WO1998001140A1 - Oligonucleotides as inhibitors of selectins - Google Patents

Abstract

Disclosed are oligonucleotides and methods for inhibiting selectins. The oligonucleotides of the invention specifically bind L-selectin and can be isolated by systematic evolution of ligands by exponential enrichment (SELEX) technology. Preferably, the method involves non-covalently binding the selectin receptor globulin to protein A sepharose beads. The oligonucleotides are useful for blocking selectin-dependent interactions with natural ligands in vivo and for diagnostic tests in vitro-cell surface and soluble selections. Clinically, the oligonucleotides can be administered to patients in methods for treating a variety of inflammatory and postischemic pathologies, such as ischemia-reperfusion injury, acute inflammatory states, and chronic immune responses. A specific modification of the previously described modifications are: (a) carrying out binding at anion concentrations < 160mM, i.e., close to physiological; (b) eluting by chelating Ca++, thereby obtaining oligos binding the Ca++ dependent lectin domain; (c) using low 1-5 mM EDTA for elution, avoiding non-specific elution; (d) doing selection at 22-37 °C to avoid loss of ligand structure if initial selection is done at 4 °C.

Description

OLIGONUCLEOTIDES AS INHIBITORS OF SELECTINS Cross-Reference to Related Application This application claims priority under 35 U.S.C. 119 from Provisional Application Serial No. 60/019,552 and 60,033,149.

Statement as to Federally-Sponsored Research

This invention was made, at least in part, with funds from the Federal Government under grant no. RO1 C A38701, awarded through the National Institutes of Health.

Background of the Invention

The field of the invention is oligonucleotides that are inhibitors of selectins. The selectins (L-, E-, and P-selectin) are a family of calcium-dependent cell surface lectins that mediate cell adhesion by recognition of cell-specific carbohydrate ligands. These cell adhesion molecules play critical roles in the initial events of leucocyte adhesion to vascular endothelium as well as in signalling events. Each of the three selectins has an amino-terminal C-type lectin domain that mediates calcium- dependent interactions with specific endogenous ligands. These high-affinity ligands include certain mucin-type glycoproteins carrying sialylated, fucosylated polylactosaminoglycans (including sialyl Lewis" (SLe*)), structural subsets of heparan sulfate glycosaminoglycans, some sulfated glycolipids, as well as certain peptide sequences with tyrosine sulfate residues. In addition, a variety of other non-native macromolecules such as yeast phosphomannan and sulfated algal fucoidan can be recognized with high affinity. A common feature of all ligands is that they present hydrophilic polyanionic surfaces bearing multiple carboxylate, sulfate or phosphate groups, in the form of clustered O-linked saccharides, heparan sulfate glycosaminoglycans, micellar sulfated glycolipids or combined oligosaccharidc/peptide epitopes, involving sialylated oligosaccharides and tyrosine sulfate residues. Abundant information indicates that selectin-ligand interactions play critical roles in the earliest steps of tissue injury following hypoxemia, reperfusion or inflammation. Thus, small-molecule sialyloligosaccharide inhibitors of the selectins are expected to have therapeutic value in many pathological conditions, including ischemia- reperfusion injury, acute inflammatory states, and chronic immune responses. Indeed, soluble selectin antagonists with binding constants in the micromolar range (e.g., SLe" analogs) are capable of blunting tissue injury in several in vivo models. However, these antagonists have low affinities must be used in large quantities, and are very expensive to prepare. Furthermore, they show relatively little selectivity between the three selectins, precluding the preferential blockade of a specific selectin in a particular pathological situation. On the other hand, the natural macromolecular high-affinity ligands specific to each selectin have not been available in the amounts needed for such applications. Another body of literature indicates that the extracellular domains of the selectins can be shed upon cell stimulation. Thus, measurements of soluble selectins in body fluids and on cell surfaces (platelets and leukocytes) are of potential diagnostic value in several disease states. Abbreviations: The following abbreviations arc used herein: SELEX, Systematic Evolution of Ligands by Exponential Enrichment; PAS, Protein A Sepharose 4 Fast Flow (Pharmacia); LS-Rg, L-selectin receptor globulin; PS-Rg, P-selectin receptor globulin; ES-Rg, E-selectin receptor globulin; PBMCs, Peripheral Blood Mononuclear Cells (PBMCs); GlyCAM-1, Glycosylation-dependent Cell Adhesion Molecule- 1; SLe", Sialyl Lewis-x; SLe\ Sialyl Lewis-a; 3'HSO₃Le^x, 3' sulfo-Lewis-x; IC_jo, Concentration giving 50% inhibition; ELISA, Enzyme-linked immunosorbant assay. SUMMARY OF THE INVENTION

There has now been developed a method for isolating oligonucleotides (also referred to herein as "aptamers") that inhibit binding of selectins to selectin ligands. Accordingly, the invention features a method for selecting oligonucleotides that inhibit binding of selectins to selectin ligands; the exemplary method entails:

(a) providing a-selectin receptor globulin (Rg) soluble selectin (e.g., A) non-covalently or covalently bound to a substrate;

(b) contacting in the presence of 1 to 2 mM Ca⁺⁺ and 1 to 5 mM Mg⁺⁺ the immobilized selectin with a plurality of single-stranded oligonucleotides, wherein the oligonucleotides include a randomized sequence of 15 to 50 nucleotides in length, thereby allowing a subset of the oligonucleotides to bind the immobilized selectin and form a selectin/oligonucleotide complex;

(c) separating the selectin/oligonucleotide complex from unbound oligonucleotides; (d) contacting the selectin/oligonucleotide complex with 1 to 50 mM

EDTA, thereby chelating the divalent cations and eluting bound oligonucleotides from the selectin/oligonucleotide complex as a plurality of eluted oligonucleotides; and

(e) isolating the eluted oligonucleotides as oligonucleotides that inhibit binding of selectin to an selectin ligand (i.e., as aptamers). Typically, steps (b) through (e) are repeated by using the eluted oligonucleotides (amplified by PCR) to contact the immobilized selectin. Steps (b) through (e) typically are repeated multiple times for a total of 10 to 15 rounds of binding and elution. Although this method shares certain features with the SELEX method for selecting ligands, the method of the invention is distinct in certain essential aspects, as discussed herein.

In practicing the invention, the substrate typically is a chromatography resin, such as Protein A Sepharose (PAS). Other suitable substrates include any standard method for covalent or non-covalent immobiuzation of a protein to a solid support. The selectin is bound to the substrate in a non-covalent manner. Alternatively, the selectin can be covalently cross-linked to the substrate, provided that cross-linking is not mediated by the certain lysine residues of the selectin, (e.g. biotinycation of S-Rj with immobilization to strepthuldin; carbodiimide coupling to amino-containing supports; or periodate oxidation with x-linking to hydrazides). S-Rg is a selectin-IgG fusion protein, and can be produced according to conventional protocols. The single-stranded oligonucleotides that are contacted with selectin can be RNA or DNA, although DNA is preferred. Oligonucleotides that are 20 to 50 nucleotides in length are suitable for use in the invention. Typically, the oligonucleotides contain a region of 30 to 40 nucleotides in length (e.g., 40 nt) that is random in sequence; the random sequence is flanked by 15 to 20 nucleotides that are common to the pool of oligonucleotides. These common sequences can be used for binding primers for DNA amplification (e.g., by PCR) and/or contain sequences for initiation of transcription (e.g., by T7 polymerase). If desired, the oligonucleotides can be modified to increase their resistance to nucleases by using chemically modified nucleotide donors. For example, the oligonucleotides can be modified to contain 2'NH₂ groups. Thus, the term "oligonucleotide" as used herein includes DNA, RNA, or any chemical modification thereof. Such modifications include, but are not limited to, modifications at cytosine exocyclic amines, substitution of 5-bromo-uracil, modifications of the backbone of the nucleic acid, methylation, and the like. In a preferred embodiment, the oligonucleotides are also capped at their 3' end and coupled to polyethylene glycol (PEG), e.g., through a 5' amine moiety, e.g., as described herein, to prolong circulatory half-life.

Initial binding of the substrate generally is carried out at 4° C. In order to optimize the isolation of aptamers that inhibit L-selectin under physiologic conditions, it is preferable to carry out steps (b) through (d) at 20-40°C (e.g., at 37°C). Binding of LS-Rg to the substrate generally is carried out at 4°C. Because selectin binding to ligands is exquisitely sensitive to ionic strength, the concentration of salts present is as close to physcological as possible, e.g., 140 to 145 mM. Typically, the oligonucleotides will contact the immobilized LS-Rg in the presence of 0.5 to 2 mM Ca^+~ (e.g., ImM CaCl₂) and 1 to 2 mM Mg⁺⁺. A calcium-chelator is then used to elute the bound oligonucleotides from LS-Rg/oligonucleotide complex. Other suitable calcium chelators might be citrate or EGTA. In general, the oligonucleotides are eluted by contacting the LS-Rg/oligonucleotide complex with 1 to 50 mM EDTA. The concentration of EDTA used at step (d) of the method is decreased with successive rounds of elution. In a typical selection protocol, rounds 1-3 utilize 50 mM EDTA to elute the oligonucleotides, while rounds 4-14 use 2-5 EDTA. Since EDTA is a tetravalent salt, higher concentrations represend a not only divalent cation chelation, but also an increase in ionic strength. Thus, the final 10 rounds of elution must be carried out at a relatively low EDTA concentration (e.g., 1 to 5 mM EDTA). After each round of elution, the eluted oligonucleotide (i.e., aptamers) can be precipitated (e.g., with ethanol), reverse transcribed (for RNAs), amplified, transcribed in vitro, and then purified (e.g., from a gel) using standard molecular biology techniques, in preparation for the next round of selectin. The key factors in this method are therefore: 1) salt in physiological range, 2) divalent cation chelation, 3) use of low EDTA elution to avoid non-specific elution.

Included within the invention are oligonucleotides eluted from LS-Rg/oligonucleotide complexes as described above (i.e., aptamers). As the working examples provided below indicate, many such oligonucleotides contain some common concensus sequences. In particular, the following oligonucleotides (shown 5' to 3', left to right) are, without limitation, included within the invention: 2-Amino RNAs

6.79 AUGUGUGAGUAGCUGAGCGCCCGAGUAUGAWACCUGACUA

6.50 UAAUGUGUGAAGCUGAGCGCCCGAAUAGAUUAGACAAAAU

6.60 GGCAUUGUGUGAAUAGCUGAUCCCACAGGUAACAACAGCA 13.32 CGCGUAUGUGUGAAAGCGUGUGCACGGAGGCGUCUACAAU

14.21 UUGAGAUGUGUGAGUACAGCUCAAAAUCCCGUUGGAGG

14.9 AAACCUUGAUGUGUGAUAGAGCAUCCCCCAGGCG ACGUAC

14.25 UAGAGGUAGUAUGUGUGGGAGAUGAAAAUACUGUGGAAAG

6.28 GUAAAGAGAUCCUAAUGGCUCGCUAGAUGUGAUGUGAAAC 13.48 AΛAGUUAUGAGUCCGUAUAUCAAGGUCGACAUGUFUGAAU

6.71 CACGAAAAACCCGAAUUGGGUCGCCCAUAAGGAUGUGUGA Sinele- Stranded DNAs

14.12 U AAC AAC AAUCAAGGCGGGUUC ACCGCCCC AGU AUG AGU A

LD20 i CAAGGTAACCAGTACAAGGTGCTAAACGTAATGGCTTCG LD174 CATTCACCATGGCCCCTTCCTACGTATGTTCTGCGGGTG LD196 TGGCGGTACGGGCCGTGCACCCACTTACCTGGGAAGTGA

The eluted oligonucleotides of the invention can be used in vitro, ex vivo, or in vivo to inhibit binding of selectin to a ligand (e.g., naturally-occurring ligands such as correctly glycosylated forms of PSGL-1, MAbCAM-1, CD-34, GlyCAM-1, etc.). Thus, the invention also features a method for evaluating the inhibition of binding of selectins to a selectin ligand; the method entails:

(a) providing recombinant soluble selectin and a ligand to which selectin is capable of specifically binding; and

(b) in the presence of 1 to 2 mM Ca⁺⁺, and physiological buffers, contacting the selectin with an oligonucleotide(s) eluted from a selectin/oligonucleotide complex (i.e., an aptamer) as described above, thereby inhibiting binding of the selectin to the ligand. The oligonucleotide can be used to contact the selectin either before or after the selectin comes into the proximity of the ligand. For example, the oligonucleotide can be incubated with cells bearing selectin prior to mixing the cells with a selectin ligand. If desired, the L-selectin and/or ligand can be present on the surface of a cell. For instance, the L-selectin may be present on the surface of a peripheral blood mononuclear cell (PBMC). Binding of the ligand to L-selectin or inhibition of binding of selectin to a selectin ligand can be detected using any of a variety of conventional techniques. For example, inhibition of binding can be detected as the ability of the aptamers to inhibit the ability of L-selecting to bind immobilized SLe^x. Inhibition of binding also can be detected as an inhibition of lymphocyte "rolling" on endothelium in the presence of the aptamers of the invention. In the absence of the aptamers, lymphocytes will roll along human umbilical vein endothelial cells (HUVEC). In an alternative method, inhibition of L-selectin binding can be detected as inhibition of lymphocyte trafficking in vivo when the aptamers are administered to a mammal. These methods for detecting inhibition of L-selectin are described in detail herein. Other art-known methods for detecting inhibition of selectins also can be used in practicing the invention. Aptamers that inhibit ligand binding by selectins to any detectable extent are included within the invention. The oligonucleotides of the invention (i.e., aptamers) can be used therapeutical ly in vivo. Indeed, selectin-ligand interactions are thought to play a critical role in many types of inflammation and reperfusion injury. Thus, the oligonucleotides of the invention can be used to inhibit a variety of inflammatory and postischemic pathologies, such as ischemia-reperfusion injury, acute inflammatory states, and chronic immune responses. The therapeutic use of the aptamers may entail modifications designed to alter bioauai lability. The potential indication include all conditions in which selectins are known to play pathological roles (see Table 2). The oligonucleotides of the invention can be prepared for therapeutic use by admixing one or more oligonucleotides with a pharmaceutically acceptable excipient, such as saline solution or water. Generally, the oligonucleotides are introduced into a mammal by intravenous or intraarterial injection. Any other parenteral route (e.g., subcutaneous or intraperitoneal injection) may also be potentially used, although bioauallability may be less reliable. The oligonucleotides may also be modified e.g., with peg to increase bioauailability and improve half life. Other applications include diagnostic purposes, such as the use of suitably tagged oligonucleotides (e.g., with biotin or a fluorescent group) to detect L-selectin molecules on cell surfaces (e.g. circulating leukocytes) or in plasma or other body fluids (shed/proteolytically cleaved forms). If desired, additional doses of the oligonucleotides can be administered to the mammal for further amelioration of the pathology (e.g., injury or inflammation). To optimize the therapeutic regime, a practitioner of ordinary skill can monitor the patient for signs of amelioration of injury, and increase or decrease the dosage and/or frequency of oligonucleotide therapy as desired. BRIEF DESCRIPTION OF THE DRAWINGS

Figs. 1A- IB illustrate high affinity binding of evolved oligonucleotide pools to human mononuclear cells and selective interaction with L-selectin. For Fig. 1 A, binding of 2nd and 9th round oligonucleotide pools to human PBMCs was performed as described herein. Fig. IB illustrates inhibition binding of recombinant soluble selectins to immobilized polyacrylamide-SLe" by the enriched oligonucleotide pools. For comparison, the inhibitory properties of soluble SLe^λ are shown (Fig IB).

Figs. 2A-2D illustrate the interaction of a cloned oligonucleotide ligand with L- selectin. Fig. 2 A shows the primary structure of a family of 2-amino RNA ligands to L-selectin. An alignment of the evolved sequences for ligands isolated from rounds 6, 13 (22^"C) and 14 (4°C) is shown. Ligand designations specify round and isolate number. The sequence of ligand 14.12 was observed in 69 clones; 35 of these contained the sequence AUGAGUG rather than AUGAGUA. Fig. 2B illustrates binding of the cloned 14.12 oligonucleotide ligand to human peripheral blood mononuclear cells. The cell binding assays were carried out exactly as in Fig. 1 A. For determining divalent cation dependence, the buffer contained 4 mM EDTA in place of these cations. Fig. 1C illustrates inhibition by anti-L selectin MAb (DREG56) of ligand 14.12 binding to human PBMCs. Assays were performed as described in Fig. 1 A except that aliquots of a ³²P-labeled 14.12 oligonucleotide were combined with various concentrations of DREG56 (Endogen) or an isotype matched control antibody (anti-KLH, Becton Dickinson ) prior to mixing with cells. Oligonucleotide bound at various antibody concentrations is expressed as the percent of that bound in their absence. Fig. 2D shows inhibition of selectin binding to immobilized sialyl-Lewis", by cloned oligonucleotides with comparison to the randomized pool 40N7. The ELISA assays were carried out as described in Fig. IB.

Figs. 3A-3C illustrate the effects of cloned oligonucleotide ligands on the binding of L-selectin to natural ligands. Fig. 3 A illustrates competition of binding of L-selectin to metabolically labelled and purified GlyC AM- 1, which was carried out as described herein. Each point shown is: [(average of duplicates) - (negative control)]/ [(positive control) - (negative control)] expressed as a percentage. Fig. 3B illustrates competition of staining of lymph node HEV with recombinant L-selectin. Staining was carried out as described previously (Norgard et al., 1993, PNAS 90:1068-1072). Initial LS-Rg binding was carried out in the presence or absence of the oligonucleotides at various concentrations. Examples are shown of lOOnM of 40N7 (randomized pool, no effect) and of 13.32 (cloned ligand, complete inhibition). A control without oligonucleotide gave staining similar to that shown for 40N7 (data not shown). Fig. 3C illustrates competition of binding of lymphocytes to the high endothelial venules of lymph nodes, as studied using the Stamper -Woodruff assay (Stamper et al., 1977, J. Immunol. 119:772-780), exactly as previously described (Norgard et al., supra). The representative experiment shown here shows the effects of adding the oligonucleotides at a final concentrations of 160nM (40N7) or 80nM (13.32 and 14.12).

Figs. 4A-4B show that the single-stranded DNA oligonucleotides of the invention block L-selectin' s SLe* binding site. Fig. 4A shows inhibition of LS-Rg binding to SLe . Immobilized SLe" was incubated with LS-Rg and increasing concentrations of DNAs, along with a peroxidase-conjugated anti-human IgG. After washing, bound LS-Rg was indirectly quantified by addition of a peroxidase substrate and detection at 450 nM. Values shown represent the mean±SE from duplicate, or triplicate, samples from a representative experiment. Fig. 4B illustrates inhibition of oligonucleotide binding to LS-Rg by the adhesion blocking mAb DREG-56. 5'-³²P-labeled oligonucleotides (5 nM) were incubated with 1 nM LS-Rg and increasing concentrations of DREG56 or an isotype-matched control. Reaction mixtures were incubated at 37^CC for 15 min, partitioned by nitrocellulose filtration, and bound oligonucleotide was quantified. Open squares, LD20H1 plus control antibody; filled squares, LD20U1 plus DREG-56; open triangles, LD174tl plus control antibody; closed triangles, LD174tl plus DREG-56; open circles, LD196tl plus control; filled circles, LD196tl plus DREG-56. The data shown are representative of two experiments. Figs. 5A-5B show that FITC-conjugate oligonucleotides binds specifically to L-selectin on human lymphocytes (Fig. 5A) and granulocytes (Fig. 5B) in whole blood. Cells were stained with FITC-LD20U1 alone and in the presence of 0.3 μM DREG-56, 7 μM unlabeled LD20U1 , or cells were reassayed after addition of 4 mM EDTA. Cells were gated using side scatter and CD45-Cy5PE staining.

Figs. 6A-6C show that modified oligonucleotides block L-selectin-mediated adhesion in shear dependent assays in vitro and in vivo. (Fig. 6A) In vitro, LD201tl significantly reduces rolling of human PBMC on activated HUVEC. HUVEC were cultured in capillary tubes and activated with IL-lβ. Isolated PBMC were infused into a loop in which physiological shear forces were maintained, and rolling cells were monitored by video microscopy. (Fig. 6B) Ex vivo pretreatment of human PBMC with LD20U1 inhibits lymphocyte trafficking to SCID mouse PLN. ^5,Cr-labeled human PBMC were incubated with modified (PEGylated and 3' capped) aptamer or antibody and then injected intravenously into SCID mice. After 1 hour (h), mice were anesthetized, killed, and counts incorporated into organs were determined by a gamma counter. Values shown represent the mean±SE of triplicate samples, and are representative of three experiments. (Fig. 6C) Preinjection of LD201tl inhibits human lymphocyte trafficking to SCID mouse PLN and MLN. 1-5 min before intravenous injection of ⁵¹Cr-labeled human PBMC, modified aptamer or antibody was injected intravenously. Incoφorated counts were determined as in Fig. 6B. Values shown represent the mean±SE of triplicate samples and are representative of two experiments.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS PART I

The following examples are provided in order to illustrate, not limit, the invention. First, certain parameters of the experiments are described in detail and provide guidance for practicing the invention in general. Those of skill in the art recognize that other art-known methods and materials can readily be substituted for those described herein.

Briefly, these examples demonstrate (i) the isolation and characterization of oligonucleotides that inhibit L-selectin and (ii) use of the oligonucleotides to inhibit binding of L-selectin to a natural L-selectin ligand. Similar approaches could be taken to isolate and characterize calcium-dependent oligonucleotides as inhibitors of the other two selectins.

Materials and Methods:

Selection for isolation of L-selectin ligands. L-selectin Receptor Globulin (LS-Rg) was prepared as described previously (Norgard et al., 1993, PNAS 90: 1068-1072), immobilized on Protein A Sepharose 4 Fast Flow (Pharmacia) (PAS) over-night at 4°C in binding buffer (20mM HEPES pH 7.4, 125 mM NaCl, ImM CaCl₂, ImM MgCl₂) adjusted to pH 8.0 followed by extensive washes with unmodified binding buffer. Coupling efficiency was >95% based on the LS-Rg content of wash fractions quantified by ELISA. Coupling densities ranged from 8 pmole/ul of drained beads in the initial round to 2.4 fmole/μl in the final rounds. Typically, 10 μl of beads, total reaction volumes of 100 to 200 μl and a 10: 1 molar ratio of oligonucleotide to protein were used. Oligonucleotide pools were pre-cleared for 30 minutes at 4°C or 22°C with 250μl of PAS beads, and unbound oligonucleotide mixed with LS-Rg-PAS beads for 90 minutes at 4°C or 22°C in binding buffer. Backgrounds were determined by incubating an equal quantity of the same oligonucleotide with PAS beads under identical conditions. Both sets of beads were washed identically with binding buffer (pH 7.4) until wash fractions of the control beads contained (-0.05%) or less of the input oligonucleotide. Bound oligonucleotide was eluted with binding buffer containing EDTA in place of divalent cations (Rounds 1-3, 50 mM EDTA; rounds 4- 14, 5 mM EDTA). It is important to note (a) total salt concentration should not exceed 150 mM (b) high EDTA gives non-specific elution. EDTA -eluted oligonucleotides from the LS-Rg-PAS beads were precipitated, reverse transcribed, amplified, in vitro transcribed and gel-purified (Tuerk, C. & Gold, L. (1990) Science 249, 505-510).

The starting pool of oligonucleotide molecules (40N7), which contained a 40- nucleotide randomized region, was prepared by PCR amplification and T7 oligonucleotide polymerase transcription from a synthetic DNA template: 5'-

TCGGGCGAGTCGTCTG-40N-CCGCATCGTCCTCCC-3' (Operon). PCR primers were: 5n7, 5'-TAATACGACTCACTATAGGGAGGACGATGCGG-3'; 3n7, 5'- TCGGGCGAGTCGTCTG-3'. Evolved pools were cloned and sequenced by standard procedures. Inhibition of selectin binding to immobilized sialyl-Lewis^* or S'SOj-Le is" The binding of recombinant soluble receptor-globulin fusion proteins including the lectin and EGF domains of L- E- and P-selectins (Norgard, K. E., Han, II., Powell, L., Kriegler, M., Varki, A. & Varki, N. M. (1993) Proc. Natl. Acad. Sci. USA 90, 1068- 1072; Nelson, R. M., Dolich, S., Aruffo, A., Cecconi. O. & Bevilacqua, M. P. (1993) J. Clin. Invest. 91, 1 157-1166) to immobilized polyacrylamide-SLe^x or 3'-HSO,Le^x (Syntesome, Munchen, Germany) was studied in an ELISA assay similar to that previously described (Nelson et al. , supra), except that the assay buffers contained 20mM Hepes, pH 7.45, 125 mM NaCl, 2 mM CaCl₂, 2 mM MgCl₂ and 1% protease- free BSA, and that autoclaved reagents and sterile materials were used throughout. All three selectins were used at 1 nM, and pre-complexed with an optimal secondary antibody dilution as previously described for L-selectin (Nelson et al, supra). The starting randomized mixture of sequences (40N7) was used as a negative control. Background values were determined in the presence of 2-5 mM EDTA. Competition of binding of L-selectin to metabolically labelled GlyCAM-1. Labelling and purification of ³⁵S-labelled lymph node secreted L-selectin ligand GlyCAM-1 was carried out by minor modifications of prior methods (Imai, Y., Singer, M. S., Fennie, C, Lasky, L. A. & Rosen, S. D. (1991) J. Cell Biol. 113, 1213- 1222; Lasky, L. A., Singer, M. S., Dowbenko, D., Imai, Y., Henzel, W. J., Grimley, C, Fennie, C, Gillett, N., Watson, S. R. & Rosen, S. D. (1992) Cell 69, 927-938) involving sequential Wheat Germ Agglutinin and L-selectin affinity columns. The binding of -3000 cpm of [³⁵S]GlyCAM-l to LS-Rg immobilized on Protein A coated 12-well plates was studied in the buffer used for the other ELISA assays. The oligonucleotides in serial dilution were mixed with labeled GlyCAM-1 prior to addition to the wells. After washing, bound molecules were eluted with EDTA and counted. Non-specific binding was determined by adding 5 mM EDTA during initial binding.

Dissociation constants and IC_M values. Oligonucleotide-protein dissociation constants were measured by nitrocellulose filter partioning (Tuerk et al. , supra) at 4°C or 22 °C in binding buffer, and calculated by least square fits using the graphics program Kaleidagraph (Synergy Software, Reading, PA). IC₅₀ values for ELISA inhibition assays were derived by fitting the data iteratively to a non-linear least squares equation (SigmaPlot, Jandel Scientific, San Rafael, CA) and are reported as mean +/- SD. Human Peripheral Blood Mononuclear Cells (PBMCs) were isolated by Ficoll- Hypaque density gradient centrifugation from EDTA or citrate anticoagulated whole blood of normal volunteers.

Binding of oligonucleotide pools to PBMCs. PBMCs were washed twice in 10 ml DPBS without divalent cations (Gibco 141-90-029) and resuspended in buffer modified to have close to physiological salt concentration buffer (140 mM NaCl, 5 mM KCI, 1 mM CaCl₂, 1 mM MgCl₂ and 20 mM HEPES pH 7.35). Cells were counted, viability confirmed by trypan blue exclusion (>99%), resuspended at 2x10⁷ cells/ml in plus 1% BSA, and immediately used. Cells in 25 ul of buffer were combined with equal volumes of serially diluted ³²P-labeled oligonucleotide in 0.65 ml Eppendorf tubes and incubated on ice for 30 minutes with occasional gentle vortexing; 40 to 45 ul of the reaction was carefully layered on 50 ul of a 1 :1 mixture of diony dibutyl phthalate in a 0.65 ml Eppendorf tubes and centrifuged for 5 minutes at 16,000g at 4°C. Tubes were frozen in dry ice/ethanol; tips were amputated into scintillation vials and counted without fluor in a Beckman LS2000. Oligonucleotide binding was calculated from duplicate determinations, using the fraction of input counts bound, total oligonucleotide concentration, and number of cells.

Results:

Isolation of high affinity L-selectin oligonucleotides. The first starting oligonucleotide pool for selection (40N7) was nuclease-stabilized by 2' amino pyrimidine nucleotides (Jellinek, D., L.S. Green, C. Bell, C.K. Lynott, N. Gill, C. Vargeese, G. Kirscheheuter, D.P.C. McGee, P. Abesinghe, W.A. Pieken, R. Shapiro, D.B. Rifkin, D. Moscatelli, and N. Janic. (1995). Biochemistry. 34:\, 1 1363-1 1372) and randomized at 40 positions (potentially 4⁴⁰, but in practice 6 x 10'" members). The apparent affinity of the starting pool for the target protein, a human L-selectin-Ig chimera (LS-Rg) (31) immobilized on Protein A Sepharose beads, was 9 uM. The strategy for selecting high-affinity selectin antagonists was based on the premise that oligonucleotides (also referred to herein as ligands) interacting with the lectin binding site would inhibit carbohydrate binding and be preferentially eluted by chelating the lectin domain's bound Ca⁺⁺ with low concentrations of EDTA. The initial six rounds of selection were performed at 4°C. At the 7th round, the selection was branched and carried in parallel at 4°C and at 22°C. The dissociation constants of the 9th (22°C) and 10th (4°C) round pools for purified L-selectin were 8 and 17 nM at 4°C, respectively (data not shown). Binding was specific for L-selectin in comparison to E- and P-selectin, divalent cation dependent, and temperature sensitive. After 14 rounds at 4°C, the evolved oligonucleotide pool's apparent dissociation constant was 0.3 nM, remained divalent cation dependent and exhibited a 300,000-fold improvement over the starting pool. Thus, the protocol enriched for a subset of oligonucleotide sequences which likely bind with high-affinity to the calcium- dependent C-type lectin domain of L-selectin (although divalent cation dependence of oligonucleotide structure cannot be ruled out).

The 9th round, but not 2nd round pool, showed high affinity saturable binding to human peripheral blood mononuclear cells (PBMCs) which are known to express L- selectin (Fig. 1 A), indicating that the oligonucleotides ligands selected against the immobilized, purified protein are able to recognize native L-selectin in the context of a cell surface. In static ELISA assays (Fig. 1 B), the 1 Oth round pool inhibited the binding of purified L-selectin to immobilized sLe^x with IC₅₀s of 18 nM (+/- 4.5) and 3'S0₃-Le^x (6 nM +/- 4) (n=2, see Methods for details). Complete inhibition is seen at concentrations of 1 OOnM, and this concentration has no effect on the binding of E- and P-selectin receptor-globulin chimeras (Norgard et al.; Nelson et al, supra) to the same ligands (Fig IB). The specific inhibition of L-selectin agrees with the above mentioned binding specificity. In contrast, sialyl Lewis\ a well-recognized natural oligosaccharide inhibitor of the the selectins, is -10,000-fold less effective than the oligonucleotide pool and, unlike the latter, shows very limited selectivity among the three selectins (Fig IB). At a lOOnM concentration, the 10th round oligonucleotide pool also abolished the binding of LS-Rg to its natural ligands on the high endothelial venules of lymph nodes. Taken together, these data confirm the specificity of the inhibition of L-selectin, and suggest that the oligonucleotide ligands are interacting with the calcium-dependent C-type lectin domain of L-selectin, which mediates physiological recognition in the vascular system.

Cloning and Sequencing of the ligands shows a common motif. Upon cloning, 75% of the ligands from the 14th (4°C) round pool and 35% from the 13th (22°C) pool had the same sequence, designated 14.12 (Fig. 2A). Ligand 14.12 gave a measured K_d of 0.2 nM and 3 nM to soluble L-selectin at 4°C and 22°C, respectively. The affinity of 14.12 for L-selectin is 3,500 to 5,500-fold greater than for E- and P- selectin and it showed the high affinity, saturable, divalent cation-dependent binding to human PBMCs found with the enriched oligonucleotide pool (Fig 2B). The estimated number of oligonucleotide binding sites (0.5 -1.3xl0⁵/cell) approximates the number of L-selectin molecules expected on these cells (Spertini, O., Schleiffenbaum, B., White-Owen, C, Ruiz, P.,Jr. & Tedder, T. F. (1992) J. Immunol. Methods 156, 115-123). Furthermore, binding was competitively inhibited by the anti-human L-selectin blocking monoclonal antibody DREG56 but not by an isotype matched control (Fig. 2C). Ligand 13.32 (Fig. 2A), isolated from the 22°C 13th round SELEX pool gave a Kd of 4 nM at 4°C and 3 nM at 22°C, i.e, it does not show the binding temperature sensitivity of 14.12. It also specifically binds to L-selectin on human PBMCs (data not shown). Both 13.32 and 14.12 inhibit L-selectin binding in the static ELISA assay with IC₅₀s of 9 nM (+/-8) and 37 nM (+/-29), respectively (n=4), while neither pool, at 500 nM, affects E- and P-selectin binding (Fig 2D). Sequence alignment suggests that both ligands are members of a family with the consensus sequence, AUGUGUGA (Fig. 2A). Although it is probable that the concensus nucleotides are directly involved in binding L-selectin, preliminary boundary and truncation experiments demonstrate that additional sequence is required for high affinity binding. Furthermore, high affinity ligands were observed in six additional, unrelated sequence families.

The high-affinity ligands block binding of L-selectin to natural ligands. All the ELISA competition studies presented above involve the binding of L-selectin to artificial ligands (polyacrylamide immobilized sLe^x or 3'HS0₃-Le^x). To see if the cloned oligonucleotides can block binding to physiological ligands, we studied the interaction of L-selectin with the natural ligand GlyC AM- 1, which was isolated from metabolically labeled high endothelial venules of mouse lymph nodes by affinity chromatography (Imai et al; Lasky et al. supra). As shown in Fig 3 A, this interaction was inhibited with an IC₅₀ of 17 nM (+/- 2, for oligonucleotide 14.12) and 9 nM (+/- 0.4, for oligonucleotide 13.32), while the randomized mixture (40N7) was ineffective (n=2). The cloned oligonucleotides (14.12 and 13.32) also specifically inhibited the interaction of LS-Rg (Fig 3B) and of human PBMCs (Fig 3C) with lymph node high endothelial venules (HEV) at concentrations of 50 to 100 nM. The PBMC:HEV interaction study (Fig 3C.) uses the Stamper- Woodruff assay, with which L-selectin was originally discovered (Stamper, H. B. & Woodruff, J. J. (1977) J. Immunol. 119, 772-780; Siegelman, M. H., van de Rijn, M. & Weissman, I. L. (1989) Science 243, 1165-1 172). The IC₅₀ values in these assays are higher than the directly measured Kd values. This is likely because the assays cannot be made sensitive enough to measure IC,₀s in the picomolar range, i.e., the number of selectin molecules required for a readout gives a lectin concentration in the nM range, and the inhibitors must be present in excess.

Conclusions and Prospects. These studies demonstrate the first in vitro selection of nucleic acid ligands for cell surface receptors. Using this approach, we have prepared specific oligonucleotide ligands for L-selectin with IC₅₀ values that are at least 10,000 - 100,000-fold better than those of the oligosaccharide ligands (Nelson et al , supra) currently in clinical trials for the therapeutic modulation of selectin function, and of those recently suggested (Hemmerich, S. & Rosen, S. D. (1994) Biochemistry 33, 4830-4835) as important in L-selectin binding to GlyCAM-1 (Crottet , P., Kim, Y., and Varki, A. Glycobiology 6, 191-208). While the therapeutic use of nucleotides presents some challenges (Gold, L. (1995) J. Biol. Chem. 270, 13581-13584), technical progress in the modification and stabilization of oligonucleotides suggests ways in which potential problems may be circumvented. For example, nuclease susceptibility of oligonucleotides can be reduced by chemical alterations, such as the 2'-NH₂ modifications used here (Jellinek et al. supra). However, since relatively short-lived infusions of oligosaccharides seem sufficient to attain significant therapeutic advantage in various pathological situations (Ward, P. A., Mulligan, M. S. & Vaporciyan, A. A. (1993) Thromb. Haemost. 70, 155-157; Albelda, S. M., Smith, C. W. & Ward, P. A. (1994) FASEB J. 8, 504-512; Bevilacqua, M. P., Nelson, R. M., Mannori, G. & Cecconi, O. (1994) Annu. Rev. Med. 45, 361-378; Lefer, A. M., Weyrich, A. S. & Buerke, M. (1994) Cardiovasc. Res. 28, 289-294), it may not be necessary or even desirable to greatly enhance the stability of the oligonucleotides. The partial temperature sensitivity of binding affinity can be dealt with by carrying out the selection at physiological temperatures or by using alternative modifications. Finally, these studies provide high-affinity, specific reagents for dissecting the roles of L-selectin in normal and pathological states. Since the published literature suggests that E- and P-selectin can be even more important in some pathological processes, experiments directed at obtaining unique high affinity nucleotide ligands for these receptors are also in progress. We anticipate that such molecules will allow the preferential blockade of a specific selectin in a particular physiological or pathological situation.

PART II

Briefly, these examples demonstrate that the single-stranded aptamers of the invention (i) inhibit binding of L-selectin to SLe" , (ii) bind to L-selectin on cell surfaces, (iii) inhibit lymphocyte rolling on activated endotherial cells, and (iv) inhibit lymphocyte trafficking in vivo. First, certain parameters of these examples, and of the invention in general, are provided. The 2-NH₂RNA ligands isolated in part I suffered from two problems (a) loss of binding at 37°C (b) require 2-NH₂RNA nucleotide donors that are expensive to prepare. We therefore turned to single-stranded DNAs. Selection. An L-selectin-IgG fusion protein (LS-Rg) was produced and selection was performed as described (23 and references therein), with the following modifications. All selections were performed at 22°C except round 1 (4°C) and rounds 8, 13, 16, and 17 (37°C). Again, physiological salt concentrations and low EDTA elution are critical. Selected single-stranded DNAs (ssDNAs) were precipitated, PCR-amplified using a biotinylated 3' PCR primer, and the strands were separated using denaturing polyacrylamide gel electrophoresis. The starting ssDNA pool contained a 40- nucleotide randomized region flanked by fixed sequences for PCR primer annealing: 5'-CTACCTAC-GATCTGACTAGC-N₄₀-GCTTACTCTCATGTAGTTCC-3'. Individual ligands were cloned and sequenced by standard procedures. DNA-protein equilibrium dissociation constants. K_ds were measured by nitrocellulose filter partitioning (Tuerk, C, and L. Gold (1990) Science (Wash., D.C.) 249:505-510) in binding buffer (20 mM Hepes, pH 7.5, 125 mM NaCl, 1 mM MgCl₂, ImM CaCl₂, 5 mM KCI) plus 0.01% (wt/vol) human serum albumin (Sigma Chemical Co., St. Louis, MO) and were calculated by least square fits using Kaleidagraph (Synergy Software, Reading, PA). Oligonucleotide syntheses and modification. DNAs were synthesized by Operon Technologies, Inc. (Alameda, CA) or at NeXstar Pharmaceuticals using standard procedures. Fluorescein labeling was accomplished by incorporation of an FITC phosphoramidite (Glen Research Corp., Sterling, VA) at the 5' or 3' end. Synthesis of modified oligonucleotides, at NeXstar, was initiated by coupling to a dT-5'-CE- polystyrene support (Glen Research Corp.), resulting in a 3'-3' terminal phosphodiester linkage, and ending with an Amino Modifier C6 dT (Glen Research Corp.) At the 5' end. For polyethylene glycol (PEG)-ylation, a 20,000 mol wt PEG2- N-hydroxysuccinimide ester (Shearwater Polymers, Huntsville, AL) was coupled to the oligonucleotide through the 5' amine moity. Truncated forms of the three aptamers were synthesized: LD201tl :

TAGCCAAGGTAACCAGTACAAGGTGCTAAACGTAATGGCTT- CGGCTTAC; LD196tl : AGCTGGCGGTACGGGCCGTGCACCCACTTACCTGGGAAGT- GAGCTTA; LD174tl: TAGCCATTCACCATGGCCCCTTCCTACGTATGTTCTGCGGGTG- GCTTA. A scrambled sequence control DNA was generated by randomizing the sequence of LD20U1 with an additional A:

GATGTAGGGACAGTCAAATGGAGTGGTTCAAACCGCC- CATCTTCAACAAT. Sle^x binding assay. Polyacrylamide-SLe^λ or SLe^x-BSA (Oxford GlycoSystems. Oxford, United Kingdom) in lx PBS, without CaCl₂ and MgCl₂ and MgCl₂ (GIBCOBRL, Gaithersburg, MD), was immobilized at 100 ng/well onto a microtiter plate by overnight incubation at 22 °C. The wells were blocked for 1 h with the assay buffer consisting of 20 mM Hepes, JJLL mM NaCl, 1 mM CaCl₂, 1 mM MgCl₂. 5 mM KCL, 8.9 mM NaOH, final pH 8, and 1% globulin-free BSA (Sigma Chemical Co.). The reaction mixtures, incubated for 90 min with orbital shaking, contained 5 nM LS- Rg, a 1 : 100 dilution of anti-human IgG peroxidase conjugate (Sigma Chemical Co.), and 0-50 nM of competitor in assay buffer. After incubation, the plate was washed with BSA-free assay buffer to remove unbound chimera-antibody complex and incubated for 25 min with O-phenylenediamine dihydrochloride peroxidase substrate (Sigma Chemical Co.) By shaking in the dark at 22 °C. Absorbance was read at 450 nm on a Bio-Kinetics reader (model EL312e;Bio-Tek Instruments, Laguna Hills, CA). Flow cytometry. 25-μl aliquots of heparinized whole blood were stained for 30 min at 22°C with 2 μg cyanine5-phycoerythrin-labeled anti-CD45 (generous gift of Ken Davis, Becton-Dickinson, San Jose, CA) and 0.15 μM FITC-LD201tl . The final concentration of whole blood was at least 70% (vol/vol). Stained, concentrated whole blood was diluted 1 :15 in 140 mM NaCl, 5 mM KCI, 1 mM MgCl₂, 1 mM CaCl₂, 20 mM Hepes, pH 7.4, 0.1% BSA, and 0.01% NaN₃ immediately before flow cytometry on a Becton-Dickinson FACS® caliber. Lymphocyte rolling. Human PBMC were isolated and human umbilical vein endothelial cells (HUVEC) were prepared in capillary tubes as described (Bargatze, R.F., S. Kurk, G. Watts, T.K. Kishimoto, CA. Speer and M.A. Jutila (1994) J. Immunol. 152:5814-5825). HUVEC were then treated with human recombinant IL- 1 β for 1 h, washed, and kept at 37°C before infusion into the shear system loop. Flow rates simulated in vivo shear conditions at 2 dyn/cm² (Bargatze et al. , supra). PBMC were infused at 2 x IO⁶ cell/ml in Hepes-HBSS, containing MgSO₄ and CaCl₂ (GIBCOBRL) plus 1% human serum. Rolling PBMC were monitored for the experiment's duration while being videotaped for off-line analysis using NIH IMAGE software within 350μm video-microscopic fields. Lymphocyte trafficking. Human PBMC were purified from heparinized blood by a Ficoll-Hypaque gradient, washed twice with HBSS (calcium/magnesium free) and labeled with ^5ICr (Amersham, Arlington Heights, IL). Cells were then washed twice with HBSS (containing calcium and magnesium) and 1% BSA (Sigma Chemical Co.). Labeled cells (2 x 10⁶) were either untreated or mixed with either 15 pmol of antibody (DREG-56 or MEL-14) or 4, 1 , or 0.4 nmol of PEGylated and 3' capped aptamer, before intravenous injection into female SCID mice (6-12 wk of age). Alternatively, the mice were injected with either 15 pmol DREG-56 or 4 nmol modified oligonucleotide 1-5 min before injecting the labeled cells. 1 h later the animals were anesthetized, a blood sample was taken, and the mice were killed. Peripheral lymph nodes (PLN), mesenteric lymph nodes (MLN), Peyer's patches, spleen, liver, lungs, thy us, kidneys, and bone marrow were removed and the counts incoφorated into the organs determined by a gamma counter (Packard Instruments, Meriden, CT).

Results:

Selection of aptamers from a combinatorial DNA library. The binding specificity of selectins for their ligands appears to be mediated predominantly by the amino- terminal calcium-dependent lectin domain (Geng, J-G., K.L. Moore, A.E. Johnson and R.P. McEver (1991) J. Biol. Chem., 266:22313-22318; Erbe, D.V., B.A. Wolitzky, L.G. Presta, CR. Norton, R.J. Ramos, D.K. Burns, J.M. Rumberger, B.N. Rao, C. Foxall, B.K. Brandley and L.A. Lasky (1992) J. Cell Biol. 119:215-227; Erbe, D.V.. S.R. Watson, L.G. Presta, B.A. Wolitzky, C. Foxall, B.K. Brandley and L.A. Lasky (1993) J. Cell Biol. 120:1227-1235). This calcium dependence provides a method for preferentially isolating inhibitory aptamers, since oligonucleotides bound at or near the carbohydrate binding site can be selectively eluted with low concentrations of EDTA (O'Connell, D., A. Koenig, S. Jennings, B. Hicke, H.-L. Han, T. Fitzwater, Y.-F. Chang, N. Varki, D. Parma, and A. Varki ( 1996) Proc. Natl. Acad. Sci., USA 93:5883-5887) high concentrations of EDTA give non-specific elution. The 2' amino-pyrimidine oligonucleotides previously isolated by this procedure have high affinity at 4 and 22°C and much lower affinity at 37°C (O'Connell et al, supra) and are hence unsuitable for in vivo testing. To isolate antagonists with improved thermal stability, we performed a selection experiment using deoxyoligonucleotides and higher selection temperatures, either 22 or 37°C A starting pool of 10¹⁵ random sequence ssDNAs was incubated with human LS-Rg immobilized on protein A-Sepharose beads. After extensive washing, bound oligonucleotides were eluted with 5 mM EDTA and PCR-amplified. DNA strands were then separated and the cycle was repeated. After 15 iterations, the DNA pool bound to LS-Rg with a K_d of 0.9±0.1 nM, versus > 5 μM, for the starting random pool.

Sequence, affinity, and specificity of aptamers. Cloning and sequencing of aptamers from the 15^th and 17^,h rounds revealed three distinct sequence families. Individual ligands had high affinity and specificity for LS-Rg; binding was divalent cation-dependent (data not shown). A representative aptamer from each sequence family is shown in Table 1. Ligand LD201 bound to LS-Rg with a K_ά of 1.8 nM at 37°C The affinities of LD 174 and LD 196 were comparable. No binding was detected to 700 nM concentrations of wheatgerm agglutinin, an N-acetyl glucosamine/sialic acid binding plant lectin, (Sgroi, D., A. Varki, S. Braesch- Andersen, and I. Stamenkovic (1993) J Biol. Chem. 268:701 1-7018). These ligands bound to LS-Rg 200-600-fold more tightly than to human E-selectin-Rg and 8,000- 15,000-fold more tightly than to human P-selectin-Rg (Table 1 ). In contrast to Sle^x, the aptamers described here are specific for L-selectin and bind with low nanomolar affinity.

Table 1 Ligand Sequence K_dL (nM) K_dE/K L K_dP/K L

LD201 5'-CAAGGTAACCAGTACAAGGTGCTAAACGTAATGGCTTCG-3' 1.8±0.2 300 9000 LD174 5'-CATTCACCATGGCCCCTTCCTACGTATGTTCTGCGGGTG-3' 5.5±5.1 600 8000 LD196 5'-TGGCGGTACGGGCCGTGCACCCACTTACCTGGGAAGTGA-3' 3.1±0.4 200 15000

Inhibition of Sle" binding and competition with a blocking mAb. We next determined that the DNAs inhibited L-selectin binding to Sle\ Shortened forms of LD201 , LD174, and LD196 were prepared (see Methods for sequences). These truncated forms, LD20H1, LD174tl, and LD196H (data not shown) inhibited LS-Rg binding to immobilized Sle^x with IC₅₀s of ~ 3 nM (Fig. 4-4). This is a 10⁵-10⁶-fold improvement over the published IC₅₀ values for SLe" in similar plate-binding assays (9-1 1 ,23). A scrambled sequence based on LD201tl showed no activity in this assay. Binding of all three DNA ligands to LS-Rg was blocked by DREG-56, an L-selectin blocking monoclonal antibody (29), but not by an isotype-matched control (Fig. 4-5). In competition experiments, LD20U1, LD174tl , or LD196tl prevented radiolabeled LD20U1 from binding to LS-Rg, consistent with the premise that the ligands bind the same or overlapping sites (data not shown). The blocking and competition experiments, taken together with divalent cation dependence of binding, suggest that all three aptamers bind to the lectin domain. This conclusion has been verified for LD201 by cross-linking experiments.

Aptamer binding to cell surface L-selectin. FITC-conjugated LD201tl specifically bound human lymphocytes and neutrophils in whole blood (Fig. 5B); binding was inhibited by competition with DREG-56, unlabeled LD201 , and by the addition of 4 mM EDTA (Fig. 5B ). In addition, human PBMC bound radiolabeled LD201. The binding was saturable, divalent cation-dependent, and competed by DREG-56 but not by an isotype-matched control antibody. These cell binding studies demonstrated that the aptamers bound saturably and specifically to human L-selectin in the context of lymphocyte and neutrophil cell surfaces.

Inhibition of lymphocyte rolling on activated endothelial cells. To effectively block L-selectin-mediated adhesion in vivo, an antagonist must function in systems that are subject to hydrodynamic shear (Springer, T.A. (1994) Cell 76:301-314; Bargatze et al, supra). Accordingly, LD20U1 and the scrambled sequence, modified by addition of a 3'- capping group and a 5' 20,000 mol wt PEG (neither modification significantly alters aptamer affinity; data not shown), were studied in a flow system in vitro. In this system human PBMC "roll" on activated endothelial cells (HUVEC; activated with IL-1 β) and rolling is dependent on both L-selectin and E-selectin (Bargatze et al., supra). LD20U1 and DREG-56 blocked rolling to a similar extent, 70% for PBMC (Fig. 6 A) and ~ 50% for neutrophils. The scrambled sequence had no activity in this assay (Fig. 6 A). Aptamer activity in vivo: lymphocyte trafficking in SCID mice. As the aptamers bound to human but not rodent L-selectin (data not shown), a xenogeneic lymphocyte trafficking system was established to evaluate in vivo efficacy. Human PBMC, labeled with ⁵¹Cr, were injected intravenously into SCID mice. In this system, human cells traffic to PLN and MLN. Lymphocyte accumulation in MLN and PLN is inhibited by DREG- 56 (Fig. 6 B) but not by MEL- 14 (data not shown), a monoclonal antibody that blocks murine L-selectin-dependent trafficking (30). Cell trafficking was determined 1 h after injection. For trafficking experiments, 3'-capped and 5'-PEGylated ssDNA aptamers were used because pharmacokinetic studies in rats indicate that their half-life in plasma is - 18 min, significantly longer than that of unmodified ssDNA aptamers. In initial trafficking experiments, cells were incubated with either DREG-56 OR 3'- capped and 5'-PEGylated oligonucleotide before injection. LD20U1 inhibited trafficking of cells to PLN (Fig. 65) and MLN in a dose-dependent fashion but had no effect on the accumulation of cells in other organs. At the highest dose tested (4 nmol), inhibition by the oligonucleotide was comparable with the effect of DREG-56 (15 pmol) in this system. LD174tl had similar activity (data not shown), while the scrambled sequence had no significant effect (Fig. 65). We next assayed the effect of modified oligonucleotide when it was not preincubated with cells. DREG-56 (15pmol/mouse) or the modified oligonucleotide (4 nmol/mouse) was injected intravenously into animals and 1-5 min later the radiolabeled human cells were given intravenously. Again, both LD20U1 and

DREG-56 inhibited trafficking to PLN and MLN while the scrambled sequence had no effect (Fig. 6C). Therefore, the modified oligonucleotide did not require preincubation with the cells to effectively block trafficking. To our knowledge, these experiments are the first demonstration of in vivo efficacy of an aptamer directed against a cell surface receptor.

In summary, we have generated oligonucleotide antagonists that bind with high affinity and specificity, in a divalent cation-dependent fashion, to human L-selectin. In vitro, the aptamers block binding of soluble L-selectin to SLe\ In vivo, the aptamers block the trafficking of human lymphocytes to murine peripheral lymphoid tissues, making them superior to the previously described aptamer antagonists of L-selectin, the temperature sensitivity of which rendered them unsuitable for use in vivo (O'Connell et al, supra).

Table 2. Selectins in Pathological Processes

The Table indicates where there is evidence for involvement of one or more selectins in a pathological process and/ or where abormal levels of a soluble selectin have been found, with potential utility in diagnosis

Selectin(s) Involved

MECHANISM TISSUE/PROCESS L P E REFS

Ischemia-reperfusion injury Heart (Coronary) + + + (1-15)

Brain (Stroke) + + + (16,17)

Lung + + (18-20)

Muscle + + (18,21)

Skin/ soft tissues + + (22-25)

Kidney + (26)

Liver + (27)

Intestine + + (28-32)

Transplant rejection +

Cardiac transplant rejection + (33)

Allergic encephalomyelitis + (61)

Arthus reaction + (62)

Atopic dermatitis + (63)

Allergic contact dermatitis + (64)

Infection-related inflammation Streptococcus pneumonia + + (65-67)

Streptococcus peritonitis + (68)

Listeria monocytogenes infection + (69)

Circuiting selectins in HIV infection + (70)

HTLV type I-associated myelopathy + (45)

CSF pleiocytosis in bacterial + (71,72) meningitis

Pediatric meningoencephalitis + (73)

Plasmodium falciparium malaria + + (74,75)

Neutrophil function in HIV infection + (76)

Tuberculosis (TB) + (77)

Immune responses L P E REFS. Humoral immune response + (34,78,79)

Primary T cell responses + (80)

Lymphocyte homing + (80,81)

Localecruitment of Helper T-l cells + + (82,83)

Common variable immunodefiency + (84) (CVID)

Abrogation of tumor immunity + (85)

Artherosclerosis and Thrombosis Atherosclerotic vascular disease + + (86-90)

Vascular thrombus formation + (91-93,93)

Enhanced heart allograft + (94) arteriosclerosis

Disseminated intravascular + (95) coagulation

Cancer cell adhesion and metastasis Adhesion & metastasis of colon cancer + + + (96-105)

Meningeal leukemia + (106)

Chronic myelocytic leukemia cell + (107) release from marrow

Squamous cell carcinoma (108)

Small cell lung carcinoma + (109)

Endothelium in in breast cancer (110) Altered serum selectin levels in + + (111) leukemia

Langerhans cell histiocytosis (LCH) (112)

Congenital hemangiomas (113)

Multifactorial Organ Damage Multisystem organ failure + + (18,114,115)

Hemorrhagic shock injury + + (26,116-119)

Adult respiratory distress syndrome + (120)

Sepsis-induced organ injury + + + (121-124)

Systemic inflammatory response + + + (125-127) syndrome

Experimental Inflammation Thioglycollate peritonitis + + (68,128-131)

Lipopolysaccharide injection + (132,133)

Chemically induced Liver + (134) inflammation

Skin inflammation by IgE injection + (135)

Cvtokine induced skin inflammation + (131)

Complement-mediated lung injury + + + (136-139)

Immune-complex mediated lung + + (138,140-14 injury 3)

Indomethacin-induced Intestinal + + (144) inflammation Complement-mediated lung injury + + + (136-139)

Immune-complex mediated lung + + (138,140-14 injury 3)

Indomethacin-induced Intestinal + + (144) inflammation

Delayed Type Hypersensitivity + + + (145-149)

Intestinal mucosal injury with + (150) lactoferrin

Radiation induced microvascuiar + (151) damage

Miscellaneous +

Soluble L-selectin in premature infants + (152,153)

Burn injury + + (122,154)

Leukocytes rolling on activated + + + (155-158) endothelium

Hyperoxic lung injury + + (159,160)

Control of neutrophil half life + (161)

Altered hematopoiesis in + (162) selectin-deficiency

Endothelial cell hypoxia and + + (163-165) regeneration

Grey platelet syndrome + (166)

Idiopathic pulmonary fibrosis + (167,168)

REFERENCES

1. Ma, X., A. S. Weyrich, D. J. Lefer, M. Buerke, K. H. Albertine, T. K. Kishimoto. and A. M. Lefer. 1993. Monoclonal antibody to L-selectin attenuates neutrophil accumulation and protects ischemic reperfused cat myocardium. Circulation 88:649-658.

2. Weyrich, A. S., X. Ma, D. J. Lefer, K. H. Albertine, and A. M. Lefer. 1993. In vivo neutralization of P-selectin protects feline heart and endothelium in myocardial ischemia and reperfusion injury. J. Clin. Invest. 91 :2620-2629.

3. Altavilla, D., F. Squadrito, M. Ioculano, P. Canale, G. M. Campo, B. Zingarelli, and A. P. Caputi. 1994. E-selectin in the pathogenesis of experimental myocardial ischemia-reperfusion injury. Eur. J. Pharmacol. Environ. Toxicol. Pharmacol. 270:45-51.

4. Buerke, M., A. S. Weyrich, T. Murohara, C. Queen, C K. Klingbeil, M. S. Co, and A. M. Lefer. 1994. Humanized monoclonal antibody DREG-200 directed against L-selectin protects in feline myocardial reperfusion injury../ Pharmacol. Exp. Ther. 271 : 134-142.

5. Buerke, M., A. S. Weyrich, Z. Zheng, F. C A. Gaeta, M. J. Forrest, and A. M. Lefer. 1994. Sialyl Lewis^x-containing oligosaccharide attenuates myocardial reperfusion injury in cats. J. Clin. Invest. 93: 1140-1148. 6. Lefer, D. J., D. M. Flynn, M. L. Phillips, M. Ratcliffe, and A. J. Buda. 1994. A novel sialyl Lewis analog attenuates neutrophil accumulation and myocardial necrosis after ischemia and reperfusion. Circulation 90:2390-2401.

7. Murohara, T., M. Buerke, and A. M. Lefer. 1994. Polymorphonuclear leukocyte-induced vasocontraction and endothelial dysfunction: Role of selectins. Arterioscler. Thromb. 14: 1509-1519.

8. Kaikita, K., H. Ogawa, H. Yasue, T. Sakamoto, H. Suefuji, H. Sumida, and K. Okumura. 1995. Soluble P-selectin is released into the coronary circulation after coronary spasm. Circulation 92:1726-1730.

9. Lefer, A. M. 1995. Role of selectins in myocardial ischemia reperfusion injury. Ann. Thorac. Surg. 60:113-111. 10. Flynn, D. M., A. J. Buda, P. R. Jeffords, and D. J. Lefer. 1996. Sialyl Lewis^λ-containing carbohydrate reduces infarct size: Role of selectins in myocardial reperfusion injury. Am. J. Physiol. Heart Circ. Physiol. 271 :H2086-H2096.

11. Lefer, D. J., D. M. Flynn, D. C. Anderson, and A. J. Buda. 1996. Combined inhibition of P-selectin and ICAM-1 reduces myocardial injury following ischemia and reperfusion. Am. J. Physiol. Heart Circ. Physiol. 27 H2421-H2429.

12. Lefer, D. J., D. M. Flynn, and A. J. Buda. 1996. Effects of a monoclonal antibody directed against P-selectin after myocardial ischemia and reperfusion. Am. J. Physiol Heart Circ. Physiol. 270:H88-H98. 13. Miura, T., D. P. Nelson, M. L. Schermerhom, T. Shin'oka, G. Zund, P. R. Hickey, E. J. Neufeld, and J. E. Mayer r.. 1996. Blockade of selectin-mediated leukocyte adhesion improves postischemic function in lamb hearts. Ann. Thorac. Surg. 62:1295-1300.

14. Scalia, R., T. Murohara, J. A. Delyani, T. O. Nossuli, and A. M. Lefer. 1996. Myocardial protection by N,N,N-trimethylsphingosine in ischemia reperfusion injury is mediated by inhibition of P-selectin. J. Leukocyte Biol. 59:317-324.

15. Tojo, S. J., S. Yokota, H. Koike, J. Schultz, Y. Hamazume, E. Misugi, K. Yamada, M. Hayashi, J. C. Paulson, and S. Morooka. 1996. Reduction of rat myocardial ischemia and reperfusion injury by sialyl Lewis x oligosaccharide and anti-rat P-selectin antibodies. Glycobiology 6:463-469.

16. Morikawa, E., S. M. Zhang, Y. Seko, T. Toyoda, and T. Kirino. 1996. Treatment of focal cerebral ischemia with synthetic oligopeptide corresponding to lectin domain of selectin. Stroke 27:951-955.

17. Zhang, R. L., M. L. Phillips, M. Chopp, C L. Rosenbloom, R. Cruz, and A. Manning. 1996. E-selectin in focal cerebral ischemia and reperfusion in the rat. J.

Cereb. Blood Flow Metab. 16: 1126- 1136.

18. Seekamp, A., G. O. Till, M. S. Mulligan, J. C. Paulson, D. C. Anderson, M. Miyasaka, and P. A. Ward. 1994. Role of selectins in local and remote tissue injury following ischemia and reperfusion. Am. J. Pathol. 144:592-598. 19. Moore, T. M., P. Khimenko, W. K. Adkins, M. Miyasaka, and A. E. Taylor. 1995. Adhesion molecules contribute to ischemia and reperfusion-induced injury in the isolated rat lung. J. Appl. Physiol. 78:2245-2252.

20. Carden, D. L., J. A. Young, and D. N. Granger. 1993. Pulmonary microvascuiar injury after intestinal ischemia-reperfusion: Role of P-selectin. J. Appl. Physiol. 75:2529-2534.

21. Weiser, M. R., S. A. L. Gibbs, C R. Valeri, D. Shepro, and H. B. Hechtman.

1996. Anti-selectin therapy modifies skeletal muscle ischemia and reperfusion injury. Shock 5:402-407.

22. Winn, R. K., D. Liggit N. B. Vedder, J. C. Paulson, and J. M. Harlan. 1993. Anti-P-selectin monoclonal antibody attenuates reperfusion injury to the rabbit ear. J. Clin. Invest. 92:2042-2047.

23. Mihelcic, D., B. Schleiffenbaum, T. F. Tedder, S. R. Sharar, J. M. Harlan, and R. K. Winn. 1994. Inhibition of leukocyte L-selectin function with a monoclonal antibody attenuates reperfusion injury to the rabbit ear. Blood 84:2322-2328. 24. Han, K. T., S. R. Sharar, M. L. Phillips, J. M. Harlan, and R. K. Winn. 1995. Sialyl Lewis" oligosaccharide reduces ischemia-reperfusion injury in the rabbit ear. J. Immunol. 155:401 1-4015.

25. Yamada, S., T. N. Mayadas, F. Yuan, D. D. Wagner, R. O. Hynes, R. J. Melder, and R. K. Jain. 1995. Rolling in P-selectin deficient mice is reduced but not eliminated in the dorsal skin. Blood 86:3487-3492.

26. Billups, K. L., M. A. Palladino, B. T. Hinton, and J. L. Sherley. 1995. Expression of E-selectin mRNA during ischemia/reperfusion injury. J. Lab. Clin. Med. 125:626-633.

27. Garcia-Criado, F. J., L. H. Toledo-Pereyra, F. Lopez-Neblina, M. L. Phillips, A. Paez-Rollys, and K. Misawa. 1 95. Role of P-selectin in total hepatic ischemia and reperfusion. J. Am. Coll. Surgeons 181:327-334.

28. Kubes, P., I. Kurose, and D. N. Granger. 1994. NO donors prevent integrin-induced leukocyte adhesion but not P-selectin-dependent rolling in postischemic venules. Am. J. Physiol. Heart Circ. Physiol. 267:H931-H937. 29. Gibbs, S. A. L., M. R. Weiser, L. Kobzik, C. R. Valeri, D. Shepro, and H. B. Hechtman. 1996. P-selectin mediates intestinal ischemic injury by enhancing complement deposition. Surgery 1 19:652-656.

30. Davenpeck, K. L., T. W. Gauthier, K. H. Albertine, and A. M. Lefer. 1994. Role of P-selectin in microvascuiar leukocyte-endothelial interaction in splanchnic ischemia-reperfusion. Am. J. Physiol. Heart Circ. Physiol. 267:H622-H630.

31. Gauthier, T. W., K. L. Davenpeck, and A. M. Lefer. 1994. Nitric oxide attenuates leukocyte-endothelial interaction via P-selectin in splanchnic ischemia-reperfusion. Am. J. Physiol Gastrointest. Liver Physiol. 267:G562-G568. 32. Altavilla, D., F. Squadrito, P. Canale, M. loculano, G. M. Campo, G. Squadrito, A. Saitta, and A. P. Caputi. 1995. Tumor necrosis factor induces E-selectin production in splanchnic artery occlusion shock. Am. J. Physiol. Heart Circ. Physiol. 268-.H1412-H1417. 33. Turunen, J. P., M. L. Majuri, A. Seppo, S. Tiisala, T. Paavonen, M. Miyasaka, K. Lemstrδm, L. Penttila, O. Renkonen, and R. Renkonen. 1995. De novo expression of endothelial sialyl Lewis" and sialyl Lewis" during cardiac transplant rejection: Superior capacity of a tetravalent sialyl Lewis" oligosaccharide in inhibiting L-selectin-dependent lymphocyte adhesion. J. Exp. Med. 182: 1 133-1 141.

34. Munro, J. M., D. M. Briscoe, and T. F. Tedder. 1996. Differential regulation of leucocyte L-selectin (CD62L) expression in normal lymphoid and inflamed extralymphoid tissues. J. Clin. Pathol 49:721-727.

35. Shreeniwas, R., L. L. Schulman, M. Narasimhan, C C McGregor, and C C. Marboe. 1996. Adhesion molecules (E-selectin and ICAM-1) in pulmonary allograft rejection. Chest 1 10:1 143-1 149. 36. Pilewski, J. M., R. A. Panettieri r., L. R. Kaiser, and S. M. Albelda. 1994. Expression of endothelial cell adhesion molecules in human bronchial xenografts. Am. J. Respir. Crit. Care Med. 150:795-801. 37. Hanninen, A., C. Taylor, P. R. Streeter, L. S. Stark, J. M. Sarte, J. A. Shizuru, O. Simell, and S. A. Michie. 1993. Vascular addressins are induced on islet vessels during insulitis in nonobese diabetic mice and are involved in lymphoid cell binding to islet endothelium. J. Clin. Invest. 92:2509-2515. 38. Yang, X. -D., N. Karin, R. Tisch, L. Steinman, and H. O. McDevitt. 1993. Inhibition of insulitis and prevention of diabetes in nonobese diabetic mice by blocking L-selectin and very late antigen 4 adhesion receptors. Proc. Natl. Acad. Sci. £/&4 90: 10494-10498.

39. Lepault, F., M. -C. Gagnerault, C Faveeuw, H. Bazin, and C. Boitard. 1995. Lack of L-selectin expression by cells transferring diabetes in NOD mice: Insights into the mechanisms involved in diabetes prevention by Mel- 14 antibody treatment. Ewr. J. Immunol. 25:1502-1507.

40. Jilma, B., P. Fasching, C. Ruthner, A. Rumplmayr, S. Ruzicka, S. Kapiotis, O. F. Wagner, and H. G. Εichler. 1996. Elevated circulating P-selectin in insulin dependent diabetes mellitus. Thromb. Haemost. 76:328-332.

41. Grober, J. S., B. L. Bowen, H. Ebling, B. Athey, C. B. Thompson, D. A. Fox, and L. M. Stoolman. 1993. Monocyte-endothelial adhesion in chronic rheumatoid arthritis. In situ detection of selectin and integrin-dependent interactions. J. Clin. Invest. 91 :2609-2619. 42. Hosaka, S., M. R. Shah, R. M. Pope, and A. E. Koch. 1996. Soluble forms of P-selectin and intercellular adhesion molecule-3 in synovial fluids. Clin. Immunol. Immunopathol 78:276-282.

43. Jamar, F., P. T. Chapman, A. A. Harrison, R. M. Binns, D. O. Haskard, and A. M. Peters. 1995. Inflammatory arthritis: Imaging of endothelial cell activation with an indium- 111 -labeled F(ab')₂ fragment of anti-E-selectin monoclonal antibody. Radiology 194:843-850.

44. Mόssner, R., K. Fassbender, J. Kϋhnen, A. Schwartz, and M. Hennerici. 1996. Circulating L-selectin in multiple sclerosis patients with active, gadolinium-enhancing brain plaques. J. Neuroimmunol. 65:61-65. 45. Tsukada, N., K. Miyagi, M. Matsuda, and N. Yanagisawa. 1995. Soluble E-selectin in the serum and cerebrospinal fluid of patients with multiple sclerosis and human T-lymphotropic virus type 1 -associated myelopathy. Neurology 45: 1914-1918.

46. Blann, A. D., P. A. Sanders, A. Herrick, and M. I. V. Jayson. 1996. Soluble L-selectin in the connective tissue diseases. Br. J. Haematol 95:192-194.

47. Hebbar, M., P. Lassalle, A. Janin, D. Vanhee, S. Bisiau, P. -Y. Hatron, A. -B. Tonnel, and B. Gosselin. 1995. E-selectin expression in salivary endothelial cells and sera from patients with systemic sclerosis. Role of resident mast cell-derived tumor necrosis factor a. Arthritis Rheum. 38:406-412. 48. Adams, D. H., S. G. Hubscher, N. C Fisher, A. Williams, and M. Robinson. 1996. Expression of E-selectin and E-selectin ligands in human liver inflammation. Hepatology 24:533-538.

49. Lim, A. G., R. P. Jazrawi, J. H. Levy, M. L. Petroni, A. C. Douds, J. D. Maxwell, and T. C. Northfield. 1995. Soluble E-selectin and vascular cell adhesion molecule-1 (VCAM-1 ) in primary biliary cirrhosis. J. Hepatol 22:416-422.

50. Aziz, K. E., P. J. McCluskey, and D. Wakefield. 1996. Expression of selectins (CD62 E,L,P) and cellular adhesion molecules in primary Sjogren's syndrome: Questions to immunoregulation. Clin. Immunol. Immunopathol 80:55-66.

51. Wenisch, C, D. Myskiw, A. Gessl, and W. Graninger. 1995. Circulating selectins, intercellular adhesion molecule- 1 , and vascular cell adhesion molecule- 1 in hyperthyroidism. J. Clin. Endocrinol. Metab. 80:2122-2126.

52. Schurmann, G. M., A. E. Bishop, P. Facer, M. Vecchio, J. C. W. Lee, D. S. Rampton, and J. M. Polak. 1995. Increased expression of cell adhesion molecule P-selectin in active inflammatory bowel disease. Gut 36:411-418. 53. Tipping, P. G., X. R. Huang, M. C. Berndt, and S. R. Holdsworth. 1996. P-selectin directs T lymphocyte-mediated injury in delayed-type hypersensitivity responses: Studies in glomerulonephritis and cutaneous delayed-type hypersensitivity. Eur. J. Immunol. 26:454-460. 54. Tipping, P. G., X. R. Huang, M. C. Berndt, and S. R. Holdsworth. 1994. A role for P selectin in complement-independent neutrophil-mediated glomerular injury. Kidney Int. 46:79-88.

55. Bonifati, C, E. Trento, M. Carducci, G. Sacerdoti, A. Mussi, M. Fazio, and F. Ameglio. 1995. Soluble E-selectin and soluble tumour necrosis factor receptor (60 kD) serum levels in patients with psoriasis. Dermatology 190:128-131.

56. Mengelers, H. J. J., T. Maikoe, B. Hooibrink, T. W. Kuypers, J. Kreukniet, J. -W. J. Lammers, and L. Koenderman. 1993. Down modulation of L-Selectin expression on eosinophils recovered from bronchoalveolar lavage fluid after allergen provocation. Clin. Exp. Allergy 23 : 196-204.

57. Gundel, R. H., C. D. Wegner, C A. Torcellini, C. C. Clarke, N. Ilaynes, R. Rothlein, C. W. Smith, and L. G. Letts. 1991. Endothelial leukocyte adhesion molecule- 1 mediates antigen-induced acute airway inflammation and late-phase airway obstruction in monkeys. J. Clin. Invest. 88: 1407-1411. 58.eoras et al, Am. J. Respir. Cell Mol. Biol. 1992; 7: 261-269.

59. Ebisawa, M., B. S. Bochner, S. N. Georas, and R. P. Schleimer. 1992. Eosinophil transendothelial migration induced by cytokines: I. Role of endothelial and eosinophil adhesion molecules in IL-lb-induced transendothelial migration../. Immunol. 149:4021-4028. 60.Ohkawara et al. Am. J. Respir. Cell Mol. Biol. 1995; 12: 4-12.

61. Dopp, J. M., S. M. Breneman, and J. A. Olschowka. 1994. Expression of ICAM-1 , VCAM-1, L-selectin, and leukosialin in the mouse central nervous system during the induction and remission stages of experimental allergic encephalomyelitis. J. Neuroimmunol 54: 129-144. 62. Ohnishi, M., H. Koike, N. Kawamura, S. J. Tojo, M. Hayashi, and S. Morooka. 1996. Role of P-selectin in the early stage of the Arthus reaction. Immunopharmacology 34: 161 - 170.

63. Hirai, S., T. Kageshita, T. Kimura, M. Tsujisaki, K. Okajima, K. Imai, and T. Ono. 1996. Soluble intercellular adhesion molecule-1 and soluble E-selectin levels in patients with atopic dermatitis. Br. J. Dermatol. 134:657-661. 64. Henseleit, U., K. Steinbrink, M. Goebeler, J. Roth, D. Vestweber, C Sorg, and C Sunderkόtter. 1996. E-selectin expression in experimental models of inflammation in mice. J. Pathol. 180:317-325.

65. Mizgerd, J. P., B. B. Meek, G. J. Kutkoski, D. C. Bullard, A. L. Beaudet, and C M. Doerschuk. 1996. Selectins and neutrophil traffic: Margination and Streptococcus pneumoniae-induced emigration in murine lungs. J. Exp. Med. 184:639-645.

66. Doyle, N. A., S. D. Bhagwan, B. B. Meek, G. J. Kutkoski, D. A. Steeber, T. F. Tedder, and C M. Doerschuk. 1997. Neutrophil margination, sequestration, and emigration in the lungs of L-selectin-deficient mice. J. Clin. Invest. 99:526-533. 67. Bums, A. R. and C. M. Doerschuk. 1994. Quantitation of L-selectin and CD 18 expression on rabbit neutrophils during CD18-independent and CD 18 -dependent emigration in the lung. J. Immunol. 153:3177-3188.

68. Bullard, D. C, L. Qin, I. Lorenzo, W. M. Quinlin, N. A. Doyle, R. Bosse, D. Vestweber, C. M. Doerschuk, and A. L. Beaudet. 1995. P-selectin/ICAM-1 double mutant mice: Acute emigration of neutrophils into the peritoneum is completely absent but is normal into pulmonary alveoli. J. Clin. Invest. 95: 1782-1788.

69. Inagaki, H., K. Suzuki, K. Nomoto, and Y. Yoshikai. 1996. Increased susceptibility to primary infection with Listeria monocytogenes in germfree mice may be due to lack of accumulation of L-selectin⁺ CD44⁺ T cells in sites of inflammation. Infect. Immun. 64:3280-3287.

70. Sfikakis, P. P., V. Tzavara, N. Sipsas, O. Kosmopoulou, P. Sfikakis, and T. Kordossis. 1995. Levels of the circulating cell adhesion molecule E-selectin and disease progression in HIV infection. Infection 23:207-211.

71. Granert, C, J. Raud, X. Xie, L. Lindquist, and L. Lindbom. 1994. Inhibition of leukocyte rolling with polysaccharide fucoidin prevents pleocytosis in experimental meningitis in the rabbit. J. Clin. Invest. 93:929-936.

72. Tang, T., P. S. Frenette, R. O. Hynes, D. D. Wagner, and T. N. Mayadas. 1996. Cytokine-induced meningitis is dramatically attenuated in mice deficient in endothelial selectins. J. Clin. Invest. 97:2485-2490. 73. Bϋhrer, C, R. Herold, D. Stibenz, G. Henze, and M. Obladen. 1996. Cerebrospinal fluid soluble L-selectin (sCD62L) in meningoencephalitis. Arch. Dis. Child. 74:288-292.

74. Wenisch, C, E. Presterl, W. Graninger, and S. Looareesuwan. 1995. Circulating L-selectin is elevated in patients with Plasmodium falciparum malaria. J. Infect. Dis.

171 :1078.

75. Muanza, K., F. Gay, C. Behr, and A. Scherf. 1996. Primary culture of human lung microvessel endothelial cells: A useful in vitro model for studying Plasmodium falciparum-infected erythrocyte cytoadherence. Res. Immunol. 147: 149-163. 76. Elbim, C, M. H. Prevot, F. Bouscarat, E. Franzini, S. Chollet-Martin, J. Hakim, and M. A. Gougerot-Pocidalo. 1994. Polymorphonuclear neutrophils from human immunodeficiency virus-infected patients show enhanced activation, diminished fMLP-induced L-selectin shedding, and an impaired oxidative burst after cytokine priming. Blood 84:2759-2766. 77. Lai et al. Clin. Exp. Immunol. 1993; 94: 552-526.

78. Steeber, D. A., N. E. Green, S. Sato, and T. F. Tedder. 1996. Humoral immune responses in L-selectin-deficient mice. J. Immunol. 157:4899-4907.

79. Catalina, M. D., M. C Carroll, H. Arizpe, A. Takashima, P. Estess, and M. H. Siegelman. 1996. The route of antigen entry determines the requirement for L-selectin during immune responses. J. .Exp. Med. 184:2341-2351.

80. Xu, J. C, I. S. Grewal, G. P. Geba, and R. A. Flavell. 1996. Impaired primary T cell responses in L-selectin-deficient mice. J. Exp. Med. 183:589-598.

81. Bargatze, R. F., S. Kurk, G. Watts, T. K. Kishimoto, C. A. Speer, and M. A. Jutila. 1994. In vivo and in vitro functional examination of a conserved epitope of L- and E-selectin crucial for leukocyte-endothelial cell interactions. J. Immunol. 152:5814-5825.

82. Austrup, F., D. Vestweber, E. Borges, M. Lδhning, R. Brauer, U. Herz, H. Renz, R. Hallmann, A. Scheffold, A. Radbruch, and A. Hamann. 1997. P- and E-selectin mediate recruitment of T-helper-1 but not T-helper-2 cells into inflamed tissues. Nature 385:81-83. 83. Borges, E., W. Tietz, M. Steegmaier, T. Moll, R. Hallmann, A. Hamann, and D. Vestweber. 1997. P-selectin glycoprotein ligand-1 (PSGL-1) on T helper 1 but not on T helper 2 cells binds to P-selectin and supports migration into inflamed skin. J. oExp. Med. 185:573-578. 84. Zhang, J. G., L. Morgan, and G. P. Spickett. 1996. L-selectin in patients with common variable immunodeficiency (CVID): A comparative study with normal individuals. Clin. Exp. Immunol. 104:275-279.

85. Onrust, S. V., P. M. Haiti, S. D. Rosen, and D. Hanahan. 1996. Modulation of L-selectin ligand expression during an immune response accompanying tumorigenesis in transgenic mice. J. Clin. Invest. 97:54-64.

86. Lehr, H. -A., A. M. Olofsson, T. E. Carew, P. Vajkoczy, U. H. Von Andrian, C. Hϋbner, M. C. Berndt, D. Steinberg, K. Messmer, and K. E. Arfors. 1994. P-selectin mediates the interaction of circulating leukocytes with platelets and microvascuiar endothelium in response to oxidized lipoprotein in vivo. Lab. Invest. 71 :380-386. 87. Lip, G. Y. H., A. D. Blann, J. Zarifis, M. Beevers, P. L. Lip, and D. G. Beevers. 1995. Soluble adhesion molecule P-selectin and endothelial dysfunction in essential hypertension: Implications for atherogenesis? A preliminary report. J. Hypertens. 13: 1674-1678.

88. O'Brien, K. D., T. O. McDonald, A. Chait, M. D. Allen, and C. E. Alpers. 1996. Neovascular expression of E-selectin, intercellular adhesion molecule- 1, and vascular cell adhesion molecule- 1 in human atherosclerosis and their relation to intimal leukocyte content. Circulation 93:672-682.

89. Sakai, A., N. Kume, E. Nishi, K. Tanoue, M. Miyasaka, and T. Kita. 1997. P-selectin and vascular cell adhesion molecule- 1 are focally expressed in aortas of hypercholesterolemic rabbits before intimal accumulation of macrophages and T lymphocytes. Arterioscler. Thromb. Vase. Biol. 17:310-316. 90. Tenaglia, A. N., A. J. Buda, R. G. Wilkins, M. K. Barron, P. R. Jeffords, K. Vo, M. O. Jordan, B. A. Kusnick, and D. J. Lefer. 1997. Levels of expression of P-selectin, E-selectin, and intercellular adhesion molecule- 1 in coronary atherectomy specimens from patients with stable and unstable angina pectoris. Am. J. Cardiol. 79:742-747.

91. Toombs, C. F., C L. DeGraaf, J. P. Martin, J. G. Geng, D. C. Anderson, and R. J. Shebuski. 1995. Pretreatment with a blocking monoclonal antibody to P-selectin accelerates pharmacological thrombolysis in a primate model of arterial thrombosis. J. Pharmacol. Exp. Ther. 275:941-949. 92. Fujise, K., B. M. Revelle, L. Stacy, E. L. Madison, E. T. H. Yeh, J. T. Willerson, and P. J. Beck. 1997. A tissue plasminogen activator/P-selectin fusion protein is an effective thrombolytic agent. Circulation 95:715-722.

93. Subramaniam, M., P. S. Frenette, S. Saffaripour, R. C. Johnson, R. O. Hynes, and D. D. Wagner. 1996. Defects in hemostasis in P-selectin-deficient mice. Blood 87:1238-1242.

94. Koskinen, P. K. and K. B. Lemstrόm. 1997. Adhesion molecule P-selectin and vascular cell adhesion molecule- 1 in enhanced heart allograft arteriosclerosis in the rat. Circulation 95: 191-196.

95. Okajima, K., M. Uchiba, K. Murakami, H. Okabe, and K. Takatsuki. 1997. Plasma levels of soluble E-selectin in patients with disseminated intravascular coagulation. Am. J. Hematol 54:219-224.

96. Lafrenie, R. M., S. Gallo, T. J. Podor, M. R. Buchanan, and F. W. Orr. 1994. The relative roles of vitronectin receptor, E-selectin and a₄b, in cancer cell adhesion to interleukin-1 -treated endothelial cells. Ewr. J. Cancer [A] 30A:2151-2158. 97. Ye, C, K. Kiriyama, C Mistuoka, R. Kannagi, K. Ito, T. Watanabe, K. Kondo, S.

Akiyama, and H. Takagi. 1995. Expression of E-selectin on endothelial cells of small veins in human colorectal cancer. Int. J. Cancer 61 :455-460.

98. Mannori, G., P. Crottet, O. Cecconi, K. Hanasaki, A. Aruffo, R. M. Nelson, A.

Varki, and M. P. Bevilacqua. 1995. Differential colon cancer cell adhesion to E-. P-, and L-selectin: Role of mucin type glycoproteins. Cancer Res. 55:4425-4431. 99. Suzuki, Y., H. Ohtani, T. Mizoi, S. Takeha, K. Shiiba, S. Matsuno, and H. Nagura. 1995. Cell adhesion molecule expression by vascular endothelial cells as an immune/inflammatory reaction in human colon carcinoma. Jpn. J. Cancer Res. 86:585-593. 100. Wittig, B. M., R. Thees, H. Kaulen, K. Gott, E. Bartnik, C. Schmitt, K. H. M. Zum Buschenfelde, and W. Dippold. 1996. a(l,3)fucosyltransferase expression in E-selectin-mediated binding of gastrointestinal tumor cells. Int. J. Cancer 67:80-85.

101. Bresalier, R. S., S. B. Ho, H. L. Schoeppner, Y. S. Kim, M. H. Sleisenger, P. Brodt, and J. C Byrd. 1996. Enhanced sialylation of mucin-associated carbohydrate structures in human colon cancer metastasis. Gastroenterology 110: 1354- 1367.

102. Daneker, G. W., S. A. Lund, S. W. Caughman, C. A. Staley, and W. C Wood. 1996. Anti-metastatic prostacyclins inhibit the adhesion of colon carcinoma to endothelial cells by blocking E-selectin expression. Clin. Exp. Metastasis 14:230-238.

103. Srinivas, U., P. Pahlsson, and A. Lundblad. 1996. E-selectin: Sialyl Lewis, a dependent adhesion of colon cancer cells, is inhibited differently by antibodies against E-selectin ligands. Scand. J. Immunol. 44: 197-203.

104. Wittig, B. M., H. Kaulen, R. Thees, C. Schmitt, P. Knolle, J. Stock, K. H. M. Zum Bϋschenfelde, and W. Dippold. 1996. Elevated serum E-selectin in patients with liver metastases ofcolorectal cancer. Eur. J. Cancer [A] 32AT215-I218. 105. Biancone, L., M. Araki, K. Araki, P. Vassalli, and I. Stamenkovic. 1996. Redirection of tumor metastasis by expression of E-selectin in vivo. J. Exp. Med. 183:581-587.

106. Stucki, A., A. -S. Cordey, N. Monai, J. -C De Flaugerues, M. Schapira, and O. Spertini. 1995. Cleaved L-selectin concentrations in meningeal leukaemia. Lancet 345:286-289.

107. Kawaishi, K., A. Kimura, O. Katoh, A. Sasaki, N. Oguma, A. Ihara, and Y. Satow. 1996. Decreased L-selectin expression in CD34-positive cells from patients with chronic myelocytic leukaemia. Br. J. Haematol 93:367-374. 108. Allen, M. H., M. K. Robinson, P. E. Stephens, D. M. MacDonald, and J. N. W. N. Barker. 1996. E-selectin binds to squamous cell carcinoma and keratinocyte cell lines. J. Invest. Dermatol. 106:611-615.

109. Pottratz, S. T., T. D. Hall, W. M. Scribner, H. N. Jayara , and V. Natarajan. 1996. P-selectin-mediated attachment of small cell lung carcinoma to endothelial cells. Am. J. Physiol. Lung Cell. Mol. Physiol. 27LL918-L923.

1 10. Fox, S. B., G. D. H. Turner, K. C. Gatter, and A. L. Harris. 1995. The increased expression of adhesion molecules ICAM-3, E- and P-selectins on breast cancer endothelium. J Pathol. 177:369-376. 1 1 1. Bruserud, O., P. E. Akselen, J. Bergheim, and I. Nesthus. 1995. Serum concentrations of E-selectin, P-selectin, ICAM-1 and interleukin 6 in acute leukaemia patients with chemotherapy-induced leucopenia and bacterial infections. Br. J. Haematol. 91 :394-402.

1 12. Simonitsch, I., C W. Kopp, I. Mosberger, B. Volc-Platzer, and T. Radaszkiewicz. 1996. Expression of the monoclonal antibody HECA-452 defined E-selectin ligands in Langerhans cell histiocytosis. Virchows Arch. Int. J. Pathol. 427 :477 -481.

1 13. Kraling, B. M., M. J. Razon, L. M. Boon, D. Zurakowski, C. Seachord, R. P. Darveau, J. B. Mulliken, C. L. Corless, and J. Bischoff. 1996. E-selectin is present in proliferating endothelial cells in human hemangiomas. Am. J. Pathol. 148:1 181-1 191.

1 14. Albelda, S. M., C. W. Smith, and P. A. Ward. 1994. Adhesion molecules and inflammatory injury. FASEB J. 8:504-512.

115. Mayadas, T. N. 1995. Gene knockout on P-selectin: Its biology and function. Trends Cardiovasc. Med. 5:149-157. 116. Ramamoorthy, C, S. R. Sharar, J. M. Harlan, T. F. Tedder, and R. K. Winn.

1996. Blocking L-selectin function attenuates reperfusion injury following hemorrhagic shock in rabbits. Am. J. Physiol. Heart Circ. Physiol. 271 :H 1871 -HI 877.

1 17. Shenkar, R., A. J. Cohen, D. Vestweber, Y. E. Miller, R. Tuder, and E. Abraham.

1995. Hemorrhage and resuscitation alter the expression of ICAM-1 and P-selectin in mice. Circ. Shock 45:248-259. 1 18. Kushimoto, S., K. Okajima, M. Uchiba, K. Murakami, H. Okabe, and K. Takatsuki. 1996. Pulmonary vascular injury induced by hemorrhagic shock is mediated by P-selectin in rats. Thromb. Res. 82:97-106.

1 19. Winn, R. K., J. C. Paulson, and J. M. Harlan. 1994. A monoclonal antibody to 5 P-selectin ameliorates injury associated with hemorrhagic shock in rabbits. Am. J.

Physiol. Heart Circ. Physiol. 267:H2391-H2397.

120. Donnelly, S. C, C. Haslett, I. Dransfield, C. E. Robertson, D. C. Carter, J. A. Ross, I. S. Grant, and T. F. Tedder. 1994. Role of selectins in development of adult respiratory distress syndrome. Lancet 344:215-219.

10 121. Ridings, P. C, A. C J. Windsor, M. A. Jutila, C. R. Blocher, B. J. Fisher, M. M. Sholley, H. J. Sugerman, and A. A. Fowler II. 1995. A dual-binding antibody to E- and L-selectin attenuates sepsis-induced lung injury. Am. J. Respir. Crit. Care Med. 152:247-253.

122. Ridings, P. C, S. Holloway, G. L. Bloomfield, M. L. Phillips, B. J. Fisher, C R. 15 Blocher, H. J. Sugerman, and A. A. FowlerJII. 1997. Protective role of synthetic sialylated oligosaccharide in sepsis-induced acute lung injury. J. Appl. Physiol. 82:644-651.

123. Simons, R. K., D. B. Hoyt, R. J. Winchell, R. M. Rose, and T. Holbrook. 1996. Elevated selectin levels after severe trauma: A marker for sepsis and organ failure and 0 a potential target for immunomodulatory therapy. J. Trauma Injury Infect. Crit. Care 41 :653-662.

124. Friedman, G., S. Jankowski, M. Shahla, M. Goldman, R. M. Rose, R. J. Kahn, and J. L. Vincent. 1996. Administration of an antibody to E-selectin in patients with septic shock. Crit. Care Med. 24:229-233. 5 125. McGill, S. N., N. A. Ahmed, F. Hu, R. P. Michel, and N. V. Christou. 1996. Shedding of L-selectin as a mechanism for reduced polymorphonuclear neutrophil exudation in patients with the systemic inflammatory response syndrome. Arch. Surg. 131 :1 141-1146. 126. Ahmed, N. A. and N. V. Christou. 1996. Decreased neutrophil L-selectin expression in patients with systemic inflammatory response syndrome. Clin. Invest. Med. 19:427-434.

127. Kneidinger, R., S. Bahrami, H. Redl, G. Schlag, M. Robinson, I. Weichselbraun, and J. Cremer. 1996. Evaluation of a soluble E-selectin enzyme-linked immunosorbent assay under posttraumatic conditions. J. Lab. Clin. Med. 128:520-523.

128. Narasinga Rao, B. N., M. B. Anderson, J. H. Musser, J. H. Gilbert, M. E. Schaefer, C Foxall, and B. K. Brandley. 1994. Sialyl Lewis X mimics derived from a pharmacophore search are selectin inhibitors with anti-inflammatory activity. J. Biol. Chem. 269:19663-19666.

129. Rabb, H., G. Ramirez, S. R. Saba, D. Reynolds, J. C. Xu, R. Flavell, and S. Antonia. 1996. Renal ischemic-reperfusion injury in L-selectin-deficient mice. Am. J. Physiol. Renal, Fluid Electrolyte Physiol. 27LF408-F413. 130. Cecconi, O., R. M. Nelson, W. G. Roberts, K. Hanasaki, G. Mannori, C Schultz, T. R. Ulich, A. Aruffo, and M. P. Bevilacqua. 1994. Inositol polyanions. Noncarbohydrate inhibitors of L- and P-selectin that block inflammation. J. Biol. Chem. 269: 15060-15066.

131. Briggs, J. B., Y. Oda, J. H. Gilbert, M. E. Schaefer, and B. A. Macher. 1995. Peptides inhibit selectin-mediated cell adhesion in vitro, and neutrophil influx into inflammatory sites in vivo. Glycobiology 5:583-588.

132. Wong, D. and K. Dorovini-Zis. 1996. Regulation by cytokines and lipopolysaccharide of E-selectin expression by human brain microvessel endothelial cells in primary culture. J. Neuropathol. Exp. Neurol. 55:225-235. 133. Hess, D. C, Y. Thompson, A. Sprinkle. J. Carroll, and J. Smith. 1996. E-selectin expression on human brain microvascuiar endothelial cells. Neurosci. Lett. 213:37-40. 134. Kajihara, J., Y. Guoji, K. Kato, and Y. Suzuki. 1995. Sulfatide, a specific sugar ligand for L-selectin, blocks CCl₄-induced liver inflammation in rats. Biosci. Biotechnol Biochem. 59:155-157. 135. Wada, Y., T. Saito, N. Matsuda, H. Ohmoto, K. Yoshino, M. Ohashi, H. Kondo, H. Ishida, M. Kiso, and A. Hasegawa. 1996. Studies on selectin blockers .2. Novel selectin blocker as potential therapeutics for inflammatory disorders. J. Med. Chem. 39:2055-2059. 136. Mulligan, M. S., M. J. Polley, R. J. Bayer, M. F. Nunn, J. C. Paulson, and P. A. Ward. 1992. Neutrophil-dependent acute lung injury. Requirement for P-selectin (GMP-HO). J. Clin. Invest. 90: 1600-1607.

137. Mulligan, M. S., J. C. Paulson, S. De Frees, Z. -L. Zheng, J. B. Lowe, and P. A. Ward. 1993. Protective effects of oligosaccharides in P-selectin-dependent lung injury. Nature 364: 149-151.

138. Mulligan, M. S., S. R. Watson, C. Fennie, and P. A. Ward. 1993. Protective effects of selectin chimeras in neutrophil-mediated lung injury. J. Immunol. 151 :6410-6417.

139. Doerschuk, C. M., W. M. Quinlan, N. A. Doyle, D. C Bullard, D. Vestweber, M. L. Jones, F. Takei, P. A. Ward, and A. L. Beaudet. 1996. The role of P-selectin and

ICAM-1 in acute lung injury as determined using blocking antibodies and mutant mice. J. Immunol. 157:4609-4614.

140. Mulligan et al. J. of Immunology. 1994; 152: 832-840.

141. Mulligan et al. International Immunology, 1995 ; 7: 1 107- 1 113. 142. Mulligan, M. S., M. Miyasaka, T. Tamatani, M. L. Jones, and P. A. Ward. 1994. Requirements for L-selectin in neutrophil-mediated lung injury in rats. J. Immunol. 152:832-840.

143. Mulligan, M. S., J. B. Lowe, R. D. Larsen, J. Paulson, Z. Zheng, S. DeFrees, K. Maemura, M. Fukuda, and P. A. Ward. 1993. Protective effects of sialylated oligosaccharides in immune complex-induced acute lung injury. J. Exp. Med. 178:623-631.

144. Amdt, H., K. D. Palitzsch, D. C. Anderson, J. Rusche, M. B. Grisham, and D. N. Granger. 1995. Leucocyte-endothelial cell adhesion in a model of intestinal inflammation. Gut 37:374-379. 145. Tedder, T. F., D. A. Steeber, and P. Pizcueta. 1995. L-selectin-deficient mice have impaired leukocyte recruitment into inflammatory sites. ./ Exp. Med. 181 :2259-2264.

146. Silber, A., W. Newman, K. A. Reimann, E. Hendricks, D. Walsh, and D. J. Ringler. 1994. Kinetic expression of endothelial adhesion molecules and relationship to leukocyte recruitment in two cutaneous models of inflammation. Lab. Invest. 70:163-175.

147. Staite, N. D., J. M. Justen, L. M. Sly, A. L. Beaudet, and D. C. Bullard. 1996. Inhibition of delayed-type contact hypersensitivity in mice deficient in both E-selectin and P-selectin. Blood 88:2973-2979.

148. Binns, R. M., A. Whyte, S. T. Licence, A. A. Harrison, Y. T. M. Tsang, D. O. Haskard, and M. K. Robinson. 1996. The role of E-selectin in lymphocyte and polymorphonuclear cell recruitment into cutaneous delayed hypersensitivity reactions in sensitized pigs. J. Immunol 157:4094-4099. 149. Abe, Y., K. Sugisaki, and A. M. Dannenberg,Jr.. 1996. Rabbit vascular endothelial adhesion molecules: ELAM-1 is most elevated in acute inflammation, whereas VCAM-1 and ICAM-1 predominate in chronic inflammation. J. Leukocyte Biol. 60:692-703.

150. Kurose, I., T. Yamada, R. Wolf, and D. N. Granger. 1994. P-selectin-dependent leukocyte recruitment and intestinal mucosal injury induced by lactoferrin. J.

Leukocyte Biol. 55:771-777.

151. Panes, J., D. C. Anderson, M. Miyasaka, and D. N. Granger. 1995. Role of leukocyte-endothelial cell adhesion in radiation-induced microvascuiar dysfunction in rats. Gastroenterology 108: 1761 -1769. 152. Rebuck, N., A. Gibson, and A. Finn. 1995. Neutrophil adhesion molecules in term and premature infants: Normal or enhanced leucocyte integrins but defective L-selectin expression and shedding. Clin. Exp. Immunol. 101 :183-189. 153. Buhrer, C, D. Stibenz, J. Graulich, U. Gernhold, E. C. Butcher, J. W. Dudenhausen, and M. Obladen. 1995. Soluble L-selectin (sCD62L) umbilical cord plasma levels increase with gestational age. Pediatr. Res. 38:336-341. 154. Hansbrough, J. F., T. Wikstrδm, M. Braide, M. Tenenhaus, O. H. Rennekampff, V. Kiessig, R. Zapata-Sirvent, and L. M. Bjursten. 1996. Effects of E-selectin and P-selectin blockade on neutrophil sequestration in tissues and neutrophil oxidative burst in burned rats. Crit. Care Med. 24:1366-1372. 5 155. Kuijper, P. H. M., H. I. G. Torres, J. A. M. Van der Linden, J. W. J. Lammers, J. J. Sixma, L. Koenderman, and J. J. Zwaginga. 1996. Platelet-dependent primary hemostasis promotes selectin- and integrin-mediated neutrophil adhesion to damaged endothelium under flow conditions. Blood 87:3271-3281.

156. Ley, K., G. Linnemann, M. Meinen, L. M. Stoolman, and P. Gaehtgens. 1993. 10 Fucoidin, but not yeast polyphosphomannan PPME, inhibits leukocyte rolling in venules of the rat mesentery. Blood 81 :177-185.

157. Mayadas, T. N., R. C Johnson, H. Rayburn, R. O. Hynes, and D. D. Wagner. 1993. Leukocyte rolling and extravasation are severely compromised in P selectin-deficient mice. Cell 74:541-554.

15 158. Kubes, P. and S. Kanwar. 1994. Histamine induces leukocyte rolling in post-capillary venules: A P-selectin-mediated event. J. Immunol. 152:357 '0-3577.

159. Zeb, T., B. Piedboeuf, M. Gamache, C. Langston, and S. E. Welty. 1996.

P-Selectin is upregulated early in the course of hyperoxic lung injury in mice. Free

Radic. Biol. Med. 21 :567-574. 0 160. Ramsay, P. L., R. S. Geske, C. A. Montgomery, and S. E. Welty. 1996. Increased soluble E-selectin is associated with lung inflammation, and lung injury in hyperoxia-exposed rats. Toxicol. Lett. 87:157-165.

161. Johnson, R. C, T. N. Mayadas, P. S. Frenette, R. E. Mebius, M. Subramaniam, A. Lacasce, R. O. Hynes, and D. D. Wagner. 1995. Blood cell dynamics in 5 P-selectin-deficient mice. Blood 86:1106-1 114.

162. Frenette, P. S., T. N. Mayadas, H. Raybum, R. O. Hynes, and D. D. Wagner. 1996. Susceptibility to infection and altered hematopoiesis in mice deficient in both P- and E-selectins. Cell 84:563-574. 163. Zund, G., D. P. Nelson, E. J. Neufeld, A. L. Dzus, J. Bischoff, J. E. Mayer, and S. P. Colgan. 1996. Hypoxia enhances stimulus-dependent induction of E-selectin on aortic endothelial cells. Proc. Natl. Acad. Sci. USA 93:7075-7080.

164. Closse, C, M. Seigneur, M. Renard, and A. Pruvost. 1996. Influence of hypoxia and hypoxia-reoxygenation on endothelial P-selectin expression. Haemostasis 26

Suppl. 4:177-181.

165. Closse, C, M. Seigneur, M. Renard, A. Pruvost, P. Dumain, F. Belloc, and M. R. Boisseau. 1997. Influence of hypoxia and hypoxia-reoxygenation on endothelial P-selectin expression. Thromb. Res. 85:159-164. 166. Mazurov, A. V., D. V. Vinogradov, S. G. Khaspekova, A. V. Krushinsky, L. V. Gerdeva, and S. A. Vasiliev. 1996. Deficiency of P-selectin in a patient with grey platelet syndrome. Eur. J. Haematol 57:38-41.

167. Nakao, A., Y. Hasegawa, Y. Tsuchiya, and K. Shimokata. 1995. Expression of cell adhesion molecules in the lungs of patients with idiopathic pulmonary fibrosis. Chest 108:233-239.

168. Nakao et al. Chest. 1995; 108: 233-239.

169. Stefano et al. Am. J. Respir. Crit. Care Med. 1994; 149: 803-810. 170. Riise et α/. Eur. Respir. J. 1994; 7: 1673-1677.

Claims

What is claimed is:

1. A method for selecting oligonucleotides that inhibit binding of a selectin to a selectin ligand, the method comprising:

(a) providing selectin recombinant soluble non-covalently or covalently bound to a substrate;

(b) contacting in the presence of 1 to 2 mM Ca⁺⁺ the immobilized selectin with a plurality of single-stranded oligonucleotides, wherein the oligonucleotides comprise a randomized sequence of 15 to 50 nucleotides in length, thereby allowing a subset of the oligonucleotides to bind the immobilized selectin and form an selectin/oligonucleotide complex;

(c) separating the selectin/oligonucleotide complex from unbound oligonucleotides;

(d) contacting the selectin/oligonucleotide complex with 1 to 50 mM EDTA, thereby eluting bound oligonucleotides from the selectin/oligonucleotide complex as a plurality of eluted oligonucleotides; and

(e) isolating the eluted oligonucleotides as oligonucleotides that inhibit binding of selectin to a selectin ligand.

2. The method of claim 1 , wherein the substrate is Protein A-Sepharose (PAS).

3. The method of claim 1 , wherein the oligonucleotide is DNA.

4. The method of claim 1, wherein the oligonucleotide is RNA or modified RNA.

5. The method of claim 1 , wherein the oligonucleotides comprise 2'-NH₂.

6. The method of claim 1, wherein steps (b) through (d) are carried out at 20 to 40°C

7. The method of claim 6, wherein steps (b) through (d) are carried out at

37°C

8. An eluted oligonucleotide of claim 1.

9. The oligonucleotide of claim 8, wherein the oligonucleotide is 10 to 50 nucleotides in length.

10. The oligonucleotide of claim 8, wherein the 2 amino-RNA oligonucleotide comprises the sequence: 5ΑUGUGUGA3'.

11. The oligonucleotide of claim 8, wherein the 2-NH₂RNA oligonucleotide is selected from the group consisting of:

(6.79) AUGUGUGAGUAGCUGAGCGCCCGAGUAUGΛWACCUGACUA;

(6.50) UAAUGUGUGAAGCUGAGCGCCCGAAUAGAUUAGACAAAAU;

(6.60) GGCAUUGUGUGAΛUAGCUGAUCCCACAGGUAACAACAGCA; (13.32) CGCGUAUGUGUGAAAGCGUGUGCACGGAGGCGUCUACAAU;

(14.21 ) UUGAGAUGUGUGAGUACAGCUCAAAAUCCCGUUGGAGG;

(14.9) AAACCUUG AUGUGUGAUAGAGCAUCCCCCAGGCGACGUAC;

(14.25) UAGAGGUAGUAUGUGUGGGAGAUGAAAAUACUGUGGAAAG;

(6.28) GUAAAGAGAUCCUAAUGGCUCGCUAGAUGUGAUGUGAAAC; (13.48) AAAGUUAUGAGUCCGUAUAUCAAGGUCGACAUGUFUGAAU;

(6.71 ) CACGAAAAACCCGAAUUGGGUCGCCCAUAAGGAUGUGUGA; and

(14.12) UAACAACΛAUCAΛGGCGGGUUCACCGCCCCAGUAUGAGUA.

12. The oligonucleotide of claim 8, wherein the single-stranded DNA oligonucleotide is selected from the group consisting of: (LD201 ) CAAGGTAACCAGTACAAGGTGCTAAACGTAATGGCTTCG;

(LD174) CATTCACCATGGCCCCTTCCTACGTATGTTCTGCGGGTG; and (LD196) TGGCGGTACGGGCCGTGCACCCACTTACCTGGGAAGTGA.

13. A method for inhibiting binding of selectin to a ligand, the method comprising:

(a) providing selectin and a ligand to which selectin is capable of specifically binding; and (b) contacting the selectin with an oligonucleotide of claim 8 in the presence of 1 to 2 mM Ca⁺\ thereby inhibiting binding of L-selectin to the ligand.

14. The method of claim 13, wherein the selectin is present on a cell surface.

15. The method of claim 14, wherein L-selectin is present on the surface of a peripheral blood mononuclear cell.

16. The method of claim 13, wherein inhibition of binding is detected as inhibition of lymphocyte rolling on endothelial cells.

17. The method of claim 13, wherein binding is inhibited in vivo.

18. The method of claim 13, wherein the oligonucleotide is administered to a mammal.

19. The method of claim 13, wherein inhibition of binding is detected as inhibition of lymphocyte trafficking or any other known selectin-ligand interaction in vivo.

20. The method of claim 13, wherein inhibition of binding is detected as inhibition of binding of L-selectin to SLe".

21. The method of claim 13, wherein inhibition of binding is detected as inhibition of rolling of peripheral blood mononuclear cells containing cell-surface L- selectin on human umbilical vein endothelial cells.

22. The method of claim 13, wherein the ligand is GlyCAM-1.