The preferred manner of preparation is to generate a series of mammals, each containing one of the desired transgenic phenotypes. Such animals are bred together through a series of crosses, backcrosses and selections, to ultimately generate a single animal containing all desired knockout constructs and/or expression constructs, where the animal is otherwise congenic (genetically identical) to the wild type except for the presence of the knockout construct(s) and/or transgene(s) .
The present invention is further illustrated by the following examples which should not be construed as limiting in any way. The contents of all cited references, including literature references, issued patents, published patent applications as cited throughout this application are hereby expressly incoφorated by reference. The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (D. N. Glover ed., 1985); Oligonucleotide Synthesis (M. J. Gait ed., 1984); Mullis et al. U.S. Patent No: 4,683,195; Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Gene Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor Laboratory); Methods In Enzymology, Vols. 154 and 155 (Wu et al. eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV(D. M. Weir and C. C. Blackwell, eds., 1986); Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986).
EXAMPLE 1: Identification and Characterization of a Novel Related
Adhesion Focal Tyrosine Kinase (RAFTIC) from Megakaryocytes and Brain
A cDNA encoding a novel human intracytoplasmic tyrosine kinase, termed RAFTK (for a related adhesion focal tyrosine kinase) was isolated. The murine homolog of the human RAFTK cDNA was also cloned and characterized. Comparison of the deduced amino acid sequences of human and murine RAFTK cDNAs revealed 95% homology, indicating that RAFTK is highly conserved between these species. The RAFTK cDNA clone, encoding a polypeptide of 1009 amino acids, has closest homology (48% identity, 65% similarity) to the focal adhesion kinase ( HS^ A Comparison of the deduced amino acid sequences also indicates that RAFTK like ppl25^ AK lacks a transmembrane region, myristylation sites and SH2 and SH3 domains. In addition, like ppl25^^, RAFTK contains a kinase domain flanked by large N-terminal (426 residues) and C-terminal (331 residues) domains, and the C-terminal region contains a predicted proline-rich stretch of residues. In fetal tissues, RAFTK expression was abundant in brain and low levels were observed in lung and liver. In adult tissues, it was less restricted indicating that RAFTK expression is developmentally upregulated. Expression of RAFTK was also observed in human CD34+ marrow cells, primary bone marrow megakaryocytes, platelets and various areas of brain. The human RAFTK gene was assigned to human Chromosome 8 using genomic DNAs from human/rodent somatic cell hybrid lines. The mouse RAFTK gene was mapped to Chromosome 14 closely linked to gonadotropin releasing hormone. Using specific antibodies for RAFTK, an approximately 123 Kd protein from the human CMK megakaryocyte cell line was immunoprecipitated. Treatment of the CMK megakaryocytic cells with thrombin caused a rapid induction of tyrosine phosphorylation of RAFTK protein. The structural features of RAFTK suggest that it is a member of the focal adhesion kinase gene family and may participate in signal transduction in human megakaryocytes and brain as well as other cell types.
The predicted amino acid sequence of the RAFTK protein shares consensus motifs in the central catalytic domain common to protein tyrosine kinases. The RAFTK cDNA, encoding a polypeptide of 1009 amino acids, has the closest homology (48% identity, 65% similarity) to FAK. Analysis of their deduced amino acid sequences also indicates that RAFTK, like FAK, lacks a transmembrane region, myristylation sites, and SH2 and SH3 domains. In addition, like FAK, the RAFTK C- terminal domain contains a predicted proline-rich stretch of residues. RAFTK was reported to be highly expressed in the central nervous system (Avraham, S. et al. (1995) J. Biol. Chem. 270, 1-10) and involved in Ca*^+-induced regulation of ion channel and MAP kinase functions in PC-12 cells (Lev, S. et al. (1995) Nature 376, 737). RAFTK expression is abundant in primary bone marrow megakaryocytes and their progeny, blood platelets (Avraham, S. et al. (1995) J Biol. Chem. 270, 1-10). To address the role of RAFTK in signal transduction pathways in megakaryocytes, experiments were performed using the model CMK megakaryocytic cell line (Sakaguchi, M. et al. (1991) Blood 77, 481-485). The c-kit receptor and its cognate ligand SCF were investigated since they play a critical role in the adhesion, migration, motility, proliferation and maturation of a number of hematopoietic cells, including megakaryocytes and platelets (See, e.g., Dastych, j. and Metcalfe, D. D. (1994) J. Immunol. 152, 213-219; Kinashi, T. et al. (1995) Blood 86, 2086-2090; Scott, G. et al. (1994) Pigment Cell Res. 7, 44-51). Since SCF effects appear to be modulated by PKC (Blume-Jensen, P. et al. (1995) Journal of Biological Chemistry 270, 14192- 14200), the ability of PKC to mediate the effects of SCF and Ca2+ on RAFTK phosphorylation was investigated. In this study, SCF and PMA induced the tyrosine phosphorylation of RAFTK through PKC. In addition, RAFTK was associated with the cytoskeletal protein paxillin in megakaryocytes, and this association appeared critical for RAFTK phosphorylation.
The following materials and methods were used to clone and characterize
RAFTK
Materials
Chemical reagents were purchased from Sigma (St. Louis, MO). Restriction endonucleases, modifying enzymes, and terminal deoxynucleotidyl transferase were purchased from Pharmacia Biotech, Inc. (Piscataway, NJ) and New England Biolabs (Beverly, MA). The primers for polymerase chain reaction (PCR), RNA-PCR and sequencing were synthesized by an automated DNA synthesizer (Applied Biosystems, model 394). The PCR and RNA-PCR reagents were obtained from Perkin-Elmer Cetus (Norwalk, CT) and random primed labeling kits were obtained from Stratagene (La Jolla, CA). Manual and automated sequencing kits were obtained from USB (Cleveland, OH) and Pharmacia Biotech, Inc., respectively. Automated sequencing was performed using Pharmacia's Automated Laser Fluorescent Sequencer (ALF). Monoclonal antibody 2A7 against ppl25*^^*^ protein was kindly obtained from Dr. J. Thomas Parsons (Charlottesville, VA). Monoclonal antibody PY-20 directed against Tyr(P) was obtained from ICN (Costa Mesa, CA).
Cells
Human marrow megakaryocytes were isolated by a method employing immunomagnetic beads using anti-human glycoprotein GpIIIa monoclonal antibody, as previously described (Tanaka, H. et al. (1989) Br. J. Haematol. 73, 18-22; Avraham, H. et al. (1992) Blood 80, 1679-1684). CD34 bearing marrow progenitor cells were purified from heparinized bone marrow aspirates using immunomagnetic beads coated with an anti-CD34 monoclonal antibody as previously described (Avraham, H. et al. (1992) Blood 80, 1679-1684). The CMK cell line, provided by Dr. T. Sato and derived from a child with megakaryoblastic leukemia, has properties of cells of the megakaryocytic lineage (Sato, T. et al. (1987) Exp. Hematol. (N.Y.) 15, 495-502). The CMK cell line was cultured in RPMI 1640 medium with 10% fetal calf serum. Additional permanent human megakaryocytic cell lines were studied. DAMI cells were obtained from Dr. S. Greenberg, (Brigham and Women's Hospital, Boston, MA), Mo7e and erythroid-megakaryocytic HEL cells were obtained from Dr. L. Zon, (Children's Hospital, Boston, MA). Each cell line was cultured as previously described (Avraham, H. et al. (1992) Blood 80, 1679-1684; Avraham, H. et al. (1992) Blood l9, 365-371 ; Avraham, H. et al. (1992) Int. J. Cell Cloning 10, 70-75). Other permanent human cell lines such as Ramos (human B-cells) were obtained from the American Type Tissue Culture Collection and maintained in liquid culture according to the specifications in the catalog.
Human platelets were isolated by gel filtration from freshly drawn blood anticoagulated with 0.15 vol NIH formula A acid-citrate-dcxtrose solution supplemented with 1 μM prostaglandin E, (PGE,) as previously described (Lipfert, L. et al. ( 1992) J. Cell Biol. 1 19, 905-912).
DNA amplification and cloning
Total RNA derived from CMK cells was prepared by a standard protocol of lysis in guanidinium isothiocyanate followed by cesium chloride gradient centrifugation (Maniatis, T. et al. (1992) Molecular Cloning, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY). Protein-tyrosine kinase sequences were amplified with degenerate oligonucleotide primers as previously described (Wilks, A.F. (1989) Proc. Natl. Acad. Sci. USA 86, 1603-1607).
Briefly, total RNA (10 μg) was used as a template for synthesis of complementary DNA (cDNA). The PTK3 oligonucleotide "SDVWSF/YG" (SEQ ID NO:5) 5'- (C/G)(T/A)(A/G)TC(A/C/G/T)ACCCA(A C/G/T)(C/G)(T/A)(A/G)(T/A)A (A/C/G/T)CC - 3' (SEQ ID NO:6) was designed in our lab and was used as a primer. PCR was performed on one quarter of the cDNA synthesis reaction mixture (original volume-20 μl), using PTK1 "DLAARN" (SEQ ID NO:7) 5'- CGACGA(T/C)CT(A/C/G/T)GC(A/C/G/T) (A/G)C(A/C/G/T)AA - 3*(SEQ ID NO:8) and PTK2 "WMAPE" (SEQ ID NO:9) 5' -
GTACC(T/C)TC(G/C/A)GG(A/C/G/T)GCCATCCA - 3' (SEQ ID NO: 10) oligonucleotides (50 pmol each) (Wilks, A.F. (1989) Proc. Natl. Acad. Sci. USA 86, 1603-1607). The mixture was then subjected to PCR amplification using the Perkin- Elmer Cetus thermal cycler set for 30 cycles as follows: denature 95°C, 2 min; primer anneal 37°C, 1.5 min; primer extension 72°C, 2.30 min; 1 minute ramp times were used between these temperatures. PCR products of the amplified tyrosine kinase domains were purified from the agarose gel, digested with EcoRI and BamHI, ligated into pUC19, and transformed into Escherichia coli DH5α. Sequencing was carried out by the dideoxy chain termination method using version 2.0 sequenase kit (USB, Cleveland, OH). Sequences were compared with known sequences in GenBank and EMBL data bases using the Autosearch computer program. A novel clone was identified. This 160-base pair (bp) PCR product, designated JJ3, was radiolabeled using the "Prime It II" random priming protocol (Stratagene) and used as a probe to screen human cDNA libraries.
Isolation and characterization of cDNA clones The human brain (hippocampus) cDNA library in λ-ZapII vector (randomized and oligo dT, cat #936205, Stratagene, CA) was screened (- 5 x 10-' recombinants/screening) initially with the 160 bp PCR fragment (termed JJ3), and labeled with [γ P] dCTP using random primed cDNA labeling. Hybridization to nylon filters (MSI) was performed in 50% formamide, 6 x SSC, 10 mM sodium phosphate, 5 x Denhardt's solution, 0.1% sodium dodecyl sulfate (SDS), and 1 mg/ml Herring sperm DNA (Boehringer Mannheim, Germany) at 43°C overnight. The filters were washed at room temperature in 2 x SSC, 1% SDS, and then in 0.2 x SSC, 0.1% SDS at 63°C three times for 30 min., UV crosslinked (Stratagene Stratal inker), and exposed to Kodak X-OMAT AR film (Eastman Kodak). Twelve clones were isolated and processed. Plasmid DNA was prepared using Exassist Helper Phage and the SolR System according to the manufacturer's instructions (Stratagene). Of these twelve clones, two were sequenced on both strands. A human CMK-PMA cDNA library oligo dT (Avraham, H. et al. (1992) Blood 79, 365-371) (~3 x 105 recombinants/screening) in λ-gtl 0 vector was screened with the --^P-labeled JJ3 fragment. Four clones were isolated and the recombinant DNAs of 2 positive phages were digested with EcoRI, and the cDNA insert was subcloned into pBSK (Stratagene) and thereafter sequenced.
A 340 bp probe was prepared from the 5'- end of one of the CMK cDNA clones (termed 2-1) and used to screen the human brain (hippocampus) cDNA library. Twelve clones were isolated and two clones were sequenced on both strands. In addition, a 248 bp probe was prepared from the 5'- end of one of the clones (termed 4C) and the human hippocampus cDNA library was rescreened. Twelve clones were identified and isolated and of these, 1 clone (termed 3B) was sequenced on both strands. The mouse brain cDNA library (cat # ML 1042b, Clontech, Palo Alto, CA) in λ-gtl 1 vector was screened (~ 5 x 10*^ recombinants/screening) using 381 bp 5'- Kpn I fragment or 764 bp Apal -3'- fragment of human RAFTK cDNA as a probe and the filters were hybridized and washed under high stringency conditions. Six clones were isolated. The DNA was isolated as previously described (Maniatis, T. et al. (1992) Molecular Cloning, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) and subcloned into pBSK and thereafter sequenced. Nucleotide sequences were determined by the Automated Laser Fluorescent
(ALF) DNA sequencer (Pharmacia Biotech, Inc.) using Autoread (Pharmacia) and by manual sequencing using sequenase kit (USB).
Chromosomal localization of the human RAFTK gene Genomic DNAs from the NIGMS Hybrid Mapping Panels #1 and #2 were obtained from the NIGMS Genetic Mutant Cell Repository (Coriel Cell Institute for Medical Research, Camden, NJ). In addition, both mapping panels included DNA samples isolated from human and rodent parental cell lines (mouse and Chinese hamster). Approximately 5 μg of DNA from human, hamster, and mouse genomic DNAs were digested with BamHI, Hindlll and Pstl to find a suitable restriction fragment length polymoφhism (RFLP) or unique genomic fragment for use in mapping. Subsequently, genomic DNAs from each panel were cut with BamHI. Southern blots were probed with a human 1.4 kb RAFTK cDNA and hybridizations were carried out as previously described (Rowe, L.B. et al. (1994) Mamm. Genome 5, 253-274; White, R.A. et al. (1992) Nature Genet. 2, 80-83). Hybrids were scored for the appropriate human-specific restriction endonuclease fragment on the autoradiographs. The results were compared with the chromosome contents of the hybrid cell lines and the concordance between restriction fragments and specific chromosome content was used to establish the localization of human RAFTK.
Backcross mapping of the mouse RAFTK gene
Genomic DNAs from C57BL/6J, Mus spretus and a (M. spretus x C57BL/6J) M. spretus BSS type backcross DNA panel were obtained from The Jackson Laboratory (Bar Harbor, Maine) (Rowe, L.B. et al. (1994) Mamm. Genome 5, 253- 274). Southern blots and hybridizations were performed as previously described
(White, R.A. et al. (1992) Nature Genet. 2, 80-83). Approximately 5 μg of genomic DNAs of C57BL/6J and Mus spretus were digested with 29 different restriction enzymes to identify a potential RFLP genetic marker. The Southern blots were probed with a 1.4 kb human RAFTK cDNA fragment labeled with ^P using a Decaprime II Kit (Ambion, Inc., Austin, TX). Digestion of the backcross DNA panel with BamHI, Southern blotting and hybridizations were carried out as previously described (White, R.A. et al. (1992) Nature Genet. 2, 80-83). Recombinant inbred (RI) line mapping of the mouse RAFTK gene
RAFTK and Gnrh co-segregated in BXD RI lines and mapped to chromosome 14. Genomic DNAs isolated from the progenitors of BXD RI lines (C57BL/6J and DBA/2J) were digested with 29 different restriction enzymes to identify a RFLP genetic marker for mapping. Subsequently, genomic DNAs isolated from the BXD RI lines were digested with Sad. Conditions for Southern blots and hybridizations were the same as previously described (White, R.A. et al. (1992) Nature Genet. 2, 80-83) and the 1.4 kb human RAFTK cDNA was used as a probe. Data were compared with strain distribution patterns (SPDs) recorded in GBASE (1993) (Yang-Feng, T.L. et al. (1986) Somatic Cell. Mol. Genet. 12, 95-100).
Northern blot analysis
Total RNA was prepared by a standard protocol of lysis in guanidinium isothiocyanate followed by cesium chloride gradient centrifugation (Maniatis, T. et al. (1992) Molecular Cloning, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY). The human adult and fetal tissue Northern blots, the brain regions and the human tissue II blots were obtained from Clontech (Palo Alto, CA). Hybridization was carried out according to the manufacturer's instructions. Each RNA blot was probed with a 146 bp, 3'- gene-specific RAFTK cDNA radiolabeled to a high specific activity (10 - 10^ cpm/μg) with [γ- P]dCTP. The level of expression for each mRNA was also determined densitometrically (EC Apparatus Coφ. Densitometer; St. Petersburg, FL). The radioactivity associated with each band was also assayed with a Betascope 603 blot analyzer (Betagen, Mountain View, CA). The same blot was assessed for the presence of the actin or GAPDH specific probes; Actin and GAPDF1 were used as controls to assure uniform loading.
PCR blots cDNA was prepared from platelets (10 x 10°), CD34+ marrow cells (10° cells) and bone marrow megakaryocytes (10" cells) and amplified by PCR using specific RAFTK primers as previously described (Bennett, B.D. et al. (1994) J. Biol. Chem. 269, 1068-1074). The sequence of the RAFTK upstream primer was 5'- CGGGCCGTGCTGGAGCTCAA - 3' (SEQ ID NO:l l)(position 2958 - 2977). The nucleotide sequence of the RAFTK downstream primer was 5'- GTCCGTGAAGATGACGGCAA - 3' (SEQ ID NO: 12) (position 3084 - 3103). The sequence of the FAK upstream primer was 5'- AAAGCTGTCATCGAGATGTCC -3' (SEQ ID NO: 13) (position 2292-2312). The nucleotide sequence of the downstream primer was 5'- TCGGTGGGTGCTGGCTGGTAGG - 3' (SEQ ID NO: 14) (position 2417-2438)( Andre, E., and Becker- Andre, M. (1993) Biochem. Biophys. Res. Commun. 190, 140-147). The sequence of the actin upstream primer was 5'- ATCTGGCACCACACCTTCTACAATGAGCTGCG - 3' (SEQ ID NO: 15). The nucleotide sequence of the downstream primer was 5'-
CGTCATACTCCTGCTTGCTGATCCACATCTGC -3' (SEQ ID NO: 16) (Clontech, Palo Alto, CA). The PCR products were electrophoresed on a 1.5% agarose gel, denatured, neutralized, transferred to filters, and vacuum blotted. The probes used were the RAFTK, FAK and actin gene-specific probes, which were labeled by random priming as described above. Prehybridization and hybridization were carried out as previously described (Bennett, B.D. et al. (1994) J. Biol. Chem. 269, 1068-1074).
Protein analysis
Metabolic labeling, immunoprecipitation, and Western blot analysis were performed in CMK cells as previously described (Laemmli, U.K. (1970) Nature 227, 680-685; Yarden, Y et al. (1987) EMBOJ. 6, 3341 -3351 ; Konopka, J. B., and Witte, O.N. (1985) Mol. Cell Biol. 5, 31 16-3123; Konopka, J. B. et al. (1984) J. Virol. 51 , 223-232). For immunoblot analysis, total cell lysates of CMK cells untreated or stimulated with α-thrombin (1 U/ml or 2 U/ml as indicated)(ChromoLog Coφ., Havertown, PA) for 5 min were prepared as previously described (Yarden, Y et al. (1987) EMBOJ. 6, 3341-3351). Relative protein concentrations were determined with a colorimetric assay kit (Bio-Rad Laboratories, Inc., Hercules, CA) with bovine serum albumin as the standard. A portion of lysate containing approximately 0.05 mg of protein was mixed with an equal volume of 2 x SDS sample buffer containing β- mercaptoethanol, boiled for 5 min., fractionated on 8% polyacrylamide-SDS gels (Laemmli, U.K. (1970) Nature 227, 680-685) and transferred to Immobilon polyvinylidene difluoride (Millipore Coφ., Bedford, MA) filters. Protein blots were treated with specific RAFTK antibodies (R-4250) (see below). Primary binding of the RAFTK antibodies (see below) was detected using anti-IgG second antibodies conjugated to horseradish peroxidase and subsequent chemiluminescence development using the ECL Western blotting system (Amersham Life Sciences, Arlington Heights, IL).
For metabolic labeling, 10" cells were labeled with 100 μCi of [-^S] methionine in 1 ml of Dulbecco's modified Eagle's medium minus methionine (Amersham Life Sciences) for 16 h. Immunoprecipitation of RAFTK protein from labeled cells with RAFTK antiserum or with normal rabbit serum (NRS) was performed as previously described (Bennett, B.D. et al. (1994) J. Biol. Chem. 269, 1068-1074; Yarden, Y et al. (1987) EMBOJ. 6, 3341-3351). For immunoprecipitation of Tyr (P) proteins, cold soluble extracts were first incubated with RAFTK antibodies (R-4250) overnight at 4°C. The extracts were then incubated with protein-G-Sepharose beads precoupled to goat anti-rabbit IgG for 1.5 h at 4°C. Proteins were eluted from the beads by heating the samples at 100°C for 5 min in SDS-polyacrylamide gel electrophoresis buffer. Proteins were separated by SDS- PAGE, transferred and immunoblotted with PY-20 (diluted 1 :5000). The immunoreactive bands were visualized using the ECL system.
Antibodies
An -RAFTK antiserum was obtained from New Zealand white rabbits immunized with a bacterially expressed fusion protein consisting of the GST-C- terminal (681-1009 amino acid residues) of human RAFTK cDNA subcloned into the pGEX-2T expression vector. The sera were titered against the GST-RAFTK C- terminus fusion protein by ELISA (Dymecki, S. M. et al. ( 1992) J. Biol. Chem. 267, 4815-4823; Bennett, B.D. et al. (1991 ) J. Biol. Chem. 266, 23060-23067) and the serum (R-4250) exhibiting the highest titer (1 :256,000) was used in subsequent experiments.
Isolation and characterization of RAFTK cDNAs
To identify tyrosine kinases in human megakaryocytes, PCR primers based on conserved sequences of PTKs were used (Wilks, A.F. (1989) Proc. Natl. Acad. Sci. USA 86, 1603-1607). RNA from the human megakaryocytic CMK cell line was used as a template to synthesize CMK cDNA. The cDNA was amplified by using the PTK primers. Fragments of the expected size (-160 bp) were isolated and subcloned for sequence analysis. One clone that appeared to represent a novel tyrosine kinase (termed JJ3) was used as a probe to screen the human hippocampus cDNA library. A partial cDNA clone (termed S2-3) containing an ~2.0 kb insert was isolated. A homology analysis of this clone to human ppl25^^^ was performed and regions were chosen to design specific primers to generate an RAFTK gene-specific probe. The JJ3 fragment was used to screen the human hippocampus cDNA library to obtain overlapping cDNAs. The 5'- end of each of these clones was in turn used as probes to obtain the full-length RAFTK cDNA. Eight different overlapping sequences were obtained of the coding region of RAFTK. Figure 1 is a schematic representation along with a restriction map of the sequence showing the pattern of overlapping cDNAs. The 3.6 kb length of the RAFTK cDNA contains an open reading frame with the first in frame ATG codon located at nucleotide 294-296, followed by a stop codon at position 3260-3262. This open reading frame encodes a predicted protein of 1009 amino acid residues with a calculated molecular weight of -123 Kd and has been given the name RAFTK (for a related adhesion focal tyrosine kinase). Analysis of the hydrophobicity of the predicted protein revealed lack of a transmembrane region and no recognizable sites for acylation. The kinase domain is flanked by large N-terminal (426 residues) and C-terminal (331 residues) domains. Comparison of the nucleotide sequence and the deduced amino acid sequence of the encoded protein with the National Biomedical Research Foundation and GenBank data bases revealed that this cDNA encoded a tyrosine kinase related to the ppl25*^^^. The predicted amino acid sequence of ppl20*^ ' ^ contains the structural motifs common to all protein kinases, including the putative ATP-binding site (432-437a.a, Gly43~ - Xaa - Gly434 - Xaa - Xaa - Gly437), and three residues that are predicted to interact with the γ- phosphate group of the bound ATP molecule (in positions 402a.a, 529a. a and 655a.a). In addition, RAFTK contains two peptide sequences that are highly conserved among PTKs (Asp549 - He550 - Ala551 - Val552 - Arg553 - Asn554 and Pro588 - He589 - Lys590 . X 591 . Met592*) interestingly, like chicken ppl25FAK*, the C-terminal region of RAFTK contains a proline-rich stretch (residues 690-767) where the proline content exceeds 20%. A unique domain is found at the NH terminus of RAFTK (amino acids 1-39) (Figure 3). This region is the most divergent among various PTKs and may be involved in cellular localization and/or interaction with other cellular proteins. Like ppl25^^*^*, RAFTK does not contain SH2 or SH3 domains. The kinase domain (amino acid 427 - 679) of RAFTK shares 60% identical homology with the mouse ppl25^*^^, 54% with human ppl25^^*^, and 36% with src (Figure 2). The kinase domain consists primarily of the catalytic domain including the putative ATP binding site (amino acids 432 - 437). RAFTK shares 42% homology in the NH2 domain and about 39% in the C-terminal domain with mouse ppl25*FA T e overall amino acid homology of RAFTK is 48% identity (65% similarity) with mouse ppl25FAK.
Molecular cloning of the full-length murine RAFTK cDNA
Southern blot analysis of human and mouse genomic DNA digested with EcoRI, Hindlll, BamHI, Xbal, Pstl and probed under conditions of high stringency with 3'- fragment of RAFTK cDNA from 1595 - 2974 bp (1.4 kb) as a probe, revealed a single band in each lane, indicating that the human RAFTK gene and the mouse RAFTK gene are highly homologous and are single genes. Therefore, a random and oligo (dT)-primed mouse adult brain cDNA library was screened under conditions of high stringency for the full-length mouse cDNA of RAFTK using the 5'- fragment and 3'- fragment of human RAFTK cDNA as probes. Four clones were isolated and two of these clones were sequenced in both directions and additional clones were partially sequenced. Sequence analysis of these clones revealed identical sequences. The 4.5 kb full length cDN A has an open reading frame of 1009 amino acid residues and possesses 95.6% identical homology with the human RAFTK gene.
Chromosomal localization of human RAFTK gene
Hamster, human and mouse DNAs were digested with BamHI, Hindlll and Pstl to identify a specific RFLP pattern for the RAFTK gene in each species. Southern blots were probed with a human 1.4 kb RAFTK cDNA. Unique BamHI 16.5 kb and 14.5 kb fragments for RAFTK were identified in human DNA from the parental cell lines used to prepare human rodent cell hybrids. DNAs from the parental and the somatic hybrid cell lines in mapping panel #2 were digested with BamHI, Southern blotted and probed. Analysis indicated that the human-specific BamHI pattern was observed in cell line #8 which contains human Chromosome 8 (Figure 4). A fainter signal was also observed for the human-specific BamHI pattern in hybrid cell line #20 (Fig. 4) which, although it contained an intact human Chromosome #20, also carried a gene from human Chromosome #8 (NEFL, neurofilament light polypeptide, 8p21) as determined by Southern blot hybridization (Coriel Cell Institute for Medical Research, Camden, NJ). All other hybrid cell lines were negative for the human-specific BamHI RFLP. Additionally, when the human 1.4 kb RAFTK cDNA was used to probe Coriel Panel #1, the human-specific fragment was detected in all hybrids containing greater than 4% of human Chromosome 8 and was absent in every hybrid that lacked Chromosome 8. Southern blots of C57BL/6J and Mus spretus DNAs were digested with 29 different restriction enzymes and probed with a human RAFTK 1.4 kb cDNA. A BamHI restriction fragment length polymoφhism (RFLP) was detected. The alleles for this BamHI RFLP consist of 8.6 kb and 5.2 kb genomic DNA bands, characteristic of C57BL/6J, and 15.5 kb and 6.7 bands which are found in Mus spretus. These alleles were characterized in 87 DNAs from the C57BL/6J X Mus spretus backcross panel. Results of the haplotype analysis from this mapping data indicate that the RAFTK gene co-localizes with D14Birl0 (DNA segment-Birkenmeier 10) and is linked to Nfl (neurofilament, light polypeptide) on mouse Chromosome 14 (Figure 5). The RAFTK locus mapped between Xmvl 9 (xenotropic-MCF leukemia virus- 19) and Nfl and the calculated map distances for these loci are: Xmvl 9, 7.1 ± 5.3 cM, RAFTK, 3.5 ± 2.0 cM, Nfl. The position of RAFTK on mouse Chromosome 14 was confirmed by determining the segregation of a Sad RFLP for RAFTK DNAs from BXD recombinant inbred (RI) lines. The Sad RFLP for RAFTK was indicated by the presence of a 16.5 kb genomic DNA band in C57BL/6J or a 6.2 kb fragment in DBA/2J. These alleles were characterized for 26 DNAs from the BXD RI line. The strain distribution patterns of RAFTK and the locus coding for gonadotropin releasing hormone, Gnrh (Hearne, CM. et al. (1991) Mαmm. Genome 1 , 273-282), indicate close linkage between these two loci on Chromosome 14. Perfect concordance was observed with the BXD strain distribution pattern for the Gnrh locus, indicating linkage of less than one map unit distance from RAFTK Gnrh (Silver, J. ( 1985) J. Hered. 76, 436-440). This mapping data places RAFTK distal to Nfl and is a contradiction to the backcross data. However, backcross data are not as accurate as RI data since backcross mice were derived from interspecies cross.
Expression of RAFTK in tissues and cell lines
A specific RAFTK probe was designed (nucleotide 2958 bp - 3103 bp). This sequence is present in RAFTK and not in human ppl25* A . This probe was used for hybridization of all Northern blots described here.
Northern blot analysis of RNA from human fetal heart, brain, lung, liver and kidney revealed a weak single major species of mRNA of 4.5 kb in brain and it appears to be expressed at low levels in the lung and liver. Expression in human adult tissues was assessed by hybridization of the cDNA probe to a Northern blot of poly (A+) RNA from heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas. While heart and skeletal muscle RNA samples were negative for RAFTK, a single mRNA was observed in all other tissues with the highest levels expressed in brain. To further characterize the distribution of RAFTK expression in other human tissues, Northern blot analysis of spleen, thymus, prostate, testes, ovary, intestine, colon and peripheral blood leukocytes revealed high expression of RAFTK in thymus, spleen and peripheral blood leukocytes. Northern blot analysis of different human brain regions (amygdala, caudate nucleus, coφus callosum, hippocampus, hypothalamus, substantia nigra, subthalamic nucleus and thalamus) revealed that the highest expression of RAFTK was in amygdala and hippocampus. Lower expression was observed in the other brain regions, with the exception of coφus callosum and substantia nigra where there was no detectable signal. These results demonstrate that brain has abundant expression of RAFTK, especially in the amygdala and hippocampus. Expression of RAFTK was observed in several megakaryocytic cell lines such as CMK, Mo7e, HEL and DAMI cells. In addition, expression of RAFTK -was detected in Ramos, FHS and HeLa cells but low level of expression was detected in Jurkat, Flep 3B and CCL 75 cells. Using PCR techniques, expression of RAFTK was also found in primary bone marrow megakaryocytes, blood platelets, and in marrow CD34+ progenitor cells. The level of expression of RAFTK mRNA is similar to FAK in CD34+ cells, and is higher than FAK in bone marrow megakaryocytes. In platelets, the level of expression of RAFTK mRNA is lower than FAK, as observed by PCR under the same experimental conditions. RAFTK mRNA expression in bone marrow megakaryocytes is higher than that in CD34+ cells. Taken together, these results demonstrate that RAFTK is abundantly expressed in brain and hematopoietic cells. The restricted expression observed in fetal versus adult tissues indicates its expression is upregulated during development.
Generation of specific antibodies for RAFTK and detection of RAFTK protein
The fusion protein GST-C-terminus of RAFTK (residues 681 -1009) was chosen for rabbit immunizations in order to obtain specific antibodies for RAFTK protein. These polyclonal antibodies (R-4250) do not cross react with ppl25^^**^. The monoclonal antibody 2A7 against FAK does not cross react with the C-terminal GST-RAFTK fusion protein, indicating that RAFTK might be antigenically different from FAK. Furthermore, FAK immunoprecipitated by the monoclonal antibody 2A7 from megakaryocytes was not recognized by polyclonal antiserum 4250. Similarly, RAFTK immunoprecipitated by antiserum 4250 also was not recognized by the monoclonal antibody 2A7. Taken together, these data demonstrate that FAK and RAFTK are distinguishable antigenically while being related members of the FAK family.
The specificity of this antiserum was examined by immunoprecipitation. The CMK cell line was metabolically labeled with [ S] methionine, and extracts were immunoprecipitated with an -RAFTK antiserum. A major protein species of -123 Kd was detected in CMK cells. A similar species was observed in other human megakaryocytic cell lines such as DAMI. This band was not observed when normal rabbit serum or pre-immune rabbit serum was used for immunoprecipitation. Incubation of R4250 with 1 μg or 10 μg of the C-terminus of GSΥ-RAFTK fusion protein abolished the appearance of -123 Kd, while incubation with 10 μg of the fusion protein GST-MATK-SH2 domain did not have any effects. These results demonstrate that polyclonal antibodies R-4250 are specifically recognizing RAFTK protein of ~123Kd size. Furthermore, thrombin (1 unit/ml) stimulated a rapid increase in the amount of RAFTK protein immunoreactivity in anti-Tyr(P) immunoprecipitates. These results demonstrate that RAFTK is a protein tyrosine kinase, and that thrombin can induce its tyrosine phosphorylation.
The method of PCR cloning has been successfully employed by many laboratories to identify novel members of the PTK family. Using this strategy, a novel intracytoplasmic tyrosine kinase in human megakaryocytic cells has been identified, termed RAFTK. Sequence analysis of RAFTK revealed -48% identity (65% similarity) to ppl25^** * suggesting that RAFTK belongs to this subfamily of cytoplas ic tyrosine kinases. RAFTK does not appear to be the recently described FAKB protein (Kanner, S.B. et al. (1994) Proc. Natl. Acad. Sci. USA \, \ 0484- 10487), also related to ppl25FA*\ since the specific amino acid sequence used to make antisera which recognized the FAKB protein is missing in the predicted amino acid sequence of RAFTK protein. Furthermore, unlike FAKB, RAFTK protein did not form stable complexes with the TCR/CD3 linked tyrosine kinase ZAP 70 in T-cells indicating that RAFTK and FAKB are different proteins.
The chicken, human and mouse focal adhesion kinases have been recently implicated as playing key roles in signal transduction pathways associated with extracellular adhesion molecules and with receptors for neuropeptide growth factors (Schaller, M.D., and Parsons, J.T. ( 1993) Trends Cell Biol. 3, 258-262; Zachary, I., and Rozengurt, E. (1992) Cell 71 , 891-894; Leeb-Lundberg, L.M., and Song, X.-H. (1991) J. Biol. Chem. 266, 7746-7749; Zachary, I. et al. (1992) J Biol. Chem. 267, 19031-19034). Thus, based on its homology to ppl25FAK, one would expect RAFTK to participate in signalling pathways as well. The deduced 1009 amino acid sequence of RAFTK (with calculated molecular mass of 120 Kd) contains a kinase domain and lacks a transmembrane region, myristylation sites, and SH2 and SH3 domains. In order to identify conserved regions within RAFTK between species that may have important functions, the murine homolog of the human RAFTK cDNA was cloned. The sequence identity between the human and murine RAFTK cDN As is 90% at the nucleotide level and 95.6% at the predicted amino acid level. In the kinase domain, 98.5% of the amino acids are identical. Therefore, the RAFTK gene is highly conserved in human and rodent, again suggesting an important role in cell signalling functions. The RAFTK has an insertion of an additional 4 amino acids between 76-81 (G'"R7 'I '8G'")compared to chicken, murine, and human ppl25*^A^* sequences (Schaller, M.D. et al. (1992) Proc. Natl. Acad. Sci. USA 89, 5192-5196; Schaller, M.D., and Parsons, J.T. (1993) Trends Cell Biol. 3, 258-262; Clark, E.A., and Brugge, J.S. (1995) Science 268, 233-239). Amino acids corresponding to positions 292 - 320 of human ppl25FA^ and amino acids corresponding to position 850 - 864 and 901 - 926 of chicken ppl25FA^ are absent in the predicted RAFTK protein. Interestingly, like chicken ppl25FA , the C-terminus region of human RAFTK and mouse RAFTK contains a proline-rich stretch (residues 690-767). It has been shown that proteins containing proline-rich peptide motifs (such as She, p62 and ribonucleoprotein K) could serve as SH3 domain ligands, and that the binding of these proteins to the Src SH3 domain was inhibited with a proline-rich peptide ligand (Weng, Z. et al. (1994) Mol. Cell. Biol. 14, 4509-4521). Furthermore, the predicted RAFTK protein, like the ppl25FA^ protein, displays several unique features among the known tyrosine kinases. The primary sequence of RAFTK does not contain a signal peptide or a membrane-spanning region and the protein is therefore presumed to be located in the cytoplasm. RAFTK lacks SH2 and SH3 domains, which are structural elements involved in protein-protein interactions (Pawson, T., and Gish, G.D. (1992) Cell 71 , 359-362; Konopka. J. B. et al. (1984) J. Virol. 51, 223-232; Waksman, G. et al. (1992) Nature 358, 646-653; Taylor, S.J., and Shalloway, D. (1993) Current Opin. Genet. & Dev. 3, 26-34; Yu, H. et al. (1992) Science 258, 1665-1668), and does not exhibit significant homology with any known PTK beyond ppl25 A*^ outside of the catalytic domain. Lack of SH2 and SH3 domains suggests that other regions within RAFTK protein are important for protein interaction and targeting. In the case of the ppl25FA^ protein, it has been demonstrated by structural-functional analysis that 159 amino acids within the C-terminus are essential as a "Focal adhesion targeting" sequence (Hildebrand, J.D. et al. (1993) J. Cell. Biol. 123, 993-1005). The homology between RAFTK and ppl25FAK within this region is 52%. The overall structure of RAFTK is characteristic of the ppl25FA*^ gene, with the catalytic domain flanked by large N-terminal and C-terminal domains. It has recently been reported that deletions of the NH2 - or the COOH-terminal non-catalytic domain of ppl25^A*^ including Tyrosine39 ' did not abolish the kinase activity of ppl25FA^ (Chan, P.-Y. et al. (1994) J. Biol. Chem. 269, 20567-20574). Moreover, there is conservation of several tyrosine residues between RAFTK and ppl25FA^ including Tyrosine39' which has been shown to be the major site of tyrosine phosphorylation in ppl25*^AKt protein (Schaller, M.D. et al. (1994) Mol. Cell. Biol. 14, 1680-1688).
RAFTK specific mRNA expression was observed in human fetal tissues most abundant in brain (predominantly in amygdala and hippocampus regions) and appeared to be developmentally upregulated as demonstrated in the pattern of adult tissue expression. Within the hematopoietic system, in addition to peripheral blood leukocytes, a high level of specific mRNA expression of RAFTK was detected in B- cells and various megakaryocytic cell lines. By using PCR, the specific mRNA expression of RAFTK was also detected in primary bone marrow CD34+ progenitor cells, primary bone marrow megakaryocytes and platelets.
RAFTK is phosphorylated after thrombin treatment of CMK cells. FAK protein was also found phosphorylated on tyrosine after thrombin or collagen treatment of platelets (Lipfert, L. et al. (1992) J. Cell Biol. 1 19, 905-912). There is considerable homology in the thrombin receptors and considerable signal similarities in transduction mechanisms between platelets and megakaryocytes (Vittet, D., and Chevillard, C. (1993) Blood Coagulation & Fibrinolysis 4, 759-768). Furthermore, bone marrow megakaryocytes in liquid culture stimulated with thrombin for 5 min revealed dramatic moφhological changes reminiscent of those found in platelets, including shape change and organelle centralization that involved immature as well as mature cells (Cramer, E.M. et al. (\992) Am. J. Path. 143, 1498-1508). Megakaryocytes were also able to secrete alpha-granule proteins in the dilated cisternae of the demarcation membrane system (Cramer, E.M. et al. (1993) Am. J. Path. 143, 1498-1508).
The human RAFTK gene was found on Chromosome 8 using DNAs from the somatic cell hybrid lines. The signal observed in cell line #20 in mapping panel #2 suggested that a fragment of Chromosome 8 is in the Chromosome #20 cell line. Although cell line #20 contained the human NEFL gene, there was no evidence for Chromosome 20 or a fragment of Chromosome 20 in cell line #8 (Coriel Cell Institute for Medical Research, Camden, NJ). The localization of RAFTK to Chromosome 8 was confirmed using mapping panel #1. The human NEFL gene has been localized to Chromosome 8p21 (Hurst, J. et al. (1987) Cytogenet. Cell Genet. 45, 30-32). Nfl, the murine homolog of human NEFL, has been mapped to mouse Chromosome 14 and is within 3 cM of the Gnrh locus (GBASE). The close linkage of the mouse RAFTK gene to Nfl (whose homolog NEFL is on human Chromosome 8p21) suggested that the human RAFTK gene may be mapped to Chromosome 8 based on homology between human and mouse chromosomes (Hurst, J. et al. (1987) Cytogenet. Cell Genet. 45, 30-32). Therefore, the human RAFTK gene is localized to Chromosome 8p21. The mouse RAFTK gene has been mapped to Chromosome 14 using a (C57BL/6J) x M. spretus) F-j x M. spretus backcross. The position of mouse RAFTK was confirmed by RI line mapping using the BXD RI lines. The RAFTK gene was also shown to be closely linked to Gnrh whose human homolog (LHRH-luteinizing hormone releasing hormone) has been mapped to human Chromosome 8p21-1 1.2 (Yang-Feng, T.L. et al. (1986) Somatic Cell. Mol. Genet. 12, 95-100). EXAMPLE 2: Activation of the Novel Protein Tyrosine Kinase, RAFTK, in Megakaryocytes Upon SCF and PMA Stimulation and Its Direct Association with Paxillin
RAFTK appears to be a member of the Focal Adhesion Kinase (FAK) family, and is involved in Ca2+-mediated signalling events in PC-12 cells. In this Example, the signalling pathways involving RAFTK in human megakaryocytic cells were characterized. Stem Cell Factor (SCF), which potentiates the growth of megakaryocytes and their progenitors, and Phorbol Myristate Acetate (PMA), which causes differentiation of megakaryocytic cell lines, induced the tyrosine phosphorylation of RAFTK through Protein Kinase C (PKC). The constitutive association of RAFTK with PKC-δ was observed, while the association of RAFTK with PKC-α was induced upon stimulation with SCF. In addition, the direct association of RAFTK with paxillin, a 68-Kd cytoskeleton protein, was demonstrated. Upon the activation of RAFTK, there was a sequential activation and phosphorylation of paxillin. Cytochalasin D, which disrupts the cytoskeleton, abolished the phosphorylation of RAFTK upon PMA and SCF stimulation.
These results show that RAFTK is a down-stream signalling protein of PKC and that paxillin is a down-stream associated protein of RAFTK. Furthermore, RAFTK association with the cytoskeleton was critical for its phosphorylation. These observations show the manner in which RAFTK participates in megakaryocyte proliferation and differentiation.
The following materials and methods were used to study activation of RAFTK:
Materials
Recombinant SCF/KL and polyclonal anti-c-kit antibodies were generously provided by Dr. Keith E. Langley and Dr. L. Bennett, Amgen Inc. (Thousand Oaks, CA). Monoclonal anti-phosphotyrosine antibody (PY-20) and monoclonal anti- paxillin were obtained from ICN (Costa Mesa, CA ); monoclonal antibodies anti-p85, anti-She, anti-Grb2, anti-FAK, anti-PKC- , anti-PKC-β, and anti-PKC-δ were obtained from Transduction Laboratories (Lexington, KY). Calphostin C, staurosporine, calcium ionophore A23187, EGTA and Phorbol 12-Myristate 13- Acetate (PMA) were obtained from Calbiochem (La Jolla, CA ). Electrophoresis reagents were obtained from Bio-Rad Laboratories (Hercules, CA). All other reagents were purchased from Sigma Co. (St. Louis, MO). CMK cells
The CMK cell line, provided by Dr. T. Sato (Chiba University, Japan), was maintained in RPMI 1640 with 10% fetal calf serum (FCS) as described previously (Sato, T. et al. (1989) Br. J. Hematol. 72, 184-190). The CMK cell line was derived from a child with megakaryoblastic leukemia and has properties of cells of the megakaryocytic lineage, including the surface expression of glycoproteins lb and Ilb/IIIa, synthesis of platelet factor 4, PDGF and von Willebrand factor. CMK cells can proliferate in response to cytokines and have been used by us and other investigators in studies of megakaryocyte growth and maturation. In addition, CMK cells also differentiate upon induction with PMA (Sakaguchi, M. et al. (1991 ) Blood 11, 481-485; Cowley, S. A. et al. (1992) Int. J. Cell Cloning 10, 223-231 ; Avraham, H. et al. (1992) Int. J. Cell Cloning 10, 70-79; Namciu, S. et al. (1994) Oncogen 9, 1407-1416). For such experiments, PMA was dissolved in dimethyl sulfoxide and stored at -20°C until use, when it was diluted in RPMI 1640 medium.
Antibodies
Anti -RAFTK antiserum was obtained from New Zealand White rabbits immunized with a bacterially expressed fusion protein consisting of GST and the C- terminus (amino acids 681-1009) of human RAFTK cDNA subcloned into the pGEX- 2T expression vector as described (Avraham, S. et al. (1995)J. Biol. Chem. 270, 1- 10). The sera were titered against the GST-RAFTK C-terminus fusion protein by an enzyme-linked immunosorbent assay, and the serum (R-4250) exhibiting the highest titer (1 :256,000) was used in subsequent experiments. In immunoblotting experiments anti-phosphotyrosine antibodies were used (PY20) or anύ-RAFTK (1 :1000) or antibodies for FAK-2A7 (1 : 1000).
Cell stimulation, immunoprecipitation and immunoblotting
The CMK cells were starved overnight in RPMI- 1640 with 0.5% FCS. Cells (106/ml) were stimulated for 0 to 30 min at RT with either SCF (100 to 500 ng/ml) or PMA ( 10- 100 nM). The stimulation was terminated by adding ice-cold RPMI- 1640 containing sodium vanadate followed by centrifugation. The cells were lysed in odified-RIPA buffer (50 mM Tris-HCl, pH 7.4, 1% NP-40, 0.25% sodium deoxycholate, 150 mM NaCl, 1 mM PMSF, 2 (g/ml of aprotinin, leupeptin and pepstatin, and 1 mM Na3VO4). Total cell lysates (TCL) were clarified by centrifugation at 10,000 x g for 10 min. Protein concentrations were determined by using a protein assay (Bio-Rad Laboratories) and were standardized to equal concentrations of protein prior to immunoprecipitation. Identical amounts of protein from each sample were precleared by incubation with Protein G-Sepharose CL-4B (Sigma Co., St. Louis, MO) for 1 h at 4°C. After the removal of Protein G-Sepharose by brief centrifugation, the solution was incubated with different primary antibodies as described below for each experiment for 4 h or overnight at 4°C. Immunoprecipitation of the antigen-antibody complex was accomplished by incubation for 1 h at 4°C with 40 μl of protein G-Sepharose as described (Huang, E. et al. (1990) Cell 63, 225-233). Normal rabbit serum was used as a control in immunoprecipitations. Bound proteins were solubilized in 20 μl of 2 X Laemmli buffer. Samples were separated and analyzed by 7.5% SDS-PAGE, and then transferred to nitrocellulose membranes. The membranes were blocked with 5% bovine serum albumin (BSA) (Boehringer Mannheim Co., Indianapolis, IN) and probed with primary antibody for 1 h at RT. Immunoreactive bands were visualized using HRP-conjugated secondary antibody and the enhanced chemiluminescent (ECL) reagents (Amersham Coφ., Arlington Heights, IL).
SCF induces the tyrosine phosphorylation of RAFTK in CMK megakaryocytic cells.
To investigate whether RAFTK participated in growth-related signal transduction pathways in megakaryocytes, model CMK megakaryocytic cells were studied with a focus on the c-kit/SCF pathway which is known to be important in the proliferation of this lineage (Briddell, R. A. et al. (1991) Blood lZ, 2854-2859; Avraham, H. et al. (1992) Blood 79, 365-371 ; Avraham, H. et al. (1992) Blood 80, 1679-1684). The CMK cells were starved in RPMI- 1640 medium followed by stimulation with SC, and then harvested at different time intervals as indicated. Cells were lysed and immunoprecipitated with polyclonal RAFTK R-4250 antibodies. The precipitates were then immunoblotted with monoclonal anti-phosphotyrosine (PY-20) antibodies or FAK monoclonal antibodies or with RAFTK-specific antibodies.
Tyrosine phosphorylation of RAFTK peaked at a concentration of SCF of 500 ng/ml at 5 min. No phosphorylation of FAK was observed under these conditions. Maximum stimulation of RAFTK in CMK cells was observed within 1 min and peaked at 5 min.
SCF treatment is known to increase cytoplasmic calcium levels (Columbo, M. et al. (1994) Biochemical Pharmacology 47, 2137-2145) as well as to stimulate phosphorylation of components of c-kit associated signalling pathways (.Lev, S. et al. (1992) Journal of Biological Chemistry 267, 15970-15977; Rottapel, R. et al. (1991) Molecular & Cellular Biology 11, 3043-3051). Since SCF effects are modulated by PKC (Blume-Jensen, P. et al. (1995) Journal of Biological Chemistry 270, 14192- 14200; Na ciu, S. et al. (1994) Oncogene 9, 1407-1416; Grabarek, J. et al. (1992) Journal of Biological Chemistry 267, 1001 1 - 10017), the role of PKC in RAFTK stimulation was investigated. SCF treatment of CMK cells induced rapid phosphorylation of RAFTK within 1 min and was completely blocked by the PKC inhibitors calphostin C or staurosporine.
PMA induces tyrosine phosphorylation of RAFTK in CMK megakaryotic cells.
To determine if RAFTK participates in pathways of megakaryocyte differentiation, the effect of PMA, which induces differentiation and maturation of cells of this lineage (Sakaguchi, M. et al. (1991 ) Blood 11, 481 -485,Cowley, S. A. et al. (1992) Int. J. Cell Cloning 10, 223-231 ; Avraham, H. et al. (1992) Int. J. Cell Cloning 10, 70-79; Namciu, S. et al. (1994) Oncogene 9, 1407-1416), was studied and was found to be able to stimulate RAFTK phosphorylation. Under these conditions, phosphorylation of RAFTK peaked at 5 min at 50 nM PMA. Because PMA activates PKC, the relationship between PMA induced tyrosine phosphorylation of RAFTK in CMK cells and PKC activation was further characterized. Addition of the PKC inhibitors Calphostin C (1 (M) or staurosporine (75 nM) inhibited RAFTK phosphorylation following PMA treatment of CMK cells. In additional correlative experiments, PMA-sensitivc isozymes were first down- regulated in CMK cells by prolonged treatment with PMA (15 min at 37°C), and then these cells were treated with SCF or PMA. This prolonged treatment with PMA completely abolished the subsequent effects of PMA or SCF treatment, suggesting that tyrosine phosphorylation of RAFTK by SCF or PMA is a PKC dependent mechanism. PMA stimulation did not result in an increase in the tyrosine phosphorylation of FAK, suggesting these related molecules may have distinct roles in different signalling activation pathways in megakaryocytes.
She association with Grb2 in SCF stimulated CMK cells.
The activated c-kit receptor can recruit Grb2 by tyrosine phosphorylation of She (Liu, L. et al. (1994) Mole, and Cell Biol. 14, 6926-6935; Tauchi, T. et al. (1994) J. Exp. Med. 179, 167-175). It was then investigated whether SCF could induce tyrosine phosphorylation of She and whether it associates with Grb2 in CMK cells. CMK cells stimulated by SCF (500 ng/ml) or PMA (50 nM) were lysed and immunoprecipitated with monoclonal anti-human She antibody and the precipitates were then immunoblotted with monoclonal anti-phosphotyrosine antibody PY-20. SCF induced She phosphorylation and association with Grb2 while PMA has no effect on Shc-Grb2 association, suggesting differences in proliferative versus maturational pathways with regard to these molecules in megakaryocytes.
PKCα and PKCδ isoforms are involved in RAFTK phosphorylation. To identify the PKC-isozymes involved in RAFTK phosphorylation, an analysis of PKC isozymes present in CMK cells was performed. PKCδ and PKCα isoforms were expressed in megakaryocytes as observed by immunoprecipitation using specific antibodies for PKCα and PKCδ, while no expression of PKCβ or PKCγ was observed. To characterize which PKC-isozymes that may be involved in RAFTK phosphorylation upon SCF or PMA stimulation of CMK cells, CMK cell lysates unstimulatcd or after PMA or SCF treatment were immunoprecipitated with either PKCδ or PKCα specific antibodies. The immunoprecipitates were resolved on 7.5% SDS-PAGE, immunoblotted with PY-20 antibodies or anti-phosphoserine/threonine or PKCδ or PKCα or RAFTK specific antibodies. Constitutive association of PKCδ with RAFTK was demonstrated by co-immunoprecipitation studies as shown in. An increase in phosphorylation of PKCδ upon PMA treatment was observed. A similar observation of augmented PKCδ phosphorylation was made in CMK cells stimulated with SCF.
PKCα was found only to be associated with RAFTK after stimulation with SCF or PMA, but changes in the degree of phosphorylation of PKCα upon such activation by SCF or PMA using phosphoserine/threonine antibodies were not detected. These results show that PKCα and PKCδ isozymes are involved in RAFTK activation, that PKCδ is constitutively associated with RAFTK while association of RAFTK with PKCα is inducible, and may be increased in activation upon certain stimuli but may not alter the phosphorylation status of this species.
Association of RAFTK with Paxillin and PKCδ.
To address the role of RAFTK in the formation of focal adhesions, RAFTK association with a known focal adhesion protein paxillin was investigated. Cell lysates of CMK cells treated with PMA were immunoprecipitated with either RAFTK specific antibodies or anti-paxillin antibodies. The immunoprecipitates were resolved and immunoblotted with PY-20 antibodies. An increase in phosphorylation of paxillin was observed upon PMA stimulation which peaked by 5 min. Constitutive association of paxillin and RAFTK was observed in untreated CMK cells. Treatment with the PKC inhibitor calphostin C abolished RAFTK activation and decreased its association with paxillin. Paxillin phosphorylation at 10 min was not altered by calphostin C treatment, indicating that paxillin phosphorylation is not dependent on PKC. Similar observations of paxillin phosphorylation and its association with RAFTK were observed in CMK cells stimulated with SCF.
In addition, CMK cells stimulated with SCF were immunoprecipitated with RAFTK antibodies, and the immunoprecipitates were then resolved and immunoblotted with PY-20 antibodies, RAFTK or paxillin antibodies. RAFTK constitutively associated with paxillin and was not altered in its degree of phosphorylation upon activation with SCF. Constitutive association of PKCδ with RAFTK was also observed. These results demonstrate a constitutive association of PKCδ, RAFTK and paxillin in untreated cells. Upon activation with PMA, PKCδ was phosphorylated and peaked by 10 min. The constitutive association of PKCδ with RAFTK was not affected by PMA stimulation.
RAFTK activation is inhibited by BAPTA, calphostin C and cytochalasin-D.
Calcium ionophore (A23187) treatment of cells elevates intracellular calcium levels and initiates a cascade of signalling events including PKC activation. CMK cells treated with calcium ionophore A23187 showed tyrosine phosphorylation of RAFTK, which was inhibited by the intracellular calcium chelator, BAPTA. In the presence of calphostin C, a specific PKC inhibitor, induction of RAFTK phosphorylation by the calcium ionophore A23187 was inhibited, indicating that calcium regulation of this PKC isoform was involved in RAFTK phosphorylation. Upon calcium ionophore A23187 treatment, RAFTK activation was completely inhibited in the presence of cytochalasin-D, indicating that RAFTK is associated with the cytoskeleton and this association is essential for its activation following changes in intracellular calcium. Similarly, SCF treatment of CMK cells induced rapid, transient tyrosine phosphorylation of RAFTK which was inhibited in the presence of BAPTA, suggesting that SCF may induce RAFTK phosphorylation through elevating intracellular calcium levels. However, in the presence of cytochalasin-D, SCF induction of RAFTK phosphorylation was inhibited completely, indicating again that the integrity of the cytoskeleton is required for RAFTK phosphorylation. Since SCF stimulation of RAFTK in the presence of calphostin C was also completely inhibited, this mechanism of RAFTK activation appears to be mediated through PKC.
PMA phosphorylation of RAFTK also was blocked by calphostin C or by BAPTA, further indicating that calcium regulation of PKC isoforms is involved in RAFTK stimulation. Cytochalasin-D treatment inhibited PMA stimulation of RAFTK, suggesting that RAFTK association with the megakaryocytic cytoskeleton is critical for its phosphorylation in cells of this lineage. In this study, RAFTK activation and its regulation in megakaryocytic cells was characterized. The results obtained in these studies demonstrated that RAFTK, unlike FAK, is tyrosine phosphorylated upon SCF and PMA treatments. The finding that FAK is not phosphorylated under these conditions is consistent with prior studies of FAK activation in Mo7E megakaryocytic cells (Gotoh, A. et al. (1995) Experimental Hematology 23, 1 153-1 159) and suggests important differences in the roles of FAK and RAFTK in cells of this lineage.
The effects of SCF, PMA and Ca2+ on activation of RAFTK were mediated through PKC. Moreover, direct association of RAFTK with paxillin was observed and activation of RAFTK resulted in a sequential activation and phosphorylation of this cytoskeletal protein.
PKC plays an important role in cellular responses to various hormones, growth factors, neurotransmitters and cytokines, and transduces signals promoting lipid hydrolysis (See, e.g., Dekker. L. V. and Parker, P. J. (1994) Trends in Biochemical Sciences 19, 73-77; Nishizuka, Y. (1992) Science 258, 607-614; Nishizuka, Y. (1986) Science 233, 305-312). PKC regulates the action of a variety of ion channels, G- protein coupled receptors, tyrosine kinase receptors or non-receptor tyrosine kinases (See, e.g., Ohtani, K. et al. (1995) Journal ofNeurochemistry 65, 605-614; Rozengurt, E. (1995) Cancer Surveys 24, 81 -96; Sadoshima, J., et al. (1995) Circulation Research 16, 1-15). Since the proliferative effects of SCF appeared to be modulated in part by PKC (See, e.g., Blume-Jensen, P. et al. ( 1995) Journal of Biological Chemistry 270, 14192-14200; Sato, T. et al. (1989) Br. J. Hematol. 72, 184-190; Cowley, S. A. et al. (1992) Int. J. Cell Cloning 10, 223-231), a role for PKC in RAFTK stimulation was investigated. Indeed, SCF induced rapid phosphorylation of RAFTK and was completely blocked by the PKC inhibitors calphostin C or Staurosporine. Furthermore, PMA, which induces differentiation of CMK megakaryocytic cells (Sakaguchi, M. et al. (1991 ) Blood 11, 481-485; Cowley, S. A. et al. (1992) Int. J. Cell Cloning 10, 223-231; Avraham, H. et al. (1992) Int. J. Cell Cloning 10, 70-79; Namciu, S. et al. (1994) Oncogen 9, 1407-1416), also stimulated RAFTK tyrosine phosphorylation; this RAFTK phosphorylation was abolished by the PKC inhibitors or prolonged treatment with PMA. These results also demonstrate that RAFTK activation was mediated by PKC.
To further characterize this pathway, the role of PKC isoforms in RAFTK activation was studied. The PKC-α and PKC-δ isoforms are known to be expressed in megakaryocytes while PKC-γ and PKC-β have not been found (Grabarek, J. et al. ( 1992) Journal of Biological Chemistry 267, 1001 1 - 10017). Constitutive association in vivo of PKC-δ with RAFTK was observed while association of PKC-α and RAFTK was inducible. No increase in the level of PKC-α or PKC-δ with RAFTK after SCF or PMA stimulation was observed by co-immunoprecipitation techniques. Although PKC isoenzymes do not possess intrinsic tyrosine kinase activity, activation of PKC by phorbol esters such as PMA has been demonstrated to indirectly induce tyrosine phosphorylation in different cells types (See, e.g., Li, W. et al. (1994) Journal of Biological Chemistry 269, 2349-2352; Einspahr, K. J. et al. (1990) Journal of Immunology 145, 1490-1497; Nel, A. E et al. (1990) Journal of Immunology 145, 971-979). In NIH-3T3 or 32D transfectants overexpressing various PKC isoenzymes, pronounced phorbol diester-dependent tyrosine phosphorylation of PKC-δ was observed, while no detectable tyrosine specific phosphorylation was found after treatment with the other PKC isoenzymes transfcctants (Li, W. et al. (1994) Journal of Biological Chemistry 269, 2349-2352).
SCF induction of tyrosine phosphorylation of RA FTK could be mediated by elevated intracellular calcium levels and activation of PKC through PLC-γ (Yeo, E. J. et al. (1994) Journal of Biological Chemistry 269, 27823-27826; Ma, Y. H. et al.
(1994) Journal of Biological Chemistry 269, 30734-30739; Zirrgiebel, U. et al. (1995) Journal ofNeurochemistry 65, 2241-2250). RAFTK phosphorylation was inhibited following treatment by the PKC inhibitors Calphostin C or Staurosporine as well as BAPTA (an intracellular Ca2+ chelator). Thus PKC is directly involved in RAFTK phosphorylation. BAPTA blocked PMA or SCF induced RAFTK phosphorylation, indicating that calcium was essential for PKC mediated RAFTK activation. Moreover, the calcium-ionophore (A23187) also stimulated RAFTK phosphorylation and was inhibited by PKC inhibitors Calphostin C and Staurosporine or by BAPTA, indicating again a role for PKC as a mediator of several signalling pathways including Ca2+ in RAFTK phosphorylation.
The cytoskeleton is essential for many cellular functions including regulation of cell shape, flexibility, and adhesive properties (Hynes, R. O. (1992) Cell 69, 11-25; Juliano, R. L. and Haskill, S. (1993) J. Cell Biol. 120, 577-585). Part of the cytoskeleton and plasma membrane form a region known as the focal adhesion (Lo, S. H. et al. (1994) Bioessays 16, 817-823). Focal adhesions are structures that form adherent contacts with the extracellular matrix. Proteins contained in the focal adhesion include talin, (-actinin, vinculin, paxillin, and other proteins (See, e.g., Tachibana, K. et al. (1995) Journal of Experimental Medicine 182, 1089-1099; Petch, L. A. et al. (1995) Journal of Cell Science 108, 1371-1379; Lewis, J. M. and Schwartz, M. A. (1995) Molecular Biology of the Cell 6, 151-160). The signal transduction pathways initiated by integrins involves cytoskeletal dependent activation of tyrosine kinases and phosphorylation of a number of substrates including FAK protein (See, e.g., Juliano, R. L. and Haskill, S. (1993) J. Cell Biol. 120, 577- 585; Hamawy, M. M. et al. (1994) American Society of Microbiology, Washington DC, p. 235; Schaller, M. D. et al. (1992) Proc. Natl. Acad. Sci. USA 89, 5192-5196). RAFTK is tyrosine phosphorylated upon fibronectin stimulation and co- localized with vinculin at "focal adhesion like structures" in CMK cells. RAFTK activation upon calcium ionophore (A23187) treatment or SCF or PMA stimulation of CMK cells is completely abolished in the presence of cytochalasin-D, which disrupts the cytoskeleton. These observations indicate that RAFTK is associated with the cytoskeleton and the integrity of the cytoskeleton is required for RAFTK phosphorylation, similar to that of FAK phosphorylation by integrins and external stimuli (Clark, E. A. and Brugge, j. S. (1995) Science 268, 233-239).
Constitutive in vivo association of RAFTK and paxillin was also observed. This effect of RAFTK on paxillin activation can promote paxillin binding to other SH2 -domain containing proteins that might be involved in multiple signal transduction pathways.
Constitutive association between RAFTK, PKC-δ and paxillin in vivo was observed. This shows a role for RAFTK in linking and crosstalk between various signaling proteins localized in the cytosol and focal adhesion contacts. The RhoA- dependent assembly of focal adhesions in Swiss 3T3 cells was associated with increased tyrosine phosphorylation and the recruitment of both ppl25FAK and PKC-δ to focal adhesions (Barry, S. T. and Critchley, D. R. (1994) Journal of Cell Science 107, 2033-2045). Association of PKC-δ with RAFTK and paxillin shows that phosphorylation of these components can be an important event in integrin mediated events in megakaryocytes. The tyrosine kinase PYK2, which is identical to RAFTK, has been shown to be involved in calcium signalling and MAP kinases function in PC- 12 neuronal cells (Lev, S. et al. (1995) Nature 376, 737). Stimulation of megakaryocytes with thrombin leads to tyrosine phosphorylation of RAFTK (Avraham, S. et al. (1995) J. Biol. Chem. 270, 1-10). The evidence that RAFTK is involved in the c-kit growth factor signalling pathway in megakaryocytic cells as described in this study further supports the broad function of this kinase in a variety of signalling pathways. EXAMPLE 3: Characterization of RAFTK, a Novel Focal Adhesion
Kinase, and Its Integrin-Dependent Phosphorylation and Activation in Megakaryocytes
Biochemical characterization and functional analysis of the RAFTK protein was performed. Coexpression of RAFTK and FAK proteins in megakaryocytic cells and blood platelets was observed. Using a specific antibody to RAFTK and the monoclonal antibody 2A7 to FAK, FAK and RAFTK could be distinguished antigenically.
RAFTK had intrinsic tyrosine kinase and auto-kinase activities. It was phosphorylated on tyrosine in growing cultures of COS cells transfected with the pCDNAUVfϊag-RAFTK expression vector containing the RAFTK cDNA ligated with the eight amino acid flag peptide sequence. Similar to FAK, dephosphorylation of RAFTK was observed when adherent transfected COS cells were detached.
Phosphorylation was regained upon replating of these cells on the fibronectin-coated dishes. Analysis of tyrosine phosphorylated RAFTK from adherent transfected COS cells revealed that the Src homology 2 (SH2) domains of the Src and Fyn protein kinases as well as the Grb2 adaptor protein were able to specifically associate with RAFTK. Tyrosine phosphorylation of endogenous RAFTK was observed upon fibronectin induced activation of human megakaryocytic cells. Furthermore, colocalization of RAFTK protein with vinculin, a focal adhesion protein, was observed in "focal adhesion-like structures" in adherent CMK cells and in transfected pCDNAIII/flag-/ f FTK COS cells upon fibronectin activation, by confocal microscopy.
These data show that RAFTK is a novel member of the FAK family, that it localizes to "focal adhesion-like structures" in CMK megakaryocytic cells, participates in integrin-mediated signaling pathways in megakaryocytes and is able to associate with the tyrosine kinases Src and Fyn as well as the adaptor protein Grb2 via SH2-phosphotyrosine interactions.
The following materials and methods were used to biochemically characterize and functionally analyze the RAFTK protein:
Chemical and biological reagents
Human fibronectin, Poly-L-Lysine (MW 70,000-150,000 Dalton) and geneticin (G418) were purchased from Sigma Chemical Co. (St. Louis, MO). Monoclonal antibody to phosphotyrosine (PY20) was purchased from Zymed Laboratories, Inc. (South San Francisco, CA). Monoclonal antibody 2A7 and polyclonal antibody BC3 to ppl25FAK were gifts from Dr. T. Parsons (University of Virginia, Charlottesville, VA). The 2A7 antibody was also purchased from Upstate Biotechnology Inc. (Lake Placid, NY). Polyclonal antibody 331 to FAK was a gift from Dr. S.K. Hanks (Vanderbilt University, Nashville, TN). Monoclonal antibody M5 to the flag peptide was purchased from Eastman Kodak Co. (New Haven, CT). rhGM-CSF was purchased from R & D Systems (Minneapolis, MN). Monoclonal anti-human antibody to vinculin was purchased from Sigma (St. Louis, MO).
Cells and cell growth
COS cells were obtained from the American Type Tissue Culture (Rockville, MD). The cells were maintained in Dulbecco's modified Eagle's medium (DMEM) (Mediatech Co., Washington, D.C.) supplemented with 10% fetal calf serum (FCS) (Sigma), 2 mM glutamine, 100 U/ml of penicillin and 100 mg/ml of streptomycin. Megakaryocytic cell lines CMK, DAMI, CMS, Meg-01 and CMK1 1-5 were maintained in RPMI-1640 supplemented with 10% FCS, 2 mM glutamine, 100 U/ml of penicillin and 100 mg/ml of streptomycin as described previously (Sakaguchi M et al. (1991) Blood ll, 481 ; Komatsu N et al. (1989) Blood lA, 42; Greenberg S M et al. (1988) Blood 12, 1968; Avraham H et al. (1994) Blood 83, 2126).
Expression of GST (Glutathione S-Transferase) fusion proteins
Oligonucleotides flanking various RAFTK domains and containing appropriate restriction sites were synthesized. The polymerase chain reaction (PCR) was used with RAFTK cDNA as a template to amplify the appropriate fragments. The DNA fragments encoding amino acid (a.a) residues 26-286 (N-RAFTK), 375-680 (KA- RAFTK), 375-1009 (KC-RAFTK) and 681-1009 (C-RAFTK) of RAFTK were amplified by the PCR technique and the sequences for these encoding regions were confirmed by DNA sequencing. The PCR products were precleaved with BamHI and EcoRI and were ligated into the pGEX-2T expression vector (Pharmacia Biotech, Inc., Piscataway, NJ) which had also been cleaved with BamHI and EcoRI. Competent Escherichia coli (E. coli) DH5a were transformed, and recombinant bacterial clones were screened by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS- PAGE) analysis of overexpressed fusion proteins and restriction enzyme analysis. GST-fusion proteins were produced by 1 mM isopropyl b-thiogalactopyranoside induction and purified by affinity chromatography on Glutathione-Sepharose beads (Pharmacia Biotech, Inc., Piscataway, NJ). Construction of pCDNAIII/flag and pCDNAIII/flag-&4Fr#
The pCDNAIII/flag expression vector was constructed by inserting a short DNA fragment encoding a starting codon and an 8-a.a flag peptide into a pCDNAIII expression vector (Invitrogen Co., San Diego, CA) at Hindlll and EcoRI sites. The two oligonucleotides used were: sense primer: 5 -AGC TTA TGG ACT AC A AGG ACG ACG ATG ACA GGG G-3' (SEQ ID NO: 17); antisense primer: 5' AAT TCC CTT GTC ATC GTC GTC CTT ATG GTC CAT A-3' (SEQ ID NO: 18). The cDNA encoding 1009 amino acids of human RAFTK was then subcloned in an EcoRI site located downstream of the flag sequences of the pCDNAIII/flag vector. The orientation and DNA sequences of the RAFTK cDN A were confirmed by DNA sequencing.
Transfection of COS cells and analysis of RAFTK phosphorylation COS cells were transfected by the calcium phosphate method using pCDNAIII/flag--&4F7X or pCDNAIII/flag expression vectors according to the manufacturer's protocol (Invitrogen Co., San Diego, CA). The transfected cells were starved in serum-free DMEM for 4-6 hr, harvested by phosphate-buffered saline (PBS) containing 2 mM EDTA and washed with PBS twice. The cells (1.5 x \ per 60 mm dish) were then plated onto fibronectin (5.0 μg/ml) or Poly-L-Lysine (5.2 μg/ml) coated dishes at 37°C for various times (20 or 40 min). Adherent cells were lysed in 1 ml of RIPA buffer (50 mM Tris-HCl, pH 7.4, 1% NP-40, 0.25% sodium deoxycholate, 150 mM NaCl, 1 mM PMSF, 10 μg/ml of aprotinin, leupeptin and pepstatin, and 1 mM Na3VO4). Analysis of RAFTK phosphorylation was performed as described further.
Immunoprecipitation
Total cell lysates (TCL) were clarified by centrifugation at 10,000 x g for 10 min. Protein concentrations were determined by the protein assay (Bio-Rad Laboratories, Hercules, CA) and were standardized to equal concentrations of protein prior to immunoprecipitation. Identical amounts of protein from each sample were precleared by incubation with protein G-Sepharose CL-4B (Sigma Co., St. Louis, MO) for 1 hr at 4°C. After the removal of protein G-Sepharose by brief centrifugation, the solution was incubated with different primary antibodies as described below for each experiment for 4 hr or overnight at 4°C.
Immunoprecipitation of the antigen-antibody complex was accomplished by incubation for 2 hr at 4°C with 25 μl of protein G-Sepharose. Non-specific bound proteins were removed by washing the Sepharose beads three times with HNTG buffer (20 mM Hepes, pH 7.4, 150 mM NaCl, 10% glycerol and 0.1% Triton X-100). Bound proteins were solubilized in 20 μl of 2 x Laemmli buffer and further analyzed by immunoblotting.
Endogenous RAFTK phosphorylation upon integrin activation
20 x l θ6 CMK cells were starved in serum-free RPMI- 1640 culture medium overnight. The cells were divided into 4 parts: one portion was replated onto fibronectin-coated (8 μg/cm2) dishes; one portion onto collagen-coated (8 μg/cm-2) dishes; one portion onto Poly-L-Lysine (5 μg/cm2) dishes; and one portion was kept in suspension. After 1 hr replating, the medium was aspirated and adherent cells were gently and quickly washed with ice-cold PBS. The cells were lysed in 1 ml RIPA buffer and cleared by centrifugation for 10 min at 10,000 rpm. 800 μg of TCL was incubated overnight at 4^C with 10 μl of R-4250, followed by immunoprecipitation with protein- A-Sepharose beads for 2 hr. The complexes were washed with HNTG buffer 3 times and then analyzed by Western blot analysis.
Immunoblot
A defined amount of protein lysate was combined with the same volume of Laemmli loading buffer and boiled for 2 min. In the case of immunoprecipitates, 20 μl of 2 x Laemmli loading buffer was added. Samples were separated and analyzed by 8% SDS-PAGE gel and then transferred to nitrocellulose membranes. The membranes were blocked with 5% bovine serum albumin (BSA) in PBS containing 0.1% Tween-20 (Boehringer Mannheim Co., Indianapolis, IN) and probed with primary antibody for 1 hr at room temperature according to the enhanced chemiluminescent (ECL) protocol (Amersham Coφ., Arlington Heights, IL). Immunoreactive bands were visualized using HRP-conjugated secondary antibodies and ECL reagents (Amersham Coφ., Arlington Heights, IL).
In vitro kinase assay
Immunoprecipitated complexes were washed twice with RIPA buffer and once in kinase buffer (20 mM Hepes; pH 7.4, 50 mM NaCl, 5 mM MgCl2, 5 mM MnCl2, and 100 μM Na3 VO4). The washed immune complexes or a defined amount of purified GST-fusion proteins were suspended in 20 μl of kinase buffer and then [g- 32P]ATP was added up to 250 μCi/ml in the presence of 25 μg of poly (Glu:Tyr) (4:1, 20 to 50 Kd) (Sigma Chemical Co., St. Louis, MO), at RT for 15 min. The reaction was stopped by the addition of 10 mM Hepes (pH 7.4)/10 mM EDTA. The labeled substrates were analyzed by SDS-PAGE and autoradiography.
In vitro SH2 association assays In vitro association experiments were carried out with GST-fusion proteins containing the SH2 domains of Fyn and Grb2 (a generous gift of Dr. L. Cantley, Harvard Medical School, Boston, MA) and Src (a generous gift of Dr. T. Pawson, Mount Sinai Research Institute, Canada). TCL (1 mg) was incubated for 120 min at 4°C with 10 μg of GST-fusion proteins coupled to Glutathione-Sepharose beads in the absence or presence of the indicated amount of synthetic peptide. The beads were washed three times with Tris-buffer saline, and proteins were separated by 8% SDS- PAGE.
Antibodies
Figure imgf000100_0001
antiserum was obtained from New Zealand white rabbits immunized with a bacterially expressed GST-fusion protein containing the C-terminal (681 - 1009 amino acid residues) of human RAFTK cDNA. The sera were titered by ELISA against the GST-RAFTK C-ter inus fusion protein. The serum R-4250 exhibited the highest titer (1 :256,000) and was found to react specifically with the GST-fusion proteins containing the C-terminus of RAFTK. This serum was used in subsequent experiments.
Confocal microscopy
(1) Cell staining: Cultured CMK megakaryocytes or transfected COS cells were plated overnight on glass coverslips coated with fibronectin (5-8 μg/cm2).
Adherent cells were fixed with 2% paraformaldehyde in PBS, pH 7.4 for at least 15 min, permeabilized in PBS containing 0.2% Triton X-100 for 2 min, washed in PBS, and placed in a blocking buffer containing PBS, 3% BSA and 1% normal goat serum for 1 hr. Adherent cells were incubated with anti-vinculin (IgGl mouse anti-human, 1 :200 dilution) and RAFTK (rabbit an\ -RAFTK, 1 : 100 dilution) antibodies for 1 hr. Cells were washed in PBS, incubated with FITC conjugated (anti-mouse IgG), and Texas red conjugated (anti-rabbit IgG) antibodies for 1 hr.
(2) Microscopy: Stained cells were briefly washed in PBS, then sealed in microwell chambers containing Vectashield antifade and examined using a Sarastro 2000 confocal laser scanning microscope (CLSM) (Molecular Dynamics, Sunnyvale, CA) fitted with a 25 mW argon-ion laser. The microscope was configured for dual channel fluorescent imaging with: 488/514 nm excitation, 535 nm primary beamsplitter, 10% laser transmission, 18 mW laser power. A 595 nm secondary beamsplitter passed fluorescent light emitted from ΛΛF-TAMabeled (Texas red)-cells to a photomultiplier tube fitted with a 600 long pass filter. Short wavelength light (<595 nm) emitted from the vinculin-labeled focal adhesion plaques (FITC) was directed to a second photomultiplier tube fitted with a 540 ± 15 nm band pass filter and simultaneously recorded. Image pairs were subjected to a 2-D median filter to reduce background noise, then examined as color composite images with RAFTK appearing red, and vinculin green. Focal adhesion plaques expressing both RAFTK and vinculin appeared yellow-orange. (3) Image analysis: In some cases, the distribution of RAFTK and vinculin were determined using a quantitative image analysis procedure in which 2-D pixel intensity histograms from both the RAFTK and vinculin images were compared using ImageSpace (Molecular Dynamics, Sunnyvale, CA) software. Image analysis was performed on pairs of images to determine the area occupied by RAFTK and vinculin within the CMK cells. Pixel dimensions of all micrographs were 0.17 μm, and pixel intensities ranged from 0-255 intensity units.
The pixel intensity range corresponding to the cell cytoplasm was determined separately for each image. Cell background was found to be within a range of 4-73 pixel intensity units. The noncellular background composed of surrounding media and slide surface was determined to be 0-3 pixel intensity units. Cells containing fluorescent stained RAFTK were observed to have pixel intensities from 74-255, whereas pixel intensities for vinculin ranged between 86-254 units. Pixel intensities corresponding to either RAFTK or vinculin were applied to a 2-D histogram of pixel intensities with RAFTK (X-axis), plotted against vinculin (Y-axis). Pixels unique to each either RAFTK or vinculin were identified on the 2-D histogram and converted into a binary section. This section was applied as a mask over the original image to produce area measurements on a per cell basis. This procedure was repeatedly used to measure the area occupied by both RAFTK and vinculin for both cell types.
The RAFTK gene is highly conserved during species evolution and is coexpressed with FAK in several hematopoietic cells.
RAFTK shares about 65% similarity of its amino acid sequence with that of FAK, suggesting that RAFTK and FAK may have some common features. In order to determine whether RAFTK and FAK may be coexpressed in the same cells, total RNA from different megakaryocytic cell lines was prepared and Northern blot analysis was performed using a human &4 F7 -specific probe and a human FAK-specific probe. Northern blot analysis showed that all tested megakaryocytic cell lines coexpressed both RAFTK- and FAK- specific transcripts of 4.5 Kb.
Coexistence of RAFTK and FAK proteins was detected by Western blot analysis in the CMK megakaryocytic cell line and in blood platelets using the polyclonal antibody 4250 to the C-terminal RAFTK and the monoclonal antibody 2A7 to FAK. Total lysates from 5 x 108 platelets of 10^ CMK cells were prepared and protein concentrations were determined. An equal amount of protein was immunoprecipitated by polyclonal antiserum 4250 for RAFTK or normal rabbit serum (NRS) or immunoprecipitated with the monoclonal antibody 2A7 to FAK or control irrelevant monoclonal antibody with the same isotype. The immunocomplexcs were resolved by SDS-PAGE and then immunoblotted with antibody 4250 (1 : 1000) or immunoblotted with 2A7 (1 :500)- Antibodies 4250 and 2A7 were shown to be specific to RAFTK and FAK, respectively, as described below. Taken together, these results demonstrated that RAFTK and FAK were coexpressed in these hematopoietic cells.
RAFTK is antigenically distinct from, but related to FAK.
In order to investigate whether RAFTK and FAK were antigenically related, Three DNA fragments encoding N-terminal (N-RAFTK), kinase catalytic (KA- RAFTK) and C-terminal (C-RAFTK) domains of RAFTK were subcloned into the pGEX-2T expression vector. In addition, the full length cDNA was ligated with a sequence encoding an eight amino acid flag peptide and subcloned into a pCDNAIII vector.
Expression of the GST-fusion proteins, Η-RAFTK, KA-RAFTK and C-RAFTK as well as GST protein was analyzed by Western blot using antibodies to GST and FAK. Only the C-terminal GST-RAFTK (amino acids 681-1009) was recognized by polyclonal antibodies BC3 and 331, respectively, which were generated against the C- terminal of the FAK protein (Schaller M D et al. ( 1992) Proc Nαtl Acαd Sci USA 89, 5192; Hanks S K et al. (1992) Proc Nαtl Acαd Sci USA 89, 8487). This result showed that RAFTK is antigenically related to FAK. However, the monoclonal antibody 2A7 against FAK did not crossreact with any of the three fusion proteins, suggesting that RAFTK may be antigenically different from FAK.
To further confirm these findings, a polyclonal antiserum 4250 by rabbit immunization with the C-terminal RAFTK GST-fusion protein was generated. This antiserum, like the monoclonal antibody M5 to the flag peptide and polyclonal Ab BC3, specifically recognized the M5-immunoprecipitated flag-RAFTK protein expressed in transfected COS cells. To verify 2A7 antibody specificity, antibody 2A7 but not 4250 or M5, was shown to recognize a 2A7-immunoprecipitated 125 Kd protein in either vector alone or f\ag-RAFTK transfected COS cells; this protein appears to represent the endogenous FAK. Similarly, RAFTK immunoprecipitated by antiserum 4250 from CMK megakaryocytic cell lysates was not recognized by the monoclonal antibody 2A7 to FAK and FAK immunoprecipitated by the monoclonal antibody 2A7 from CMK cell lysates was not recognized by ΛΛF7X-specific antibodies. Taken together, these data show that FAK and RAFTK are distinguishable antigenically while being related members of the FAK family.
RAFTK has intrinsic protein tyrosine kinase and auto-kiπasc activities.
Enzymatic activity of a protein tyrosine kinase is essential for its role in signal transduction. To assess intrinsic tyrosine kinase activity, kinase activity of the purified N-RAFTK, KA-RAFTK, KC-RAFTK, and C-RAFTK GST-fusion proteins in in vitro assays in which poly (Glu:Tyr) (4:1) was used as an exogenous substrate was tested. The results showed that the KC-RAFTK fusion protein possessed kinase activity.
Similar data were obtained by testing total recombinant bacterial cell lysates, as only the KC- RAFTK construct had kinase activity. These results demonstrate that RAFTK has intrinsic PTK activity.
Autophosphorylation of FAK is an initial step in cell response to stimuli and provides a dock for the association of Src-family kinases (Weng Z et al. ( 1993) J Biol Chem 268, 14956; Schaller M D et al. (1994) Mol Cell Biol 14, 1680). In order to test RAFTK auto-kinase activity, the incoφoration of 32P into the purified GST-fusion proteins containing either the kinase catalytic domain, C-terminal domain or kinase plus C-terminal domain was tested in the absence of exogenous substrate. In agreement with the results from the in vitro kinase activity assay, only the kinase catalytic domain plus C-terminal domain of RAFTK appeared capable of autophosphorylating itself (MW 100 Kd). The additional low molecular weight proteins might represent the proteolytic isoforms of the KC-RAFTK GST-fusion protein which were found during recombinant E. coli growth and induction, as detected by antibodies to the GST protein. These results show that RAFTK possesses auto-kinase activity.
RAFTK is involved in integrin-mediated signaling in transiently transfected COS cells and CMK megakaryocytic cells. Since RAFTK is structurally similar to FAK which plays a central role in integrin-mediated signaling pathways, RAFTK phosphorylation upon integrin engagement was studied. Tyrosine phosphorylation and kinase activity of flag- RAFTK in transiently transfected COS cells were analyzed. When transfected COS cells were grown on plastic culture dishes, flag-RAFTK protein was phosphorylated. Detachment of the transfected cells by 1 mM EDTA in PBS resulted in a significant decrease in the level of RAFTK phosphorylation; replating the cells onto fibronectin- coated dishes increased the phosphorylation of flag-RAFTK in a time dependent manner. In contrast, replating the cells onto Poly-L-Lysine coated dishes had no effect on the phosphorylation of flag-RAFTK. These data show that the phosphorylation of flag-RAFTK is modulated by integrin interaction with fibronectin. To assess whether the kinase activity of RAFTK was stimulated by integrin activation, the flag-RAFTK from detached cells, cells attached to fibronectin or cells attached to Poly-L-Lysine were analyzed. While flag-RAFTK from fibronectin-coated dishes was markedly increased in its kinase activity, no increased kinase activity was found in flag-RAFTK from Poly-L-Lysine coated dishes. The flag-RAFTK in the detached cells retained a very low level of activity. In order to elucidate whether or not endogenous RAFTK is responsive to integrin activation (like FAK), a detailed analysis of integrin-mediated signaling of endogenous RAFTK in megakaryocytes was also performed. After starvation. CMK cells were lysed in RIPA buffer as a control, or replated onto fibronectin, collagen or Poly-L-Lysine coated dishes for 1 hr. The adherent cells were quickly washed and lysed in RIPA buffer. A total of 1.2 mg TCL for each sample was immunoprecipitated with anύ-RAFTK serum (R-4250). After washing, the immunocomplexes were divided into three parts: equivalent of 1 mg TCL for phosphorylation analysis; equivalent of 180 ug TCL for autophosphorylation assay; and equivalent of 20 ug TCL for kinase assay. The phosphorylation of RAFTK was significantly increased in CMK megakaryocytic cells adherent to fibronectin or collagen coated dishes, while no phosphorylation of RAFTK was observed in nonadherent CMK cells or CMK cells grown onto Poly-L-Lysine dishes. These data show that RAFTK can be activated by integrin engagement in CMK cells.
To assess whether the auto-kinase activity of RAFTK was stimulated by integrin activation, endogenous RAFTK in CMK cells untreated or stimulated with collagen, fibronectin, or Poly-L-Lysine was analyzed. There was an increase in autophosphorylation of RAFTK upon the collagen or fibronectin adhesion of CMK cells. In contrast, a very low level of autophosphorylation in CMK cells adherent to Poly-L-Lysine and no autophosphorylation activity in untreated CMK cells was observed.
In order to evaluate the intrinsic kinase activity of endogenous RAFTK in CMK cells, the kinase activity of endogenous RAFTK in CMK cells adherent to fibronectin, collagen, or Poly-L-Lysine was tested. Strong phosphorylation of the exogenous substrate poly (Glu.Tyr) (4:1) by RAFTK was observed when CMK cells were adherent to collagen or fibronectin, while low kinase activity of RAFTK was detected when CMK cells were adherent to Poly-L-Lysine or in suspension. These results, together with the in vitro kinase experiments using the GST-RAFTK fusion proteins, demonstrated that RAFTK increased its intrinsic PTK and auto-kinase activities upon integrin activation.
Association of phosphorylated RAFTK with Src-family kinases and Grb2 adaptor protein via SH2-phosphotyrosinc interactions.
The tyrosine phosphorylation of several signaling proteins provides a specific dock for the association of SH2-containing proteins. To test whether phosphorylated RAFTK associated with the Src-family kinases and the Grb2 protein, GST-SH2 fusion proteins from Fyn, Src, Grb2, N-terminal and C-terminal p85 subunits of PI3-K (NP85 and CP85), respectively were purified to homogeneity. These proteins were incubated with TCL from flag-RAFTK transfected COS cells adherent on fibronectin- coated dishes. Associated complexes were analyzed by Western blot analysis. GST- SFI2 fusion proteins from Fyn, Src and Grb2 appeared to be specifically associated with phosphorylated RAFTK while GST protein alone, GST-NP85SH2 and GST- CP85SH2 did not bind to phosphorylated RAFTK. In order to test whether such association was enhanced specifically by fibronectin treatment, RAFTK protein from transfected COS cells in suspension was compared to that of transfected COS cells adherent on fibronectin in its association with SrcSH2, FynSH2 and Grb2SH2 GST- fusion proteins. Cells adherent on fibronectin significantly increased the association of RAFTK with SrcSH2, FynSH2 and Grb2SH2 GST proteins. These results demonstrate that RAFTK strengthens its ability to bind Src, Fyn and Grb2 molecules after cellular integrin activation.
Since Grb2SH2 GST-fusion proteins seemed to be associated less with RAFTK than the SrcSH2 and FynSH2 GST-fusion proteins, this specificity was further confirmed by abolishing this association with increasing concentrations of a phosphotyrosine synthetic peptide (VpYLNVMEL) corresponding to amino acids 880-887 of RAFTK. Taken together, these results demonstrated that tyrosine- phosphorylated RAFTK has the ability to specifically associate with Src and Fyn kinases and Grb2 protein in a SH2-dependent manner. Localization of RAFTK to "focal adhesion-like structures" of CMK cells and transfected COS cells.
To analyze whether endogenous RAFTK in CMK cells was localized to focal adhesion structures or to cell-cell contacts, a detailed analysis using confocal microscopy was performed. In addition, localization of RAFTK in transfected COS cells was determined. Purified R-4250 antibodies which specifically detect RAFTK were used. Confocal image analysis of immunostained CMK cells and transfected COS cells adherent to the fibronectin substrate reveal "focal adhesion-like structures" adjacent to the glass coverslip surface. Confocal image analysis showed greater than 90% of the RAFTK was colocalized with vinculin under these conditions. Cells immunostained with RAFTK revealed punctate areas of staining near the basal surfaces of cells which were adherent to fibronectin for 12 hrs. Cells adherent to fibronectin for 1 hr revealed similar colocalization to basal cell surfaces, however, focal adhesion plaques were not well developed at this time point.
In this study, the biochemical characterization and functional analysis of a novel signaling molecule, RAFTK, which is abundantly expressed in megakaryocytes, platelets and brain tissue (Avraham S et al. (1995) J Biol Chem 270, 27742) is described. The results show that RAFTK, like FAK, possesses intrinsic protein tyrosine kinase and auto-kinase activities; is coexpressed with FAK in megakaryocytic cells and platelets; and is immunologically related to, but distinct from FAK. The phosphorylation and kinase activity of RAFTK were stimulated by integrin engagement. Phosphorylated RAFTK was able to specifically bind to Src- family kinases and the Grb2 adaptor protein via an apparent phosphotyrosine-SH2 interaction. These data demonstrate that RAFTK is a novel member of the FAK family and shares structural, immunological, enzymatic, and functional features with FAK.
Fibronectin stimulation increased RAFTK tyrosine phosphorylation when an epitope tagged RAFTK was expressed into COS cells. In addition, the phosphorylation of RAFTK was significantly increased in CMK cells adherent onto fibronectin or collagen coated dishes, while no phosphorylation of RAFTK was observed in untreated CMK cells or CMK cells grown onto Poly-L-Lysine coated dishes. These results clearly show that the phosphorylation of endogenous RAFTK is modulated by integrin interaction with fibronectin or collagen in CMK cells. In addition, microscopic imaging of CMK cells and transfected pCDNAIII/flag-./? F-7 COS cells following double-staining with vinculin and RAFTK revealed colocalization of the RAFTK protein with vinculin in "focal adhesion-like structures" in CMK and transfected COS cells treated with fibronectin. It is important to note that all published studies involving focal adhesion sites were done in adherent cells (such as 3T3 cells) where the staining of focal adhesion structures is in a conventional punctate pattern. Megakaryocytic as well as CMK cells are cells grown in suspension and lack the typical focal adhesion structures. Therefore, these confocal studies were done in transfected COS cells as well as CMK cells grown in fibronectin and the stained structures are called "focal adhesion-like structures". Furthermore, the colocalization of RAFTK with vinculin, a well-known focal adhesion protein, was performed in CMK and transfected COS cells. The colocalization of both proteins is about 90%. The microscopic studies support the biochemical evidence that RAFTK is localized to "focal adhesion-like structures" surrounded by vinculin in adherent CMK cells and transfected COS cells.
These studies on RAFTK localization were performed in transfected COS cells (with a flag-RAFTK construct) and in CMK cells. The plane of focus was set to be within the focal adhesion plaque region at 0.2 microns above the coverslip surface to exclude cell-cell contact. Furthermore, the tyrosine phosphorylation of endogenous RAFTK was observed upon collagen stimulation of platelets. However, in PC 12 cells, RAFTK was not phosphorylated upon collagen treatment. These observations suggest that RAFTK phosphorylation upon integrin-mediated signaling is dependent on cell types and integrin forms, indicating a cell type specific signaling event.
Amino acid and DNA sequence homology studies showed that RAFTK is most closely related to FAK, sharing 65% similarity (Avraham S et al. (1995) J Biol Chem 270, 27742). Such high similarity between the proteins suggested that RAFTK and FAK may have similar molecular structural conformations. This prediction was supported by antigenic crossreactivity studies in which two polyclonal antibodies to FAK recognized the C-terminal GST-fusion protein of RAFTK as well as flag- RAFTK. RAFTK appears to be structurally distinct from FAK. A further comparison of RAFTK and FAK in different regions indicated that NH2 and COOH terminal domains have more divergence than the kinase domain. Such divergence may account for the failure of monoclonal antibody 2A7 to FAK and polyclonal antibody 4250 to RAFTK to recognize common epitopes.
Since FAK-family kinases lack SH2 and SH3 domains, the regulation of tyrosine phosphorylation plays a critical role in protein-protein interactions during signal transduction. More than half (20/35) of the tyrosine residues of RAFTK axe highly conserved in the FAK molecule (Avraham S et al. (1995) J Biol Chem 270, 27742). Importantly, two of these residues in FAK were identified as being phosphorylated and sequentially bound to the SH2 domains of the Src-family kinases and the Grb2 adaptor protein: Tyr397(Schaller M D et al. (1994) Mol Cell Biol 14, 1680) and Tyr925 (Schlaepfer D.D. et al. (1994) Nature 372, 786), respectively. The sequences downstream of these two phosphotyrosines are consistent with the prediction that the Src SH2 domain preferentially binds to the phosphotyrosine sequence pYAEI, whereas Grb2 binds to pYENV (Songyang Z et al. ( 1993) Cell 72, 767). Equivalent phosphotyrosine sequences were found at Tyr4^ and Tyr8 1 of RAFTK, however, glutamic acid next to Tyr88*- was substituted with leucine. These results demonstrated that the SH2 domains of Src, Fyn and Grb2 were able to specifically associate with tyrosine phosphorylated RAFTK from fibronectin-activated COS cells. The leucine substituted next to phosphotyrosine-881 did not change its specificity of binding for Grb2. However, unlike FAK, RAFTK contains more than one potential binding site for Src-family tyrosine kinases. These results show that RAFTK, like FAK, is a substrate for Src kinases which are required for FAK family kinase mediated signaling pathway(s). Tyrosine kinase and auto-kinase activities are essential for FAK to initiate its downstream signaling pathway. Because RAFTK has very large NH2 and COOH domains, it is important to preclude the possibility that any other
Figure imgf000108_0001
kinase(s) may contribute to the enzymatic activity in the in vitro kinase assay. Therefore, purified GST-RAFTK fusion proteins produced from recombinant bacteria were tested for kinase activity. The data described herein demonstrated that RAFTK, like FAK, possesses intrinsic kinase and auto-kinase activities. However, it is interesting to observe that such activities may require not only the kinase catalytic domain but also the COOH domain, which would differ from that observed with FAK produced in mammalian cells (Eide B L et al. (1995) Mol Cell Biol 15, 2819; Chan P Y et al. ( 1994) J Biol Chem 269, 20567). It is unclear whether the different observations imply different characteristics of FAK and RAFTK or are due to different expression systems.
EXAMPLE 4: Activation of a Novel Related Focal Adhesion Tyrosine Kinase (RAFTK) During an Early Phase of Platelet
Activation by an Integrin GpIIb-IIIa Independent Mechanism
RAFTK is rapidly tyrosine phosphorylated in thrombin-stimulated platelets, To elucidate the role of RAFTK activation in platelets the effect of thrombin on RAFTK tyrosine phosphorylation was studied. Thrombin induced a dose and time dependent phosphorylation of RAFTK in platelets. Treatment of platelets with 0.05, 0.1 or 0.25 U/ml of thrombin induced a basal level of RAFTK phosphorylation similar to the resting or unstimulated platelets. An increase, but equal levels of RAFTK phophorylation was induced with 0.5 or 1 U/ml of thrombin, while 2 U/ml of thrombin induced highest levels of RAFTK phosphorylation. A time course of thrombin stimulation in platelets showed a rapid induction of
RAFTK phosphorylation. The resting or unstimulated platelets showed very low basal level of phosphorylation. Activation was observed as early as 10 seconds post- thrombin stimulation, reaching a maximum at 2 minutes and tapering off by 10 minutes. These results showed that thrombin stimulation of platelets induces RAFTK phosphorylation in a time and concentration dependent manner.
RAFTK is an endogenous substrate for Calpain.
During the course of platelet activation, agonist induced activation of calpain (Fox, J. E. B. et al. (1990) Blood 76, 2510-2519; Fox, J. E. et al. (1991) J. Biol. Chem. 266, 13289-13295; Saido, T. et al. (1993) J. Biol. Chem. 268, 7422-7426) and limited proteolysis of some specific substrates (Ando, Y. et al. (1987) Biochem. Biophys. Res. Commun. 144, 484-490; Tsujinaka, T. et al. (1982) Thromb.Res. 28, 149-156; Oda, A. et al. (1993) J. Biol. Chem. 268, 12603-12608; Frangioni, J. V. et al. (1993) EMBO J. 12, 4843-4856) has been reported. Calpain constitutes most of the calcium dependent protease activity in platelets (Fox, J. E. B. et al. (1990) Blood 16, 2510-2519; Oda, A. et al. (1993) J. Biol. Chem. 268, 12603-12608). Thrombin is one of the agonists that causes activation of calpain in platelets.
Despite the use of equal number of platelets (5 X 10 /ml) for immunoprecipitations, a dose and time dependent decrease in RAFTK protein levels after thrombin stimulation was consistently observed. The decrease in the protein levels could be due to protein degradation or protein processing. Since RAFTK undergoes processing upon thrombin stimulation, an examination was performed to determine if calpain is involved in this process by using a specific membrane permeable calpain inhibitor, calpeptin (Thujinaka, T. et al. (1988) Biochem. Biophys. Res. Commun. 153, 1201-1208). When platelets were activated by thrombin, no differences were seen in the levels of RAFTK phosphorylation between calpeptin pretreated or thrombin alone treated platelets. There was no detectable phosphorylation in untreated or resting platelets. However, when RAFTK protein levels were examined on the same immunoblot, thrombin treated sample showed cleavage of RAFTK where as calpeptin treated platelets showed a complete blockage in RAFTK degradation. The level of the RAFTK protein in calpeptin treated platelets was equal to the level in the resting or unstimulated platelets. Furthermore, RAFTK processing was observed in a time dependent manner in response to the pharmacological activator of calpain, A23187, and to the physiological activator of calpain collagen. The characteristics of inhibition of degradation of RAFTK were consistent with the involvement of calcium dependent neutral cysteine protease, since degradation of RAFTK occurred at neutral pH and was inhibited by cysteine protease inhibitor, calpeptin. These results provide evidence that agonist induced RAFTK processing is mediated through the activation of calpain.
RAFTK phosphorylation is independent of aggregation and occurs early, during platelet shape change.
The earliest platelet response induced by physiological agonists involves a change in shape from flat discs into compact spheres followed by secretion of granular contents. The later phase of platelet response is aggregation when large platelet aggregates are formed. Since RAFTK phosphorylation is induced early (10 seconds) after thrombin stimulation, it was investigated if aggregation is a prerequisite for
RAFTK phosphorylation. In order to prevent aggregation, platelets were activated by thrombin in the absence of stirring. A time course of thrombin induced platelets showed that RAFTK is rapidly phosphorylated as early as 10 seconds in the presence or absence of stirring (aggregation). However, the signal declined faster upon stirring, where as it persisted longer in the absence of stirring (10 min). The levels of RAFTK protein remained equal in the absence of stirring and the levels decreased only in the presence of stirring, indicating that RAFTK cleavage is dependent on aggregation, while RAFTK phosphorylation does not require aggregation. However some aggregation can occur in the absence of stirring because of the close proximity of the platelets (5 X 10 8/ml). Therefore, in order to further confirm that RAFTK phosphorylation does not require aggregation, platelets were pretreated with an aggregation inhibitor, RDGS tetrapeptide, before activation by an agonist. Treatment with RGDS peptide allows shape change but prevents aggregation by blocking the interaction of fibrinogen with the integrin GpIIb/IIIa. Addition of thrombin to platelets pretreated with increasing concentrations of RGDS or RGES (mock) peptides showed no change in the levels of tyrosine phosphorylation of RAFTK. Thus, these results confirm that RAFTK phosphorylation does not require aggregation and it occurs during platelet shape change. Furthermore, consistent with previous findings, proteolytic processing of RAFTK was inhibited by RGDS treatment (absence of aggregation), but it was not inhibited when platelets were treated by RGES (presence of aggregation) or with thrombin alone. The phosphorylation of RAFTK correlated well with an early wave of tyrosine phosphorylation especially of proteins pp60 src and pp72 s k (Clark, E. A., and Brugge, J. S. (1993) Mol. Cell. Biol. 13, 1863-1871 ; Clark, E.A. et al. (1994) J.Biol.Chem. 269, 288859-28864), but it precedes the wave of tyrosine phosphorylation of its family member, pp 125 ^ AK known to be dependent on platelet aggregation (Clark, E. A. et al. (1994) J.Biol.Chem. 269, 288859-28864).
Activation oi RAFTK is not dependent on the integrin, GplIb/IIIa.
GplIb/IIIa is a major integrin receptor which plays an important role in adhesive events critical in clot formation by binding to fibrinogen and von Willebrand factor matrix proteins (Fox, J. E. B. et al. (1993) J. Biol. Chem. 268, 25973-25984). Activation of FAK was found to be mediated through the integrin GplIb/IIIa (Lipfert, L. et al. (1992) J. Cell Biol. 1 19, 905-912). Since RAFTK is a member of FAK subfamily, whether RAFTK and FAK have similar mechanisms of regulation was investigated. Tyrosine phosphorylation of RAFTK was studied under conditions that specifically induce or inhibit fibrinogen binding to this receptor. The monoclonal antibody 7E3 binds to GplIb/IIIa and blocks fibrinogen binding (Coller, B. S. et al. (1989) Circulation 80, 1766-1774). Incubation of platelets with 7E3 for 20 minutes prior to stirring, followed by addition of thrombin did not inhibit tyrosine phosphorylation of RAFTK while tyrosine phosphorylation of FAK was inhibited under the same conditions. Pretreatment with a (control) monoclonal antibody 6D1 , specific for collagen receptor GpIa IIb did not alter thrombin induced phosphorylation of RAFTK or FAK. Preincubation of platelets with 7E3, 6D1 or buffer alone without thrombin stimulation showed no phosphorylation of RAFTK or FAK. These results showed that phosphorylation of RAFTK was not dependent either on fibrinogen binding to GplIb/IIIa or platelet aggregation, and therefore, the phosphorylation of RAFTK in platelets is not solely regulated through ligand occupancy of the integrin GplIb/IIIa. Furthermore it is interesting to note that preincubation with 7E3 plus thrombin stimulation, but not 6D1 prevented proteolytic processing of RAFTK. These results indicate that RAFTK phosphorylation is not dependent on GplIb/IIIa, but the proteolytic processing of RAFTK is dependent GplIb/IIIa. To further confirm that phosphorylation of RAFTK is not dependent on the activation (crosslinking) of GplIb/IIIa, fibrinogen binding to the stirred platelets was initiated by an anti-B3 antibody Fab fragment (anti-LIBS6), in the absence of an agonist. This antibody renders GplIb/IIIa competent to bind fibrinogen, but it does not itself cause detectable platelet activation (Huang, M.-M. et al. (1993) J. Cell Biol. 122, 473-483). RAFTK was not phosphorylated when platelets were stirred or unstirred with anti-LIBS6 and fibrinogen, in platelets treated with fibrinogen alone or in resting platelets despite containing the protein. RAFTK was however activated when platelets were treated with thrombin (positive contol). Thus these studies indicate that activation of RAFTK does not require crosslinking of GplIb/IIIa receptors on the platelet surface.
RAFTK activation is regulated by actin polymerization.
Thrombin stimulation in platelets leads to actin polymerization and causes dramatic rearrangements of the cytoskeleton thereby inducing the formation of focal- contact like areas (Furman, M. I. et al. (1993) Thromb. Haemostasis 70, 229-232). It was also examined whether phosphorylation of RAFTK was affected by agents that disrupt the actin cytoskeleton. Platelets pretreated with cytochalasin D block agonist induced actin polymerization but do not inhibit platelet aggregation. Pretreatment with cytochalasin D inhibited tyrosine phosphorylation of RAFTK in thrombin stimulated platelets. However the level of inhibition was not 100%, suggesting that the actin-dependent cytoskeletal interactions effected partially phosphorylation of RAFTK. Furthermore proteolytic processsing of RAFTK is not inhibited in cytochalasin D treated platelets.
RAFTK is activated by multiple platelet agonists.
RAFTK has been found to be activated by thrombin, calcium ionophore, collagen, and the combination of ADP plus epinepherine.
EXAMPLE 5: Identification of a Novel Signal Transduction Pathway in
Human Macrophages Mediated by the Related Adhesion Focal Tyrosine Kinase (RAFTK)
RA.FTK, a novel non-receptor protein kinase, has been shown to be involved in focal adhesion signal transduction pathways in neuronal PC 12, megakaryocytes and platelets. Because focal adhesions may modulate cytoskeleton function and thereby alter phagocytosis, cell migration, and adhesion in macrophages, the role of RAFTK signaling in these cells was investigated. RAFTK was abundantly expressed in THP1 monocytic cells as well as primary alveolar and peripheral blood derived macrophages. Phorbol diester stimulation of THP1 cells increased tyrosine phosphorylation of RAFTK by 2.5 minutes. Similar increases in phosphorylation were detected within 1 minute after CSF-1/MCSF stimulation. While RAFTK was phosphorylated with similar kinetics in peripheral blood derived macrophages, alveolar macrophages showed high constitutive phosphorylation levels which decreased over increased time after treatment with either PMA or CSF-1/M-CSF. Immunoprecipitation analysis identified constitutive associations between RAFTK and the cytoskeleton protein paxillin and the signaling molecule PI-3 kinase. However, both these molecules appear disassociate from RAFTK at the peak time of phosphorylation after PMA or CSF-1/M-CSF stimulation. RAFTK was also found to preferentially associate with the amino terminus-SH3 domain of the Grb2 adaptor protein in THPl cells. Furthermore the CSF-1/M-CSF receptor ftns and RAFTK appear to associate in response to CSF-1/M-CSF treatment of THPl cells. These data demonstrate that RAFTK participates in macrophage signal transduction pathways mediated by CSF-1/M-CSF.
With this background, it was investigated whether RAFTK was expressed in human monocyte-macrophages and whether it participated in CSF-1/M-CSF induced signaling. In parallel, the effects of treatment of monocyte-macrophages with the known chemical activator phorbol diester PMA were tested. It was observed that RAFTK was robustly expressed in both peripheral blood derived monocyte- macrophages as well as tissue derived alveolar macrophages. Moreover, it was activated upon treatment of mononuclear phagocytes with CSF-1/M-CSF or PMA and associated with other signaling molecules and the cytoskeletal protein paxillin. These observations provide new data on CSF-1/M-CSF signaling and molecules which may contribute to focal adhesion formation in cells of this lineage.
The following materials and methods were used to identify the novel signal transduction in human macrophages mediated by RAFTK:
Cells and cell cultures
The permanent human monocyte-macrophage cell line THP-1 was obtained from the American Type Culture Collection (ATCC) and shown to be mycoplasma free prior to expansion in culture. The cells were carried in Dulbecco's Modified Eagel's Medium (DMEM) supplemented with 10% fetal calf serum (FCS), 2mM glutamine, sodium pyruvate, non-essential amino acids and 50μg/ml penicillin and 50ug/ml streptomycin. Primary human peripheral blood monocyte-macrophages (MMs) were obtained by phlebotomy of normal volunteers after obtaining informed consent and isolated by ficoll hypaque density centrifugation as previously described (Boyum, A. (1968) Scand. J. Lab Invest. 21 , (Suppl. 97). Mms plated on plastic dishes for 24 hours were shaken at 200 RPM for 15 minutes and washed 3X with HBSS to remove non-adherent cells. The adherent population of cells used for subsequent studies as previously described (Kharbanda, S. et al. (1995) Proc. Nat. Acad. Sci. USA, 92, 6132-6136). Alveolar macrophages (AMs) were obtained by bronchoalveolar lavage of normal non-smoking volunteers after informed consent was obtained and using standard procedures.
Reagents and materials
Phorbol 12-myristate 13-acetate (PMA) was obtained from Sigma (St. Louis, MO) and dissolved in dimethyl sulfoxide and stored at -20°C until use. Recombinant human CSF-1/M-CSF was kindly provided by Genetics Institute.
The monoclonal antibodies against phosphotyrosine (4G10), PI-3 kinase p85 regulatory subunit, Grb2, and paxillin and the polyclonal rabbit antisera antibody to the human c-fms receptor were obtained from Upstate Biotechnology. Specific polyclonal antibodies to RAFTK were generated by immunizing New Zealand White rabbits with a bacterially expressed fusion protein consisting of GST and the carboxy terminus (amino acids 681-1009) of human RAFTK cDN A subcloned into the pGEX- 2T expression vector as described (Avraham, S. et al. (1995) J. Biol. Chem. 270, 27742-27751 ). High titer RAFTK antiserum (R-4250)) was employed in subsequent experiments and was shown to be specific and not cross reactive with FAK in prior experiments (Avraham, S. et al. (1995) J. Biol. Chem. 270, 27742-27751).
The Grb2 and PI-3 kinase GST fusion proteins were obtained from Santa Cruz Biotechnology. Electrophoresis reagents and nitrocellulose membranes were obtained from Bio-Rad Laboratories (Hercules, CA). All other chemicals including the protease inhibitors pepstatin, antipain, chymostatin, leupeptin, aprotinin, and alpha 1 antitrypsin were obtained from Sigma (St. Louis, MO). Because endotoxin is known to alter monocyte-macrophage function, all media and reagents were shown to be free of endotoxin contamination by Limulus endotoxinassay (Sigma Chemical) prior to using in cell cultures.
Signal transduction studies
Cells were initially starved in DMEM with 0.5% FCS and stimulated in HBSS at density of 5 x 106/ml for varying time periods at 37°C with PMA (2nM-200nM/mI) or CSF-l/M-CSF(10U-10,000U/ml). After stimulation 20 x 106 cells were microfuged for 10 seconds and lysed in 1 ml of ice cold modified RIPA buffer (50mM Tris-HCl, pH 7.4, 1% NP-40, 0.25% sodium deoxycholate, 150mM NaCl, ImM PMSF, 10 ug/ml of pepstatin, antipain, chymostatin, leupeptin, aprotinin, alpha 1 antitrypsin, lOmM sodium fluoride and 10 mM sodium pyrophosphate). Total cell lysates (TCL) were clarified by centrifugation at 10,000 x g for 10 min. Protein concentrations were determined by protein assay (BioRad Laboratories). Immunoprecipitation and Western blot analysis
For immunoprecipitation studies, identical amounts of protein from each sample were clarified by incubation with protein A-Sepharose CL-4B (Pharmacia Biotech) for 1 h at 4°C. Following the removal of protein A-Sepharose by brief centrifugation, the solution was incubated with different primary antibodies as detailed below for each experiment for 4 h or overnight at 4°C. Immunoprecipitations of the antibody-antigen complexes were performed by incubation for 2 h at 4°C with 75 μl of protein A-Sepharose (10% suspension). Non-specific bound proteins were removed by washing the Sepharose beads three times with modified RIPA buffer and one time with Phosphate buffered saline (PBS). Bound proteins were solubilized in 30 μl of 2 X Laemmli buffer and further analyzed by immunoblotting. Samples were separated on 7.5% SDS-PAGE and then transferred to nitrocellulose membranes. The membranes were blocked with 5% non-fat milk protein and probed with primary antibody for 3 h at RT or 4°C overnight. Immunoreactive bands were visualized using FIRP-conjugated secondary antibody and the enhanced chemiluminescent (ECL) system (Amersham Coφ., Arlington Heights, IL). Blots were stripped (2% SDS, 62.5mM Tris, lOOmM Beta Mercaptoethanol) for 30 minutes at 50oC and washed in TBS-T for 60 minutes before blocking and re-probing with primary antibodies.
GST-fusion protein binding studies
GST-fusion protein Grb2-SH3 N-terminal domain, Grb2-SH3 C-terminal domain, Grb2-SH2 domain, and PI-3 Kinase-SH3 domain of the p85 regulatory subunit were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). For the binding experiments, 1 mg of cell lysate was mixed with 5 g of GST-fusion protein and incubated for 1 h at 4°C on a rotatory shaker. 50 μl of glutathione Sepharose 4B beads (Pharmacia Biotech) were added to preabsorb the complex. Following incubation for 3 h at 4°C on a rotatory shaker, the beads were centrifuged and washed three times with modified RIPA buffer. The bound proteins were eluted by boiling in Laemmli sample buffer and subjected to SDS-PAGE on 7.5% gel and Western Blot analysis.
RAFTK is expressed and phosphorylated in human monocyte-macrophages.
To further characterize signaling pathways in human MMs involved in their growth, differentiation and function, the permanent monocyte-macrophage cell line THP-1 as well as primary peripheral blood derived MMs or AMs were used as a model. Analysis by immunoprecipitation revealed abundant RAFTK protein in these cells. There appeared to be low levels of constitutive phosphorylation of RAFTK in these cells under unstimulated culture conditions.
Then it was addressed whether various stimuli associated with mononuclear phagocyte activation modulated RAFTK phosphorylation. Preliminary experiments determined that 1 OOOU/ml was opiti al for CSF- 1 /M-CSF and 20nM/ml was optimal for PMA stimulation of RAFTK in THPl cells and primary macrophage cultures. An increase in the tyrosine phosphorylation of RAFTK was specifically observed in THPl cells following PMA and CSF- 1 /M-CSF treatment. The membrane was then stripped and reprobed with anti-RAFTK antibody to confirm that equivalent amounts of RAFTK were loaded in each lane.
To determine the time course of tyrosine phosphorylation of RAFTK, THPl cells were stimulated with PMA or CSF- 1 /M-CSF. Phosphotyrosine levels in RAFTK immunoprecipitates peaked at 2.5 minutes and declined by 5 minutes. However, phosphotyrosine levels again increase by 7.5 minutes and decline after 10 minutes. There were not any changes in RAFTK protein levels to explain these fluctuations in phophotyrosine levels. The membrane was then stripped and reprobed with anti- RAFTK antibody to confirm that equivalent amounts of RAFTK were loaded in each lane.
CSF-1/M-CSF treatment of THPl cells resulted in maximum tyrosine phosphorylation of RAFTK within 0.5 minutes to 1 minute which declined by 2.5 minutes. Similar to the case following PMA stimulation, the phosphotyrosine levels on RAFTK also appeared to increase by 10 minutes. Longer stimulation times confirmed the fluctuation of RAFTK tyrosine phosphorylation.
CSF- 1 /M-CSF stimulation of MM resulted in peak tyrosine phosphorylation on RAFTK by 1 minute which gradually decreased over time. RAFTK in AM appeared to have a high constitutive degree of phosphorylation which, in response to CSF- 1 /M-CSF stimulation, increased slightly by 1 minute and gradually decreased over time. Anti-RAFTK immunoblotting of RAFTK immunoprecipitates showed the ~120Kd phosphoprotein corresponded to the RAFTK protein. Depending on the resolution of the gels, RAFTK was seen to migrate either as a single band or as a doublet.
RAFTK associates with the signaling molecules PI-3 kinase and Grb-2. Because RAFTK, like FAK, acts as a platform kinase site for the coalescence of signaling and adaptor molecules at sites of focal adhesions, RAFTK immunoblots were examined for associating co-precipitating proteins. A specific association of RAFTK with PI-3 kinase, an important enzyme in modulating of phosphoinositol signaling (Auger, K. R., and Cantley, L. C. (1991) Cancer Cells 3, 263-270) was observed. This association was confirmed by incubating THPl cell lysates using a PI- 3 kinase GST-fusion protein, immunoprecipitated with glutathione-conjugated beads and detecting the bound proteins by anύ-RAFTK immunoblotting. Time course studies using either CSF- 1 /M-CSF or PMA treatment demonstrated that the PI-3 kinase/RAFTK association fluctuates. While the PI-3 kinase signal appears to weaken after one minute its association with RAFTK stengthens after 5 minutes of stimulation. A similar pattern is detected with longer stimulation times.
Because RAFTK has been shown to associate with various SH2 and SH3 domain-containing proteins, the ability of RAFTK to form in vitro complexes with the adaptor molecule Grb2 was then examined. Grb2 is generally capable of associating with signaling molecules either through one of its two SH3 or through its SH2 domain. Studies were thus performed to determine which of the Grb2 regions may mediate its interaction with RAFTK. THPl cell lysates incubated with GST fusion proteins corresponding to the amino terminus SH3, the SH2 and the carboxyl terminus SH3 were immunoprecipitated with glutathione-conjugated beads and the bound proteins were detected by anti-RAFTK immunoblotting. RAFTK strongly associates with the Grb2 amino terminus-SH3 domain. There was some intermediate interactions between the SH2 domain and RAFTK molecule in CSF- 1 /M-CSF stimulated THPl cells.
RAFTK associates with the c-fms receptor upon mononuclear phagocyte cell activation with CSF-1/M-CSF.
Because CSF- 1 /M-CSF stimulation of THPl cells or primary macrophages appeared to have very rapid effects on RAFTK phosphorylation, whether RAFTK may directly associate with the c-fms receptor was examined. A specific association of RAFTK with the c-fms receptor upon CSF-1/M-CSF treatment of cells was observed. Associations were detected in reciprocal blotting experiments of THPl cell lysates either immunoprecipitated with RAFTK followed by c-fms immunoblot or c-fms immunoprecipitation followed by RAFTK immunoblot. No association was detected between these molecules in unstimulated or PMA stimulated THPl cells.
RAFTK associates with the cytoskeletal protein paxillin in mononculear phagocyte.
Following the observation that RAFTK may be coimmunoprecipitated with molecules previously characterized as components of MM signaling pathways, it was desirable to determine whether certain cytoskeletal molecules in such cells also associate with this novel kinase. Using specific antibodies to RAFTK or paxillin, an important molecule involved in focal adhesions, a clear association of these two molecules in THPl cells was found. Similar to PI-3 kinase, the strength of paxillin's constitutive association with RAFTK transiently fluctuated after 1 minute stimulation by either CSF- 1 /M-CSF or PMA stimulation. The paxillin RAFTK association appeared to return to constitutive levels after 5 minutes stimulation.
These studies indicate that human mononculear phagocytes, including peripheral blood derived MMs and tissue derived AMs, express RAFTK, a recently identified signaling molecule that is a member of the FAK family. RAFTK appeared to participate in certain previously described signaling pathways following activation of these cells. Treatment with CSF- 1 /M-CSF and phosphorylation of the cognate c- fms receptor revealed robust phosphorylation of RAFTK in both the model THP-1 cell line as well as in primary macrophages. Parallel studies using the chemical activator PMA also revealed phosphorylation of RAFTK in macrophages in a time and concentration dependent manner. The phosphorylation RAFTK was found to result in association with several well characterized components of cell signal pathways, including the enzyme PI-3 kinase and the adaptor molecule Grb2. Grb2 is an adaptor protein that has the capacity to link with a number of kinases and substrates and functions to facilitate signaling through creation of physical associations of such partners in enzymatic reactions (Pawson, T. (1995) Nature 373, 573-580). PI-3 kinase appears to modulate phosphoinositol metabolism in a variety of cell types, including mononuclear phagocytes, and appears to be an important component of tyrosine kinase-regulated signaling pathways that lead to cell proliferation (Gold, M. R. et al. (1994) J. Biol. Chem. 269, 5403-5412). CSF- 1 /M-CSF has been reported to induce the direct association of the p85a subunit of PI-3 kinase with the SH2 domain of Grb2 and Grb2-Sos complexes, supporting its role upstream of the Ras signaling pathway in monocytes (Saleem, A., et al. (1995) J. Biol Chem. 270, 10380-10388). In addition, PI-3 kinase activation and the production of its metabolites has been suggested to be an upstream activator of calcium-independent form of PKC (Herrera-Velit, P. and Reiner, N. E. ( 1996) J. Immunology 156, 1157- 1 165).
These observations on RAFTK show that this recently identified signaling molecule plays a variety of roles in transduction of MM signaling. It provides a missing link in prior studies of CSF- 1 /M-CSF induced integrin expression and the subsequent formation of focal adhesion contacts, as reported by De Nichilio and Yamada (De Nichilo, M. D. and Yamada, K. M. (1996) J. Biol. Chem. 271 , 1 1016- 11022). Taken together, the data presented herein contributes to the model of CSF- 1 /M-CSF mediated signaling in mononuclear phagocytes. c-Fms has been reported to form associations with She, Grb2 and Sosl in myeloid cells suggesting c-Fms signals throught the Ras pathway (Liobin, M. N. et al. ( 1994) Molecular and Cellular Biology 14, 5682-5691). The finding that RAFTK associated with c-Fms in CSF-1/M-CSF stimulated THPl cells shows that c-Fms also signals through focal adhesion contacts in concert with intergrin binding. Thus, macrophages, like megakaryocytes, prominently utilize RAFTK in cytokine mediated pathways of activation that are linked to focal contact formation. The confluence of RAFTK and other kinases and cytoskeletal molecules provides a platform for the interactions of signaling molecules and adaptor proteins that regulate cell moφhology to finely control certain components of the immune response such as adhesion or migration.
EXAMPLE 6: RAFTK, a Novel Member of the Focal Adhesion Kinase Family, Participates in T-Cell Receptor Signal
Transduction
It has been found that RAFTK is constitutively expressed in human T-cells and is rapidly phosphorylated upon the activation of the T-cell receptor (TCR) for antigen. This activation results in an increase in the association of RAFTK with the Src cytoplasmic tyrosine kinase Fyn. RAFTK also associates with the SH2 domain of Grb2 and with the cytoskeletal protein paxillin. The tyrosine phosphorylation of RAFTK following T-cell receptor-mediated stimulation was reduced by the pretreatment of cells with cytochalasin D, indicating the role of the cytoskeleton in this process. These observations show that RAFTK participates in T-cell receptor signaling and acts to link signals from the cell surface to the cytoskeleton and thereby effect the host immune response.
It was observed that RAFTK is phosphorylated in response to the activation of certain integrins in megakaryocytes (Li, J. et al. (1996) Blood 88, 417-428) and B- lymphocytes. The induced phosphorylation of RAFTK via calcium-mediated ion channel pathways was shown first in PC- 12 pheochro ocytoma cells (Lev, S. et al. (1995) Nature 376, 737-745) and subsequently in megakaryocytes.
Thus, RAFTK is expressed in human T-lymphocytes and participates in signaling events triggered by the ligation of the TCR CD3 complex. Several of the interacting molecules that associate with RAFTK in human T-cells, including the cytoskeletal protein paxillin have been characterized. The following materials and methods were used to determine the participation of RAFTK in T-cell receptor signal transduction:
Cells and cell cultures The permanent human T-cell lines Jurkat and H9 were obtained from the
American Type Culture Collection (ATCC) and shown to be mycoplasma-free prior to their expansion in culture. The cells were carried in Dulbecco's Modified Eagle's Medium (DMEM) with 10% fetal calf serum (FCS), 2 mM glutamine, 50 g/mL penicillin and 50 g/ml streptomycin. Primary human peripheral blood lymphocytes (PBLs) were obtained by phlebotomy of normal volunteers after obtaining their informed consent and isolated by ficoll hypaque density centrifugation as previously described (Boyum, A. (1968) Scand. J. Lab Invest. 21 , (Suppl. 97)). The anti-CD3 producing hybridoma (OKT-3) was obtained from ATCC and grown in Iscove's modified Dulbecco's medium with 20% FCS. For antibody production, cells were grown in serum-free and protein-free hybridoma medium (Sigma, St. Louis, MO) containing Nutridoma-HU 1% (Boehringer Mannheim, Indianapolis, IN).
Reagents and materials
The lectin phytohemagglutinin (PHA) was obtained from Pharmacia Biotech (Piscataway, NJ). The nitrocellulose membrane was obtained from Bio-Rad
Laboratories (Hercules, CA). The anti-phosphotyrosine monoclonal antibody (4G10, IgG2a) was obtained from Upstate Biotechnology Inc. (Lake Placid, NY). The anti- CD3 antibody X35 was obtained from Immunotech (Marseille, France), and OKT-3 was purified from OKT-3 producing hybridoma supernatants on protein A-Sepharose columns. Antibodies to Fyn were obtained from Santa Cruz Biotechnology (Santa Cruz, CA) and Transduction Laboratories (Lexington, KY). Anti-paxillin antibody was obtained from ICN Biomedical Inc. (Costa Mesa, CA). Specific polyclonal antibodies to RAFTK were generated by immunizing New Zealand White rabbits with a bacterially expressed fusion protein consisting of GST and the carboxy terminus (amino acids 681 -1009) of the human RAFTK cDNA subcloned into the pGEX-2T expression vector as described (Li, J. et al. ( 1996) Blood 88, 417-428). The sera were titered against the GST-RAFTK C-terminus fusion protein by ELISA and the serum (R-4250) which revealed the highest titer (1 :256,000) was employed in the subsequent experiments. This antiserum was shown to be specific and not crossreactive with FAK in prior experiments (Li, J. et al. (1996) Blood 88, 417-428). Electrophoresis reagents were obtained from Bio-Rad Laboratories (Hercules, CA). The protease inhibitors leupeptin, aprotinin, and alpha 1 antitrypsin and all other reagents were obtained from Sigma Co. (St. Louis, MO).
Stimulation of cells
Cells were washed twice with Hanks Balanced Salt Solution, Gibco (Grand Island, NY) and resuspended at 5 x 10^ cells/ml in DMEM medium. Cells were stimulated with either PHA (10 g/ml) or CD3 antibodies X35 (10 g/ml) or OKT-3 (10 g/ml) at 37°C for various time periods. In some experiments, cells were pretreated with cytochalasin D (2 m) for 60 min at 37°C before stimulation. After stimulation, 20 x lθ6 cells were microfuged for 10 seconds and lysed in 1 ml of modified RIPA buffer (50 mM Tris-HCl, pH 7.4, 1% NP-40. 0.25% sodium deoxycholate, 150 mM NaCl, 1 mM PMSF, 10 g/ml of aprotinin, leupeptin and pepstatin, 10 mM sodium vanadate, 10 mM sodium fluoride and 10 mM sodium pyrophosphate). Total cell lysates (TCL) were clarified by centrifugation at 10,000 x g for 10 min. Protein concentrations were determined by protein assay (Bio-Rad Laboratories).
Immunoprecipitation and Western blot analysis
For immunoprecipitation studies, identical amounts of protein from each sample were clarified by incubation with protein A-Sepharose CL-4B (Pharmacia Biotech) for 1 h at 4°C. Following the removal of protein A-Sepharose by brief centrifugation, the solution was incubated with different primary antibodies as detailed below for each experiment for 4 h or overnight at 4°C. Immunoprecipitations of the antibody-antigen complexes were performed by incubation for 2 h at 4°C with 75μl of protein A-Sepharose (10% suspension). Non-specific bound proteins were removed by washing the Sepharose beads three times with modified RIPA buffer and one time with Phosphate buffered saline (PBS). Bound proteins were solubilized in 40 μl of 2 X Laemmli buffer and further analyzed by immunoblotting. Samples were separated on 7.5% SDS-PAGE and then transferred to nitrocellulose membranes. The membranes were blocked with 5% non-fat milk protein and probed with primary antibody for 3 h at room temperature or 4°C overnight. Immunoreactive bands were visualized using HRP-conjugated secondary antibody and the enhanced chemiluminescent (ECL) system (Amersham Coφ., Arlington Heights, IL).
GST-fusion protein binding studies
GST-fusion protein Grb2-SH3 N-terminal domain, Grb2-SH3 C-terminal domain, Grb2-SH2 domain, and Fyn-SH2 and -SH3 domains were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). For the binding experiments, 1 mg of cell lysate was mixed with 5 g of GST-fusion protein and incubated for 1 h at 4°C on a rotatory shaker. 50 μl of glutathione Sepharose 4B beads (Pharmacia Biotech) were added to preabsorb the complex. Following incubation for 3 h at 4°C on a rotatory shaker, the beads were centrifuged and washed three times with modified RIPA buffer. The bound proteins were eluted by boiling in Laemmli sample buffer and subjected to SDS-PAGE on 7.5% gel and Western Blot analysis.
RAFTK is expressed in human T-lymphocytes and is phosphorylated upon T-cell activation.
To further characterize signaling pathways in human T-cells involved in the immune response, Two permanent T-cell lines, Jurkat and 119, were utilized as well as primary circulating PBLs. Analysis by immunoblot or immunoprecipitation revealed abundant RAFTK protein in these cells. The stimulation of human T-cell lines with T-cell receptor ligation induces the tyrosine phosphorylation of a phosphoprotein around 1 15 Kd (Motto, D. G. et al. (1994) Journal of Biological Chemistry 269, 21608-21613; Hsi, E. D. et al. (1988) The Journal of Biological Chemistry 264, 10836-10842). It was investigated whether various stimuli associated with such T-cell activation modulated the phosphorylation of RAFTK, which has a deduced molecular weight of -120 Kd. An increase in the tyrosine phosphorylation of RAFTK could be specifically observed in the T-cell lines Jurkat or H9 following T-cell receptor ligation or treatment with the lectin PHA. The membrane was then stripped and reprobed with anti-RAFTK antibody to confirm that equivalent amounts of RAFTK were loaded in each lane. Stimulation of primary circulating PBLs with anti-T-cell receptor antibody also induced an increase in the tyrosine phosphorylation of RAFTK.
To determine the time course of tyrosine phosphorylation of RAFTK, Jurkat cells were stimulated with anti-T-cell receptor antibody X35 or OKT-3 or with the lectin PHA. Ligation of the TCR/CD3 by monoclonal antibody X35 or OKT-3 reached a maximum by 2.5-5 min, and declined thereafter. PHA stimulation resulted in an increased tyrosine phosphorylation by 5 min which declined slightly thereafter with substantial phosphorylation still detectable at 20 min. Anti-RAFTK immunoblotting of anti-RAFTK immunoprecipitates showed that the -1 15 Kd phosphotyrosine polypeptide corresponds to the RAFTK protein. Depending on the resolution of the gels, RAFTK was seen to migrate either as a single band or as a doublet. RAFTK associates with the signaling molecules Fyn and Grb-2.
To further characterize the role that RAFTK plays in T-cell signaling following activation via TCR/CD3 ligation, as well as the other stimulatory pathways activated by the lectin PHA, coimmunoprecipitation studies followed by immunoblotting were performed. A specific association of RAFTK with Fyn, a src family kinase which is known to be capable of associating with TCR was observed. A small fraction of Fyn was readily detected as associating with RAFTK prior to the TCR/CD3 activation of Jurkat cells and this association increased following stimulation.
The ability of RAFTK to form in vitro complexes with various SH2 and SH3 domain-containing proteins was then examined. For this puφose, GST-fusion proteins were added to the lysates of the stimulated Jurkat cells, the complexes were immunoprecipitated with glutathione-conjugated beads and the bound proteins were detected by anti-RAFTK immunoblotting. Sepharose beads containing the GST-Grb2- SH2 domain and the GST-Fyn-SH2 domain bound RAFTK from the activated T-cell lysates. Beads containing only GST, GST-N-terminal Grb2-SH3, GST-C-terminal Grb2-SH3 or GST-Fyn-SH3 failed to bind RAFTK, indicating the specificity of these interactions. These data clearly show that the stable interaction between RAFTK and the SH2 domain of Fyn can be mimicked in vitro and provide additional evidence that the SH2 domain may be the principal determinant of RAFTK binding to Fyn in vivo.
RAFTK associates with the cytoskeletal protein paxillin.
Following the observation that RAFTK may be coimmunoprecipitated with molecules previously characterized as components of the TCR signaling pathways, it was desirable to determine whether certain cytoskeletal molecules in T-cells may also associate with this novel kinase. Using specific antibodies to RAFTK or paxillin, a constitutive association of these two molecules was found.
To further investigate the cytoskeletal dependence of the tyrosine phosphorylation of RAFTK, Jurkat cells, prior to TCR stimulation, were pre-incubated for 60 min at 37°C with media alone or with cytochalasin D. The phosphorylation of RAFTK was reduced following the cytochalasin D treatment of cells.
These studies show that RAFTK, a novel signaling molecule that appears to be a member of the FAK family, is present in human T-Iymphocytes and participates in signaling pathways following T-cell activation. Following the ligation of the TCR/CD3 there was a robust phosphorylation of RAFTK in both the model permanent T-cell lines, Jurkat and H9, as well as in primary PBLs. Parallel studies using other T-cell activators, specifically the lectin PHA, revealed a similar activation of RAFTK in a time and concentration dependent manner. It is noteworthy that following activation, RAFTK was found to be associated with several well-characterized components of TCR/CD3 signaling pathways, including Fyn and Grb2. Fyn is known to be capable of associating with the TCR/CD3 complex, and is believed to play an important role in initiating the changes in phosphorylation that lead to further downstream signaling. This role has been most clearly demonstrated in studies showing the impaired development of CD4+CD8+ thymocytes from double mutant mice rendered null for Fyn and FAK through homologous recombination (Kanazawa, S. et al. (1996) Blood 87, 865-870). Also, transgenic thymocytes from mice overexpressing Fyn were hyperstimulatable, and overexpression of a catalytically inactive form of Fyn substantially inhibited TCR- mediated activation in otherwise normal thymocytes (Cooke, M. P. et al. (1991) Cell 65, 281 -291 ). Grb2 is a well-characterized adaptor molecule that seems capable of associating with a number of kinases and substrates and may also act to facilitate signaling through the enhancement of the physical association of such partners in enzymatic reactions (See, e.g., Li, N. et al. (1993) Nature 363, 85-88; Koch, C. A. et al. (1991) Science 252, 668-674; Pawson, T., and Gish, G. D. (1992) Cell 71, 359- 362). She and Grb2 have also been shown to play important roles in T-cell signaling (Motto, D. G. et al. (1994) Journal of Biological Chemistry 269 , 21608-21613; Meisner, H. et al. (1995) Molecular & Cellular Biology 15, 3571-3578; Fukazawa, T. et al. (1995) Journal of Biological Chemistry 270, 19141-19150).
These observations on RAFTK show that this novel signaling molecule can play a variety of roles in the transduction of T-cell signaling. The confluence of signaling molecules and cytoskeletal components provides a platform for the regulated interactions of kinases and substrates and lead to important changes in cell moφhology that enable other aspects of the immune response such as adhesion or migration. Analogy with work in adherent mesenchymal cells shows that the formation of the so-called focal adhesions facilitate the creation of these platforms and mediate cell attachment and transduction of signals (See, e.g., Richardson, A. and Parsons, J. T. (1995) Bioessays 17, 229; Schaller, M. D. et al. (1992) Proceedings of the National Academy of Sciences of the United States of America 89, 5192-5196; Clark, E. A. and Brugge, J. S. (1995) Science 268, 233-239). Relatively little is known about similar mechanisms in hematopoietic cells like T-lymphocytes. Recently, another member of the FAK family, termed FAK B, was identified. Initial studies indicated that FAK B may associate with ZAP-70, an intracytoplasmic protein tyrosine kinase also capable of associating with TCR (Kanner, S. B. et al. (1994)
Proceedings of the National Academy of Sciences of the United States of America 91, 10484-10487). There is relatively limited information available on the convergence of protein tyrosine kinases and cytoskeletal elements in T-lymphocytes. Several T-cell surface structures, including CD1 la/CD 18 and CD44, associate with the cytoskeleton upon receptor cross-linking. Recently, the interaction of the chain of TCR with the actin cytoskeleton upon T-cell activation was demonstrated (Valitutti, S. et al. (1995)
Journal of Experimental Medicine 181, 577-584). These results revealed that RAFTK co-associates with paxillin, a major component of the cytoskeleton. Furthermore, the pre-treatment of cells with cytochalasin D results in the reduced tyrosine phosphorylation of RAFTK upon T-cell receptor activation. This response shows that RAFTK phosphorylation requires the formation of a cytoskeletal complex which provides a foundation for the interactions and compartmentalization of kinases and substrates.
EXAMPLE 7: Cytokine Signalling Through the Novel Tyrosine Kinase RAFTK in Kaposi's Sarcoma Cells
Considerable data indicate a role of endogenous and exogenous cytokines in the pathogenesis of Kaposi's sarcoma (KS). A number of growth factors inculding basic FGF, VEGF, oncostatin M (OSM), IL-6, and TNF-α have been reported to promote KS cell growth. A novel tyrosine kinase receptor, FLT-4, was found to be present on normal lymphatic endothelium and robustly expressed in KS cells. Moreover, the recently identified ligand VRP for the FLT-4 receptor results in signalling in KS cells. Signal transduction pathways following receptor engagement by these diverse cytokines that belong to different receptor families was studied. KS cells expressed a recently identified focal adhesion kinase termed RAFTK which is believed to coordinate surface signals from cytokine and integrin receptors with the cytoskeleton. RAFTK was phosphorylated in KS cells following treatment with b- FGF, OSM, IL-6, VEGF, VRP, or TNF-α. Following RAFTK activation by these cytokines, there was enhanced association of RAFTK with the cytoskeletal protein paxillin. This association appeared to be mediated through the C-terminal domain of RAFTK based on studies using GST-fusion proteins of different RAFTK domains. A novel surface receptor FLT-4 expressed on KS cells, as well as a novel intracytoplasmic tyrosine kinase RAFTK have been identified. Treatment with diverse cytokines previously reported to potentiate KS cell growth all led to phosphorylation of RAFTK and its association with the cytoskeletal protein paxillin. These observations suggest that inhibition of RAFTK may allow for disruption of a common pathway important in KS cell growth and could be clinically exploited as an anti- neoplastic strategy.
Kaposi's sarcoma (KS) is the most frequent neoplasm arising among patients with the acquired immune deficiency syndrome (AIDS). The cell of origin of the tumor is believed to be from lymphatic endothelium (Dictor, M. (1988) Lymphology. 21, 53-60; Dorfman, R. F. (1988) Lymphology. 21, 45-52). Etiological factors implicated in KS include the recently discovered human heφes virus 8 (HHV- 8)/Kaposi's sarcoma heφes virus (KSIIV) and TAT, the soluble transcriptional activator of HIV (See, e.g., Chang, Y. et al. ( 1994) Science. 266, 1865-1869; Zhong, W. et al. (1996) Proc. Natl. Acad. Sci. USA. 93, 6641 -6646; Huang, Y. Q. et al. (1996) J. Clin. Invest. 97, 2803-2806). Considerable data indicate a role of endogenous and exogenous cytokines in the pathogenesis of KS (See, e.g. , Ba, G. et al. (1992) J. Immunol. 149, 3727-3734; Buonaguro, L. et al. (1992) J Virol. 66. 7159- 7167; Cai, J., et al. (1994) Am. J. Pathol. 145, 74-79). Growth factors such as basic fibroblast growth factor (b-FGF) and vascular endothelial growth factor (VEGF) which are known to stimulate mitogenesis of certain types of endothelium, as well as oncostatin M, interleukin-6 (IL-6), and tumor necrosis factor alpha (TNF-a), which are elaborated during inflammatory conditions, have been implicated in promoting KS cell growth.
Defining the signal transduction pathways which may be utilized by cytokines which appear to stimulate KS growth provides an opportunity for rational and targeted therapeutic intervention against this neoplasm. One issue that is immediately apparent is that the cytokines described to date as promoting KS belong to distinctly different families as defined by their receptors. VEGF and b-FGF receptors are of the protein tyrosine kinase family, oncostatin M and IL-6 utilize a common gpl30 subunit, and TNF-a receptors are of the Fas/apoptosis CD95 family. Cognizant of this diversity, the signalling pathways triggered by cytokine treatment in permanent human KS cells in vitro have been characterized and a common molecule sought among the diverse pathways. KS cells express RAFTK.
In KS cells, treatment with cytokines of different families, including b-FGF, oncostatin M, IL-6, VEGF, and TNF-α, all led to phosphorylation of RAFTK. After cytokine treatment, RAFTK is found to associate with the cytoskeletal protein paxillin. This observation has been extended and focused on the tyrosine kinase receptor termed FLT-4, which has been found in fetal and adult lymphatic endothelium
(Kaipainen A. et al. (1995) Proc. Natl. Acad. Sci. USA. 92, 3566-3570; Kaipainen A. et al. (1993) J. Exp. Med. 178, 2077-2088; Pajusola K. et al. (1993) Oncogene. 8, 2931 -2937). KS cells express the FLT-4 receptor, and treatment with its newly discovered ligand called VEGF related protein (VRP or VEGF-C) (Lee, J. et al. (1996) Proc. Natl. Acad. Sci. USA. 93, 1988-1992; Joukov V., et al. (1996) EMBOJ. 15, 290-298) again results in RAFTK phosphorylation.
The following materials and methods were used to study cytokine signalling through RAFTK in Kaposi's Sarcoma cells:
Cells and cell cultures Human Kaposi's sarcoma cells lines KS 38 were derived from cutaneous biopsy of an AIDS patient as previously described (Lunardi-Iskandar, Y. et al. (1995) J. Natl. Cancer. Inst. 87, 974-981; Masood R. et al. (1994) Human Retroviruses. 10, 969-975). The cells were grown on 1.5% gelatin-coated flasks and were carried in RPMI 1640 with 15% fetal calf serum (FCS), 2mM glutamine, ImM MEM Sodium Pyruvate, 0.05mM MEM Non-Essential Amino Acids, lx MEM Amino Acids, 1% Nutridoma-HU (Boehringer Mannheim) and 50 mg/mL penicillin and 50 mg/ml streptomycin. Cultures were carried until near confluent prior to different treatments in the signaling studies described below. 293 cells were transfected with the FLT-4 gene and used as controls for detection of receptor protein as described (Lee, J. et al. ( 1996) Proc. Natl. Acad. Sci. USA . 93 , 1988- 1992).
Reagents and antibodies
RAFTK antibodies were generated using GST fusion proteins to various domains of the molecule and immunizing New Zealand rabbits as previously described (Avraham S. et al. (1995) J. Biol. Chem. 270, 27742-27751; Li J. et al. (1996) Blood. 88, 417-428). Using an ELISA assay, sera were screened for specific binding to RAFTK. Serum R4520 was chosen for further studies based on its titer in the ELISA. Serum R4520 did not cross react with FAK and was specific for RAFTK. Antibodies to the VEGF receptor FLK-1 and to the receptor FLT-4 were obtained from Genentech Inc. Antibodies to paxillin were obtained from Santa Cruz
Biotechnology. Monoclonal anti-phosphotyrosine antibody (4G10) was obtained from Upstate Biotechnology Inc. (Lake Placid, NY). Electrophoresis reagents were obtained from Bio-Rad Laboratories (Hercules, CA). The Phorbol 12-myristate 13- acetate (PMA) and protease inhibitors leupeptin, aprotinin and alpha 1 antitrypsin and all other reagents were obtained from Sigma Co. (St.Louis, MO). The recombinant cytokines b-FGF, TNF-a ,and IL-6 were obtained from R&D systems. VRP, the ligand for the FLT-4 receptor, was obtained and expressed from a glioblastoma cell line and purified as previously reported (Lee, J. et al. (1996) Proc. Natl. Acad. Sci. USA. 93, 1988-1992). Recombinant VEGF was obtained from Genentech, Inc. (South San Francisco, CA). Recombinant oncostatin M was obtained from the AIDS Reagent Bank (Bethesda, MD).
Indirect immunofluorescence
KS 38 cells were cultured in Chamber Slides (Lab Tek) to 90% confluency. Cells were washed twice with cold PBS and then fixed for 30 min in 4% paraformaldehyde. Cells were washed 3X PBS and blocked for non-specific staining using 10% FCS in PBS for 30 minute on ice. FLT-4 and FLK-1 expression were determined using purified antiserum at a dilution 1 :100 for one hour on ice. Normal rabbit serum was used as a control for non-specific staining. After washing cells 3X with PBS, cells were stained with secondary antibody conjugated to FITC (Boehringer Mannheim) at 1 :500 dilution for one hour on ice. Proteins were visualized and photographed after washing 3X PBS using an inverted fluorescence microscope.
Stimulation of cells
KS cells, grown to 80% confluence, were serum-starved for 16-18 hrs and washed twice with Hank's balanced salt solution (Gibco BRL) prior to PMA or cytokine treatments. KS cells were first treated with PMA to assess the effects of a chemical stimulus known to phosphorylate RAFTK in other cell systems (Avraham S. et al. (1995) J. Biol. Chem. 270, 27742-27751). After a time course of stimulation with PMA was established, the effects of cytokines were studied. VEGF, VRP, TNF- α, oncostatin M, IL-6, or b-FGF were added to cultures at a range of concentrations for different time periods in vitro. After stimulation, cell lysates were directly prepared within the culture dish by lysis in 500 μL modified RIPA (50 mM Tris-HCl, pH 7.4, l% NP-40, 0.25%> sodium deoxycholate, 150 mM NaCl, 1 mM PMSF, 10 (g/ml of aprotinin, leupeptin and pepstatin, 10 mM sodium vanadate, 10 mM sodium fluoride and 10 mM sodium pyrophosphate) per dish at varying timepoints. Total cell lysates (TCL) were clarified by centrifugation at 10,000 x g for 10 min. Protein concentrations were determined by protein assay (Bio-Rad Laboratories).
Immunoprecipitation and Western blot analysis For immunoprecipitation studies, identical amounts of protein from each sample were clarified by incubation with protein A-Sepharose CL-4B (Pharmacia Biotech) for 1 h at 4°C. Following the removal of protein A-Sepharose by brief centrifugation, the solution was incubated with different primary antibodies as detailed below for each experiment for 4 h or overnight at 4°C. Immunoprecipitations of the antibody-antigen complexes were performed by incubation for 2 h at 4°C with 75 μl of protein A-Sepharose (10% suspension). Non-specific bound proteins were removed by washing the Sepharose beads three times with modified RIPA buffer and one time with Phosphate buffered saline (PBS). Bound proteins were solubilized in 40 μl of 2 X Laemmli buffer and further analyzed by immunoblotting. Samples were separated on 7.5% SDS-PAGE and then transferred to nitrocellulose membranes. The membranes were blocked with 5% non-fat milk protein and probed with primary antibody for 2 h at RT or 4°C overnight. Immunoreactive bands were visualized using HRP-conjugated secondary antibody and the enhanced chemiluminescent (ECL) -system (Amersham Coφ., Arlington Heights, IL).
Kaposi sarcoma cells express Flk-I and Flt-4 receptors. To characterize the effects of different cytokines on KS cell signalling the KS
38 cell line was examined for expression of receptors for members of the VEGF family. Because KS spindle cells appear to be derived from lymphatic endothelium. Using indirect immunofluorescence (IFA), expression of both the FLK-1 receptor and the FLT-4 receptor was readily observed. The presence of both receptors was confirmed by Western blot using specific antisera to FLK-1 and FLT-4.
RAFTK is expressed in Kaposi sarcoma cells and phosphorylated upon cytokine treatment.
The KS cells were further characterized for expression of RAFTK. KS 38 cells expressed significant amounts of RAFTK protein as detected by Western blot and immunoprecipitation. Moreover, PMA treatment of KS 38 cells resulted in a time dependent phosphorylation of RAFTK.
Having established that RAFTK is expressed in KS 38 cells, whether or not treatment of these cells with VEGF or VRP, respective ligands for the FLK-1 and FLT-4 receptors, resulted in activation of signalling pathways that included RAFTK was investigated. There was a clear time dependent phosphorylation of RAFTK in response to VRP. Similar changes were observed following treatment with VEGF.
Previously, cytokines such as b-FGF, oncostatin M, IL-6 and TNF-a have been reported to promote in vitro proliferation of KS cells. The effects of treatment with these cytokines on RAFTK phosphorylation in KS 38 cells was analyzed. Each of these cytokines resulted in phosphorylation of this novel tyrosine kinase. Cytokine treatment of Kaposi sarcoma cells results in RAFTK association with the cytoskeletal protein paxillin.
Following the observation that RAFTK was phosphorylated by cytokines like oncostatin M, IL-6, b-FGF and TNF-α known to stimulate KS cell growth, as well as the endothelial growth factors VEGF and VRP, whether this phosphorylation might modulate the association of RAFTK with certain cytoskeletal molecules was investigated. Using specific antibodies to RAFTK or paxillin, significantly increased association of these two molecules following cytokine treatments was found. The development of authentic permanent KS cell lines has afforded the opportunity to characterize the surface structures of these cells and to examine which cytokines may modulate proliferation of the neoplasm. There is an extensive literature which supports a role for several cytokines in promoting KS cell growth via autocrine or paracrine mechanisms (See, e.g., Ba, G. et al. (1992) J Immunol. 149, 3727-3734; Buonaguro, L. et al. (1992) J. Virol. 66, 7159-7167; Cai, J., et al. (1994) Am. J. Pathol. 145, 74-79). Characterization of signalling pathways in KS cells and the effects of these cytokines on such pathways have been less extensively explored. Amaral et. al found that OSM activated the MAP kinase pathway (Amaral M. C. et al. (1993) J. Clin. Invest. 92, 848-857) while Faris et. ai reported that members of the Jak Stat family of kinases known to participate in signalling via the gp 130 receptor were active in KS cells as well (Faris M. et al. (1996) AIDS. 10, 369-378). In these studies, the KS 38 cell line was derived from a patient with cutaneous KS as a model because of its previously characterized properties that closely correspond to those of primary pathological KS specimens (Lunardi-Iskandar, Y. et al. (1995) ./ Natl Cancer. Inst. 87, 974-981). The expression of novel receptors on KS 38 cells which are preferentially expressed in normal lymphatic endothelium was investigated, and characterization made of signalling pathways that may link surface receptor activation to the cytoskeleton in these cells.
The tyrosine kinase FLT-4 receptor is relatively restricted in expression in normal tissues, with prior studies indicating its presence on the surface of lymphatic endothelium (Kaipainen A. et al. (1995) Proc. Natl. Acad. Sci. USA. 92, 3566-3570; Kaipainen A. et al. (1993) J. Exp. Med. 178, 2077-2088; Pajusola K. et al. (1993) Oncogene. 8, 2931-2937). KS 38 cells express FLT-4 as well as the related FLK-1 receptor. The recently identified ligand VRP specifically binds to the FLT-4 receptor (Lee, J. et al. (1996) Proc. Natl. Acad. Sci. USA. 93, 1988-1992; Joukov V., et al. (1996) EMBOJ. 15, 290-298), while FLK-1 is activated by VEGF. VRP, as well as VEGF, induced significant signalling changes in target KS 38 cells based on enhanced phosphorylation of proteins. Following this observation, investigation into signalling molecules whose enhanced phosphorylation was a common response to these cytokines as well as those previously reported to stimulate KS cells was performed. A variety of ligands and receptors of different molecular families have been implicated in the pathogenesis of KS. To survey this range of cytokines, representative cytokines from each family was chosen and a comparative analysis was made of b-FGF, TNF-α, oncostatin M, and IL-6 with VEGF and VRP. They all signalled via the recently identified RAFTK molecule.
RAFTK functions as a "platform kinase" upon which a number of intracytoplasmic kinases and adaptor molecules converge. The convergence of such molecules facilitates transmission of surface signals to the cytoskeleton. In this study, the phosphorylation of RAFTK by a variety of cytokines which belong to distinctly different families is described. Specifically, b-FGF, VEGF and VRP signal through receptor tyrosine kinases, OSM and IL-6 bind to a dual receptor with a specific chain and a shared gpl30 chain, and TNF-a binds to the CD95 receptor family linked to apoptosis. It appears, from this KS cell line model, that RAFTK may participate in each of these diverse receptor activated pathways. Based on the observations reported here, RAFTK functions in KS cells to transduce receptor signals via association with cytoskeletal molecules such as paxillin. RAFTK activation likely participates in a final common pathway for KS cell growth. Given the accessibility of cutaneous KS lesions to locally applied treatments, specific inhibitors of RAFTK are particularly useful in treatment of this disorder.
Equivalents
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents of the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANTS: Shalom Avraham et al . di) TITLE OF INVENTION: Novel RAFTK Signaling Molecules and Uses Therefor (ill) NUMBER OF SEQUENCES: 18
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: LAHIVE & COCKFIELD
(B) STREET: 60 State Street, suite 510 (C) CITY: Boston
(D) STATE: Massachusetts
( E ) COUNTRY : USA
(F) ZIP: 02109-1875 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Patentln Release #1.0, Version #1 25
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: August 23, 1996
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: (viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Jean M. Silveri
(B) REGISTRATION NUMBER: 39,030
(C) REFERENCE/DOCKET NUMBER: NER-255 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (617)227-7400
(B) TELEFAX: (617)227-5941
(2) INFORMATION FOR SEQ ID Nθ:l:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3621 base pairs
(B) TYPE: nucleic acid (C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(ix) FEATURE: (A) NAME/KEY : CDS
(B) LOCATION: 294..3321
(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 1 :
AACCACAAGT CAAATAGAAA GAAGTTAAAA GAATGTTTAT GCAAACACAT GAGAAAAGAA 60
GGGTGCAGAT GAGAATAGGG GTGTGGTTAA CAACTCAGAG GAGGAGGGAG AATCTAACCT 120
GTCAGCCCTT TTACTCAGCC ACAGCCTCCG GAGCCGTTGC ACACCTACCT GCCCGGCCGA 180
CTTACCTGTA CTTGCCGCCG TCCCGGCTCA CCTGGCGGTG CCCGAGGAGT AGTCGCTGGA 240 GTCCGCGCCT CCCTGGGACT GCAATGTGCC GATCTTAGCT GCTGCCTGAG AGG ATG 296
Met
1
TCT GGG GTG TCC GAG CCC CTG AGT CGA GTA AAG TTG GGC ACG TTA CGC 344 Ser Gly Val Ser Glu Pro Leu Ser Arg Val Lys Leu Gly Thr Leu Arg
5 10 15
CGG CCT GAA GGC CCT GCA GAG CCC ATG GTG GTG GTA CCA GTA GAT GTG 392 Arg Pro Glu Gly Pro Ala Glu Pro Met Val Val Val Pro Val Asp Val 20 25 30
GAA AAG GAG GAC GTG CGT ATC CTC AAG GTC TGC TTC TAT AGC AAC AGC 440 Glu Lys Glu Asp Val Arg He Leu Lys Val Cys Phe Tyr Ser Asn Ser 35 40 45
TTC AAT CCT GGG AAA AAC TTC AAA CTG GTC AAA TGC ACT GTC CAG ACG 488 Phe Asn Pro Gly Lys Asn Phe Lys Leu Val Lys Cys Thr Val Gin Thr 50 55 60 65 GAG ATC CGG GAG ATC ATC ACC TCC ATC CTG CTG AGC GGG CGG ATC GGG 536 Glu He Arg Glu He He Thr Ser He Leu Leu Ser Gly Arg He Gly 70 75 80
CCC AAC ATC CGG TTG GCT GAG TGC TAT GGG CTG AGG CTG AAG CAC ATG 584 Pro Asn He Arg Leu Ala Glu Cys Tyr Gly Leu Arg Leu Lys His Met
85 90 95
AAG TCC GAT GAG ATC CAC TGG CTG CAC CCA CAG ATG ACG GTG GGT GAG 632 Lys Ser Asp Glu He His Trp Leu His Pro Gin Met Thr Val Gly Glu 100 105 110
GTG CAG GAC AAG TAT GAG TGT CTG CAC GTG GAA GCC GAG TGG AGG TAT 680 Val Gin Asp Lys Tyr Glu Cys Leu His Val Glu Ala Glu Trp Arg Tyr 115 120 125
GAC CTT CAA ATC CGC TAC TTG CCA GAA GAC TTC ATG GAG AGC CTG AAG 728 Asp Leu Gin He Arg Tyr Leu Pro Glu Asp Phe Met Glu Ser Leu Lys 130 135 140 145 GAG GAC AGG ACC ACG CTG CTC TAT TTT TAC CAA CAG CTC CGG AAC GAC 776 Glu Asp Arg Thr Thr Leu Leu Tyr Phe Tyr Gin Gin Leu Arg Asn Asp 150 155 160
TAC ATG CAG CGC TAC GCC AGC AAG GTC AGC GAG GGC ATG GCC CTG CAG 824
Tyr Met Gin Arg Tyr Ala Ser Lys Val Ser Glu Gly Met Ala Leu Gin 165 170 175
CTG GGC TGC CTG GAG CTC AGG CGG TTC TTC AAG GAT ATG CCC CAC AAT 872
Leu Gly Cys Leu Glu Leu Arg Arg Phe Phe Lys Asp Met Pro His Asn 180 185 190
GCA CTT GAC AAG AAG TCC AAC TTC GAG CTC CTA GAA AAG GAA GTG GGG 920
Ala Leu Asp Lys Lys Ser Asn Phe Glu Leu Leu Glu Lys Glu Val Gly 195 200 205 CTG GAC TTG TTT TTC CCA AAG CAG ATG CAG GAG AAC TTA AAG CCC AAA 968
Leu Asp Leu Phe Phe Pro Lys Gin Met Gin Glu Asn Leu Lys Pro Lys 210 215 220 225
CAG TTC CGG AAG ATG ATC CAG CAG ACC TTC CAG CAG TAC GCC TCG CTC 1016 Gin Phe Arg Lys Met He Gin Gin Thr Phe Gin Gin Tyr Ala Ser Leu
230 235 240
AGG GAG GAG GAG TGC GTC ATG AAG TTC TTC AAC ACT CTC GCC GGC TTC 1064
Arg Glu Glu Glu Cys Val Met Lys Phe Phe Asn Thr Leu Ala Gly Phe 245 250 255
GCC AAC ATC GAC CAG GAG ACC TAC CGC TGT GAA CTC ATT CAA GGA TGG 1112
Ala Asn He Asp Gin Glu Thr Tyr Arg Cys Glu Leu He Gin Gly Trp 260 265 270
AAC ATT ACT GTG GAC CTG GTC ATT GGC CCT AAA GGG ATC CGC CAG CTG 1160
Asn He Thr Val Asp Leu Val He Gly Pro Lys Gly He Arg Gin Leu 275 280 285 ACT AGT CAG GAC GCA AAG CCC ACC TGC CTG GCC GAG TTC AAG CAG ATC 1208
Thr Ser Gin Asp Ala Lys Pro Thr Cys Leu Ala Glu Phe Lys Gin He 290 295 300 305
AGG TCC ATC AGG TGC CTC CCG CTG GAG GAG GGC CAG GCA GTA CTT CAG 1256 Arg Ser He Arg Cys Leu Pro Leu Glu Glu Gly Gin Ala Val Leu Gin
310 315 320
CTG GGC ATT GAA GGT GCC CCC CAG GCC TTG TCC ATC AAA ACC TCA TCC 1304
Leu Gly He Glu Gly Ala Pro Gin Ala Leu Ser He Lys Thr Ser Ser 325 330 335
CTA GCA GAG GCT GAG AAC ATG GCT GAC CTC ATA GAC GGC TAC TGC CGG 1352
Leu Ala Glu Ala Glu Asn Met Ala Asp Leu He Asp Gly Tyr Cys Arg 340 345 350
CTG CAG GGT GAG CAC CAA GGC TCT CTC ATC ATC CAT CCT AGG AAA GAT 1400
Leu Gin Gly Glu His Gin Gly Ser Leu He He His Pro Arg Lys Asp 355 360 365 GGT GAG AAG CGG AAC AGC CTG CCC CAG ATC CCC ATG CTA AAC CTG GAG 1448
Gly Glu Lys Arg Asn Ser Leu Pro Gin He Pro Met Leu Asn Leu Glu 370 375 380 385
GCC CGG CGG TCC CAC CTC TCA GAG AGC TGC AGC ATA GAG TCA GAC ATC 1496 Ala Arg Arg Ser His Leu Ser Glu Ser Cys Ser He Glu Ser Asp He 390 395 400
TAC GCA GAG ATT CCC GAC GAA ACC CTG CGA AGG CCC GGA GGT CCA CAG 1544 Tyr Ala Glu He Pro Asp Glu Thr Leu Arg Arg Pro Gly Gly Pro Gin 405 410 415
TAT GGC ATT GCC CGT GAA GAT GTG GTC CTG AAT CGT ATT CTT GGG GAA 1592 Tyr Gly He Ala Arg Glu Asp Val Val Leu Asn Arg He Leu Gly Glu 420 425 430 GGC TTT TTT GGG GAG GTC TAT GAA GGT GTC TAC ACA AAT CAT AAA GGG 1640 Gly Phe Phe Gly Glu Val Tyr Glu Gly Val Tyr Thr Asn His Lys Gly 435 440 445
GAG AAA ATC AAT GTA GCT GTC AAG ACC TGC AAG AAA GAC TGC ACT CTG 1688 Glu Lys He Asn Val Ala Val Lys Thr Cys Lys Lys Asp Cys Thr Leu 450 455 460 465
GAC AAC AAG GAG AAG TTC ATG AGC GAG GCA GTG ATC ATG AAG AAC CTC 1736 Asp Asn Lys Glu Lys Phe Met Ser Glu Ala Val He Met Lys Asn Leu 470 475 480
GAC CAC CCG CAC ATC GTG AAG CTG ATC GGC ATC ATT GAA GAG GAG CCC 1784 Asp His Pro His He Val Lys Leu He Gly He He Glu Glu Glu Pro 485 490 495
ACC TGG ATC ATC ATG GAA TTG TAT CCC TAT GGG GAG CTG GGC CAC TAC 1832 Thr Trp He He Met Glu Leu Tyr Pro Tyr Gly Glu Leu Gly His Tyr 500 505 510 CTG GAG CGG AAC AAG AAC TCC CTG AAG GTG CTC ACC CTC GTG CTG TAC 1880 Leu Glu Arg Asn Lys Asn Ser Leu Lys Val Leu Thr Leu Val Leu Tyr 515 520 525
TCA CTG CAG ATA TGC AAA GCC ATG GCC TAC CTG GAG AGC ATC AAC TGC 1928 Ser Leu Gin He Cys Lys Ala Met Ala Tyr Leu Glu Ser He Asn Cys 530 535 540 545
GTG CAC AGG GAC ATT GCT GTC CGG AAC ATC CTG GTG GCC TCC CCT GAG 1976 Val His Arg Asp He Ala Val Arg Asn He Leu Val Ala Ser Pro Glu 550 555 560
TGT GTG AAG CTG GGG GAC TTT GGT CTT TCC CGG TAC ATT GAG GAC GAG 2024 Cys Val Lys Leu Gly Asp Phe Gly Leu Ser Arg Tyr He Glu Asp Glu 565 570 575
GAC TAT TAC AAA GCC TCT GTG ACT CGT CTC CCC ATC AAA TGG ATG TCC 2072 Asp Tyr Tyr Lys Ala Ser Val Thr Arg Leu Pro He Lys Trp Met Ser 580 585 590 CCA GAG TCC ATT AAC TTC CGA CGC TTC ACG ACA GCC AGT GAC GTC TGG 2120 Pro Glu Ser He Asn Phe Arg Arg Phe Thr Thr Ala Ser Asp Val Trp 595 600 605
ATG TTC GCC GTG TGC ATG TGG GAG ATC CTG AGC TTT GGG AAG CAG CCC 2168 Met Phe Ala Val Cys Met Trp Glu He Leu Ser Phe Gly Lys Gin Pro 610 615 620 625
TTC TTC TGG CTG GAG AAC AAG GAT GTC ATC GGG GTG CTG GAG AAA GGA 2216 Phe Phe Trp Leu Glu Asn Lys Asp Val He Gly Val Leu Glu Lys Gly 630 635 640
GAC CGG CTG CCC AAG CCT GAT CTC TGT CCA CCG GTC CTT TAT ACC CTC 2264 Asp Arg Leu Pro Lys Pro Asp Leu Cys Pro Pro Val Leu Tyr Thr Leu 645 650 655 ATG ACC CGC TGC TGG GAC TAC GAC CCC AGT GAC CGG CCC CGC TTC ACC 2312 Met Thr Arg Cys Trp Asp Tyr Asp Pro Ser Asp Arg Pro Arg Phe Thr 660 665 670
GAG CTG GTG TGC AGC CTC AGT GAC GTT TAT CAG ATG GAG AAG GAC ATT 2360 Glu Leu Val Cys Ser Leu Ser Asp Val Tyr Gin Met Glu Lys Asp He 675 680 685
GCC ATG GAG CAA GAG AGG AAT GCT CGC TAC CGA ACC CCC AAA ATC TTG 2408 Ala Met Glu Gin Glu Arg Asn Ala Arg Tyr Arg Thr Pro Lys He Leu 690 695 700 705
GAG CCC ACA GCC TTC CAG GAA CCC CCA CCC AAG CCC AGC CGA CCT AAG 2456 Glu Pro Thr Ala Phe Gin Glu Pro Pro Pro Lys Pro Ser Arg Pro Lys 710 715 720
TAC AGA CCC CCT CCG CAA ACC AAC CTC CTG GCT CCA AAG CTG CAG TTC 2504 Tyr Arg Pro Pro Pro Gin Thr Asn Leu Leu Ala Pro Lys Leu Gin Phe 725 730 735 CAG GTT CCT GAG GGT CTG TGT GCC AGC TCT CCT ACG CTC ACC AGC CCT 2552 Gin Val Pro Glu Gly Leu Cys Ala Ser Ser Pro Thr Leu Thr Ser Pro 740 745 750
ATG GAG TAT CCA TCT CCC GTT AAC TCA CTG CAC ACC CCA CCT CTC CAC 2600 Met Glu Tyr Pro Ser Pro Val Asn Ser Leu His Thr Pro Pro Leu His 755 760 765
CGG CAC AAT GTC TTC AAA CGC CAC AGC ATG CGG GAG GAG GAC TTC ATC 2648 Arg His Asn Val Phe Lys Arg His Ser Met Arg Glu Glu Asp Phe He 770 775 780 785
CAA CCC AGC AGC CGA GAA GAG GCC CAG CAG CTG TGG GAG GCT GAA AAG 2696 Gin Pro Ser Ser Arg Glu Glu Ala Gin Gin Leu Trp Glu Ala Glu Lys 790 795 800
GTC AAA ATG CGG CAA ATC CTG GAC AAA CAG CAG AAG CAG ATG GTG GAG 2744 Val Lys Met Arg Gin He Leu Asp Lys Gin Gin Lys Gin Met Val Glu 805 810 815 GAC TAC CAG TGG CTC AGG CAG GAG GAG AAG TCC CTG GAC CCC ATG GTT 2792 Asp Tyr Gin Trp Leu Arg Gin Glu Glu Lys Ser Leu Asp Pro Met Val 820 825 830
TAT ATG AAT GAT AAG TCC CCA TTG ACG CCA GAG AAG GAG GTC GGC TAC 2840 Tyr Met Asn Asp Lys Ser Pro Leu Thr Pro Glu Lys Glu Val Gly Tyr 835 840 845
CTG GAG TTC ACA GGG CCC CCA CAG AAG CCC CCG AGG CTG GGC GCA CAG 2888 Leu Glu Phe Thr Gly Pro Pro Gin Lys Pro Pro Arg Leu Gly Ala Gin 850 855 860 865
TCC ATC CAG CCC ACA GCT AAC CTG GAC CGG ACC GAT GAC CTG GTG TAC 2936 Ser He Gin Pro Thr Ala Asn Leu Asp Arg Thr Asp Asp Leu Val Tyr 870 875 880 CTC AAT GTC ATG GAG CTG GTG CGG GCC GTG CTG GAG CTC AAG AAT GAG 2984 Leu Asn Val Met Glu Leu Val Arg Ala Val Leu Glu Leu Lys Asn Glu 885 890 895
CTC TGT CAG CTG CCC CCC GAG GGC TAC GTG GTG GTG GTG AAG AAT GTG 3032 Leu Cys Gin Leu Pro Pro Glu Gly Tyr Val Val Val Val Lys Asn Val 900 905 910
GGG CTG ACC CTG CGG AAG CTC ATC GGG AGC GTG GAT GAT CTC CTG CCT 3080 Gly Leu Thr Leu Arg Lys Leu He Gly Ser Val Asp Asp Leu Leu Pro 915 920 925
TCC TTG CCG TCA TCT TCA CGG ACA GAG ATC GAG GGC ACC CAG AAA CTG 3128
Ser Leu Pro Ser Ser Ser Arg Thr Glu He Glu Gly Thr Gin Lys Leu 930 935 940 945
CTC AAC AAA GAC CTG GCA GAG CTC ATC AAC AAG ATG CGG CTG GCG CAG 3176
Leu Asn Lys Asp Leu Ala Glu Leu He Asn Lys Met Arg Leu Ala Gin
950 955 960 CAG AAC GCC GTG ACC TCC CTG AGT GAG GAG TGC AAG AGG CAG ATG CTG 3224 Gin Asn Ala Val Thr Ser Leu Ser Glu Glu Cys Lys Arg Gin Met Leu 965 970 975
ACG GCT TCA CAC ACC CTG GCT GTG GAC GCC AAG AAC CTG CTC GAC GCT 3272 Thr Ala Ser His Thr Leu Ala Val Asp Ala Lys Asn Leu Leu Asp Ala 980 985 990
GTG GAC CAG GCC AAG GTT CTG GCC AAT CTG GCC CAC CCA CCT GCA GAG T 3321 Val Asp Gin Ala Lys Val Leu Ala Asn Leu Ala His Pro Pro Ala Glu 995 1000 1005
GACGGAGGGT GGGGGCCACC TGCCTGCGTC TTCCGCCCCT GCCTGCCATG TACCTCCCCT 3381
GCCTTGCTGT TGGTCATGTG GGTCTTCCAG GGAGAAGGCC AAGGGGAGTC ACCTTCCCTT 3441
GCCACTTTGC ACGACGCCCT CTCCCCACCC CTACCCCTGG CTGTACTGCT CAGGCTGCAG 3501
CTGGACAGAG GGGACTCTGG GCTATGGACA CAGGGTGACG GTGACAAAGA TGGCTCAGAG 3561 GGGGACTGCT GCTGCCTGGC CACTGCTCCC TAAGCCAGCC TGGTCCATGC AGGGGGCTCG 3621 (2) INFORMATION FOR SEQ ID NO : 2 : (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1009 ammo acids
(B) TYPE: amino acid (D) TOPOLOGY: linear (li) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO .2 :
Met Ser Gly Val Ser Glu Pro Leu Ser Arg Val Lys Leu Gly Thr Leu 1 5 10 15
Arg Arg Pro Glu Gly Pro Ala Glu Pro Met Val Val Val Pro Val Asp 20 25 30 Val Glu Lys Glu Asp Val Arg He Leu Lys Val Cys Phe Tyr Ser Asn 35 40 45
Ser Phe Asn Pro Gly Lys Asn Phe Lys Leu Val Lys Cys Thr Val Gin 50 55 60
Thr Glu He Arg Glu He He Thr Ser He Leu Leu Ser Gly Arg He 65 70 75 80
Gly Pro Asn He Arg Leu Ala Glu Cys Tyr Gly Leu Arg Leu Lys His 85 90 95
Met Lys Ser Asp Glu He His Trp Leu His Pro Gin Met Thr Val Gly 100 105 110 Glu Val Gin Asp Lys Tyr Glu Cys Leu His Val Glu Ala Glu Trp Arg 115 120 125
Tyr Asp Leu Gin He Arg Tyr Leu Pro Glu Asp Phe Met Glu Ser Leu 130 135 140
Lys Glu Asp Arg Thr Thr Leu Leu Tyr Phe Tyr Gin Gin Leu Arg Asn 145 150 155 160
Asp Tyr Met Gin Arg Tyr Ala Ser Lys Val Ser Glu Gly Met Ala Leu 165 170 175
Gin Leu Gly Cys Leu Glu Leu Arg Arg Phe Phe Lys Asp Met Pro His 180 185 190 Asn Ala Leu Asp Lys Lys Ser Asn Phe Glu Leu Leu Glu Lys Glu Val 195 200 205
Gly Leu Asp Leu Phe Phe Pro Lys Gin Met Gin Glu Asn Leu Lys Pro 210 215 220
Lys Gin Phe Arg Lys Met He Gin Gin Thr Phe Gin Gin Tyr Ala Ser 225 230 235 240
Leu Arg Glu Glu Glu Cys Val Met Lys Phe Phe Asn Thr Leu Ala Gly 245 250 255
Phe Ala Asn He Asp Gin Glu Thr Tyr Arg Cys Glu Leu He Gin Gly 260 265 270
Trp Asn He Thr Val Asp Leu Val He Gly Pro Lys Gly He Arg Gin 275 280 285
Leu Thr Ser Gin Asp Ala Lys Pro Thr Cys Leu Ala Glu Phe Lys Gin 290 295 300 He Arg Ser He Arg Cys Leu Pro Leu Glu Glu Gly Gin Ala Val Leu 305 310 315 320
Gin Leu Gly He Glu Gly Ala Pro Gin Ala Leu Ser He Lys Thr Ser 325 330 335
Ser Leu Ala Glu Ala Glu Asn Met Ala Asp Leu He Asp Gly Tyr Cys 340 345 350
Arg Leu Gin Gly Glu His Gin Gly Ser Leu He He His Pro Arg Lys 355 360 365
Asp Gly Glu Lys Arg Asn Ser Leu Pro Gin He Pro Met Leu Asn Leu 370 375 380 Glu Ala Arg Arg Ser His Leu Ser Glu Ser Cys Ser He Glu Ser Asp 385 390 395 400
He Tyr Ala Glu He Pro Asp Glu Thr Leu Arg Arg Pro Gly Gly Pro 405 410 415
Gin Tyr Gly He Ala Arg Glu Asp Val Val Leu Asn Arg He Leu Gly 420 425 430
Glu Gly Phe Phe Gly Glu Val Tyr Glu Gly Val Tyr Thr Asn His Lys 435 440 445
Gly Glu Lys He Asn Val Ala Val Lys Thr Cys Lys Lys Asp Cys Thr 450 455 460 Leu Asp Asn Lys Glu Lys Phe Met Ser Glu Ala Val He Met Lys Asn 465 470 475 480
Leu Asp His Pro His He Val Lys Leu He Gly He He Glu Glu Glu 485 490 495
Pro Thr Trp He He Met Glu Leu Tyr Pro Tyr Gly Glu Leu Gly His 500 505 510
Tyr Leu Glu Arg Asn Lys Asn Ser Leu Lys Val Leu Thr Leu Val Leu 515 520 525 Tyr Ser Leu Gin He Cys Lys Ala Met Ala Tyr Leu Glu Ser He Asn 530 535 540
Cys Val His Arg Asp He Ala Val Arg Asn He Leu Val Ala Ser Pro 545 550 555 560
Glu Cys Val Lys Leu Gly Asp Phe Gly Leu Ser Arg Tyr He Glu Asp 565 570 575 Glu Asp Tyr Tyr Lys Ala Ser Val Thr Arg Leu Pro He Lys Trp Met 580 585 590
Ser Pro Glu Ser He Asn Phe Arg Arg Phe Thr Thr Ala Ser Asp Val 595 600 605
Trp Met Phe Ala Val Cys Met Trp Glu He Leu Ser Phe Gly Lys Gin 610 615 620
Pro Phe Phe Trp Leu Glu Asn Lys Asp Val He Gly Val Leu Glu Lys 625 630 635 640
Gly Asp Arg Leu Pro Lys Pro Asp Leu Cys Pro Pro Val Leu Tyr Thr 645 650 655 Leu Met Thr Arg Cys Trp Asp Tyr Asp Pro Ser Asp Arg Pro Arg Phe 660 665 670
Thr Glu Leu Val Cys Ser Leu Ser Asp Val Tyr Gin Met Glu Lys Asp 675 680 685
He Ala Met Glu Gin Glu Arg Asn Ala Arg Tyr Arg Thr Pro Lys He 690 695 700
Leu Glu Pro Thr Ala Phe Gin Glu Pro Pro Pro Lys Pro Ser Arg Pro 705 710 715 720
Lys Tyr Arg Pro Pro Pro Gin Thr Asn Leu Leu Ala Pro Lys Leu Gin 725 730 735 Phe Gin Val Pro Glu Gly Leu Cys Ala Ser Ser Pro Thr Leu Thr Ser 740 745 750
Pro Met Glu Tyr Pro Ser Pro Val Asn Ser Leu His Thr Pro Pro Leu 755 760 765
His Arg His Asn Val Phe Lys Arg His Ser Met Arg Glu Glu Asp Phe 770 775 780
He Gin Pro Ser Ser Arg Glu Glu Ala Gin Gin Leu Trp Glu Ala Glu 785 790 795 800
Lys Val Lys Met Arg Gin He Leu Asp Lys Gin Gin Lys Gin Met Val 805 810 815 Glu Asp Tyr Gin Trp Leu Arg Gin Glu Glu Lys Ser Leu Asp Pro Met 820 825 830 Val Tyr Met Asn Asp Lys Ser Pro Leu Thr Pro Glu Lys Glu Val Gly 835 840 845 Tyr Leu Glu Phe Thr Gly Pro Pro Gin Lys Pro Pro Arg Leu Gly Ala 850 855 860
Gin Ser He Gin Pro Thr Ala Asn Leu Asp Arg Thr Asp Asp Leu Val 865 870 875 880
Tyr Leu Asn Val Met Glu Leu Val Arg Ala Val Leu Glu Leu Lys Asn 885 890 895
Glu Leu Cys Gin Leu Pro Pro Glu Gly Tyr Val Val Val Val Lys Asn 900 905 910
Val Gly Leu Thr Leu Arg Lys Leu He Gly Ser Val Asp Asp Leu Leu 915 920 925 Pro Ser Leu Pro Ser Ser Ser Arg Thr Glu He Glu Gly Thr Gin Lys 930 935 940
Leu Leu Asn Lys Asp Leu Ala Glu Leu He Asn Lys Met Arg Leu Ala 945 950 955 960
Gin Gin Asn Ala Val Thr Ser Leu Ser Glu Glu Cys Lys Arg Gin Met 965 970 975
Leu Thr Ala Ser His Thr Leu Ala Val Asp Ala Lys Asn Leu Leu Asp 980 985 990
Ala Val Asp Gin Ala Lys Val Leu Ala Asn Leu Ala His Pro Pro Ala 995 1000 1005 Glu
(2) INFORMATION FOR SEQ ID NO : 3 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 4029 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: CDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 202..3229
(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 3 : GAGAGCAGCA GGGGTGTGGT TAACGACCGA GAGGAGGAGG GGGAAAAACA ACCTGTCAGC 60
CTCTTACTCA GCCTCTGCAG GCAGAGCCGC GCGTCCTACC TGCGGCGGCT GCGCTCACCT 120
GGCCCAGCCC GGAGCCCTGG CCCGAGTCCG CGCCTCGCCC GAGGGACTGC AATGTGCCGG 180
TCCTAGCTGC AGTCTGAGAG G ATG TCC GGG GTG TCT GAG CCC TTG AGC CGT 231
Met Ser Gly Val Ser Glu Pro Leu Ser Arg 1 5 10
GTA AAA GTG GGC ACT TTA CGC CGG CCT GAG GGC CCC CCA GAG CCC ATG 279 Val Lys Val Gly Thr Leu Arg Arg Pro Glu Gly Pro Pro Glu Pro Met 15 20 25 GTG GTG GTA CCA GTG GAT GTG GAG AAG GAA GAC GTG CGC ATC CTC AAG 327 Val Val Val Pro Val Asp Val Glu Lys Glu Asp Val Arg He Leu Lys 30 35 40
GTC TGC TTC TAC AGC AAC AGC TTC AAC CCA GGG AAG AAC TTC AAG CTT 375 Val Cys Phe Tyr Ser Asn Ser Phe Asn Pro Gly Lys Asn Phe Lys Leu 45 50 55
GTC AAA TGC ACA GTG CAG ACA GAG ATC CAG GAG ATC ATC ACC TCC ATC 423 Val Lys Cys Thr Val Gin Thr Glu He Gin Glu He He Thr Ser He 60 65 70
CTC CTG AGT GGG CGA ATA GGG CCC AAC ATC CAG CTG GCT GAA TGC TAT 471 Leu Leu Ser Gly Arg He Gly Pro Asn He Gin Leu Ala Glu Cys Tyr 75 80 85 90
GGG CTG AGG CTG AAG CAC ATG AAG TCA GAC GAG ATC CAC TGG CTG CAC 519 Gly Leu Arg Leu Lys His Met Lys Ser Asp Glu He His Trp Leu His 95 100 105 CCA CAG ATG ACC GTG GGC GAA GTG CAG GAC AAG TAT GAA TGT CTA CAC 567 Pro Gin Met Thr Val Gly Glu Val Gin Asp Lys Tyr Glu Cys Leu His 110 115 120
GTG GAA GCT GAG TGG AGG TAT GAC CTT CAA ATC CGC TAC TTG CCG GAA 615 Val Glu Ala Glu Trp Arg Tyr Asp Leu Gin He Arg Tyr Leu Pro Glu 125 130 135
GAC TTC ATG GAG AGC CTG AAA GAA GAC AGG ACC ACA TTG CTG TAC TTT 663 Asp Phe Met Glu Ser Leu Lys Glu Asp Arg Thr Thr Leu Leu Tyr Phe 140 145 150
TAT CAA CAG CTC CGG AAT GAC TAC ATG CAA CGC TAC GCC AGC AAG GTC 711 Tyr Gin Gin Leu Arg Asn Asp Tyr Met Gin Arg Tyr Ala Ser Lys Val 155 160 165 170
AGT GAA GGC ATG GCT CTG CAG CTG GGC TGT CTG GAG CTC AGG AGA TTC 759 Ser Glu Gly Met Ala Leu Gin Leu Gly Cys Leu Glu Leu Arg Arg Phe 175 180 185 TTC AAG GAC ATG CCC CAC AAT GCA CTG GAC AAA AAG TCC AAC TTT GAA 807 Phe Lys Asp Met Pro His Asn Ala Leu Asp Lys Lys Ser Asn Phe Glu 190 195 200
CTC CTG GAA AAA GAA GTC GGT CTG GAC CTG TTT TTC CCA AAG CAG ATG 855 Leu Leu Glu Lys Glu Val Gly Leu Asp Leu Phe Phe Pro Lys Gin Met 205 210 215
CAG GAA AAC TTA AAG CCC AAG CAG TTC CGG AAG ATG ATC CAG CAG ACC 903 Gin Glu Asn Leu Lys Pro Lys Gin Phe Arg Lys Met He Gin Gin Thr 220 225 230
TTC CAG CAG TAT GCA TCA CTC CGG GAG GAA GAG TGT GTC ATG AAA TTC 951 Phe Gin Gin Tyr Ala Ser Leu Arg Glu Glu Glu Cys Val Met Lys Phe 235 240 245 250 TTC AAT ACC CTA GCG GGC TTT GCC AAC ATT GAC CAG GAG ACC TAC CGC 999 Phe Asn Thr Leu Ala Gly Phe Ala Asn He Asp Gin Glu Thr Tyr Arg 255 260 265
TGC GAA CTC ATT CAA GGA TGG AAC ATT ACT GTG GAC CTG GTC ATC GGC 1047 Cys Glu Leu He Gin Gly Trp Asn He Thr Val Asp Leu Val He Gly 270 275 280
CCT AAA GGC ATC CGT CAG CTG ACA AGT CAA GAT ACA AAG CCC ACC TGC 1095 Pro Lys Gly He Arg Gin Leu Thr Ser Gin Asp Thr Lys Pro Thr Cys 285 290 295
CTG GCC GAG TTT AAG CAG ATC AGA TCC ATC AGG TGC CTC CCA TTG GAA 1143 Leu Ala Glu Phe Lys Gin He Arg Ser He Arg Cys Leu Pro Leu Glu 300 305 310
GAG ACC CAG GCA GTC CTG CAG CTG GGC ATC GAG GGT GCC CCC CAG TCC 1191 Glu Thr Gin Ala Val Leu Gin Leu Gly He Glu Gly Ala Pro Gin Ser 315 320 325 330 TTG TCT ATC AAA ACG TCG TCC CTG GCA GAG GCT GAG AAC ATG GCT GAT 1239 Leu Ser He Lys Thr Ser Ser Leu Ala Glu Ala Glu Asn Met Ala Asp 335 340 345
CTC ATA GAT GGC TAC TGC AGG CTG CAA GGA GAA CAT AAG GGC TCT CTC 1287 Leu He Asp Gly Tyr Cys Arg Leu Gin Gly Glu His Lys Gly Ser Leu 350 355 360
ATC ATG CAT GCC AAG AAA GAT GGT GAG AAG AGG AAC AGC CTG CCT CAG 1335 He Met His Ala Lys Lys Asp Gly Glu Lys Arg Asn Ser Leu Pro Gin 365 370 375
ATC CCC ACA CTA AAC CTG GAG GCT CGG CGG TCG CAC CTC TCA GAA AGC 1383 He Pro Thr Leu Asn Leu Glu Ala Arg Arg Ser His Leu Ser Glu Ser 380 385 390
TGC AGC ATA GAG TCA GAC ATC TAT GCG GAG ATT CCC GAT GAG ACC CTG 1431 Cys Ser He Glu Ser Asp He Tyr Ala Glu He Pro Asp Glu Thr Leu 395 400 405 410 CGA AGA CCA GGA GGT CCA CAG TAC GGT GTT GCC CGT GAA GAA GTA GTT 1479 Arg Arg Pro Gly Gly Pro Gin Tyr Gly Val Ala Arg Glu Glu Val Val 415 420 425
CTT AAC CGC ATT CTG GGT GAA GGC TTC TTT GGG GAG GTC TAT GAA GGT 1527 Leu Asn Arg He Leu Gly Glu Gly Phe Phe Gly Glu Val Tyr Glu Gly 430 435 440
GTC TAC ACG AAC CAC AAA GGG GAA AAA ATT AAT GTG GCC GTC AAG ACC 1575 Val Tyr Thr Asn His Lys Gly Glu Lys He Asn Val Ala Val Lys Thr 445 450 455
TGT AAG AAA GAC TGT ACC CAG GAC AAC AAG GAG AAG TTC ATG AGT GAG 1523 Cys Lys Lys Asp Cys Thr Gin Asp Asn Lys Glu Lys Phe Met Ser Glu 460 465 470 GCA GTG ATC ATG AAG AAT CTT GAC CAC CCT CAC ATC GTG AAG CTG ATT 1671 Ala Val He Met Lys Asn Leu Asp His Pro His He Val Lys Leu He 475 480 485 490
GGC ATC ATT GAA GAG GAA CCC ACC TGG ATT ATC ATG GAA CTG TAT CCT 1719 Gly He He Glu Glu Glu Pro Thr Trp He He Met Glu Leu Tyr Pro
495 500 505
TAT GGG GAG CTG GGA CAC TAC CTG GAA CGA AAT AAA AAC TCC CTG AAG 1767 Tyr Gly Glu Leu Gly His Tyr Leu Glu Arg Asn Lys Asn Ser Leu Lys 510 515 520
GTA CCC ACT CTG GTC CTG TAC ACC CTA CAG ATA TGC AAA GCC ATG GCC 1815 Val Pro Thr Leu Val Leu Tyr Thr Leu Gin He Cys Lys Ala Met Ala 525 530 535
TAT CTG GAG AGC ATC AAC TGT GTG CAC AGG GAT ATT GCT GTC CGG AAC 1863 Tyr Leu Glu Ser He Asn Cys Val His Arg Asp He Ala Val Arg Asn 540 545 550 ATC CTG GTG GCC TCT CCT GAG TGT GTG AAG CTG GGG GAC TTT GGG CTC 1911 He Leu Val Ala Ser Pro Glu Cys Val Lys Leu Gly Asp Phe Gly Leu 555 560 565 570
TCC CGG TAC ATT GAG GAC GAA GAC TAT TAC AAA GCC TCT GTG ACA CGT 1959 Ser Arg Tyr He Glu Asp Glu Asp Tyr Tyr Lys Ala Ser Val Thr Arg
575 580 585
CTA CCC ATC AAA TGG ATG TCC CCC GAG TCC ATC AAC TTC CGC CGC TTC 2007 Leu Pro He Lys Trp Met Ser Pro Glu Ser He Asn Phe Arg Arg Phe 590 595 600
ACA ACC GCC AGT GAT GTC TGG ATG TTT GCT GTA TGC ATG TGG GAG ATC 2055 Thr Thr Ala Ser Asp Val Trp Met Phe Ala Val Cys Met Trp Glu He 605 610 615
CTC AGC TTT GGG AAG CAG CCT TTC TTC TGG CTC GAA AAT AAG GAT GTC 2103 Leu Ser Phe Gly Lys Gin Pro Phe Phe Trp Leu Glu Asn Lys Asp Val 620 625 630 ATC GGA GTG CTG GAG AAA GGG GAC AGG CTG CCC AAG CCC GAA CTC TGT 2151 He Gly Val Leu Glu Lys Gly Asp Arg Leu Pro Lys Pro Glu Leu Cys 635 640 645 650
CCG CCT GTC CTT TAC ACA CTC ATG ACT CGC TGC TGG GAC TAC GAC CCC 2199 Pro Pro Val Leu Tyr Thr Leu Met Thr Arg Cys Trp Asp Tyr Asp Pro 655 660 665
AGT GAC CGG CCC CGC TTC ACG GAG CTT GTG TGC AGC CTC AGT GAC ATT 2247 Ser Asp Arg Pro Arg Phe Thr Glu Leu Val Cys Ser Leu Ser Asp He 670 675 680
TAT CAG ATG GAG AAG GAC ATT GCC ATA GAG CAA GAA AGG AAT GCT CGC 2295 Tyr Gin Met Glu Lys Asp He Ala He Glu Gin Glu Arg Asn Ala Arg 685 690 695 TAC CGA CCC CCT AAA ATA TTG GAG CCT ACT ACC TTT CAG GAA CCC CCA 2343 Tyr Arg Pro Pro Lys He Leu Glu Pro Thr Thr Phe Gin Glu Pro Pro 700 705 710
CCC AAG CCC AGC CGG CCC AAG TAC AGA CCT CCT CCA CAG ACC AAC CTG 2391 Pro Lys Pro Ser Arg Pro Lys Tyr Arg Pro Pro Pro Gin Thr Asn Leu 715 720 725 730
CTG GCT CCT AAG CTG CAG TTC CAG GTC CCT GAG GGT CTG TGT GCC AGC 2439 Leu Ala Pro Lys Leu Gin Phe Gin Val Pro Glu Gly Leu Cys Ala Ser 735 740 745
TCT CCT ACG CTT ACC AGC CCT ATG GAG TAT CCA TCT CCA GTT AAC TCG 2487 Ser Pro Thr Leu Thr Ser Pro Met Glu Tyr Pro Ser Pro Val Asn Ser 750 755 760
CTG CAC ACC CCA CCT CTC CAC CGG CAC AAT GTC TTC AAG CGC CAC AGC 2535 Leu His Thr Pro Pro Leu His Arg His Asn Val Phe Lys Arg His Ser 765 770 775 ATG CGG GAG GAG GAC TTC ATC CGG CCC AGT AGC CGA GAA GAG GCC CAG 2583 Met Arg Glu Glu Asp Phe He Arg Pro Ser Ser Arg Glu Glu Ala Gin 780 785 790
CAG CTC TGG GAG GCA GAG AAG ATC AAG ATG AAG CAG GTC CTA GAA AGA 2631 Gin Leu Trp Glu Ala Glu Lys He Lys Met Lys Gin Val Leu Glu Arg 795 800 805 810
CAG CAG AAG CAG ATG GTG GAA GAT TCC CAG TGG CTG AGG CGA GAG GAA 2679 Gin Gin Lys Gin Met Val Glu Asp Ser Gin Trp Leu Arg Arg Glu Glu 815 820 825
AGA TGC TTG GAC CCT ATG GTT TAT ATG AAT GAC AAG TCC CCA CTG ACT 2727 Arg Cys Leu Asp Pro Met Val Tyr Met Asn Asp Lys Ser Pro Leu Thr 830 835 840
CCA GAG AAG GAG GCC GGC TAC ACG GAG TTC ACA GGG CCC CCA CAG AAA 2775 Pro Glu Lys Glu Ala Gly Tyr Thr Glu Phe Thr Gly Pro Pro Gin Lys 845 850 855 CCA CCT CGG CTC GGT GCA CAG TCC ATT CAG CCC ACA GCC AAC CTG GAC 2823 Pro Pro Arg Leu Gly Ala Gin Ser He Gin Pro Thr Ala Asn Leu Asp 860 865 870
AGG ACC GAT GAC CTC GTG TAC CAC AAT GTC ATG ACC CTG GTG GAG GCT 2871 Arg Thr Asp Asp Leu Val Tyr His Asn Val Met Thr Leu Val Glu Ala 875 880 885 890
GTG CTG GGA CTC AAG AAC AAG CTT GGC CAG TTG CCC CCT GAG GAC TAT 2919
Val Leu Gly Leu Lys Asn Lys Leu Gly Gin Leu Pro Pro Glu Asp Tyr
895 900 905
GTG GTG GTG GTG AAG AAC GTG GGG CTG AAC CTG CGG AAG CTC ATC GGC 2967
Val Val Val Val Lys Asn Val Gly Leu Asn Leu Arg Lys Leu He Gly
910 915 920 AGT GTG GAC GAT CTC TTG CCC TCC TTG CCG GCA TCT TCG AGG ACA GAG 3015 Ser Val Asp Asp Leu Leu Pro Ser Leu Pro Ala Ser Ser Arg Thr Glu 925 930 935
ATT GAA GGG ACC CAG AAA CTG CTC AAC AAA GAC CTG GCA GAG CTC ATC 3063 He Glu Gly Thr Gin Lys Leu Leu Asn Lys Asp Leu Ala Glu Leu He 940 945 950
AAC AAG ATG AAG TTG GCT CAG CAG AAC GCC GTG ACG TCC CTG AGT GAG 3111 Asn Lys Met Lys Leu Ala Gin Gin Asn Ala Val Thr Ser Leu Ser Glu 955 960 965 970
GAC TGC AAG CGG CAG ATG CTC ACA GCG TCC CAT ACC CTG GCT GTG GAT 3159
Asp Cys Lys Arg Gin Met Leu Thr Ala Ser His Thr Leu Ala Val Asp 975 980 985
GCC AAG AAC CTG CTG GAT GCT GTG GAC CAA GCC AAG GTT GTG GCT AAT 3207
Ala Lys Asn Leu Leu Asp Ala Val Asp Gin Ala Lys Val Val Ala Asn 990 995 1000 CTG GCC CAC CCG CCT GCA GAG T GATCAAGAGA GGGGCCACCT GCCTGCATCT 3259 Leu Ala His Pro Pro Ala Glu 1005
TCTGCCCCCA CCTGTCTTGG CATACCTTTC CTGCCTTGCC TTTGGTTATT GGTCTTCCAG 3319
GGAAAGCTGA GAAGAGTCCA TCCCCCTTGC CACTTTGCAC GACGCCCCCT CTTCCCCCAA 3379
CCCATCCCAG ACTGTGCTAC TCAGGCTGCA TCTGGACAGA AAGGACTCTG GGCACAGACA 3439 CGGGGTGGGG TGACATAGTT CATAGGGGTA CTACTGCCAG CCACTCCCTC TTACCCCAGC 3499
CTGGGTTGCT GGAGCATCAT TGGGGTCATG AGTGTACCCC TAACGGCCAA GATGGCTTTC 3559
TGCATGGACA TTTGAGAGCC AGTATTCCTC CTTCCTCTTC AGCCCTCAGG GACCCCTGAT 3619
ACAGAGGGGA CAGAGAGGGG TTTTATTTGT AGAAAAGCTG TGACATGAGG GCTGGACCTG 3679
GCTCTCTTGT ACAGTGTACA TTGGAATTTA TTTAATGTGA GTTTGACCTG GATGGACAGC 3739 CAAGGGCCAT AGTCCAGGAG CAAACCAATC CAGTCACAGG ACTCTGTGTT TTTATGGAAC 3799 TGAGTGCCAC AGGGAAGAAG CAGAGAGTCG GAGGTCAGAA TGGGACTTTG TGCCCTTCCT 3859
GCGTTTCTCT TCTCCCTCTT TCCTCTCCCC TCTTTTCTTA CGTCTCCTTT TTCTCCTCCC 3919 CCTTTTCACA TCTGCTCCCC TCCTCTCTCA TGTCTGTGGA GAACATTTAC CTTCCTTCTT 3979
TTTGATCGGT GGTTGAATTA AAATTATTAC CATTTGCTTT GTGAAAAAAA 4029
(2) INFORMATION FOR SEQ ID NO : 4 :
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1009 ammo acids
Figure imgf000147_0001
(D) TOPOLOGY: linear
(n) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 4 :
Met Ser Gly Val Ser Glu Pro Leu Ser Arg Val Lys Val Gly Thr Leu 1 5 10 15
Arg Arg Pro Glu Gly Pro Pro Glu Pro Met Val Val Val Pro Val Asp 20 25 30
Val Glu Lys Glu Asp Val Arg He Leu Lys Val Cys Phe Tyr Ser Asn 35 40 45 Ser Phe Asn Pro Gly Lys Asn Phe Lys Leu Val Lys Cys Thr Val Gin 50 55 60
Thr Glu He Gin Glu He He Thr Ser He Leu Leu Ser Gly Arg He 65 70 75 80
Gly Pro Asn He Gin Leu Ala Glu Cys Tyr Gly Leu Arg Leu Lys His 85 90 95
Met Lys Ser Asp Glu He His Trp Leu His Pro Gin Met Thr Val Gly 100 105 110
Glu Val Gin Asp Lys Tyr Glu Cys Leu His Val Glu Ala Glu Trp Arg 115 120 125 Tyr Asp Leu Gin He Arg Tyr Leu Pro Glu Asp Phe Met Glu Ser Leu 130 135 140
Lys Glu Asp Arg Thr Thr Leu Leu Tyr Phe Tyr Gin Gin Leu Arg Asn 145 150 155 160
Asp Tyr Met Gin Arg Tyr Ala Ser Lys Val Ser Glu Gly Met Ala Leu 165 170 175
Gin Leu Gly Cys Leu Glu Leu Arg Arg Phe Phe Lys Asp Met Pro His 180 185 190 Asn Ala Leu Asp Lys Lys Ser Asn Phe Glu Leu Leu Glu Lys Glu Val 195 200 205
Gly Leu Asp Leu Phe Phe Pro Lys Gin Met Gin Glu Asn Leu Lys Pro 210 215 220
Lys Gin Phe Arg Lys Met He Gin Gin Thr Phe Gin Gin Tyr Ala Ser 225 230 235 240 Leu Arg Glu Glu Glu Cys Val Met Lys Phe Phe Asn Thr Leu Ala Gly
245 250 255
Phe Ala Asn He Asp Gin Glu Thr Tyr Arg Cys Glu Leu He Gin Gly 260 265 270
Trp Asn He Thr Val Asp Leu Val He Gly Pro Lys Gly He Arg Gin 275 280 285
Leu Thr Ser Gin Asp Thr Lys Pro Thr Cys Leu Ala Glu Phe Lys Gin 290 295 300
He Arg Ser He Arg Cys Leu Pro Leu Glu Glu Thr Gin Ala Val Leu 305 310 315 320 Gin Leu Gly He Glu Gly Ala Pro Gin Ser Leu Ser He Lys Thr Ser
325 330 335
Ser Leu Ala Glu Ala Glu Asn Met Ala Asp Leu He Asp Gly Tyr Cys 340 345 350
Arg Leu Gin Gly Glu His Lys Gly Ser Leu He Met His Ala Lys Lys 355 360 365
Asp Gly Glu Lys Arg Asn Ser Leu Pro Gin He Pro Thr Leu Asn Leu 370 375 380
Glu Ala Arg Arg Ser His Leu Ser Glu Ser Cys Ser He Glu Ser Asp 385 390 395 400 He Tyr Ala Glu He Pro Asp Glu Thr Leu Arg Arg Pro Gly Gly Pro
405 410 415
Gin Tyr Gly Val Ala Arg Glu Glu Val Val Leu Asn Arg He Leu Gly 420 425 430
Glu Gly Phe Phe Gly Glu Val Tyr Glu Gly Val Tyr Thr Asn His Lys 435 440 445
Gly Glu Lys He Asn Val Ala Val Lys Thr Cys Lys Lys Asp Cys Thr 450 455 460
Gin Asp Asn Lys Glu Lys Phe Met Ser Glu Ala Val He Met Lys Asn 465 470 475 480 Leu Asp His Pro His He Val Lys Leu He Gly He He Glu Glu Glu
485 490 495 Pro Thr Trp He He Met Glu Leu Tyr Pro Tyr Gly Glu Leu Gly His 500 505 510 Tyr Leu Glu Arg Asn Lys Asn Ser Leu Lys Val Pro Thr Leu Val Leu 515 520 525
Tyr Thr Leu Gin He Cys Lys Ala Met Ala Tyr Leu Glu Ser He Asn 530 535 540
Cys Val His Arg Asp He Ala Val Arg Asn He Leu Val Ala Ser Pro 545 550 555 560
Glu Cys Val Lys Leu Gly Asp Phe Gly Leu Ser Arg Tyr He Glu Asp 565 570 575
Glu Asp Tyr Tyr Lys Ala Ser Val Thr Arg Leu Pro He Lys Trp Met 580 585 590 Ser Pro Glu Ser He Asn Phe Arg Arg Phe Thr Thr Ala Ser Asp Val 595 600 605
Trp Met Phe Ala Val Cys Met Trp Glu He Leu Ser Phe Gly Lys Gin 610 615 620
Pro Phe Phe Trp Leu Glu Asn Lys Asp Val He Gly Val Leu Glu Lys 625 630 635 640
Gly Asp Arg Leu Pro Lys Pro Glu Leu Cys Pro Pro Val Leu Tyr Thr 645 650 655
Leu Met Thr Arg Cys Trp Asp Tyr Asp Pro Ser Asp Arg Pro Arg Phe 660 665 670 Thr Glu Leu Val Cys Ser Leu Ser Asp He Tyr Gin Met Glu Lys Asp 675 680 685
He Ala He Glu Gin Glu Arg Asn Ala Arg Tyr Arg Pro Pro Lys He 690 695 700
Leu Glu Pro Thr Thr Phe Gin Glu Pro Pro Pro Lys Pro Ser Arg Pro 705 710 715 720
Lys Tyr Arg Pro Pro Pro Gin Thr Asn Leu Leu Ala Pro Lys Leu Gin 725 730 735
Phe Gin Val Pro Glu Gly Leu Cys Ala Ser Ser Pro Thr Leu Thr Ser 740 745 750 Pro Met Glu Tyr Pro Ser Pro Val Asn Ser Leu His Thr Pro Pro Leu 755 760 765
His Arg His Asn Val Phe Lys Arg His Ser Met Arg Glu Glu Asp Phe 770 775 780
He Arg Pro Ser Ser Arg Glu Glu Ala Gin Gin Leu Trp Glu Ala Glu 785 790 795 800
Lys He Lys Met Lys Gin Val Leu Glu Arg Gin Gin Lys Gin Met Val 805 810 815
Glu Asp Ser Gin Trp Leu Arg Arg Glu Glu Arg Cys Leu Asp Pro Met 820 825 830
Val Tyr Met Asn Asp Lys Ser Pro Leu Thr Pro Glu Lys Glu Ala Gly 835 840 845
Tyr Thr Glu Phe Thr Gly Pro Pro Gin Lys Pro Pro Arg Leu Gly Ala 850 855 860 Gin Ser He Gin Pro Thr Ala Asn Leu Asp Arg Thr Asp Asp Leu Val 865 870 875 880
Tyr His Asn Val Met Thr Leu Val Glu Ala Val Leu Gly Leu Lys Asn 885 890 895
Lys Leu Gly Gin Leu Pro Pro Glu Asp Tyr Val Val Val Val Lys Asn 900 905 910
Val Gly Leu Asn Leu Arg Lys Leu He Gly Ser Val Asp Asp Leu Leu 915 920 925
Pro Ser Leu Pro Ala Ser Ser Arg Thr Glu He Glu Gly Thr Gin Lys 930 935 940 Leu Leu Asn Lys Asp Leu Ala Glu Leu He Asn Lys Met Lys Leu Ala 945 950 955 960
Gin Gin Asn Ala Val Thr Ser Leu Ser Glu Asp Cys Lys Arg Gin Met 965 970 975
Leu Thr Ala Ser His Thr Leu Ala Val Asp Ala Lys Asn Leu Leu Asp 980 985 990
Ala Val Asp Gin Ala Lys Val Val Ala Asn Leu Ala His Pro Pro Ala 995 1000 1005
Glu
(2) INFORMATION FOR SEQ ID NO : 5 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(v) FRAGMENT TYPE: internal ( ix ) FEATURE :
(A) NAME/KEY: Peptide
(B) LOCATION: 6
(D) OTHER INFORMATION: /label= OTHER FEATURE /note= "X=F OR Y"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 5 : Ser Asp Val Trp Ser Xaa Gly 1 5
(2) INFORMATION FOR SEQ ID NO : 6 : (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 6 :
SWRTCNACCC ANS R ANCC 20
(2) INFORMATION FOR SEQ ID NO : 7 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(v) FRAGMENT TYPE: internal
(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 7 ;
Asp Leu Ala Ala Arg Asn l 5
(2) INFORMATION FOR SEQ ID NO: 8:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: CGACGAYCTN GCNRCNAA 18
(2) INFORMATION FOR SEQ ID NO : 9 :
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 5 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal
(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 9 :
Trp Met Ala Pro Glu 1 5 (2) INFORMATION FOR SEQ ID NO : 10 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid (C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: GTACCYTCVG GNGCCATCCA 20
(2) INFORMATION FOR SEQ ID NO: 11:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11: CGGGCCGTGC TGGAGCTCAA 20 (2) INFORMATION FOR SEQ ID NO: 12:
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ll) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12: GTCCGTGAAG ATGACGGCAA 20
(2) INFORMATION FOR SEQ ID NO:13*
(l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear (ll) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13: AAAGCTGTCA TCGAGATGTC C 21
(2) INFORMATION FOR SEQ ID NO : 14 : (l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
TCGGTGGGTG CTGGCTGGTA GG 22
(2) INFORMATION FOR SEQ ID NO: 15:
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: Single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15: ATCTGGCACC ACACCTTCTA CAATGAGCTG CG 32
(2) INFORMATION FOR SEQ ID NO: 16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: CGTCATACTC CTGCTTGCTG ATCCACATCT GC 32 (2) INFORMATION FOR SEQ ID NO: 17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 34 base pairs
(B) TYPE: nucleic acid (C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17: AGCTTATGGA CTACAAGGAC GACGATGACA GGGG 34
(2) INFORMATION FOR SEQ ID NO: 18:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 34 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 18: AATTCCCTTG TCATCGTCGT CCTTATGGTC CATA 34

Claims

What is claimed is:
1. An isolated RAFTK nucleic acid molecule from a vertebrate organism.
2. The isolated nucleic acid molecule of claim 1 having a nucleic acid sequence shown in one of SEQ ID NOs: 1 or 3, or a complement or fragment thereof.
3. The isolated nucleic acid molecule of claim 2 which has at least 70% homologous to a nucleic acid molecule shown in one of SEQ ID NOs: 1 or 3.
4. The isolated nucleic acid molecule of claim 1, which encodes a polypeptide with a RAFTK bioactivity.
5. An isolated nucleic acid molecule of claim 1, which encodes a polypeptide shown in SEQ ID NO. 2 or 4.
6. An isolated nucleic acid molecule of claim 1 , which is capable of hybridizing to a nucleic acid molecule of one of SEQ ID NOs: 1 or 3 under stringent conditions.
7. An isolated nucleic acid molecule of claim 1, which encodes a polypeptide that is at least 70% identical to the polypeptide shown in SEQ ID NOs.: 2 or 4.
8. An isolated nucleic acid molecule of claim 2, which comprises the coding region of one of SEQ ID NOs:l or 3.
9. An isolated nucleic acid molecule of claim 1 , which hybridizes to at least 6 consecutive nucleotides of the RAFTK gene shown in one of one of SEQ ID
NOs:l or 3.
10. An isolated nucleic acid molecule of claim 9, which further comprises a label.
11. An expression vector, comprising a nucleic acid molecule of claim 2 operably linked to a transcriptional regulatory sequence.
12. An expression vector of claim 1 1 , which is capable of replicating in a cell.
13. A host cell transfected with an expression vector of claim 12.
14. A method of making a RAFTK polypeptide comprising the steps of: a. culturing the cell of claim 13 in an appropriate culture medium to produce a RAFTK polypeptide; and b. isolating the RAFTK polypeptide.
15. A transgenic animal in which expression of a genomic sequence encoding a functional RAFTK polypeptide is enhanced, induced, prevented or suppressed.
16. An isolated polypeptide of a vertebrate organism having a RAFTK bioactivity.
17. A polypeptide of claim 16, which is at least 70% homologous to the polypeptide shown in SEQ ID NOs. 2 or 4.
18. A polypeptide of claim 17, which has a molecular weight of approximately 123kD.
19. A fusion protein comprising a polypeptide of claim 17 and a second polypeptide, said fusion protein containing a detectable label or a matrix binding domain.
20. A pharmaceutical preparation comprising a therapeutically effective amount of the polypeptide of claim 17 and a pharmaceutically acceptable carrier.
21. An antibody which is specifically reactive with an epitope of the polypeptide of claim 16.
22. A method for modulating one or more of growth, differentiation, heamtopoiesis, or survival in a cell, comprising treating the cell with an effective amount of an agent which modulates the activity of a RAFTK protein thereby altering, relative to the cell in the absence of the agent, at least one of (i) rate of growth, (ii) differentiation, (iii) hematopoiesis or (iv) survival of the cell.
23. The method of claim 22, wherein the cell is selected from the group consisting of a mast cell, a melanocyte, and a megakaryocyte.
24. A method for modulating one or more of cell adhesion, migration, phagocytosis, or motility of a cell, comprising treating the cell with an effective amount of an agent which modulates the activity of a RAFTK protein thereby altering, relative to the cell in the absence of the agent, at least one of (i) cell adhesion, (ii) migration, (iii) phagocytosis, or (iv) motility of the cell.
25. A method of claim 24, wherein said cell adhesion is modulated by modulating focal adhesion formation in a cell, said method comprising treating the cell with an effective amount of an agent which modulates the activity of a RAFTK protein.
26. The method of claim 25, wherein said method is used to treat metastasis by a tumor cell.
27. A diagnostic assay for identifying a cell or cells at risk for a disorder characterized by unwanted cell proliferation or differentiation, comprising detecting, in a cell sample, the presence or absence of a genetic lesion characterized by at least one of (i) aberrant modification or mutation of a gene encoding a RAFTK protein, and (ii) mis-expression of said gene; wherein a wild-type form of said gene encodes an polypeptide with a RAFTK bioactivity.
28. The assay of claim 27, wherein detecting said lesion includes: a. providing a diagnostic probe comprising a nucleic acid including a region of nucleotide sequence which hybridizes to a sense or antisense sequence of said gene, or naturally occurring mutants thereof, or 5' or 3' flanking sequences naturally associated with said gene; b. combining said probe with nucleic acid of said cell sample; and c. detecting, by hybridization of said probe to said cellular nucleic acid, the existence of at least one of a deletion of one or more nucleotides from said gene, an addition of one or more nucleotides to said gene, a substitution of one or more nucleotides of said gene, a gross chromosomal rearrangement of all or a portion of said gene, a gross alteration in the level of an mRNA transcript of said gene, or a non- wild type splicing pattern of an mRNA transcript of said gene.
29. A method of preparing differentiated blood cells comprising modulating the activity of a RAFTK protein in a progenitor stem cell.
30. The method of claim 29, wherein the differentiated blood cells are megakaryocytes.
31. A population of megakaryocytes prepared using the method of claim
30.
32. A population of platelets prepared using the method of claim 30.
33. An assay for screening test compounds to identify compounds which modulate RAFTK interaction with cellular proteins, comprising: a. providing a reaction mixture including a RAFTK protein, a RA FT K-bmc g protein, and a test compound; and b. detecting the interaction of the RAFTK protein and the RAFTK- binding protein, wherein a statistically significant change in the interaction of the proteins in the presence of the test compound is indicative of the capability of a compound to modulate a bioactivity of a RAFTK polypeptide.
34. The assay of claim 39, wherein the RAFTK-bmά g protein is selected from the group consisting of paxillin, protein kinase C-α, Protein kinase C-δ, src, fyn, Grb2, PI3 kinase, and the c-fms receptor, and calpain.
35. The assay of claim 33, wherein the detecting step comprises determining the level of phosphorylation of RAFTK or the RAFTK binding protein.
36. The assay of claim 33, wherein the reaction mixture is selected from the group consisting of a reconstituted protein mixture and a cell lysate.
37. The assay of claim 33, wherein the RAFTK protein is a recombinant protein.
38. The assay of claim 33, wherein one or both of the RAFTK protein and Λ F-TΛ.-binding protein is a fusion protein.
39. The assay of claim 33, wherein at least one of the RAFTK protein and RAFTK-bm' ding protein comprises an endogenous detectable label for detecting the formation of said complex.
40. The method of claim 33, which reaction mixture is a whole cell, and interaction of the RAFTK protein and &4 7X-binding protein is detected in a two hybrid assay system.
41. A RAFTK inhibitor identified using the assay of claim 33.
42. A pharmaceutical preparation comprising (i) the composition of claim 41 in an amount effective for inhibiting proliferation of a cell, and (ii) a pharmaceutically acceptable diluent.
43. A method for modulating one or more of growth, differentiation, or survival of a megakaryocytic cell, comprising treating the cell with an effective amount of the preparation of claim 42 so as to modulate RAFTK activity and alter, relative to the cell in the absence of the agent, at least one of (i) the growth, (ii) migration, (iii) differentiation state, or (iv) survival of the cell.
PCT/US1997/014093 1996-08-23 1997-08-12 Novel raftk signaling molecules and uses therefor WO1998007870A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU41479/97A AU4147997A (en) 1996-08-23 1997-08-12 Novel (raftk) signaling molecules and uses therefor

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US70362396A 1996-08-23 1996-08-23
US08/703,623 1996-08-23
US81646297A 1997-03-13 1997-03-13
US08/816,462 1997-03-13

Publications (2)

Publication Number Publication Date
WO1998007870A1 true WO1998007870A1 (en) 1998-02-26
WO1998007870A9 WO1998007870A9 (en) 1998-05-28

Family

ID=27107170

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1997/014093 WO1998007870A1 (en) 1996-08-23 1997-08-12 Novel raftk signaling molecules and uses therefor

Country Status (2)

Country Link
AU (1) AU4147997A (en)
WO (1) WO1998007870A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1009395A1 (en) * 1997-02-18 2000-06-21 Lxr Biotechnology Inc. Bak promotor expression system
WO2000049144A2 (en) * 1999-02-22 2000-08-24 Sugen, Inc. Pyk2 binding proteins

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BLOOD, 15 July 1996, Volume 88, Number 2, LI J. et al., "Characterization of RAFTK, a Novel Focal Adhesion Kinse and its Integrin-Dependent Phosphorylation and Activation in Megakaryocytes", pages 417-428. *
JOURNAL OF BIOLOGICAL CHEMISTRY, 08 September 1995, Volume 270, Number 36, SASAKI H. et al., "Cloning and Characterization of Cell Adhesion Kinase Beta, a Novel Protein-Tyrosine Kinase of the Focal Adhesion Kinase Subfamily", pages 21206-21219. *
JOURNAL OF BIOLOGICAL CHEMISTRY, 17 November 1995, Volume 270, Number 46, AVRAHAM S. et al., "Identification and Characterization of a Novel Related Adhesion Focal Tyrosine Kinase (RAFTK) from Megakaryocytes and Brain", pages 27742-27751. *
NATURE, 31 August 1995, Volume 376, LEV S. et al., "Protein Tyrosine Kinase PYK2 Involved in Ca2+-Induced Regulation of Ion Channel and MAP Kinase Functions", pages 737-745. *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1009395A1 (en) * 1997-02-18 2000-06-21 Lxr Biotechnology Inc. Bak promotor expression system
EP1009395A4 (en) * 1997-02-18 2000-11-08 Lxr Biotechnology Inc Bak promotor expression system
WO2000049144A2 (en) * 1999-02-22 2000-08-24 Sugen, Inc. Pyk2 binding proteins
WO2000049144A3 (en) * 1999-02-22 2001-02-15 Sugen Inc Pyk2 binding proteins

Also Published As

Publication number Publication date
AU4147997A (en) 1998-03-06

Similar Documents

Publication Publication Date Title
US5807708A (en) Conservin nucleic acid molecules and compositions
US5800998A (en) Assays for diagnosing type II diabetes in a subject
EP0972041A1 (en) Novel human delta3 compositions and therapeutic and diagnostic uses therefor
US5795726A (en) Methods for identifying compounds useful in treating type II diabetes
AU710856B2 (en) The irs family of genes
US6399760B1 (en) RP compositions and therapeutic and diagnostic uses therefor
WO2002053743A2 (en) Mammalian tribbles signaling pathways and methods and reagents related thereto
US6221841B1 (en) General receptors for phosphoinositides and uses related thereto
US20010041353A1 (en) Novel SSP-1 compositions and therapeutic and diagnostic uses therefor
WO1998046756A9 (en) Secreted protein ssp-1 compositions and therapeutic and diagnostic uses therefor
US5994070A (en) Trio molecules and uses related thereto
WO1998046748A1 (en) Therapeutic compositions and diagnostic assays for diseases involving trbp
WO1998007870A1 (en) Novel raftk signaling molecules and uses therefor
WO1998007870A9 (en) Novel raftk signaling molecules and uses therefor
US6475778B1 (en) Differentiation enhancing factors and uses therefor
JP2005504830A (en) Novel molecules of the HKID-1 related protein family and uses thereof
US6008014A (en) Method of making lipid metabolic pathway compositions
WO1998009979A9 (en) Lipid metabolic pathway compositions and therapeutic and diagnostic uses therefor
NZ505037A (en) Mammalian alpha helical protein-1 (Zalpha1)
US20060067926A1 (en) Novel serine threonine kinase member, h2520-59
US6303770B1 (en) Nucleic acids encoding mammalian alpha helical protein-1
AU701901B2 (en) Cytoplasmic tyrosine kinase
WO1998021363A1 (en) Compositions and methods for treating type ii diabetes involving hnf-4
WO1998040495A1 (en) Doublin, a gene involved in neuronal development and uses therefor
AU2002243454A1 (en) Mammalian tribbles signaling pathways and methods and reagents related thereto

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
COP Corrected version of pamphlet

Free format text: PAGES 1/5-5/5, DRAWINGS, REPLACED BY NEW PAGES 1/5-5/5; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 1998510795

Format of ref document f/p: F

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA