WO1998007754A1 - Ligand ii du type recepteur de t1 - Google Patents

Ligand ii du type recepteur de t1 Download PDF

Info

Publication number
WO1998007754A1
WO1998007754A1 PCT/US1996/013768 US9613768W WO9807754A1 WO 1998007754 A1 WO1998007754 A1 WO 1998007754A1 US 9613768 W US9613768 W US 9613768W WO 9807754 A1 WO9807754 A1 WO 9807754A1
Authority
WO
WIPO (PCT)
Prior art keywords
ligand
tlr
polypeptide
amino acid
seq
Prior art date
Application number
PCT/US1996/013768
Other languages
English (en)
Inventor
Jian Ni
Reiner L. Gentz
Steven M. Ruben
Original Assignee
Human Genome Sciences, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences, Inc. filed Critical Human Genome Sciences, Inc.
Priority to JP10510698A priority Critical patent/JP2001500724A/ja
Priority to AU72352/96A priority patent/AU7235296A/en
Priority to EP96933739A priority patent/EP0963205A4/fr
Priority to CA002263832A priority patent/CA2263832A1/fr
Priority to PCT/US1996/013768 priority patent/WO1998007754A1/fr
Publication of WO1998007754A1 publication Critical patent/WO1998007754A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention concerns a novel Tl Receptor (TIR)-Iike ligand II protein.
  • TIR Tl Receptor
  • isolated nucleic acid molecules are provided encoding the
  • TlR-like ligand II protein TlR-like ligand II protein.
  • TlR-like ligand II polypeptides are also provided, as are recombinant vectors and host cells for expressing the s.ame.
  • Interle kin-J Interleukin-1
  • Interleukin-1 IL-l ⁇ and IL-l ⁇
  • IL-1 ⁇ Interleukin-1 receptor antagonist
  • IL-IRa IL-1 receptor antagonist
  • IL-l ⁇ and IL-l ⁇ are agonists and IL-IRa is a specific receptor antagonist.
  • IL-l ⁇ and ⁇ are synthesized as precursors without leader sequences. The molecular weight of each precursor is 31 kD.
  • IL-IRa evolved with a signal peptide and is readily transported out of the cells and termed secreted IL-IRa (sIL-IRa).
  • sIL-IRa secreted IL-IRa
  • IL-1 Receptor and Ligands The receptors and ligands of the IL-1 pathway have been well defined (for review, see Dinarello, C.A., FASEB J. 5:1314-1325 (1994); Sims, J.E. et al, Interleukin-1 signal transduction: Advances in Cell and Molecular Biology of Membranes and Organelles, Vol.
  • IL- 1 ra Three ligands, IL-l ⁇ , IL-l ⁇ , .and IL- 1 receptor antagonist (IL- 1 ra) bind three forms of IL- 1 receptor, an
  • IL-1R1 80-kDa type I IL-1 receptor (IL-1R1 ) (Sims, J.E. et al, Science 247:585-589 (1988)), a 68-kDa type II IL-1 receptor (IL-1RII) (McMahan, CJ. et al, EMBO J. 70:2821-2832 (1991)), .and a soluble form of the type II IL-IR (sIL-lRII) (Colotta, F. et al, Science 261:472-475 (1993)).
  • IL-1R1 80-kDa type I IL-1 receptor
  • IL-1RII 68-kDa type II IL-1 receptor
  • sIL-lRII soluble form of the type II IL-IR
  • IL-1 ligands and receptors play an essential role in the stimulation and regulation of the IL-1 -mediated host response to injury and infection.
  • Cells expressing IL- 1 RI and treated with IL- 1 ⁇ or IL- 1 ⁇ respond in several specific ways, including stimulating nuclear localization of the rel- related transcription factor, NF- ⁇ (for review, see Thanos, D. & Maniatis, T., Cell 50:529-532 (1996)), activation of protein kinases of the mitogen-activated protein kinase superfamily that phosphorylate residue threonine 669 (Thr-669) of the epidermal growth factor receptor (EGFR) (Guy, G.R. et al, J. Biol. Chem.
  • EGFR epidermal growth factor receptor
  • IL-lRI-like family M.any proteins from diverse systems show homology to the cytoplasmic domain of the IL-1RI. This exp,anding IL-lRI-like f-amily includes m.ammalian proteins, Drosophila proteins, and a plant (tobacco) protein.
  • the mammalian IL-lRI-like receptor family members include a murine protein MyD88 (Lord, K.A. et al, Oncogene 5:1095-1097 (1990)) and a human gene, rsc786 (Nomura, N. et al, DNA Res. 7:27-35 (1994)).
  • Another murine receptor member, T1/ST2 was previously characterized as a novel primary response gene expressed in BAL/c-3T3 cells (Klemenz, R. et al, Proc. Natl Acad. Sci. USA 56:5708-5712 (1989); Tominaga, S., FEBS Lett. 255:301-304 (1989); Tominga, S.
  • the transmembrane protein mulL-lR AcP (Greenfeder, S.A. et al, J. Biol. Chem. 270: 13757-13765 (1995)) has homology to both the type I and type II IL-IR.
  • IL-IR AcP has recently been shown to increase the affinity of IL-IRI for IL-l ⁇ and may be involved in mediating the IL-1 response.
  • Tl Receptors T1/ST2 receptors (hereinafter, "Tl receptors"), as a member of the IL-1 receptor family (Bergers, G., etal, EMBOJ. 75:1176 (1994)) has various homologs in different species.
  • Fit- 1 an estrogen-inducible, c- bs-dependent transmembrane protein that shares 26% to 29% amino acid homology to the mouse IL-IRI and II, respectively
  • ST2 an estrogen-inducible, c- bs-dependent transmembrane protein
  • Tl the Fit-1 protein
  • the organization of the two IL-1 receptors and the Fit-l/ST2/Tl genes indicates they are derived from a common ancestor (Sims, J.E., et al, Cytokine 7:483 ( 1995)).
  • Fit-1 exists in two forms: a membrane form (Fit-1 M) with a cytosolic domain similarly to that of the IL-IRI and Fit- IS, which is secreted and composed of the extracellular domain of Fit-M.
  • these two forms of the Fit-1 protein are similar to those of the membrane-bound and soluble IL-IRI. It has been shown that the IL-lsRI is derived from proteolytic cleavage of the cell-bound form (Sims, J.E., et al, Cytokine 7:483 (1995)).
  • the Fit- ⁇ gene is under the control of two promoters, which results in two isoforms coding for either the membrane or soluble form of the receptor. Two RNA transcripts result from alternative RNA splicing of the 3' end of the gene.
  • IL- 1 ⁇ binds weakly to Fit- 1 and does not transduce a signal (Reikerstorger, A., et al, J. Biol. Chem. 270:17645 (1995))
  • a chimeric receptor consisting of the extracellular murine IL-IRI fused to the cytosolic Fit-1 transduces an IL-1 signal (Reikerstorger, A., et al, J. Biol. Chem. 270:17645 (1995)).
  • the cytosolic portion of Fit-1 align with GTPase-like sequences of IL-IRI (Hopp, T.P., Protein Sci. 4:1851 (1995)) (see below).
  • IL-1 production in various disease states Increased IL-1 production has been reported in patients with various viral, bacterial, fungal, and parasitic infections; intravascular coagulation; high-dose IL-2 therapy; solid tumors; leukemia; Alzheimer's disease; HIV-1 infection; autoimmune disorders; trauma (surgery); hemodialysis; ischemic diseases (myocardial infection); noninfectious hepatitis; asthma; UV radiation; closed head injury; p.ancreatitis; periodontitis; graft-versus-host disease; transplant rejection; and in healthy subjects after strenuous exercise.
  • ischemic diseases myocardial infection
  • noninfectious hepatitis asthma
  • UV radiation closed head injury
  • p.ancreatitis periodontitis
  • graft-versus-host disease transplant rejection
  • healthy subjects after strenuous exercise There is an association of increased IL-l ⁇ production in patients with Alzheimer's disease a .
  • IL-1 is not the only cytokine exhibiting increased production and hence the specificity of the IL-1 findings as related to the pathogenesis of any particular disease is lacking.
  • IL-l ⁇ but not IL-l ⁇ is detected in the circulation.
  • IL-1 in Therapy Although IL-1 has been found to exhibit many important biological activities, it is also found to be toxic at doses that are close to therapeutic dosages. (Dinarello, C.A., Blood 57:2095-2147 (March 15, 1996).). In general, the acute toxicities of either isoform of IL-1 were greater after intravenous compared with subcutaneous injection. Subcutaneous injection was associated with significant local pail, erythema, and swelling (Kitamura, T., & Takaku, F., Exp. Med. 7: 170 (1989); Laughlin, M.J., Ann. Hematol. 67:267
  • IL-1 has been administered to patients undergoing various regiments of chemotherapy to reduce the nadir of neutropenia and thrombocytopenia.
  • the present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding a human Tl receptor-(TlR-)Iike ligand II polypeptide having the .amino acid sequence in FIG. 1 (SEQ ID NO:2).
  • TlR-like ligand having the .amino acid sequence in FIG. 1 (SEQ ID NO:2).
  • 11 contains an open reading frame encoding a polypeptide of about 229 amino acid residues including an N-terminal methionine, a leader sequence of about 26 amino acid residues, an extracellular mature domain of about 168 residues, a transmembrane domain of about 23 residues and an intracellular domain of about
  • the invention provides isolated nucleic acid molecules encoding an TlR-like ligand II having an amino acid sequence encoded by the cDNA of the clone deposited as ATCC Deposit No. 97655 on July 12, 1996.
  • the nucleic acid molecule will encode the mature polypeptide encoded by the above-described deposited cDNA.
  • the invention is further directed to nucleic acid fragments of the nucleic acid molecules described herein.
  • fragments of an isolated nucleic acid molecule having the nucleotide sequence of the deposited cDNA or the nucleotide sequence shown in Figure 1 is intended fragments at least about 15 nt, and more preferably at least about 20 nt, still more preferably at least about
  • fragments 50-741 nt in length are also useful according to the present invention as are fragments corresponding to most, if not all, of the nucleotide sequence of the deposited cDNA or as shown in Figure 1 (SEQ ID NO: 1 ).
  • 20 nt in length for example, is intended fragments which include 20 or more contiguous bases from the nucleotide sequence of the deposited cDNA or the nucleotide sequence as shown in Figure 1 (SEQ ID NO: l). Since the gene has been deposited and the nucleotide sequence shown in Figure 1 (SEQ ID NO:l) is provided, generating such DNA fragments would be routine to the skilled artisan. For example, restriction endonuclease cleavage or shearing by sonication could easily be used to generate fragments of various sizes. Alternatively, such fragments could be generated synthetically.
  • Preferred nucleic acid fragments include nucleic acid molecules which encode: a leader sequence of about 26 amino acid residues (amino acid residues from about 1 to about 26 in Figure 1 (SEQ ID NO:2); an extracellular mature domain of about 168 residues (amino acid residues from about 27 to about 194 in Figure 1 (SEQ ID NO:2); a transmembrane domain of about 23 amino acids (amino acid residues from about 195 to about 217 in Figure 1 (SEQ ID NO:2); an intracellular domain of about 8 amino acids (amino acid residues from about
  • nucleic acid molecules having a nucleotide sequence that is at least 90% identical and, more preferably, at least 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence of any of the nucleic acid molecules described herein.
  • the present invention also relates to recombinant vectors which include the isolated nucleic acid molecules of the present invention, host cells containing the recombinant vectors, and the production of TlR-like ligand II polypeptides or fragments thereof by recombinant techniques.
  • polypeptides of the present invention include the polypeptide encoded by the deposited cDNA, the polypeptide of Figure 1 (SEQ ID NO:2) (in particular the mature polypeptide), as well as polypeptides having an amino acid sequence with at least 90% similarity, more preferably at least 95% similarity to the amino acid sequence of the polypeptide encoded by the deposited cDNA, the polypeptide of Figure 1 (SEQ ID NO:2), or a fragment thereof.
  • polypeptides of the present invention include polypeptides having an amino acid sequence at least 80% identical, more preferably, at least 90% or 95% identical to the amino acid sequence of the polypeptide encoded by the deposited cDNA, the polypeptide of Figure 1 (SEQ ID NO:2), or a fragment thereof.
  • Preferred polypeptide fragments according to the present invention include a polypeptide comprising: the mature polypeptide, the extracellular domain, the tr.ansmembrane domain, the intracellular domain, or the extracellular and intracellular domain with all or part of the transmembrane domain deleted.
  • An additional embodiment of the invention relates to a polypeptide or peptide having the amino acid sequence of an epitope-bearing portion of an TlR- like ligand II described herein.
  • Peptides or polypeptides having the amino acid sequence of an epitope-bearing portion of an IL-1-like polypeptide of the invention include portions of such polypeptides with at least 6-30 or 9-50 amino acids, although epitope-bearing polypeptides of any length up to and including the entire amino acid sequence of a polypeptide of the invention described herein also are included.
  • the invention provides an isolated antibody that binds specifically to an TlR-like ligand II polypeptide having an amino acid sequence as described herein. It is believed that biological activities of the TlR-like ligand II of the present invention may be similar to the biological activities of the TIR ligand and IL-1.
  • TlR-like ligand II may be detected in tissues or bodily fluids (e.g., serum, plasma, urine, synovial fluid or spinal fluid) taken from an individual having a TIR ligand- or IL-1 -related disorder, relative to a "normal" TlR-like ligand II gene expression level, i.e., the expression level in tissue or bodily fluids from an individual not having the TIR ligand- or IL-1 -related disorder.
  • tissue or bodily fluids e.g., serum, plasma, urine, synovial fluid or spinal fluid
  • the invention is related to a method for treating an individual in need of an increased or decreased level of TlR-like ligand II activity in the body, comprising administering to such an individual a composition comprising a TlR-like ligand II polypeptide or an inhibitor thereof.
  • the invention further provides methods for isolating antibodies that bind specifically to an TlR-like ligand II polypeptide having an amino acid sequence as described herein. Such antibodies may be useful diagnostically or therapeutically as described above.
  • FIG. 1 shows the nucleotide (SEQ ID NO:l) and deduced amino acid (SEQ ID NO:2) sequences of the TlR-like ligand II protein determined by sequencing the cDNA clone contained in ATCC Deposit No. 97655.
  • Amino acids from about 1 to about 26 represent the signal peptide (first underlined sequence); amino acids from about 27 to about 194 the extracellular domain (sequence between the first and second underlined sequences); amino acids from about 195 to about 217 the transmembrane domain (second underlined sequence); and amino acids from about 218 to about 229 the intracellular domain (the remaining sequence).
  • FIG. 2 shows the regions of similarity between the amino acid sequences of the TlR-like ligand II and the protein sequence of GenBank accession No. U41804 (SEQ ID NO:3), showing an overall 56% identity.
  • FIG.3 provides an analysis of the TlR-like ligand II amino acid sequence. Alpha, beta, turn and coil regions; hydrophilicity and hydrophobicity; amphipathic regions; flexible regions; antigenic index and surface probability are shown.
  • the present invention provides an isolated nucleic acid molecule comprising a polynucleotide encoding a TlR-like ligand II protein having an amino acid sequence shown in Figure 1 (SEQ ID NO:2), which was determined by sequencing a cloned cDNA.
  • the TlR-like ligand II protein of the present invention shares sequence homology with the TIR ligand ( Figure 2).
  • the nucleotide sequence in FIG. 1 was obtained by sequencing the HE9BK24 clone, which was deposited on July 12, 1996 at the
  • accession number 97655 The deposited clone is contained in the pBluescript SK(-) plasmid (Stratagene, LaJolla, CA).
  • nucleotide sequences determined by sequencing a DNA molecule herein were determined using an automated DNA sequencer (such as the Model 373 from Applied Biosystems, Inc.), and all amino acid sequences of peptide, polypeptides or proteins encoded by DNA molecules determined herein were expected by translation of a DNA sequence determined as above. Therefore, as is known in the art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein can contain some errors. Nucleotide sequences determined by automation are typically at least about 90% identical, more typically at least about 95% to at least about 99.9% identical to the actual nucleotide sequence of the sequenced DNA molecule.
  • the actual sequence can be more precisely determined by other approaches including manual DNA sequencing methods well known in the art.
  • a single insertion or deletion in a determined nucleotide sequence compared to the actual sequence will cause a frame shift in translation of the nucleotide sequence such that the expected amino acid sequence encoded by a determined nucleotide sequence will be completely different from the amino acid sequence actually encoded by the sequenced DNA molecule, beginning at the point of such an insertion or deletion.
  • nucleotide sequence set forth herein is presented as a sequence of deoxyribonucleotides (abbreviated A, G , C and T).
  • nucleic acid molecule or polynucleotide a sequence of deoxyribonucleotides
  • RNA molecule or polynucleotide the corresponding sequence of ribonucleotides (A, G, C and U) where each thymidine deoxynucleotide (T) in the specified deoxynucleotide sequence is replaced by the ribonucleotide uridine (U).
  • RNA molecule having the sequence in SEQ ID NO: 1 set forth using deoxyribonucleotide abbreviations is intended to indicate an RNA molecule having a sequence in which each deoxynucleotide A, G or C in SEQ ID NO:l has been replaced by the corresponding ribonucleotide A, G or C, and each deoxynucleotide T has been replaced by a ribonucleotide U.
  • isolated nucleic acid molecule(s) is intended a nucleic acid molecule
  • DNA or RNA which has been removed from its native environment
  • recombinant DNA molecules contained in a vector are considered isolated for the purposes of the present invention.
  • isolated DNA molecules include recombinant DNA molecules maintained in heterologous host cells or purified (partially or substantially) DNA molecules in solution.
  • Isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA molecules of the present invention.
  • Isolated nucleic acid molecules according to the present invention further include such molecules produced synthetically.
  • nucleic acid molecule of the present invention encoding an TlR-like ligand II polypeptide can be obtained using standard cloning and screening procedures, such as those for cloning cDNAs using mRNA as starting material.
  • standard cloning and screening procedures such as those for cloning cDNAs using mRNA as starting material.
  • the nucleic acid molecule described in FIG. 1 was discovered in a cDNA library derived from nine week old human embryo tissue. Further, the gene was also found in cDNA libraries derived from the following types of human cells: prostate, anergic
  • T-cell T-cell, TF274 stromal, WI 38, Soares breast, and Soares placenta.
  • the TlR-like ligand II cDNA contains an open reading frame encoding a protein of about 229 amino acid residues whose initiation codon is at positions 55-57 of the nucleotide sequence shown in FIG. 1 (SEQ ID NO. 1); a predicted leader sequence of about 26 amino acid residues and a deduced molecular weight of about 26 kDa.
  • the amino acid sequence of the mature TlR-like ligand II protein is shown in FIG.1 (SEQ ID NO:2) from amino acid residue 27 to residue 229.
  • the mature TlR-like ligand II protein has three main structural domains.
  • the TlR-like ligand II protein of the present invention in Figure 1 is about 56 % identical and about 75 % similar to the TIR ligand, which can be accessed on GenBank as Accession No. U41804.
  • the actual TlR-like ligand II encoded by the deposited cDNA comprises about 229 amino acids, but can be anywhere in the range of 215-245 amino acids; and the deduced leader sequence of this protein is about 26 amino acids, but can be anywhere in the range of about 15 to about 30 amino acids.
  • the exact locations of the Tl R-like ligand II protein extracellular, intracellular and transmembrane domains in Figure 1 may vary slightly (e.g., the exact amino acid positions may differ by about 1 to about 5 residues compared to that shown in Figure 1) depending on the criteria used to define the domain.
  • nucleic acid molecules of the present invention can be in the form of RNA, such as mRNA, or in the form of DNA, including, for instance, cDNA and genomic DNA obtained by cloning or produced synthetically.
  • the DNA can be double-str.anded or single-str.anded.
  • Single-stranded DNA or RNA can be the coding strand, also known as the sense strand, or it can be the non- coding strand, also referred to as the anti-sense strand.
  • Isolated nucleic acid molecules of the present invention include DNA molecules comprising an open reading frame (ORF) with an initiation codon at positions 55-57 of the nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1) and further include DNA molecules which comprise a sequence substantially different that all or part of the ORF whose initiation codon is at position 55-57 of the nucleotide sequence in FIG. 1 (SEQ ID NO. l) but which, due to the degeneracy of the genetic code, still encode the TlR-like ligand II protein or a fragment thereof.
  • ORF open reading frame
  • SEQ ID NO. 1 DNA molecules which comprise a sequence substantially different that all or part of the ORF whose initiation codon is at position 55-57 of the nucleotide sequence in FIG. 1 (SEQ ID NO. l) but which, due to the degeneracy of the genetic code, still encode the TlR-like ligand II protein or a fragment thereof.
  • the genetic code is well known in the art.
  • the invention provides isolated nucleic acid molecules encoding the TlR-like ligand II protein having an amino acid sequence encoded by the cDNA clone contained in the plasmid deposited as ATCC Deposit No. 97655 on July 12, 1996.
  • this nucleic acid molecule will encode the mature polypeptide encoded by the above-described deposited cDNA clone.
  • the invention further provides an isolated nucleic acid molecule having the nucleotide sequence shown in FIG. 1 (SEQ ID NO:l) or the nucleotide sequence of the TlR-like ligand II cDNA contained in the above-described deposited clone, or having a sequence complementary to one of the above sequences.
  • isolated molecules particularly DNA molecules, are useful as probes for gene mapping by in situ hybridization with chromosomes and for detecting expression of the TlR-like ligand II gene in human tissue, for instance, by Northern blot analysis. As described in detail below, detecting altered TlR- like ligand II gene expression in certain tissues may be indicative of certain disorders.
  • the present invention is further directed to fragments of the isolated nucleic acid molecules described herein.
  • a fragment of an isolated nucleic acid molecule having the nucleotide sequence of the deposited cDNA or the nucleotide sequence shown in Figure 1 is intended fragments at least about 15 nt, and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably, at least about 40 nt in length which are useful as diagnostic probes and primers as discussed herein.
  • fragments 50-1200 nt in length are also useful according to the present invention as are fragments corresponding to most, if not all, of the nucleotide sequence of the deposited cDNA or as shown in Figure 1 (SEQ ID NO. 1) .
  • a fragment at least 20 nt in length for example, is intended fragments which include 20 or more contiguous bases from the nucleotide sequence of the deposited cDNA or the nucleotide sequence as shown in Figure 1 (SEQ ID NO. 1). Since the gene has been deposited and the nucleotide sequence shown in Figure 1 (SEQ ID NO 1 ) is provided, generating such DNA fragments would be routine to the skilled artisan. For example, restriction endonuclease cleavage or shearing by sonication could easily be used to generate fragments of various sizes. Alternatively, such fragments could be generated synthetically.
  • Preferred nucleic acid fragments of the present invention include nucleic acid molecules encoding: a polypeptide comprising the TlR-like ligand II extracellular domain (amino acid residues from about 27 to about 194 in Figure 1 (SEQ ID NO: 1); a polypeptide comprising the TlR-like ligand II transmembrane domain (amino acid residues from about 195 to about 217 in Figure 1 (SEQ ID NO 1)); a polypeptide comprising the TlR-like ligand II intracellular domain (amino acid residues from about 218 to about 229 in Figure
  • nucleic acid fragments of the present invention include nucleic acid molecules encoding epitope-bearing portions of the TlR-like ligand II protein.
  • isolated nucleic acid molecules are provided encoding polypeptides comprising the following amino acid residues in Figure
  • SEQ ID NO:2 which the present inventors have determined are antigenic regions of the TlR-like ligand II protein: a polypeptide comprising amino acid residues from about 43 to about 52 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 82 to about 98 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 129 to about
  • the invention provides an isolated nucleic acid molecule comprising a polynucleotide which hybridizes under stringent hybridization conditions to a portion of the polynucleotide in a nucleic acid molecule of the invention described above, for instance, the cDNA clone contained in ATCC Deposit 97655.
  • stringent hybridization conditions is intended overnight incubation at 42°C in a solution comprising: 50% formamide, 5x SSC (150 mM
  • a polynucleotide which hybridizes to a "portion" of a polynucleotide is intended a polynucleotide (either DNA or RNA) hybridizing to at least about 15 nucleotides (nt), and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably at least about 30-70 nt of the reference polynucleotide. These are useful as diagnostic probes and primers as discussed above and in more detail below.
  • polynucleotides hybridizing to a larger portion of the reference polynucleotide for instance, a portion 100-750 nt in length, or even to the entire length of the reference polynucleotide, also useful as probes according to the present invention, as are polynucleotides corresponding to most, if not all, of the nucleotide sequence of the deposited cDNA or the nucleotide sequence as shown in FIG. 1 (SEQ ID NO:l).
  • nucleotide sequence of the reference polynucleotide e.g., the deposited cDNA or the nucleotide sequence as shown in FIG. 1 (SEQ ID NO:l)
  • portions are useful diagnostically either as a probe according to conventional DNA hybridization techniques or as primers for amplification of a target sequence by the polymerase chain reaction
  • TlR-like ligand II cDNA clone Since an TlR-like ligand II cDNA clone has been deposited and its determined nucleotide sequence is provided in FIG. 1 (SEQ ID NO: 1), generating polynucleotides which hybridize to a portion of the TlR-like ligand II cDNA molecule would be routine to the skilled artisan. For example, restriction endonuclease cleavage or shearing by sonication of the TlR-like ligand II cDNA clone could easily be used to generate DNA portions of various sizes which are polynucleotides that hybridize to a portion of the TlR-like ligand II cDNA molecule. Alternatively, the hybridizing polynucleotides of the present invention could be generated synd etically according to known techniques.
  • a polynucleotide which hybridizes only to a poly A sequence such as the 3' terminal poly(A) tract of the TlR-like ligand II cDNA shown in FIG. 1 (SEQ ID NO: 1 )
  • a complementary stretch of T (or U) resides would not be included in a polynucleotide of the invention used to hybridize to a portion of a nucleic acid of the invention, since such a polynucleotide would hybridize to any nucleic acid molecule contain a poly (A) stretch or the complement thereof (e.g., practically any double-stranded cDNA clone).
  • nucleic acid molecules of the present invention which encode the TlR-like ligand II can include, but are not limited to, those encoding the amino acid sequence of the mature polypeptide, by itself; the coding sequence for the mature polypeptide and additional sequences, such as those encoding the about 26 amino acid leader sequence, such as a pre-, or pro- or prepro- protein sequence; the coding sequence of the mature polypeptide, with or without the aforementioned additional coding sequences, together with additional, non- coding sequences, including for example, but not limited to introns and non- coding 5' and 3' sequences, such as the transcribed, non-translated sequences that play a role in transcription, mRNA processing - including splicing and polyadenylation signals, e.g., ribosome binding and stability of mRNA; an additional coding sequence which codes for additional amino acids, such as those which provide additional functionalities.
  • sequence encoding the polypeptide can be fused to a marker sequence, such as a sequence encoding a peptide which facilitates purification of the fused polypeptide.
  • the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector
  • hexa-histidine provides for convenient purification of the fusion protein.
  • the "HA” tag is another peptide useful for purification which corresponds to an epitope derived from the influenza hemagglutinin (HA) protein, which has been described by Wilson et al, Cell 57:767 ( 1984).
  • Other such fusion proteins include the TlR-like ligand II protein or a fragment thereof fused to Fc at the N- or C-terminus.
  • the present invention further relates to variants of the nucleic acid molecules of the present invention, which encode portions, analogs or derivatives of the TlR-like ligand II protein.
  • Variants can occur naturally, such as a natural allelic variant.
  • allelic variant is intended one of several alternate forms of a gene occupying a given locus on a chromosome of an organism.
  • Non- naturally occurring variants can be produced, e.g., using art-known mutagenesis techniques.
  • Such variants include those produced by nucleotide substitutions, deletions or additions. The substitutions, deletions or additions can involve one or more nucleotides.
  • the variants can be altered in coding or non-coding regions or both.
  • Alterations in the coding regions can produce conservative or non- conservative amino acid substitutions, deletions or additions. Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the TlR-like ligand II or portions thereof. Also especially preferred in this regard are conservative substitutions.
  • nucleic acid molecules comprising a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98%, or 99% identical to (a) a nucleotide sequence encoding the full-length TlR-like ligand II having the complete amino acid sequence (including the leader) shown in FIG. 1 (SEQ ID NO:2) or as encoded by the cDNA clone contained in ATCC Deposit No 97655; (b) a nucleotide sequence encoding the mature TlR-like ligand II (full-length polypeptide with the leader sequence removed) having the amino acid sequence at positions from about 27 to about 229 in FIG.
  • nucleotide sequence encoding the Tl R-like ligand II intracellular domain having the amino acid sequence at positions from about 218 to about 229 in FIG. 1 (SEQ ID NO:2) or as encoded by the cDNA clone contained in ATCC Deposit No. 97655; or (f) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), (c), (d), or (e).
  • nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence can include up to five mutations per each 100 nucleotides of the reference nucleotide sequence encoding the TlR-like ligand II polypeptide.
  • a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence up to 5% of the nucleotides in the reference sequence can be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence.
  • These mutations of the reference sequence can occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.
  • nucleic acid molecule is at least 90%, 95%, 96%, 97%, 98%, or 99% identical to, for instance, the nucleotide sequence shown in FIG. 1 or to the nucleotide sequence of the deposited cDNA clone can be determined conventionally using known computer programs such as the BESTFIT program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711. BESTFIT uses the local homology algorithm of Smith and
  • the present application is directed to nucleic acid molecules at least 90%, 95%, 96%, 97%, 98%, or 99% identical to a nucleic acid sequence described above irrespective of whether they encode a polypeptide having TlR-like ligand II protein activity. This is because, even where a particular nucleic acid molecule does not encode a polypeptide having TlR-like ligand II activity, one of skill in the art would still know how to use the nucleic acid molecule, for instance, as a hybridization probe or a polymerase chain reaction (PCR) primer.
  • PCR polymerase chain reaction
  • nucleic acid molecules of the present invention that do not encode a polypeptide having TlR-like ligand II activity include, inter alia, (1) isolating the TlR-like ligand II gene or allelic variants thereof in a cDNA library; (2) in situ hybridization (e.g., "FISH") to metaphase chromosomal spreads to provide precise chromosomal location of the TlR-like ligand II gene as described in Verma et al, Human Chromosomes: a Manual of Basic Techniques, Pergamon
  • nucleic acid molecules having sequences at least 90%, 95%, 96%, 97%, 98%, or 99% identical to a nucleic acid sequence described above which do, in fact, encode a polypeptide having Tl R-like ligand
  • a polypeptide having TlR-like ligand II protein activity is intended polypeptides exhibiting activity similar, but not necessarily identical, to an activity of the TlR-like ligand II protein of the invention as measured in a particular biological assay.
  • TlR-like ligand II activity can be assayed using known receptor binding assays (Mitcham, J.L. et al, J. Biol. Chem. 277:5777- 5783 (1996); and Gayle, M.A. et al, J. Biol. Chem. 277:5784-5789 (1996)).
  • these assays include an NF- ⁇ B gel shift assay, an in vitro Thr-669 kinase assay, and an IL-8 promoter activation assay.
  • an expression vector containing the cDNA for a suitable receptor can be used.
  • This cDNA can be obtained as described (Klemenz, R. et al, Proc, Natl. Acad. Sci. U.S.A. 56:5708-5712 (1989); Tominaga, S., FEBS Lett. 255:301-304; Bergers, G. et al. EMBOJ.
  • T1/ST2 cDNA can be amplified using the polymerase chain reaction.
  • a commercially available cDNA library prepared from mRNA from a suitable tissue or cell type (such as NIH- 3T3 cells (Klemenz, R. et al, Proc, Natl. Acad. Sci. U.S.A. 56:5708-5712 (1989)), can be used as template.
  • a suitable cell line e.g., COS 7 cells
  • Expression of the receptor can be verified by radioimmunoassay (see Mitcham, J.L.
  • TlR-like ligand II protein et al, J. Biol. Chem. 277:5777-5783 (1996).
  • TlR-like ligand II protein et al, J. Biol. Chem. 277:5777-5783 (1996).
  • TlR-like ligand II protein et al, J. Biol. Chem. 277:5777-5783 (1996).
  • duration of stimulation by TlR-like ligand II protein will vary, depending on which assay is used, and can be determined using only routine experimentation.
  • nuclear extracts from transfected cells are prepared immediately after stimulation (Ostrowski, J. et al, J. Biol. Chem. 266: 12,722-12,733 (1991)).
  • a double-stranded synthetic oligonucleotide probe (5' TGACAGAGGGACTTTCCGAGAGGA 3') containing the NF- ⁇ B enhancer element from the immunoglobulin K light chain is 5 '-end labeled by phosphorylation with [ ⁇ - 32 P]ATP.
  • Nuclear extracts (10 ⁇ g) are incubated with radiolabeled probe for 20 minutes at room temperature, and protein-DNA complexes are resolved by electrophoresis in a 0.5X TBE, 10% polyacrylamide gel .
  • cytoplasmic extracts of transfected cells are prepared immediately after stimulation (Bird, T.A. et al, Cytokine 4:429-440 (1992)). 10 ⁇ l of cell extract is added to 20 ⁇ l of reaction mixture containing 20 mM HEPES buffer (pH 7.4), 15 mM MgCl 2 , 15 ⁇ M ATP, 75 ⁇ Ci/ml [ ⁇ - 32 P]ATP, and 750 ⁇ M substrate peptide (residues 663-673 of
  • COS7 cells (1 x 10 5 cells per well in a multi-well tissue culture plate) are cotransfected with the T1/ST2 receptor expression vector and the pIL8p reporter plasmid (Mitcham, J.L. et al,
  • a polypeptide having TlR-like ligand II protein activity includes polypeptides that exhibit TlR-like ligand II protein activity in the above- described assay.
  • nucleic acid molecules having a sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to a nucleic acid sequence described above will encode a polypeptide
  • the present invention also relates to vectors which include the isolated
  • DNA molecules of the present invention are vectors which are genetically engineered with the recombinant vectors, and the production of TlR-like ligand II polypeptides or fragments thereof by recombinant techniques.
  • Recombinant constructs may be introduced into host cells using well known techniques such as infection, transduction, transfection, transvection, electroporation and transformation.
  • the vector may be, for example, a phage, plasmid, viral or retroviral vector. Retroviral vectors may be replication competent or replication defective. In the latter case, viral propagation generally will occur only in complementing host cells.
  • the polynucleotides may be joined to a vector containing a selectable marker for propagation in a host.
  • a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, it may be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.
  • vectors comprising cis-acting control regions to the polynucleotide of interest.
  • Appropriate trans-acting factors may be supplied by the host, supplied by a complementing vector or supplied by the vector itself upon introduction into the host.
  • the vectors provide for specific expression, which may be inducible and/or cell type-specific. Particularly preferred among such vectors are those inducible by environmental factors that are easy to manipulate, such as temperature and nutrient additives.
  • Expression vectors useful in the present invention include chromosomal-, episomal- and virus-derived vectors, e.g., vectors derived from bacterial plasmids, bacteriophage, yeast episomes, yeast chromosomal elements, viruses such as baculoviruses, papova viruses, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as cosmids and phagemids.
  • the DNA insert should be operatively linked to an appropriate promoter, such as the phage lambda PL promoter, the E.
  • the expression constructs will further contain sites for transcription initiation, termination and, in the transcribed region, a ribosome binding site for translation.
  • the coding portion of the mature transcripts expressed by the constructs will include a translation initiating AUG at the beginning and a termination codon appropriately positioned at the end of the polypeptide to be translated.
  • the expression vectors will preferably include at least one selectable marker.
  • markers include dihydrofolate reductase or neomycin resistance for eukaryotic cell culture and tetracycline or ampicillin resistance genes for culturing in E. coli and other bacteria.
  • Representative examples of appropriate hosts include bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS and Bowes melanoma cells; and plant cells. Appropriate culture media and conditions for the above-described host cells are known in the art.
  • vectors preferred for use in bacteria include pQE70, pQE60 and pQE-9, available from Qiagen; pBS vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNHl ⁇ a, pNH18A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia.
  • eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; pSVK3, pBPV, pMSG and pSVL available from Pharmacia, and pA2 available from Qiagen.
  • Other suitable vectors will be readily apparent to the skilled artisan.
  • known bacterial promoters suitable for use in the present invention include the E. coli lac ⁇ and lacL promoters, the T3 and T7 promoters, the gpt promoter, the lambda PR and PL promoters and the trp promoter.
  • Suitable eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, the promoters of retroviral LTRs, such as those of the Rous sarcoma virus (RSV), and metallothionein promoters, such as the mouse metallothionein-I promoter.
  • retroviral LTRs such as those of the Rous sarcoma virus (RSV)
  • metallothionein promoters such as the mouse metallothionein-I promoter.
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid- mediated transfection, electroporation, transduction, infection or other methods. Such methods .are described in many standard laboratory manuals, such as Davis et al, Basic Methods in Molecular Biology (1986).
  • Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act to increase transcriptional activity of a promoter in a given host cell-type.
  • enhancers include the SV40 enhancer, which is located on the late side of the replication origin at bp 100 to 270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, .and adenovirus enhancers.
  • secretion of the translated protein into the lumen of the endoplasmic reticulum, into the periplasmic space or into the extracellular environment appropriate secretion signals may be incorporated into the expressed polypeptide.
  • the signals may be endogenous to the polypeptide or they may be heterologous signals.
  • the polypeptide may be expressed in a modified form, such as a fusion protein, and may include not only secretion signals but also additional heterologous functional regions. For instance, a region of additional amino acids, particularly charged amino acids, may be added to the N-terminus of the polypeptide to improve stability and persistence in the host cell, during purification or during subsequent handling and storage. Also, peptide moieties may be added to the polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the polypeptide. The addition of peptide moieties to polypeptides to engender secretion or excretion, to improve stability and to facilitate purification, among others, are familiar and routine techniques in the art.
  • a preferred fusion protein comprises a heterologous region from immunoglobulin that is useful to solubilize proteins. For example, EP-A-O 464
  • fusion proteins comprising various portions of constant region of immunoglobulin molecules together with another human protein or part thereof.
  • the Fc part in a fusion protein is thoroughly advantageous for use in therapy and diagnosis and thus results, for example, in improved pharmacokinetic properties (EP-A 0232262).
  • EP-A 0232262 it would be desirable to be able to delete the Fc part after the fusion protein has been expressed, detected and purified in the advantageous manner described. This is the case when Fc portion proves to be a hindrance to use in therapy and diagnosis, for example when the fusion protein is to be used as .antigen for immunizations.
  • human proteins such as, WL5- has been fused with Fc portions for the purpose of high-throughput screening assays to identify antagonists of hIL-5. See, D. Bennett et al., Journal of Molecular Recognition, Vol. 8 52-58 (1995) and K. Johanson et al., The Journal of Biological Chemistry, Vol. 270, No. 16, pp 9459-9471 (1995).
  • the TlR-like ligand II can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography (“HPLC”) is employed for purification.
  • HPLC high performance liquid chromatography
  • Polypeptides of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells. Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. In addition, polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes.
  • the invention further provides an isolated Tl R-like ligand II polypeptide having the amino acid sequence encoded by the deposited cDNA, or the amino acid sequence in FIG. 1 (SEQ ID NO:2), or a peptide or polypeptide comprising a portion of the above polypeptides.
  • the terms "peptide” and “oligopeptide” are considered synonymous (as is commonly recognized) and each term can be used interchangeably as the context requires to indicate a chain of at least two amino acids coupled by peptidyl linkages.
  • polypeptide is used herein for chains containing more than ten amino acid residues. All oligopeptide and polypeptide formulas or sequences herein are written from left to right and in the direction from amino terminus to carboxy terminus.
  • isolated polypeptide or protein is intended a polypeptide or protein removed from its native environment.
  • recombinantly produced polypeptides and proteins expressed in host cells are considered isolated for purposes of the invention as are native or recombinant polypeptides and proteins which have been substantially purified by any suitable technique such as, for example, the one-step method described in Smith and Johnson, Gene 67.31 -40 (1988).
  • the invention further includes variations of the TlR-like ligand II which show substantial TlR-like ligand II activity or which include regions of TlR-like ligand II such as the protein portions discussed below.
  • Such mutants include deletions, insertions, inversions, repeats, and type substitutions (for example, substituting one hydrophilic residue for another, but not strongly hydrophilic for strongly hydrophobic as a rule). Small changes or such "neutral" amino acid substitutions will generally have little effect on activity.
  • conservative substitutions are the replacements, one for another, among the aliphatic amino acids Ala, Val, Leu and He; interchange of the hydroxyl residues Ser and Thr, exchange of the acidic residues Asp and Glu, substitution between the amide residues Asn and Gin, exchange of the basic residues Lys and Arg and replacements among the aromatic residues Phe, Tyr.
  • polypeptides of the present invention include the polypeptide encoded by the deposited cDNA including the leader sequence, the polypeptide encoded by the deposited the cDNA minus the leader (i.e., the mature protein), the polypeptide of FIG. 1 (SEQ ID NO:2) including the leader, the polypeptide of FIG. 1 (SEQ ID NO:2) minus the leader, the TlR-like ligand II extracellular domain, the TlR-like ligand II transmembrane domain, and the TlR-like ligand II intracellular domain as well as polypeptides which have at least 90% similarity, more preferably at least 95% similarity, and still more preferably at least 96%,
  • polypeptides of the present invention include polypeptides at least 80% identical, more preferably at least 90% or 95% identical, still more preferably at least 96%, 97%, 98%, or 99% identical to a polypeptide described herein, and also include portions of such polypeptides with at least 30 amino acids and more preferably at least 50 amino acids.
  • % similarity for two polypeptides is intended a similarity score produced by comparing the amino acid sequences of the two polypeptides using the BESTFIT program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive,
  • BESTFIT uses the local homology algorithm of Smith and Waterman, Adv. Appl. Math. 2:482-489 (1981), to find the best segment of similarity between two sequences.
  • a reference amino acid sequence of a Tl R-like ligand II polypeptide is intended that the amino acid sequence of the polypeptide is identical to the reference sequence except that the polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the reference amino acid sequence of the TlR-like ligand II polypeptide.
  • up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference sequence.
  • alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
  • whether any particular polypeptide is at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the amino acid sequence shown in FIG. 1 (SEQ ID NO:2) or to the amino acid sequence encoded by deposited cDNA clone can be determined conventionally using known computer programs such the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 5371 1.
  • the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference amino acid sequence and that gaps in homology of up to 5% of the total number of amino acid residues in the reference sequence are allowed.
  • polypeptides of the present invention can be used to raise polyclonal and monoclonal antibodies, which are useful in diagnostic assays for detecting TlR-like ligand II expression as described below or as agonists and antagonists capable of enhancing or inhibiting Tl R-like ligand
  • the invention provides a peptide or polypeptide comprising an epitope-bearing portion of a polypeptide of the invention.
  • the epitope of this polypeptide portion is an immunogenic or antigenic epitope of a polypeptide of the invention.
  • An "immunogenic epitope" is defined as a part of a protein that elicits an antibody response when the whole protein is the immunogen.
  • immunogenic epitopes are believed to be confined to a few loci on the molecule.
  • a region of a protein molecule to which an antibody can bind is defined as an "antigenic epitope.”
  • the number of immunogenic epitopes of a protein generally is less than the number of antigenic epitopes. See, for instance, Geysen, H.M. et al, Proc. Natl. Acad. Sci. USA 57:3998-4002 (1984).
  • peptides or polypeptides bearing an antigenic epitope i.e., that contain a region of a protein molecule to which an antibody can bind
  • relatively short synthetic peptides that mimic part of a protein sequence are routinely capable of eliciting an antiserum that reacts with the partially mimicked protein. See, for instance, Sutcliffe, J.G. et al, Science 219:660-666 (1983).
  • Peptides capable of eliciting protein-reactive sera are frequently represented in the primary sequence of a protein, can be characterized by a set of simple chemical rules, and are confined neither to immunodominant regions of intact proteins (i.e., immunogenic epitopes) nor to the amino or carboxyl terminals. Peptides that are extremely hydrophobic and those of six or fewer residues generally are ineffective at inducing antibodies that bind to the mimicked protein; longer, soluble peptides, especially those containing proline residues, usually are effective. Sutcliffe et al, supra, at 661.
  • 18 of 20 peptides designed according to these guidelines containing 8-39 residues covering 75% of the sequence of the influenza virus hemagglutinin HA1 polypeptide chain, induced antibodies that reacted with the HA1 protein or intact virus; and 12/12 peptides from the MuLV polymerase and 18/18 from the rabies glycoprotein induced antibodies that precipitated the respective proteins.
  • Antigenic epitope-bearing peptides and polypeptides of the invention are therefore useful to raise antibodies, including monoclonal antibodies, that bind specifically to a polypeptide of the invention.
  • a high proportion of hybridomas obtained by fusion of spleen cells from donors immunized with an antigen epitope-bearing peptide generally secrete antibody reactive with the native protein.
  • the antibodies raised by antigenic epitope-bearing peptides or polypeptides are useful to detect the mimicked protein, .and antibodies to different peptides may be used for tracking the fate of various regions of a protein precursor which undergoes posttranslation processing.
  • the peptides and anti-peptide antibodies may be used in a variety of qualitative or quantitative assays for the mimicked protein, for instance in competition assays since it has been shown that even short peptides (e.g., about 9 amino acids) can bind and displace the larger peptides in immunoprecipitation assays. See, for instance, Wilson, LA. et al, Cell 57:767-778 (1984) at 777.
  • the anti-peptide antibodies of the invention also are useful for purification of the mimicked protein, for instance, by adsorption chromatography using methods well known in the art.
  • Antigenic epitope-bearing peptides and polypeptides of the invention designed according to the above guidelines preferably contain a sequence of at least seven, more preferably at least nine and most preferably between about 15 to about 30 amino acids contained within the amino acid sequence of a polypeptide of the invention.
  • peptides or polypeptides comprising a larger portion of an amino acid sequence of a polypeptide of the invention, containing about 30 to about 50 amino acids, or any length up to and including the entire amino acid sequence of a polypeptide of the invention also are considered epitope-bearing peptides or polypeptides of the invention and also are useful for inducing antibodies that react with the mimicked protein.
  • the amino acid sequence of the epitope-bearing peptide is selected to provide substantial solubility in aqueous solvents (i.e., the sequence includes relatively hydrophilic residues and highly hydrophobic sequences are preferably avoided); and sequences containing proline residues are particularly preferred.
  • Non-limiting examples of antigenic polypeptides that can be used to generate TlR-like ligand II specific antibodies or fragments include the following: a polypeptide comprising amino acid residues from about 43 to about
  • the epitope-bearing peptides and polypeptides of the invention may be produced by any conventional means for making peptides or polypeptides including recombinant means using nucleic acid molecules of the invention. For instance, a short epitope-bearing amino acid sequence may be fused to a larger polypeptide which acts as a carrier during recombinant production and purification, as well as during immunization to produce anti-peptide antibodies. Epitope-bearing peptides also may be synthesized using known methods of chemical synthesis.
  • Houghten has described a simple method for synthesis of large numbers of peptides, such as 10-20 mg of 248 different 13 residue peptides representing single amino acid variants of a segment of the HA1 polypeptide which were prepared and characterized (by ELISA-type binding studies) in less than four weeks.
  • Houghten, R.A. Proc. Natl. Acad. Sci. USA 52:5131-5135 (1985).
  • This "Simultaneous Multiple Peptide Synthesis (SMPS)" process is further described in U.S. Patent No. 4,631,211 to Houghten et al.
  • Epitope-bearing peptides and polypeptides of the invention are used to induce antibodies according to methods well known in the art. See, for instance, Sutcliffe et al, supra; Wilson et al, supra; Chow, M. et al, Proc. Natl. Acad. Sci. USA 52:910-914; and Bittle, F.J. et al, J. Gen. Virol. 66:2347-2354 (1985).
  • animals may be immunized with free peptide; however, anti-peptide antibody titer may be boosted by coupling of the peptide to a macromolecular carrier, such as keyhole limpet hemacyanin (KLH) or tetanus toxoid.
  • KLH keyhole limpet hemacyanin
  • peptides containing cysteine may be coupled to carrier using a linker such as m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), while other peptides may be coupled to carrier using a more general linking agent such as glutaraldehyde.
  • Animals such as rabbits, rats and mice are immunized with either free or carrier-coupled peptides, for instance, by intraperitoneal and/or intradermal injection of emulsions containing about 100 ⁇ g peptide or carrier protein and Freund's adjuvant. Several booster injections may be needed, for instance, at intervals of about two weeks, to provide a useful titer of anti-peptide antibody which can be detected, for example, by ELISA assay using free peptide adsorbed to a solid surface.
  • the titer of anti-peptide antibodies in serum from an immunized animal may be increased by selection of anti-peptide antibodies, for instance, by adsorption to the peptide on a solid support and elution of the selected antibodies according to methods well known in the .art.
  • Immunogenic epitope-bearing peptides of the invention i.e., those parts of a protein that elicit an antibody response when the whole protein is the immunogen, are identified according to methods known in the art. For instance, Geysen et al. (1984), supra, discloses a procedure for rapid concurrent synthesis on solid supports of hundreds of peptides of sufficient purity to react in an enzyme-linked immunosorbent assay.
  • a peptide bearing an immunogenic epitope of a desired protein may be identified routinely by one of ordinary skill in the art.
  • the immunologically important epitope in the coat protein of foot-and-mouth disease virus was located by Geysen et al. with a resolution of seven amino acids by synthesis of an overlapping set of all 208 possible hexapeptides covering the entire 213 amino acid sequence of the protein. Then, a complete replacement set of peptides in which all 20 amino acids were substituted in turn at every position within the epitope were synthesized, and the particular amino acids conferring specificity for the reaction with antibody were determined.
  • peptide analogs of the epitope-bearing peptides of the invention can be made routinely by this method.
  • U.S. Patent No. 4,708,781 to Geysen (1987) further describes this method of identifying a peptide bearing an immunogenic epitope of a desired protein.
  • U.S. Patent No. 5,194,392 to Geysen (1990) describes a general method of detecting or determining the sequence of monomers (amino acids or other compounds) which is a topological equivalent of the epitope (i.e., a "mimotope") which is complementary to a particular paratope (antigen binding site) of an antibody of interest. More generally, U.S. Patent No. 4,433,092 to Geysen (1989) describes a method of detecting or determining a sequence of monomers which is a topographical equivalent of a ligand which is complementary to the ligand binding site of a particular receptor of interest. Similarly, U.S. Patent No. 5,480,971 to Houghten, R. A.
  • TlR-like ligand II polypeptides of the present invention and the epitope-bearing fragments thereof described above can be combined with parts of the constant domain of immunoglobulins (IgG), resulting in chimeric polypeptides.
  • IgG immunoglobulins
  • These fusion proteins facilitate purification and show an increased half-life in vivo. This has been shown, e.g., for chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins (EPA 394,827; Traunecker et al, Nature 557:84- 86 (1988)).
  • Fusion proteins that have a disulfide-linked dimeric structure due to the IgG part can also be more efficient in binding and neutralizing other molecules than the monomeric TlR-like ligand II protein or protein fragment alone (Fountoulakis et al, J. Biochem. 270:3958-3964 (1995)).
  • TlR-like ligand II related disorders it is believed that substantially altered (increased or decreased) levels of TlR-like ligand II gene expression can be detected in tissue or other cells or bodily fluids (e.g., sera, plasma, urine, synovial fluid or spinal fluid) taken from an individual having such a disorder, relative to a "standard" TlR-like ligand II gene expression level, that is, the TlR- like ligand II gene expression level in tissue or bodily fluids from an individual not having the disorder.
  • tissue or other cells or bodily fluids e.g., sera, plasma, urine, synovial fluid or spinal fluid
  • the invention provides a diagnostic method useful during diagnosis of an TlR-like ligand Il-related disorder, which involves measuring the expression level of the gene encoding the TlR-like ligand II in tissue or other cells or body fluid from an individual and comparing the measured gene expression level with a standard TlR-like ligand II gene expression level, whereby an increase or decrease in the gene expression level compared to the standard is indicative of an TlR-like ligand II related disorder.
  • TlR-like ligand Il-related disorders are believed to include, but are not limited to, leukemia, lymphoma, arteriosclerosis, autoimmune diseases, inflammatory diseases, Alzheimer's disease, ophthalmic diseases, apoptosis, intrauterine growth retardation, preeclampsia, pemphigus and psoriasis.
  • measuring the expression level of the gene encoding the TlR-like ligand II is intended qualitatively or quantitatively measuring or estimating the level of the TlR-like ligand II protein or the level of the mRNA encoding the TlR-like ligand II protein in a first biological sample either directly (e.g., by determining or estimating absolute protein level or mRNA level) or relatively (e.g., by comparing to the TlR-like ligand II protein level or mRNA level in a second biological sample).
  • the TlR-like ligand II protein level or mRNA level in the first biological sample is measured or estimated and compared to a standard TlR-like ligand II protein level or mRNA level, the standard being taken from a second biological sample obtained from an individual not having the disorder or being determined by averaging levels from a population of individuals not having the disorder.
  • a standard TlR-like ligand II protein level or mRNA level is known, it can be used repeatedly as a standard for comparison.
  • biological sample any biological sample obtained from an individual, body fluid, cell line, tissue culture, or other source which contains TlR-like ligand II protein or mRNA.
  • biological samples include body fluids (such as sera, plasma, urine, synovial fluid and spinal fluid) which contain secreted mature TlR-like ligand II, or tissue sources found to express TlR-like ligand II protein. Methods for obtaining tissue biopsies and body fluids from mammals are well known in the art. Where the biological sample is to include mRNA, a tissue biopsy is the preferred source.
  • Total cellular RNA can be isolated from a biological sample using any suitable technique such as the single-step guanidinium-thiocyanate-phenol- chloroform method described in Chomczynski and Sacchi, Anal. Biochem. 162:156-159 (1987). Levels of mRNA encoding an TlR-like ligand II are then assayed using any appropriate method. These include Northern blot analysis, S 1 nuclease mapping, the polymerase chain reaction (PCR), reverse transcription in combination with the polymerase chain reaction (RT-PCR), and reverse transcription in combination with the ligase chain reaction (RT-LCR).
  • PCR polymerase chain reaction
  • RT-PCR reverse transcription in combination with the polymerase chain reaction
  • RT-LCR reverse transcription in combination with the ligase chain reaction
  • RNA is prepared from a biological sample as described above.
  • an appropriate buffer such as glyoxal/dimethyl sulfoxide/sodium phosphate buffer
  • the filter is prehybridized in a solution containing formamide, SSC, Denhardt's solution, denatured salmon sperm, SDS, and sodium phosphate buffer.
  • TlR-like ligand II cDNA labeled according to any appropriate method such as the 3 P-multiprimed DNA labeling system (Amersham) is used as probe. After hybridization overnight, the filter is washed and exposed to x-ray film.
  • cDNA for use as probe according to the present invention is described in the sections above and will preferably at least 15 bp in length.
  • SI mapping can be performed as described in Fujita et al, Cell 49:357- 367 (1987).
  • probe DNA for use in SI mapping, the sense strand of above-described cDNA is used as a template to synthesize labeled antisense DNA.
  • the antisense DNA can then be digested using an appropriate restriction endonuclease to generate further DNA probes of a desired length.
  • Such antisense probes are useful for visualizing protected bands corresponding to the target mRNA (i.e., mRNA encoding the TlR-like ligand II).
  • Northern blot analysis can be performed as described above.
  • levels of mRNA encoding the TlR-like ligand II are assayed using the RT-PCR method described in Makino et al, Technique 2:295-301
  • this method involves adding total RNA isolated from a biological sample in a reaction mixture containing a RT primer and appropriate buffer. After incubating for primer annealing, the mixture can be supplemented with a RT buffer, dNTPs, DTT, RNase inhibitor and reverse transcriptase. After incubation to achieve reverse transcription of the RNA, the RT products .are then subject to PCR using labeled primers. Alternatively, rather than labeling the primers, a labeled dNTP can be included in the PCR reaction mixture.
  • PCR amplification can be performed in a DNA thermal cycler according to conventional techniques. After a suitable number of rounds to achieve amplification, the PCR reaction mixture is electrophoresed on a polyacrylamide gel. After drying the gel, the radioactivity of the appropriate bands (corresponding to the mRNA encoding the TlR-like ligand II) is quantified using an imaging analyzer. RT and PCR reaction ingredients and conditions, reagent and gel concentrations, and labeling methods are well known in the art. Variations on the RT-PCR method will be apparent to the skilled artisan.
  • any set of oligonucleotide primers which will amplify reverse transcribed target mRNA can be used and can be designed as described in the sections above.
  • Assaying TlR-like ligand II levels in a biological sample can occur using any art-known method. Preferred for assaying TlR-like ligand II levels in a biological sample are antibody-based techniques. For example, TlR-like ligand II expression in tissues can be studied with classical immunohistological methods. In these, the specific recognition is provided by the primary antibody (polyclonal or monoclonal) but the secondary detection system can utilize fluorescent, enzyme, or other conjugated secondary antibodies. As a result, an immunohistological staining of tissue section for pathological examination is obtained.
  • Tissues can also be extracted, e.g., with urea and neutral detergent, for the liberation of TlR-like ligand II for Western-blot or dot/slot assay (Jalkanen, M, et al, J. Cell. Biol 707:976-985 (1985); Jalkanen, M, et al, J. Cell . Biol.
  • TlR-like ligand II can be accomplished using isolated TlR-like ligand II as a standard. This technique can also be applied to body fluids. With these samples, a molar concentration of TlR-like ligand II will aid to set standard values of TlR-like ligand II content for different body fluids, like serum, plasma, urine, synovial fluid, spinal fluid, etc. The normal appearance of TlR-like ligand II amounts can then be set using values from healthy individuals, which can be compared to those obtained from a test subject. '
  • TlR-like ligand II levels include immunoassays, such as the enzyme linked immunosorbent assay
  • TlR-like ligand II- specific monoclonal antibodies can be used both as an immunoadsorbent and as an enzyme-labeled probe to detect and quantify the TlR-like ligand II.
  • the amount of Tl R-like ligand II present in the sample can be calculated by reference to the amount present in a standard preparation using a linear regression computer algorithm.
  • Such an ELISA for detecting a tumor antigen is described in Iacobelli et al, Breast Cancer Research and Treatment 77:19-30 (1988).
  • two distinct specific monoclonal antibodies can be used to detect TlR-like ligand II in a body fluid. In this assay, one of the antibodies is used as the immunoadsorbent and the other as the enzyme-labeled probe.
  • the above techniques may be conducted essentially as a "one-step" or
  • the "one-step” assay involves contacting TlR-like ligand II with immobilized antibody and, without washing, contacting the mixture with the labeled antibody.
  • the “two-step” assay involves washing before contacting the mixture with the labeled antibody.
  • Other conventional methods may also be employed as suitable. It is usually desirable to immobilize one component of the assay system on a support, thereby allowing other components of the system to be brought into contact with the component and readily removed from the sample.
  • Suitable enzyme labels include, for example, those from the oxidase group, which catalyze the production of hydrogen peroxide by reacting with substrate.
  • Glucose oxidase is particularly preferred as it has good stability and its substrate (glucose) is readily available.
  • Activity of an oxidase label may be assayed by measuring the concentration of hydrogen peroxide formed by the enzyme-labeled antibody/substrate reaction.
  • other suitable labels include radioisotopes, such as iodine ( I25 I, ,21 I), carbon ( M C), sulfur ( 35 S), tritium ( 3 H), indium ( ! 12 In), and technetium ( 99m Tc), and fluorescent labels, such as fluorescein and rhodamine, and biotin.
  • TlR-like ligand II can also be detected in vivo by imaging.
  • Antibody labels or markers for in vivo imaging of TlR-like ligand II include those detectable by X-radiography, NMR or ESR.
  • suitable labels include radioisotopes such as barium or cesium, which emit detectable radiation but are not overtly harmful to the subject.
  • Suitable markers for NMR and ESR include those with a detectable characteristic spin, such as deuterium, which may be incorporated into the antibody by labeling of nutrients for the relevant hybridoma.
  • a TlR-like ligand Il-specific antibody or antibody fragment which has been labeled with .an appropriate detectable imaging moiety such as a radioisotope (for example, l31 I, " 2 In, 99m Tc), a radio-opaque substance, or a material detectable by nuclear magnetic resonance, is introduced (for example, parenterally, subcutaneously or intraperitoneally) into the mammal to be examined for a disorder.
  • a radioisotope for example, l31 I, " 2 In, 99m Tc
  • a radio-opaque substance for example, parenterally, subcutaneously or intraperitoneally
  • the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of 99m Tc.
  • the labeled antibody or antibody fragment will then preferentially accumulate at the location of cells which contain TlR-like ligand II.
  • In vivo tumor imaging is described in S. W. Burchiel et al, "Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments" (Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, Burchiel, S.W. and Rhodes, B.A. eds., Masson Publishing Inc., (1982)).
  • Tl R-like ligand II specific antibodies for use in the present invention can be raised against the intact TlR-like ligand II or an antigenic polypeptide fragment thereof, which may presented together with a carrier protein, such as an albumin, to an animal system (such as rabbit or mouse) or, if it is long enough (at least about 25 amino acids), without a carrier.
  • a carrier protein such as an albumin
  • antibody As used herein, the term "antibody” (Ab) or “monoclonal antibody” (Mab) is meant to include intact molecules as well as antibody fragments (such as, for example, Fab and F(ab') 2 fragments) which are capable of specifically binding to TlR-like ligand II. Fab and F(ab') 2 fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibody (Wahl et al, J. Nucl. Med. 24:316-325 (1983)). Thus, these portions are preferred.
  • Fab and F(ab') 2 fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibody (Wahl et al, J. Nucl. Med. 24:316-325 (1983)). Thus, these portions are preferred.
  • the antibodies of the present invention may be prepared by any of a variety of methods. For example, cells expressing the TlR-like ligand II or an antigenic fragment thereof can be administered to an animal in order to induce the production of sera containing polyclonal antibodies.
  • a preparation of TlR-like ligand II protein is prepared and purified as described above to render it substantially free of natural contaminants. Such a preparation is then introduced into an animal in order to produce polyclonal antisera of greater specific activity.
  • the antibodies of the present invention are monoclonal antibodies (or TlR-like ligand II binding fragments thereof).
  • Such monoclonal antibodies can be prepared using hybridoma technology (Colligan, Current Protocols in Immunology, Wiley Interscience, New York (1990-1996); Harlow & Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N. Y. ( 1988), Chapters 6-9, Current Protocols in Molecular
  • Such procedures involve immunizing an animal (preferably a mouse) with an TlR-like ligand II antigen or, more preferably, with an TlR-like ligand Il-expressing cell. Suitable cells can be recognized by their capacity to bind anti- TlR-like ligand II antibody.
  • Such cells may be cultured in any suitable tissue culture medium; however, it is preferable to culture cells in Earle's modified Eagle's medium supplemented with 10% fetal bovine serum (inactivated at about 56°C), and supplemented with about 10 ⁇ g/1 of nonessential amino acids, about 1,000 U/ml of penicillin, and about 100 ⁇ g/ml of streptomycin.
  • the splenocytes of such mice are extracted and fused with a suitable myeloma cell line.
  • Any suitable myeloma cell line may be employed in accordance with the present invention; however, it is preferable to employ the parent myeloma cell line (SP 2 O), available from the American Type Culture Collection (ATCC) (Rockville, Maryland, USA).
  • the resulting hybridoma cells are selectively maintained in HAT medium, and then cloned by limiting dilution as described by Wands etal, Gastroenterology 50:225-232 (1981); H ⁇ irlow & Lane, infra, Chapter 7.
  • the hybridoma cells obtained through such a selection are then assayed to identify clones which secrete antibodies capable of binding the TlR- like ligand II antigen.
  • additional antibodies capable of binding to the TlR-like ligand II antigen may be produced in a two-step procedure through the use of anti-idiotypic antibodies.
  • TlR-like ligand II specific antibodies are used to immunize an animal, preferably a mouse.
  • the splenocytes of such an animal are then used to produce hybridoma cells, and the hybridoma cells are screened to identify clones which produce an antibody whose ability to bind to the TlR-like ligand Il-specific antibody can be blocked by the TlR-like ligand II antigen.
  • Such antibodies comprise anti-idiotypic antibodies to the TlR-like ligand Il-specific antibody and can be used to immunize an animal to induce formation of further TlR-like ligand Il-specific antibodies.
  • Fab and F(ab') 2 and other fragments of the antibodies of the present invention may be used according to the methods disclosed herein.
  • Such fragments are typically produced by proteolytic cleavage, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab') 2 fragments).
  • enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab') 2 fragments).
  • TlR-like ligand Il-binding fragments can be produced through the application of recombinant DNA technology or through synthetic chemistry.
  • chimeric monoclonal antibodies can be produced using genetic constructs derived from hybridoma cells producing the monoclonal antibodies described above. Methods for producing chimeric antibodies are known in the art. See, for review, Morrison, Science 229:1202 (1985); Oi et al, BioTechniques 4:214 (1986); Cabilly et al, U.S. Patent No.
  • suitable labels for the TlR-like ligand Il-specific antibodies of the present invention are provided below.
  • suitable enzyme labels include malate dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, yeast-alcohol dehydrogenase, alpha-glycerol phosphate dehydrogenase, triose phosphate isomerase, peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase, and acetylcholine esterase.
  • radioisotopic labels examples include 3 H, '"In, 125 I, I , 1, 32 P, 35 S, l C, 5, Cr, "To, 58 Co, 59 Fe, 75 Se, ,52 Eu, "Y, 67 Cu, 2,7 Ci, 21 'At, 212 Pb, 47 Sc, ,09 Pd, etc.
  • '"In is a preferred isotope where in vivo imaging is used since its avoids the problem of dehalogenation of the l25 I or l31 I-labeled monoclonal antibody by the liver.
  • this radionucleotide has a more favorable gamma emission energy for imaging (Perkins et al, Eur. J. Nucl Med.
  • non-radioactive isotopic labels examples include l57 Gd, 55 Mn,
  • fluorescent labels examples include an 152 Eu label, a fluorescein label, an isothiocyanate label, a rhodamine label, a phycoerythrin label, a phycocyanin label, an allophycocyanin label, an o-phthaldehyde label, and a fluorescamine label.
  • Suitable toxin labels include diphtheria toxin, ricin, and cholera toxin.
  • chemiluminescent labels include a luminal label, an isoluminal label, an aromatic acridinium ester label, an imidazole label, an acridinium salt label, an oxalate ester label, a luciferin label, a luciferase label, and an aequorin label.
  • nuclear magnetic resonance contrasting agents examples include heavy metal nuclei such as Gd, Mn, and Fe.
  • Typical techniques for binding the above-described labels to antibodies are provided by Kennedy et al. (Clin. Chim. Ada 70: 1-31 (1976)), .and Schurs et al (Clin. Chim. Ada 57:1 -40 (1977)). Coupling techniques mentioned in the latter are the glutaraldehyde method, the periodate method, the dimaleimide method, the m-maleimidobenzyl-N-hydroxy-succinimide ester method, all of which methods are incorporated by reference herein.
  • the nucleic acid molecules of the present invention are also valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
  • Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location.
  • the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
  • the cDNA herein disclosed is used to clone genomic DNA of an TlR-like ligand II gene. This can be accomplished using a variety of well known techniques and libraries, which generally are available commercially. The genomic DNA then is used for in situ chromosome mapping using well known techniques for this purpose. Typically, in accordance with routine procedures for chromosome mapping, some trial and error may be necessary to identify a genomic probe that gives a good in situ hybridization signal.
  • sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3' untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified portion. PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
  • mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow- sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
  • Fluorescence in situ hybridization of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step.
  • This technique can be used with probes from the cDNA as short as 50 or 60 bp.
  • Verma et al Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York (1988).
  • the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V.
  • a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb).
  • TlR-like ligand II polypeptides of the present invention share biological activities with interleukin-1 (IL-1) and the TIR ligand.
  • IL-1 interleukin-1
  • the TlR-like ligand II (particularly the mature form) can be exogenously added to cells, tissues, or the body of an individual to produce a therapeutic effect.
  • disorders caused by a decrease in the standard level of TlR-like ligand II protein activity can be treated by administering an effective amount of a TlR-like ligand II polypeptide of the invention.
  • a pharmaceutical composition is administered comprising an amount of an isolated TlR-like ligand II polypeptide of the invention effective to increase the
  • TlR-like ligand II protein activity TlR-like ligand II protein activity. Disorders where such a therapy would likely be effective are discussed above and below.
  • TlR-like ligand II polypeptide can be determined empirically for each condition where administration of a such a polypeptide is indicated.
  • the polypeptide having Tl R- like ligand II activity can be administered in pharmaceutical compositions in combination with one or more pharmaceutically acceptable carriers, diluents and/or excipients. It will be understood that, when administered to a human patient, the total daily usage of the pharmaceutical compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment.
  • the specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the type and degree of the response to be achieved; the specific composition an other agent, if any, employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the composition; the duration of the treatment; drugs (such as a chemotherapeutic agent) used in combination or coincidental with the specific composition; and like factors well known in the medical arts.
  • the TlR-like ligand II composition to be used in the therapy will also be formulated and dosed in a fashion consistent with good medical practice, taking into account the clinical condition of the individual patient (especially the side effects of treatment with TlR-like ligand II alone), the site of delivery of the TlR-like ligand II composition, the method of administration, the scheduling of administration, and other factors known to practitioners.
  • An "effective amount" of a TlR-like ligand II polypeptide for purposes herein is thus determined by such considerations.
  • the total pharmaceutically effective amount of a TlR-like ligand II polypeptide administered parenterally per dose will be in the range of about 0.01 ng/kg/day to 10 ⁇ g/kg/day of patient body weight, although, as noted above, this will be subject to therapeutic discretion. More preferably, this dose is at least 1.0 ng/kg/day, and most preferably for humans between about 1.0 to 100 ng/kg/day for the hormone.
  • the Tl R-like ligand II is typically administered at a dose rate of about 0.01 ng/kg/hour to about 100 ng/kg/hour, either by 1-4 injections per day or by continuous subcutaneous infusions, for example, using a mini-pump. An intravenous bag solution may also be employed.
  • TlR-like ligand II polypeptide treatment to affect the immune system appears to be optimal if continued longer than a certain minimum number of days, 7 days in the case of the mice.
  • the length of treatment needed to observe changes and the interval following treatment for responses to occur appears to vary depending on the desired effect.
  • the TlR-like ligand II polypeptide is also suitably administered by sustained-release systems.
  • sustained-release compositions include semi-permeable polymer matrices in the form of shaped articles, e.g., films, or microcapsules.
  • Sustained-release matrices include polylactides (U.S.
  • Sustained- release TlR-like ligand II compositions also include a liposomally entrapped TI R-1 ' WP ligand II polypeptide.
  • Liposomes containing a TlR-like ligand II polypeptide are prepared by methods known er se: DE 3,218,121 ; Epstein, et al, Proc. Natl. Acad. Sci. USA 52:3688-3692 (1985); Hwang et al, Proc. Natl. Acad. Sci. USA 77:4030-4034 (1980); EP 52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641; Japanese Pat. Appl. 83-1 18008; U.S. Pat. Nos. 4,485,045 and
  • the liposomes are of the small (about 200-800 Angstroms) unilamellar type in which the lipid content is greater than about 30 mol. percent cholesterol, the selected proportion being adjusted for the optimal TlR-like ligand II therapy.
  • the TlR-like ligand for parenteral administration, in one embodiment, the TlR-like ligand
  • polypeptide is formulated generally by mixing it at the desired degree of purity, in a unit dosage injectable form (solution, suspension, or emulsion), with a pharmaceutically acceptable carrier, i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
  • a pharmaceutically acceptable carrier i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
  • the formulation preferably does not include oxidizing agents and other compounds that are known to be deleterious to polypeptides.
  • the formulations are prepared by contacting the TlR-like ligand II polypeptide uniformly and intimately with liquid carriers or finely divided solid carriers or both. Then, if necessary, the product is shaped into the desired formulation.
  • the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient. Examples of such carrier vehicles include water, saline, Ringer's solution, and dextrose solution. Non-aqueous vehicles such as fixed oils and ethyl oleate are also useful herein, as well as liposomes.
  • the carrier suitably contains minor amounts of additives such as substances that enhance isotonicity and chemical stability.
  • additives such as substances that enhance isotonicity and chemical stability.
  • Such materials are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, succinate, acetic acid, and other organic acids or their salts; antioxidants such as ascorbic acid; low molecular weight (less than about ten residues) polypeptides, e.g., polyarginine or tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbi
  • the TlR-like ligand II is typically formulated in such vehicles at a concentration of about 0.001 ng/ml to 500 ng/ml, preferably 0.1-10 ng/ml, at apH of about 3 to 8. It will be understood that the use of certain of the foregoing excipients, carriers, or stabilizers will result in the formation of TlR-like ligand
  • TlR-like ligand II to be used for therapeutic administration must be sterile. Sterility is readily accomplished by filtration through sterile filtration membranes (e.g., 0.2 micron membranes). Therapeutic TlR-like ligand II compositions generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
  • a sterile access port for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
  • TlR-like ligand II ordinarily will be stored in unit or multi-dose containers, for example, sealed ampoules or vials, as an aqueous solution or as a lyophilized formulation for reconstitution.
  • a lyophilized formulation 10-ml vials are filled with 5 ml of sterile-filtered 1% (w/v) aqueous TlR-like ligand II solution, and the resulting mixture is lyophilized.
  • the infusion solution is prepared by reconstituting the lyophilized TlR-like ligand II using bacteriostatic Water-for-Injection.
  • a polypeptide having TlR-like ligand II activity in dosages on the order of from 0.05 to 5000 ng/kg/day, preferably 0.1 to 1000 ng/kg/day, more preferably 10 tol 00 ng/kg/day, administered once or, in divided doses, 1 to 4 times per day.
  • dosages on the order of from 0.01 to 500 ng/kg/day, preferably 0.05 to 100 ng/kg/day and more preferably 0.1 to 50 ng/kg/day can be used.
  • Suitable daily dosages for patients are thus on the order of from 2.5 ng to 250 ⁇ g p.o., preferably 5 ng to 50 ⁇ g p.o., more preferably 50 ng to 12.5 ⁇ g p.o., or on the order of from 0.5 ng to 25 ⁇ g i.v., preferably 2.5 ng to 500 ⁇ g i.v. and more preferably 5 ng to 2.5 ⁇ g i.v.
  • TlR-like ligand II protein activity can be treated by administering an effective amount of an antagonist of a TlR-like ligand II polypeptide of the invention. Therefore, antibodies (preferably monoclonal) or antibody fragments that bind a TlR-like ligand II polypeptide of the present invention are useful in treating TlR-like ligand Il-related disorders as are soluble TlR-like ligand II proteins, such as the extracellular domain, which competes with the intact protein for binding to the
  • TlR-like ligand II receptor Such antibodies and/or soluble TlR-like ligand II proteins are preferably provided in pharmaceutically acceptable compositions.
  • compositions of the present invention may be administered, for example, by the parenteral, subcutaneous, intravenous, intramuscular, intraperitoneal, transdermal, or buccal routes. Alternatively, or concurrently, administration may be oral.
  • the dosage administered will be dependent upon the age, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired.
  • Compositions within the scope of this invention include all compositions wherein the antibody, fragment or derivative is contained in an amount effective to achieve its intended purpose. While individual needs vary, determination of optimal ranges of effective amounts of each component is within the skill of the art.
  • the effective dose is a function of the individual chimeric or monoclonal antibody, the presence and nature of a conjugated therapeutic agent (see below), the patient and his clinical status, and can vary from about 10 ng/kg body weight to about 100 mg/kg body weight.
  • the preferred dosages comprise 0.1 to 10 mg/kg body wt.
  • Preparations of an TlR-like ligand II antibody or fragment for parenteral administration, such as in detectably labeled form for imaging or in a free or conjugated form for therapy include sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
  • non-aqueous solvents examples include propyleneglycol, polyethyleneglycol, vegetable oil such as olive oil, and injectable organic esters such as ethyloleate.
  • Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media, parenteral vehicles including sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils.
  • Intravenous vehicles include fluid and nutrient replenishers, such as those based on Ringer's dextrose, and the like.
  • Preservatives and other additives may also be present, such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like. See, generally, Remington's Pharmaceutical Science, 16th ed., Mack Publishing Co., Easton, PA, 1980.
  • the antibodies described herein may be advantageously utilized in combination with other monoclonal or chimeric antibodies, or with lymphokines or hemopoietic growth factors, etc., which serve to increase the number or activity of effector cells which interact with the antibodies.
  • TlR-like ligand II polypeptides of the present invention are expected to have pleiotropic biological effects including many of those shown in Table 1 below. Similar biological effects have been shown for IL-1, particularly those associated with pancreatic endocrine tissue (Mandrup-Poulsen, T., et al, Cytokine 5:185 (1993)), thyroid glands (Rasmussen, A.K., Autoimmunity 16:141 (1993)), hypothalamic-pituitary-adrenal axis (Fantuzzi, G., & Ghezzi, P., Mediator Inflamm. 2:263 (1993); Rivier, C., Ann. NY Acad. Sci.
  • Fever increased slow wave sleep, social depression, anorexia Hypotension, myocardial suppression, tachycardia, lactic acidosis Increased circulating nitric oxide, hypoamtnoacidemia Hype ⁇ nsulinemia, hyperglycemta, hypoglycemia Stimulation of hypothalamic-pituitary-adrenal axis Release of hypothalamic monoamines and neuropcptides
  • Neutrophilia increased marrow cellula ⁇ ty, ⁇ ncre ⁇ ⁇ sed platelets Increased hepatic acute phase protein synthesis Hypoferremia, hypo7tncemia, increased sodium excretion Hyperlipidemia, increased muscle protein breakdown Hypoalbuminemia, decreased drug metabolism Increased metastases
  • TlR-like ligand II on cultured cells or tissues Increased expression of ELAM-1, VCAM-1, ICA -1 Cytotoxicity (apoptosis) of insulin-producing islet ⁇ cells
  • ELAM-1, VCAM-1, ICA -1 Cytotoxicity (apoptosis) of insulin-producing islet ⁇ cells Inhibition of thyroglobulin synthesis in thyrocytes Cartilage breakdown, release of calcium from bone Increased release of arachidonic acid, prostanoids, and eicosanoids Increased mucus production and chloride flux in intestinal cells
  • GABAA receptor Enhancement in chloride flux (GABAA receptor) in brain synaptosomes Proliferation of fibroblasts, smooth muscle cells, mess ⁇ uigial cells
  • Growth inhibition of hair follicles Increased corticostcrone synthesis by adrenals Increased HIV- 1 expression
  • the DNA sequence encoding the mature, extracellular soluble portion of TlR-like ligand II in the deposited cDNA clone is amplified using PCR oligonucleotide primers specific to the amino terminal sequences of the TlR-like ligand II and to vector sequences 3' to the gene. Additional nucleotides containing restriction sites to facilitate cloning are added to the 5' and 3' sequences respectively.
  • PCR oligonucleotide primers specific to the amino terminal sequences of the TlR-like ligand II and to vector sequences 3' to the gene. Additional nucleotides containing restriction sites to facilitate cloning are added to the 5' and 3' sequences respectively.
  • the full-length, mature TlR-like ligand II protein (amino acid about 27 to about 229) can be expressed in E.coli using suitable 5' and 3' oligonucleotide primers.
  • the cDNA sequence encoding the extracellular domain of the full length TlR-like ligand II in the deposited clone is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene.
  • the 5' primer contains the sequence 5' CGC CCA TGG CCG GCT TCA CAC CTT CC 3' (SEQ ID NO:4) containing the underlined Nco I site .and 17 nucleotides (nucleotides 131-147) of the TlR-like ligand II protein coding sequence in Figure 1 (SEQ ID NO: 1 ) beginning immediately after the signal peptide.
  • the 3' primer has the sequence 5' CGC AAG CTT TCA TCT ATC AAA GTT GCT TTC 3' (SEQ ID NO:5) containing a Hind III restriction site followed by a stop codon and 18 nucleotides reverse and complementary to nucleotides 619-636 of the TlR-like ligand II protein coding sequence in Figure 1 (SEQ ID NO: l).
  • restriction sites are convenient to restriction enzyme sites in the bacterial expression vector pQE60, which are used for bacterial expression in M15/rep4 host cells in these examples. (Qiagen, Inc., Chatsworth, CA, 9131 1). pQE60 encodes ampicillin antibiotic resistance ("Amp r ”) and contains a bacterial origin of replication ("ori”), an IPTG inducible promoter, a ribosome binding site
  • RBS restriction enzyme
  • the amplified TlR-like ligand II DNA and the vector pQE60 both are digested with Nco I .and Hind III and the digested DNAs are then ligated together. Insertion of the TlR-like ligand II DNA into the restricted pQE60 vector placed the TlR-like ligand II coding region downstream of and operably linked to the vector's IPTG-inducible promoter and in-frame with an initiating AUG appropriately positioned for translation of TlR-like ligand II.
  • the ligation mixture is transformed into competent E. coli cells using standard procedures. Such procedures are described in Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd Ed.; Cold Spring Harbor
  • E. coli strain M15/rep4 containing multiple copies of the plasmid pREP4, which expresses lac repressor and confers kanamycin resistance ("Kan r "), is used in carrying out the illustrative example described here.
  • This strain which is only one of many that are suitable for expressing TlR-like ligand II, is available commercially from Qiagen. Transformants are identified by their ability to grow on LB plates in the presence of ampicillin and kanamycin. Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA was confirmed by restriction analysis.
  • Clones containing the desired constructs are grown overnight ("O/N") in liquid culture in LB media supplemented with both ampicillin (100 ⁇ g/ml) and kanamycin (25 ⁇ g/ml).
  • the O/N culture is used to inoculate a large culture, at a dilution of approximately 1 : 100 to 1 :250.
  • the cells are grown to an optical density at 600nm ("OD600") of between 0.4 and 0.6.
  • Isopropyl-B-D-thiogalactopyranoside (“IPTG”) is then added to a final concentration of 1 mM to induce transcription from lac repressor sensitive promoters, by inactivating the lacl repressor.
  • Cells subsequently are incubated further for 3 to 4 hours.
  • Cells then are harvested by centrifugation and disrupted, by standard methods.
  • Inclusion bodies are purified from the disrupted cells using routine collection techniques, and protein is solubilized from the inclusion bodies into 8M urea.
  • the 8M urea solution containing the solubilized protein is passed over a PD-10 column in 2X phosphate-buffered saline ("PBS"), thereby removing the urea, exchanging the buffer and refolding the protein.
  • PBS 2X phosphate-buffered saline
  • the protein is purified by a further step of chromatography to remove endotoxin. Then, it is sterile filtered.
  • the sterile filtered protein preparation is stored in 2X PBS.
  • the cDNA sequence encoding the full length TlR-like ligand II in the deposited clone is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene:
  • the 5' primer has the sequence 5' CGC GGA TCC GCC ATC ATG GGC GAC AAG ATC TGG 3' (SEQ ID NO:6) containing the underlined BamHl restriction enzyme site followed by 18 nucleotides (nucleotides 55 to 72) of the sequence of the TlR-like ligand II protein in Figure 1 (SEQ ID NO:l). Inserted into an expression vector, as described below, the 5' end of the amplified fragment encoding TlR-like ligand II provides an efficient signal peptide. An efficient signal for initiation of translation in eukaryotic cells, as described by Kozak, M., J. Mol. Biol. 196: 947-950 (1987) is appropriately located in the vector portion of the construct.
  • the 3' primer has the sequence 5' CGC GGT ACC TCA CAA TGT TAC
  • GTA CTC TAG 3' (SEQ ID NO:7) containing the underlined Asp 718 restriction site followed by a stop codon and 18 nucleotides reverse and complementary to nucleotides 754-771 of the TlR-like ligand II coding sequence set out in Figure 1 (SEQ ID NO: 1).
  • TlR-like lig,and II in the deposited clone is .amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene:
  • the 5' primer has the sequence 5' CGC GGA TCC GCC ATC ATG GGC GAC AAG ATC TGG 3' (SEQ ID NO:6) containing the underlined BamHl restriction enzyme site followed by 18 nucleotides (nucleotides 55-72) of the sequence encoding the TlR-like ligand II protein set out in Figure 1 (SEQ ID NO:l).
  • An efficient signal for initiation of translation in eukaryotic cells as described by Kozak, M, J. Mol. Biol. 196: 947-950 (1987) is appropriately located in the vector portion of the construct.
  • the 3' primer has the sequence 5' CGC GGT ACC TCA TCT ATC AAA
  • GTT GCT TTC 3' (SEQ ID NO:8) containing the underlined Asp 718 restriction site followed by a stop codon and 18 nucleotides complementary and reverse to nucleotides 619-636 of the TlR-like ligand II coding sequence set out in FIG. 1
  • the amplified fragment is isolated from a 1% agarose gel using a commercially available kit ("Geneclean,” BIO 101 Inc., La Jolla, Ca.). The fragment then is digested with BamH I and Asp 718 and again is purified on a 1 % agarose gel. This fragment is designated herein F2.
  • the vector pA2 is used to express the TlR-like ligand II full length and extracellular domains of an TlR-like ligand II in the baculovirus expression system, using standard methods, as described in Summers et al, A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas
  • the pA2 vector does not contain a signal peptide coding region.
  • the TlR-like ligand II signal peptide is relied upon (nucleotides 55-132 in Figure 1 (SEQ ID NO:l);
  • the pA2-GP vector may be used instead of the pA2 vector.
  • N-terminal methionine is located just upstream of a BamHl site.
  • the 5' oligonucleotide used should not contain sequence coding for the TlR-like ligand II signal peptide. Instead, the 5' oligonucleotide should begin at nucleotide
  • Both the pA2 and pA2-GP expression vectors contain the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by convenient restriction sites.
  • the polyadenylation site of the simian virus 40 ("SV40") is used for efficient polyadenylation.
  • SV40 simian virus 40
  • the beta-galactosidase gene from E. coli is inserted in the same orientation as the polyhedrin promoter and is followed by the polyadenylation signal of the polyhedrin gene.
  • the polyhedrin sequences are flanked at both sides by viral sequences for cell-mediated homologous recombination with wild-type viral DNA to generate viable virus that express the cloned polynucleotide.
  • M.any other baculovirus vectors could be used in place of pA2 or pA2-GP, such as pAc373, pVL941 and pAcIMl provided, as those of skill readily will appreciate, that construction provides appropriately located signals for transcription, translation, trafficking and the like, such as an in-frame AUG and a signal peptide, as required.
  • Such vectors are described in Luckow et al, Virology 170:31-39, among others.
  • the plasmid is digested with the restriction enzyme Xbal and then is dephosphorylated using calf intestinal phosphatase, using routine procedures known in the art.
  • the DNA is then isolated from a 1% agarose gel using a commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). This vector DNA is designated herein "V2".
  • Fragment F2 and the dephosphorylated plasmid V2 are ligated together with T4 DNA ligase.
  • E. coli HB101 cells are transformed with ligation mix and spread on culture plates.
  • Bacteria are identified that contain the plasmid with the human TlR-like ligand II gene by digesting DNA from individual colonies using Xbal and then analyzing the digestion product by gel electrophoresis. The sequence of the cloned fragment is confirmed by DNA sequencing. This pla. smid is designated herein pBacTl R-like ligand II.
  • 5 ⁇ g of the plasmid pBacTl R-like ligand II is co-transfected with 1.0 ⁇ g of a commercially available linearized baculovirus DNA ("BaculoGoldTM baculovirus DNA", Pharmingen, San Diego, CA.), using the lipofection method described by Feigner et al, Proc. Natl. Acad. Sci. USA 84: 7413-7417 (1987).
  • l ⁇ g of BaculoGoldTM virus DNA and 5 ⁇ g of the plasmid pBacTl R-like ligand II are mixed in a sterile well of a microtiter plate containing 50 ⁇ l of serum-free
  • the transfection solution is removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum is added.
  • the plate is put back into an incubator and cultivation is continued at 27°C for four days.
  • plaque assay After four days the supernatant is collected and a plaque assay is performed, as described by Summers and Smith, cited above.
  • An agarose gel with "Blue Gal” (Life Technologies Inc., Gaithersburg) is used to allow easy identification and isolation of gal-expressing clones, which produce blue-stained plaques. (A detailed description of a "plaque assay” of this type can also be found in the user's guide for insect cell culture .and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9-10).
  • the virus is added to the cells. After appropriate incubation, blue stained plaques are picked with the tip of an Eppendorf pipette. The agar containing the recombinant viruses is then resuspended in an Eppendorf tube containing 200 ⁇ l of Grace's medium. The agar is removed by a brief centrifugation and the supernatant containing the recombinant baculovirus is used to infect Sf9 cells seeded in 35 mm dishes. Four days later the supernatants of these culture dishes are h.arvested and then they are stored at 4°C. Clones containing properly inserted hESSB I, II and III are identified by DNA analysis including restriction mapping and sequencing. This is designated herein as V-Tl R-like ligand II.
  • Sf9 cells are grown in Grace's medium supplemented with 10% heat- inactivated FBS.
  • the cells are infected with the recombinant baculovirus V-T1R- like ligand II at a multiplicity of infection ("MOI") of about 2 (about 1 to about 3).
  • MOI multiplicity of infection
  • Most of the vectors used for the transient expression of the TlR-like ligand II protein gene sequence in mammalian cells should carry the SV40 origin of replication. This allows the replication of the vector to high copy numbers in cells (e.g. COS cells) which express the T antigen required for the initiation of viral DNA synthesis. Any other mammalian cell line can also be utilized for this purpose.
  • a typical mammalian expression vector contains the promoter element, which mediates the initiation of transcription of mRNA, the protein coding sequence, and signals required for the termination of transcription and polyadenylation of the transcript. Additional elements include enhancers, Kozak sequences and intervening sequences flanked by donor and acceptor sites for
  • RNA splicing Highly efficient transcription can be achieved with the early and late promoters from SV40, the long terminal repeats (LTRs) from Retroviruses, e.g. RSV, HTLV-I, HIV-I and the early promoter of the cytomegalovirus (CMN).
  • LTRs long terminal repeats
  • CMV cytomegalovirus
  • cellular signals can also be used (e.g. human actin promoter).
  • Suitable expression vectors for use in practicing the present invention include, for example, vectors such as pSVL and pMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and pBC12MI (ATCC 67109).
  • Mammalian host cells that could be used include, human Hela, 283, H9 and Jurkart cells, mouse ⁇ IH3T3 and C127 cells, Cos 1 , Cos 7 and CV1 , African green monkey cells, quail QC1-3 cells, mouse L cells and Chinese hamster ovary cells.
  • the gene can be expressed in stable cell lines that contain the gene integrated into a chromosome.
  • a selectable marker such as dhfr, gpt, neomycin, hygromycin allows the identification and isolation of the transfected cells.
  • the transfected gene can also be amplified to express large amounts of the encoded protein.
  • the DHFR dihydrofolate reductase
  • GS glutamine synthase
  • Another useful selection marker is the enzyme glutamine synthase (GS) (Murphy et al., Biochem J. 227:277-279 (1991); Bebbington et al., Bio/Technology 10:169-175 (1992)).
  • GS glutamine synthase
  • the mammalian cells are grown in selective medium and the cells with the highest resistance are selected.
  • These cell lines contain the amplified gene(s) integrated into a chromosome. Chinese hamster ovary (CHO) cells are often used for the production of proteins.
  • the expression vectors pC 1 and pC4 contain the strong promoter (LTR) of the Rous Sarcoma Virus (Cullen et al., Molecular and Cellular Biology, 438-4470 (March, 1985)) plus a fragment of the CMV-enhancer (Boshart et al.,
  • the vectors contain in addition the 3 ' intron, the polyadenylation and termination signal of the rat preproinsulin gene.
  • An expression plasmid is made by cloning a cDNA encoding TlR-like ligand II into the expression vector pcDNAI/Amp (which can be obtained from Invitrogen, Inc.).
  • the expression vector pcDNAI/amp contains: (Dower, Colotta, F., et al., Immunol Today 15:562 (1994)) an E.coli origin of replication effective for propagation in E. coli and other prokaryotic cells; (Greenfeder, S.A., et al., J.
  • a CMV promoter 349:205 (1990)
  • a polylinker 349:205 (1990)
  • an SV40 intron 349:205 (1990)
  • a polyadenylation signal arranged so that a cDNA conveniently can be placed under expression control of the CMV promoter and operably linked to the SV40 intron and the polyadenylation signal by means of restriction sites in the polylinker.
  • a DNA fragment encoding the entire TlR-like ligand II precursor and an HA tag fused in frame to its 3' end is cloned into the polylinker region of the vector so that recombinant protein expression is directed by the CMV promoter.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein described by Wilson et al., Cell 37: 767 (1984). The fusion of the HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
  • the plasmid construction strategy is as follows.
  • the TlR-like ligand II cDNA of the deposited clone is amplified using primers that contain convenient restriction sites, much as described above regarding the construction of expression vectors for expression of Tl R-like ligand II in E. coli.
  • primers that contain convenient restriction sites, much as described above regarding the construction of expression vectors for expression of Tl R-like ligand II in E. coli.
  • one of the primers contains a hemagglutinin tag ("HA tag") as described above.
  • TlR- like ligand II protein (amino acid about 1 to about 229) can be expressed in COS cells using suitable 5' and 3' oligonucleotide primers.
  • the cDNA sequence encoding the extracellular domain of the full length TlR-like ligand II in the deposited clone is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene.
  • the 5' primer has the following sequence:
  • the 3' primer has the following sequence:
  • GTA TCT ATC AAA GTT GCT TTC 3' (SEQ ID NO:9), containing the underlined Xba I restriction site, a stop codon, an HA tag, and 18 nucleotides reverse and complementary to nucleotides 619-639 of the TRl-like ligand II coding sequence set out in Figure 1 (SEQ ID NO. ).
  • the PCR amplified DNA fragment and the vector, pcDNAI/Amp, are digested with BamH I and Xbal and then ligated.
  • the ligation mixture is transformed into E. coli strain SURE (available from Stratagene Cloning Systems, 1 1099 North Torrey Pines Road, La Jolla, CA 92037) and the transformed culture is plated on ampicillin media plates which then .are incubated to allow growth of ampicillin resistant colonies. Plasmid DNA is isolated from resistant colonies and examined by restriction analysis and gel sizing for the presence of the TlR-like ligand II encoding fragment.
  • COS cells are transfected with an expression vector, as described above, using DEAE- DEXTRAN, as described, for instance, in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, Cold Spring Harbor, New York (1989). Cells are incubated under conditions for expression of TlR-like ligand II by the vector.
  • TlR-like ligand II HA fusion protein is detected by radiolabelling and immunoprecipitation, using methods described in, for example Harlow et al., Antibodies: A Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1988). To this end, two days after transfection, the cells are labeled by incubation in media containing 35 S- cysteine for 8 hours. The cells and the media are collected, and the cells are washed and the lysed with detergent-containing RIPA buffer: 150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5, as described by Wilson et al. cited above.
  • Proteins are precipitated from the cell lysate and from the culture media using an HA-specific monoclonal antibody. The precipitated proteins then are analyzed by SDS-PAGE gels and autoradiography. An expression product of the expected size is seen in the cell lysate, which is not seen in negative controls.
  • Plasmid pC4 is used for the expression of TlR-like ligand protein.
  • Plasmid pC4 is a derivative of the plasmid pSV2-dhfr [ATCC Accession No.
  • Both plasmids contain the mouse DHFR gene under control of the SV40 early promoter.
  • Chinese hamster ovary- or other cells lacking dihydrofolate activity that are transfected with these plasmids can be selected by growing the cells in a selective medium (alpha minus MEM, Life Technologies) supplemented with the chemotherapeutic agent methotrexate.
  • a selective medium alpha minus MEM, Life Technologies
  • methotrexate methotrexate
  • the amplification of the DHFR genes in cells resistant to methotrexate (MTX) has been well documented (see, e.g., Alt, F.W., Kellems, R.M., Bertino, J.R., and Schimke, R.T., 1978, J. Biol. Chem.
  • Plasmid pC4 contains for the expression of the gene of interest a strong promoter of the long terminal repeat (LTR) of the Rouse Sarcoma Virus (Cullen, et al., Molecular and Cellular biology, March 1985, 438-4470) plus a fragment isolated from the enhancer of the immediate early gene of human cytomegalovirus (CMV) (Boshart et al., Cell 41 :521-530, 1985). Downstream of the promoter are the following single restriction enzyme cleavage sites that allow the integration of the genes: BamHl, Pvull, and Nrul.
  • LTR long terminal repeat
  • CMV cytomegalovirus
  • the plasmid contains translational stop codons in all three reading frames followed by the 3' intron and the polyadenylation site of the rat preproinsulin gene.
  • Other highly efficient promoters can also be used for the expression, e.g., the human ⁇ -actin promoter, the SV40 early or late promoters or the long terminal repeats from other retro viruses, e.g., HIV and HTLVI.
  • the polyadenylation of the mRNA other signals, e.g., from the human growth hormone or globin genes can be used as well.
  • Stable cell lines carrying a gene of interest integrated into the chromosomes can also be selected upon co-transfection with a selectable marker such as gpt, G418 or hygromycin. It is advantageous to use more than one selectable marker in the beginning, e.g. G418 plus methotrexate.
  • the plasmid pC4 is digested with the restriction enzyme BamHl and then dephosphorylated using calf intestinal phosphates by procedures known in the art.
  • the vector is then isolated from a 1% agarose gel.
  • the DNA sequence encoding Tl R-like ligand II protein is amplified using
  • the cDNA sequence encoding the full length TlR-like ligand II in the deposited clone is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene.
  • the 5' primer has the sequence 5' CGC GGA TCC GCC ATC ATG GGC GAC AAG ATC TGG 3' (SEQ ID NO: 6), containing the underlined BamH I restriction enzyme site followed 18 nucleotides (nucleotides 55-72) of the sequence of TIR like ligand II in FIG. 1 (SEQ ID NO: 6), containing the underlined BamH I restriction enzyme site followed 18 nucleotides (nucleotides 55-72) of the sequence of TIR like ligand II in FIG. 1 (SEQ ID NO: 6), containing the underlined BamH I restriction enzyme site followed 18 nucleotides (nucleotides 55-72) of the sequence of TIR like ligand II in FIG. 1 (SEQ ID NO: 6), containing the underlined BamH I restriction enzyme site followed 18 nucleotides (nucleotides 55-72) of the sequence of TIR like ligand II in FIG. 1 (SEQ ID NO: 6),
  • the 3 ' primer has the sequence 5 ' GCG GGT ACC TCA CAA TGT TAC GTA CTC TAG 3' (SEQ ID NO: 7), containing the underlined Asp 718 restriction site followed by a stop codon and 18 nucleotides reverse and complementary to nucleotides 754 to 771 of the TlR-like ligand II coding sequence in FIG. 1 (SEQ ID NO: l).
  • the restriction sites are convenient to restriction enzyme sites in the CHO expression vector PC-4.
  • the cDNA sequence encoding the extracellular domain of the full length TlR-like ligand II in the deposited clone is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene.
  • the 5' primer has the sequence 5' CGC GGA TCC GCC ATC ATG GGC
  • GAC AAG ATC TGG 3' (SEQ ID NO:6) containing the underlined BamHl restriction enzyme site and 18 nucleotides (nucleotides 55 to 72) of the TlR-like ligand II coding sequence in FIG. 1 (SEQ ID NO:l).
  • An efficient signal for initiation of tr.anslation in eukaryotic cells, as described by Kozak, M., J. Mol. Biol. 196: 947-950 (1987) is appropriately located in the vector portion of the construct.
  • the 3' primer has the sequence 5' CGC GGT ACC TCA TCT ATC AAA GTT GCT TTC 3' (SEQ ID NO:8) containing the underlined Asp 718 restriction site followed by a stop codon and 18 nucleotides reverse and complementary to nucleotides 619-636 of the TlR-like ligand I coding sequence set out in FIG. 1 (SEQ ID NO: 1).
  • the amplified Tl R-like ligand II protein DNA are digested with BamH I and Asp 718.
  • the vector pC4 is digested with BamHl and the digested
  • TIR like ligand II protein DNAs are then ligated together.
  • the isolated fragment and the dephosphorylated vector are then ligated with T4 DNA ligase.
  • Insertion of the TIR like ligand II protein DNA into the BamH I restricted vector places the TIR like ligand II protein coding region downstream of and operably linked to the vector's promoter.
  • E.coli HB101 cells are then transformed and bacteria identified that contained the plasmid pC4 inserted in the correct orientation using the restriction enzyme BamHl.
  • the ligation mixture is transformed into competent E. coli cells using standard procedures as described, for example, in Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989).
  • the transformed culture is plated on ampicillin media plates which then are incubated to allow growth of ampicillin resistant colonies. Plasmid DNA is isolated from resistant colonies and examined by restriction analysis and gel sizing for the presence of the TlR-like ligand II-encoding fragment. The sequence of the inserted gene is confirmed by DNA sequencing.
  • Chinese hamster ovary cells lacking an active DHFR enzyme are used for transfection.
  • 5 ⁇ g of the expression plasmid C4 are cotransfected with 0.5 ⁇ g of the plasmid pSVneo using the lipofecting method (Feigner et al., supra).
  • the plasmid ⁇ SV2-neo contains a dominant selectable marker, the gene neo from Tn5 encoding an enzyme that confers resistance to a group of antibiotics including
  • the cells are seeded in alpha minus MEM supplemented with 1 mg/ml G418. After 2 days, the cells are trypsinized and seeded in hybridoma cloning plates (Greiner, Germany) and cultivated from 10-14 days. After this period, single clones are trypsinized and then seeded in 6-well petri dishes using different concentrations of methotrexate (25 nM, 50 nM, 100 nM, 200 nM, 400 nM).
  • Clones growing at the highest concentrations of methotrexate are then transferred to new 6-well plates containing even higher concentrations of methotrexate (500 nM, 1 ⁇ M, 2 ⁇ M, 5 ⁇ M). The same procedure is repeated until clones grow at a concentration of 100 ⁇ M.
  • the expression of the desired gene product is analyzed by Western blot analysis and SDS-PAGE. Expression of the TlR-like ligand II fusion protein is detected by radiolabelling and immunoprecipitation, using methods described in, for example Harlow et al, Antibodies: A Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1988).
  • the cells are labeled by incubation in media containing 35 S-cysteine for 8 hours.
  • the cells and the media are collected, and the cells are washed and the lysed with detergent-containing RIPA buffer: 150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5, as described by Wilson et al cited above.
  • Proteins are precipitated from the cell lysate and from the culture media using an HA-specific monoclonal antibody. The precipitated proteins then are analyzed by SDS-PAGE gels and autoradiography. An expression product of the expected size is seen in the cell lysate, which is not seen in negative controls.
  • Northern blot analysis is carried out to examine expression levels of the TlR-like ligand II gene in human tissues, using methods described by, among others, Sambrook et al., cited above.
  • a cDNA probe containing the entire T1R- like ligand II nucleotide sequence (SEQ ID NO:l) is labeled with 32 P using the rediprimeTM DNA labelling system (Amersham Life Science), according to manufacturer's instructions. After labelling, the probe is purified using a CHROMA SPIN- 100TM column (Clontech Laboratories, Inc.), according to manufacturer's protocol number PT 1200-1. The purified labelled probe is then used to examine various human tissues for expression of the Tl R-like ligand II gene.
  • MTN Multiple Tissue Northern
  • H human tissues
  • IM human immune system tissues
  • ADDRESSEE STERNE, KESSLER, GOLDSTEIN & FOX, P.L.L.C.
  • MOLECULE TYPE protein
  • SEQUENCE DESCRIPTION SEQ ID NO : 3 :
  • MOLECULE TYPE CDNA

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention concerne une nouvelle protéine du ligand II du type récepteur de T1, et notamment des molécules d'acide nucléique isolées codant pour cette protéine. On décrit également des polypeptides du ligand II du type récepteur de T1, de même que des vecteurs recombinés ainsi que des cellules hôtes destinés à exprimer ces polypeptides.
PCT/US1996/013768 1996-08-23 1996-08-23 Ligand ii du type recepteur de t1 WO1998007754A1 (fr)

Priority Applications (5)

Application Number Priority Date Filing Date Title
JP10510698A JP2001500724A (ja) 1996-08-23 1996-08-23 Ｔ１レセプター様リガンドｉｉ
AU72352/96A AU7235296A (en) 1996-08-23 1996-08-23 T1 receptor-like ligand ii
EP96933739A EP0963205A4 (fr) 1996-08-23 1996-08-23 Ligand ii du type recepteur de t1
CA002263832A CA2263832A1 (fr) 1996-08-23 1996-08-23 Ligand ii du type recepteur de t1
PCT/US1996/013768 WO1998007754A1 (fr) 1996-08-23 1996-08-23 Ligand ii du type recepteur de t1

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US1996/013768 WO1998007754A1 (fr) 1996-08-23 1996-08-23 Ligand ii du type recepteur de t1

Publications (1)

Publication Number Publication Date
WO1998007754A1 true WO1998007754A1 (fr) 1998-02-26

Family

ID=22255671

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1996/013768 WO1998007754A1 (fr) 1996-08-23 1996-08-23 Ligand ii du type recepteur de t1

Country Status (5)

Country Link
EP (1) EP0963205A4 (fr)
JP (1) JP2001500724A (fr)
AU (1) AU7235296A (fr)
CA (1) CA2263832A1 (fr)
WO (1) WO1998007754A1 (fr)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1240358A1 (fr) * 1999-12-10 2002-09-18 Human Genome Sciences, Inc. Ligand ii de type recepteur t1 et utilisations de ce dernier
US7128906B2 (en) 1996-08-23 2006-10-31 Human Genome Sciences, Inc. T1 receptor-like ligand II and uses thereof
US7432060B2 (en) 2000-11-09 2008-10-07 The Brigham And Women's Hospital, Inc. Methods for diagnosis of cardiovascular disease
US7655415B2 (en) 2002-05-09 2010-02-02 The Brigham And Women's Hospital, Inc. IL1RL-1 as a cardiovascular disease marker and therapeutic target
US8147817B2 (en) 2006-05-04 2012-04-03 The Brigham And Women's Hospital, Inc. IL-33 in the treatment and diagnosis of diseases and disorders
US9886553B2 (en) 2008-04-18 2018-02-06 Critical Care Diagnostics, Inc. Predicting risk of major adverse cardiac events
US10203339B2 (en) 2006-05-01 2019-02-12 Critical Care Diagnostics, Inc. Diagnosis of cardiovascular disease
US10303844B2 (en) 2012-08-21 2019-05-28 Critical Care Diagnostics, Inc. Multimarker risk stratification
US11016103B2 (en) 2006-04-24 2021-05-25 Critical Care Diagnostics, Inc. Predicting mortality and detecting severe disease

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994017187A1 (fr) * 1993-01-29 1994-08-04 The Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services CLONAGE ET EXPRESSION DE L'ANTIGENE CIBLE BLOQUANT LA TRANSMISSION DE PLASMODIUM FALCIPARUM, Pfs230

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU4809497A (en) * 1996-10-04 1998-04-24 Genetics Institute Inc. Secreted proteins

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994017187A1 (fr) * 1993-01-29 1994-08-04 The Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services CLONAGE ET EXPRESSION DE L'ANTIGENE CIBLE BLOQUANT LA TRANSMISSION DE PLASMODIUM FALCIPARUM, Pfs230

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CELL, 10 October 1986, Vol. 47, CLEARY M.L. et al., "Cloning and Structural Analysis of cDNAs for bcl-2 and a Hybrid bcl-2/Immunoglobulin Transcript Resulting from the t(14;18) Translocation", pages 19-28. *
EMBO J., 1994, Vol. 13, No. 5, BERGERS G. et al., "Alternative Promoter Usage of the Fos-Responsive Gene Fit-1 Generates mRNA Isoforms Coding for Either Secreted or Membrane-Bound Proteins Related to the IL-1 Receptor", pages 1176-1188. *
SCIENCE, 28 July 1995, Vol. 269, No. 5223, FLEISCHMANN R.D. et al., "Whole-Genome Random Sequencing and Assembly of Haemophilus Influenzae Rd", pages 496-512. *
See also references of EP0963205A4 *

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7128906B2 (en) 1996-08-23 2006-10-31 Human Genome Sciences, Inc. T1 receptor-like ligand II and uses thereof
EP1240358A4 (fr) * 1999-12-10 2005-10-19 Human Genome Sciences Inc Ligand ii de type recepteur t1 et utilisations de ce dernier
EP1240358A1 (fr) * 1999-12-10 2002-09-18 Human Genome Sciences, Inc. Ligand ii de type recepteur t1 et utilisations de ce dernier
US8530173B2 (en) 2000-11-09 2013-09-10 The Brigham And Women's Hospital, Inc. Methods for treatment of cardiovascular disease
US7432060B2 (en) 2000-11-09 2008-10-07 The Brigham And Women's Hospital, Inc. Methods for diagnosis of cardiovascular disease
US9857379B2 (en) 2000-11-09 2018-01-02 The Brigham And Women's Hospital Inc. Methods for treatment of cardiovascular disease
US8871452B2 (en) 2000-11-09 2014-10-28 The Brigham And Women's Hospital, Inc. Methods for treatment of cardiovascular disease
US7985558B2 (en) 2000-11-09 2011-07-26 The Brigham And Women's Hospital, Inc. Methods for diagnosis of cardiovascular disease
US8748116B2 (en) 2002-05-09 2014-06-10 The Brigham And Women's Hospital, Inc. 1L1RL-1 as a cardiovascular disease marker and therapeutic target
US7655415B2 (en) 2002-05-09 2010-02-02 The Brigham And Women's Hospital, Inc. IL1RL-1 as a cardiovascular disease marker and therapeutic target
US8597958B2 (en) 2002-05-09 2013-12-03 The Brigham And Women's Hospital, Inc. IL1RL-1 as a cardiovascular disease marker and therapeutic target
US8734769B2 (en) 2002-05-09 2014-05-27 The Brigham And Women's Hospital, Inc. 1L1RL-1 as a cardiovascular disease marker and therapeutic target
US7989210B2 (en) 2002-05-09 2011-08-02 The Brigham And Women's Hospital, Inc. IL1RL-1 as a cardiovascular disease marker and therapeutic target
US7670769B2 (en) * 2002-05-09 2010-03-02 The Brigham And Women's Hospital, Inc. IL1RL-1 as a cardiovascular disease marker and therapeutic target
US9851362B2 (en) 2002-05-09 2017-12-26 The Brigham & Women's Hosptial, Inc. 1L1RL-1 as a cardiovascular disease marker and therapeutic target
US10788500B2 (en) 2002-05-09 2020-09-29 Brigham & Women's Hospital, Inc. IL1RL-1 as a cardiovascular disease marker and therapeutic target
US11016103B2 (en) 2006-04-24 2021-05-25 Critical Care Diagnostics, Inc. Predicting mortality and detecting severe disease
US10203339B2 (en) 2006-05-01 2019-02-12 Critical Care Diagnostics, Inc. Diagnosis of cardiovascular disease
US8147817B2 (en) 2006-05-04 2012-04-03 The Brigham And Women's Hospital, Inc. IL-33 in the treatment and diagnosis of diseases and disorders
US9886553B2 (en) 2008-04-18 2018-02-06 Critical Care Diagnostics, Inc. Predicting risk of major adverse cardiac events
US9965593B2 (en) 2008-04-18 2018-05-08 Critical Care Diagnostics, Inc. Predicting risk of major adverse cardiac events
US11170896B2 (en) 2008-04-18 2021-11-09 Critical Care Diagnostics, Inc. Predicting risk of major adverse cardiac events
US10303844B2 (en) 2012-08-21 2019-05-28 Critical Care Diagnostics, Inc. Multimarker risk stratification
US10741290B2 (en) 2012-08-21 2020-08-11 Critical Care Diagnostics, Inc. Multimarker risk stratification

Also Published As

Publication number Publication date
AU7235296A (en) 1998-03-06
JP2001500724A (ja) 2001-01-23
EP0963205A1 (fr) 1999-12-15
CA2263832A1 (fr) 1998-02-26
EP0963205A4 (fr) 2002-10-02

Similar Documents

Publication Publication Date Title
US7611846B2 (en) Diagnostic methods involving human growth factor huXAG-1
EP0961831A1 (fr) Endokine alpha humaine
EP0929575A1 (fr) Nouveaux facteurs de croissance humains
US5998171A (en) Polynucleotides encoding human endokine alpha
WO1998007754A1 (fr) Ligand ii du type recepteur de t1
WO1998011138A1 (fr) Chimiokine alpha-4
US6232100B1 (en) Cortistatin Polypeptides
US7495084B2 (en) Antibodies to T1 receptor-like ligand II
US20030069409A1 (en) T1-R ligand III
WO1998029438A9 (fr) Polypeptides de cortistatine
EP0990000A1 (fr) Facteur de croissance 3 du tissu conjonctif
WO1998008969A1 (fr) Molecule accessoire soluble du recepteur de l'interleukine 1
US20020160414A1 (en) Immune cell cytokine
US6576445B1 (en) Chemokine α-4
US20050287606A1 (en) T1 receptor-like ligand I
WO1998007881A1 (fr) Ligand i du type recepteur de t1
US20020132304A1 (en) Human parotid secretory protein
WO1998007862A9 (fr) Chemokine beta-16
JP2004041212A (ja) Ｔ１レセプター様リガンドｉ
NZ514393A (en) Use of antibodies that bind to the endokine alpha polypeptide so as to decrease the level of endokine alpha activity in situ

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AM AU BG BR BY CA CN CZ EE FI GE HU IL JP KG KP KR KZ LT LV MD MN MX NO NZ PL RO RU SG SI SK TJ TM TR UA US UZ VN AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref document number: 2263832

Country of ref document: CA

Ref country code: JP

Ref document number: 1998 510698

Kind code of ref document: A

Format of ref document f/p: F

Ref country code: CA

Ref document number: 2263832

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1996933739

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1996933739

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1996933739

Country of ref document: EP