WO1997048795A2

WO1997048795A2 - Compositions and methods for treating specific gene expression-related diseases and disorders in humans

Info

Publication number: WO1997048795A2
Application number: PCT/US1997/010143
Authority: WO
Inventors: Paul J. Schechter; R. Russell Martin; Christophe Tournerie; Sudhir Agrawal; Robert W. Coombs
Original assignee: Hybridon, Inc.
Priority date: 1996-06-18
Filing date: 1997-06-11
Publication date: 1997-12-24
Also published as: AU3309697A; WO1997048795A3

Abstract

The present invention provides therapeutic compositions and methods for treating humans suffering from diseases or disorders caused by cellular expression of aberrant exogenous genes or aberrant endogenous genes comprising administering to the human a therapeutically effective amount of a composition of the invention comprising an oligonucleotide capable of specifically down-regulating the expression of such a gene. A specific example is given for the treatment of HIV infections.

Description

COMPOSITIONS AND METHODS FOR TREATING SPECIFIC GENE EXPRESSION-RELATED DISEASES AND DISORDERS IN HUMANS

BACKGROUND OF THE INVENTION

The potential for the development of an antisense oligonucleotide therapeutic approach was first suggested in three articles published in

1977 and 1978. Paterson et al . (Proc Natl. Acad. Sci. (USA) (1977) 74:4370-4374) discloses that cell-free translation of mRNA can be inhibited by the binding of an oligonucleotide complementary to the mRNA. Zamecnik and Stephenson (Proc. Natl. Acad. Sci.

(USA) (1978) 75:280-284 and 285-288) disclose that a 13mer synthetic oligonucleotide that is complementary to a part of the Rous sarcoma virus (RSV) genome inhibits RSV replication in infected chicken fibroblasts and inhibits RSV-mediated transformation of primary chick fibroblasts into malignant sarcoma cells.

These early indications that synthetic oligonucleotides can be used to inhibit virus propagation and neoplasia have been followed by the use of synthetic oligonucleotides to inhibit a wide variety of viruses. Goodchild et al . (U.S. Pat. No. 4,806,463 discloses inhibition of Human Immunodeficiency virus (HIV) by synthetic oligonucleotides complementary to various regions of the HIV genome. U.S. Pat. No. 5,194,428 discloses inhibition of influenza virus replication by phosphorothioate oligonucleotides complementary to the influenza virus polymerase 1 795 PC17US97/10143

gene. Leiter et al . (Proc. Natl. Acad. Sci. (USA) (1990) 87:3430-33434) discloses inhibition of influenza virus by synthetic oligonucleotides. Agris et al. (Biochem, (1986) 25:6268-6275) discloses the use of synthetic oligonucleotides to inhibit vesicular stomatitis virus (VSV) . Gao et al . (Antimicrob. Agents Chem. (1990) 34:808-812) . discloses inhibition of Simian virus (SV40) by synthetic oligonucleotides. Storey et al. (Nucleic Acids Res. (1991) 19:4109-4114) discloses inhibition of Human papilloma virus

(HPV) by synthetic oligonucleotides. The use of synthetic oligonucleotides and their analogs as antiviral agents has been extensively reviewed by Agrawal in Trends Biotech. (1992) 10:152-158.

Antisense oligonucleotides have also been developed as antiparasitic agents. PCT publication No. WO 93/13740 discloses the use of antisense oligonucleotides to inhibit propagation of drug-resistant malarial parasites. Tao et al . (Antisense Res. Dev. (1995) 5:123-129) teaches inhibition of propagation of a schistosome parasite by antisense oligonucleotides.

Antisense oligonucleotides have also shown promise as candidates for therapeutic applications for diseases resulting from expression of cellular genes. PCT publication No. WO 95/09236 discloses reversal of beta amyloid-induced neuronal cell line morphological abnormalities by oligonucleotides that inhibit beta amyloid expression. PCT publication no. WO 94/26887 discloses reversal of aberrant splicing of a globin gene transcript by oligonucleotides complementary to certain portions of that transcript. PCT application no. PCT/US/13685 discloses inhibition of tumorigenicity by oligonucleotides complementary to the gene encoding DNA methyltransferase.

The development of various antisense oligonucleotides as therapeutic and diagnostic agents has recently been reviewed by Agrawal and Iyer ( Current Opinion Biotech. (1995) 6:12-19) . However, none of the above-described studies disclose compositions and methods for successfully treating humans in vivo using the antisense oligonucleotide approach. One conference report has recently described intravitreal administration to humans of a formulation comprising an antisense oligonucleotide against the CMV IE2 gene. In this study, claims of antiviral efficacy were made. No study, however, has demonstrated antiviral effect, at least in part, of a systemically administered antisense oligonucleotide, nor has any study proven gene-specific effect for an antisense oligonucleotide for treatment of viral infection, bacterial infection, or cellular disorder.

Thus, there still remains a need for effective gene-specific or at least partial gene- specific antisense oligonucleotide therapy suitable for treatment in humans. The present invention provides compositions and methods based on antisense oligonucleotide therapy for treating humans which have been tested in the clinic and which for the first time show biological effect of 795 PC17US97/10143

systemically administered antisense oligonucleotides. The ramifications of these positive clinical results are expected to forever change human antisense therapy for treating diseases and disorders which afflict humans, caused by aberrant gene-specific expression.

SUMMARY OF THE INVENTION

The present invention provides therapeutic compositions and methods for treating humans suffering from diseases or disorders caused by cellular expression of aberrant exogenous genes or aberrant endogenous genes comprising administering to the human a therapeutically effective amount of a composition of the invention comprising an oligonucleotide capable of specifically down- regulating the expression of such a gene.

A therapeutic composition of the invention suitable for treating humans comprises at least one oligonucleotide capable of specifically down- regulating expression of an aberrant exogenous gene or an aberrant endogenous gene. Methods of the invention include methods of treating humans suffering from a disorder or disease caused by an aberrant exogenous gene or aberrant endogenous gene comprising administering to the human, a therapeutically effective amount of a composition of the invention.

As defined herein, "an aberrant exogenous gene" includes a gene comprising a nucleic acid foreign to a human host whose expression results 95 PC17US97/10143

in a disease or disorder which afflicts humans . Such a gene include those of viruses, bacteria, and parasites, or any other prokaryotic or eucaryotic pathogen. As defined herein, an "aberrant endogenous gene" comprises a cellular gene native to a human host but the inappropriate expression of which results in human disease or disorders. Inappropriate human host cellular gene expression includes expression of a mutant allele of a cellular gene, or underexpression or over expression of a normal allele of a cellular gene, such that disease or disorder results from such inappropriate human host cellular gene expression. Such genes include genes whose expression results in cellular disorders and diseases including oncogenesis, multiple drug resistance, retinopathy of prematurity, hypertension, hypolipidemia, and platelet aggregation-related disorders such as infarcts, arteriosclerosis, embolism and thrombosis, and cerebral and myocardial circulatory disorders.

The term "specific down-regulation" of a target gene is meant to encompass at least partial reduction in the expression of the target gene.

BRIEF DESCRIPTION OF THE DRAWINGS

The foregoing and other objects of the present invention, the various features thereof, as well as the invention itself may be more fully understood from the following description, when read together with the accompanying drawings in which:

FIG. 1 is a schematic representation of the targeted gag initiation region of the HIV-1 genome and the complementary thereto of antisense phosphorothioates nucleotides designed in accordance with the invention;

FIG. 2 is a schematic representation of the targeted gag initiation region and the 25mer oligonucleotide designed in accordance with the invention;

FIG. 3 is a graphic representation of the HIV-1 activity described in the Tables as per cent inhibition of p24 expression;

FIG. 4 is a graphic representation of HIV-1 activity described in the Tables as % reduction of CPE;

FIG. 5 is a graphic representation of a long term protection experiment, demonstrating the effectiveness of the 25mer oligonucleotide in inhibiting p24 expression until day 17 and the ineffectiveness of ddC; and FIG. 6 is a graphic representation of the decrease in cellular viremia observed in patients treated with antisense oligonucleotide according to EXAMPLE 4D.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

The patent and scientific literature referred to herein establishes the knowledge that is available to those with skill in the art and evidences the knowledge in the field. The issued U.S. patents, allowed applications, published foreign applications, and references cited herein are hereby incorporated by reference.

The present invention provides therapeutic compositions and methods for treating humans suffering from diseases or disorders caused by cellular expression of aberrant exogenous genes or aberrant endogenous genes comprising administering to the human a therapeutically effective amount of a composition comprising an oligonucleotide designed in accordance with the invention which is capable of specifically down-regulating the expression of such an aberrant gene.

Preferred antisense oligonucleotides useful in the practice of the invention and suitable for use in therapeutic compositions of the invention are particularly active in specifically inhibiting the replication and expression of aberrant exogenous genes (i.e., an HIV-1 gene) or aberrant endogenous genes, show increased resistance to nuclease digestion, and are less cytotoxic than other chemotherapeutic agents. As used herein, the term oligonucleotide includes polymers of two or more ribonucleotides, deoxyribonucleotides, 2' substituted ribonucleotides or deoxyribonucleotides or any combinations of monomers thereof, such monomers being connected together via 5 ' to 3 ' linkages which may include any of the linkages that are known in the antisense oligonucleotide art.

The term oligonucleotide also encompasses such polymers having chemically modified bases or sugars and/or having additional substituents including without limitation, lipophilic groups, intercalating agents, diamines adamantane and others. For example, oligonucleotides used in accordance with the invention may comprise other than phosphodiester internucleotide linkages between the 5 ' end of one nucleotide and the 3 ' end of another nucleotide in which the 5 ' nucleotide phosphate has been replaced with any number of chemical groups, such as a phosphorothioate. Preferably, the phosphorothioate regions will have from about 5 to about 24 phosphorothioate-linked nucleosides . The phosphorothioate linkages may be mixed Rp and Sp enantiomers, or they may be stereoregular or substantially stereoregular in either Rp or Sp form (see Iyer et al . (1995) Tetrahedron Asymmetry 6:1051-1054) . Oligonucleotides with phosphorothioate linkages can be prepared using methods well known in the field such as phosphoramidite (see, e.g., Agrawal et al . (1988) Proc. Natl. Acad. Sci. (USA) 85:7079-7083) . or by H- phosphonate (see, e.g., Froehler (1986) Tetrahedron Lett. 27:5575-5578) chemistry. The synthetic methods described in Bergot et al. (J. Chromatog. (1992) 559:35-42) can also be used. Examples of other chemical groups include alkylphosphonates, phosphorodithioates, alkyl phosphonothioates, phosphoramidates, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters or any combinations thereof. For example, U.S. Patent No. 5,149,797 describes traditional chimeric oligonucleotides having a phosphorothioate core region interposed between methylphosphonate or phosphoramidate flanking regions. PCT Application No. PCT US96/13371, filed on August 16, 1996, discloses "inverted" chimeric oligonucleotides comprising one or more nonionic oligonucleotide region (e.g. alkylphosphonate and/or phosphoramidate and/or phosphotriester internucleoside linkage) flanked by one or more region of oligonucleotide phosphorothioate. Various oligonucleotides with modified internucleotide linkages can be prepared according to known methods (see, e.g., Goodchild (1990) Bioconjugate Chem. 2:165-187; Agrawal et al. , (1988) Proc Natl. Acad. Sci. (USA) 85:7079-7083; Uhlmann et al. (1990) Chem. Rev. 90:534-583; and Agrawal et al. (1992) Trends Biotechnol. 10:152-158.

Examples of modifications to sugars include modifications to the 2 ' position of the ribose moiety which include but are not limited to 2 ' -O- substituted with an -0- lower alkyl group containing 1-6 saturated or unsaturated carbon atoms, or with an -O-aryl, or allyl group having 2-6 carbon atoms wherein such -0-alkyl, aryl or allyl group may be unsubstituted or may be substituted, (e.g., with halo, hydroxy, trifluoromethyl cyano, nitro acyl acyloxy, alkoxy, 795 PC17US97/10143

carboxy, carbalkoxyl, or amino groups), or with an amino, or halo group. None of these substitutions are intended to exclude the native 2 ' -hydroxyl group in the case of ribose or 2 ' -H- in the case of deoxyribose. PCT Publication No. WO 94/02498 discloses traditional hybrid oligonucleotides having regions of 2 ' -O-substituted ribonucleotides flanking a DNA core region. PCT application no. PCT US96/13371, filed August 16, 1996, discloses an "inverted" hybrid oligonucleotide which includes an oligonucleotide comprising a 2 ' -O- substituted (or 2' OH, unsubstituted) RNA region which is in between two oligodeoxyribonucleotide regions, a structure that "inverted relative to the "traditional" hybrid oligonucleotides.

Other modifications include those which are internal or are at the end(s) of the oligonucleotide molecule and include additions to the molecule at the internucleoside phosphate linkages, such as cholesteryl or diamine compounds with varying numbers of carbon residues between the two amino groups, and terminal ribose, deoxyribose and phosphate modifications which cleave, or crosslink to the opposite chains or to associated enzymes or other proteins which bind to the viral genome. Examples of such modified oligonucleotides include oligonucleotides with a modified base and/or sugar such as arabinose instead of ribose, or a 3', 5 ' -substituted oligonucleotide having a sugar which, at one or both its 3 ' and 5 ' positions is attached to a chemical group other than a hydroxyl or phosphate group (at its 3¹ or 5 ' position) . Other modified oligonucleotides are capped with a nuclease resistance-conferring bulky substituent at their 3' and/or 5' end(s) , or have a substitution in one or both nonbridging oxygens per nucleotide. Such modifications can be at some or all of the internucleoside linkages, as well as at either or both ends of the oligonucleotide and/or in the interior of the molecule (reviewed in Agrawal et al. (1992) Trends Biotechnol. 10:152-158) .

Preferably, oligonucleotides used in accordance with the invention will have from about 12 to about 50 nucleotides, preferably from about 15 to 40 nucleotides, most preferably from about 17 to about 35 nucleotides or from about 20 to about 30 nucleotides. Such oligonucleotides are preferably complementary to at least a portion of a targeted genomic region, or gene or an RNA transcript thereof such that the oligonucleotide is capable of hybridizing or otherwise associating with at least a portion of such genomic region, gene or RNA transcript thereof under physiological conditions. Hybridization is ordinarily the result of base-specific hydrogen bonding between complementary strands of DNA or mRNA transcript preferably to form Watson-Crick or Hoogsteen base pairs, although other modes of hydrogen bonding, as well as base stacking can also lead to hybridization.

Without being limited to any theory or mechanism, it is generally believed that the activity of oligonucleotides used in accordance with this invention depends, at least in part, on the binding of the oligonucleotide to the target nucleic acid (e.g. to at least a portion of a genomic region, gene or mRNA transcript thereof) , thus disrupting the function of the target, either by hybridization arrest or by destruction of target RNA by RNase H (the ability to activate RNase H when hybridized to RNA) . Such hybridization under physiological conditions is measured as a practical matter by observing interference with the function of the nucleic acid sequence.

Thus, a preferred oligonucleotide used in accordance with the invention is capable of forming a stable duplex (or triplex in the

Hoogsteen pairing mechanism) with the target nucleic acid; of activating RNase H thereby causing effective destruction of the target RNA molecule, and in addition is capable of resisting nucleolytic degradation (e.g. endonuclease and exonuclease activity) in vivo. A number of the modifications to oligonucleotides described above and others which are known in the art specifically and successfully address each of these preferred characteristics.

The nucleic acid sequence to which an oligonucleotide used according to the invention is complementary will vary, depending upon the agent to be inhibited. In many cases the target nucleic acid sequence will be a virus nucleic acid sequence. Viral nucleic acid sequences that are complementary to effective antisense oligonucleotides have been described for many viruses, including human immunodeficiency virus type 1 (U.S. Patent No. 4,806,463), Herpes simplex virus (U.S. Patent No. 4,689,320), influenza virus (U.S. Patent No. 5,794,428) ; human papilloma virus (HPV) (Storey et al. , Nucleic Acids Res. 19:4109-4114 (1991), and U.S. Ser. Nos. 08/471,974 and 08/469,847), hepatitis B virus (HBV) (U.S. Ser. Nos. 08/467,397, 08/463,624, 08/468,352, and 08/467,398), hepatitis C virus (U.S. Ser. Nos. 08/471,968, 08/467,939, 08/467,396, and

08/465,771), cytomegalovirus (CMV) (U.S. Ser. Nos. 08/249,386, 08/479,923, and 08/483 ,259) , respiratory syncytial virus (RSV) (U.S. Ser. No. 08/199,503), and Epstein Barr virus (EBV) (U.S. Ser. Nos. 08/199,510, and 08/460,889) . Sequences complementary to any of these nucleic acid sequences can be used for oligonucleotides according to the invention, as can be oligonucleotide sequences complementary to nucleic acid sequences from any other virus. Additional viruses that have known nucleic acid sequences against which antisense oligonucleotides can be prepared include Yellow Fever Virus (see, Rice et al. (1985) Science 229:726) and Varicella-Zoster Virus (see, Davison and Scott (1986) J. Gen. Virol. 67:2279) .

Alternatively, oligonucleotides useful according to the invention can have an oligonucleotide sequence complementary to a nucleic acid sequence of a eucaryotic or prokaryotic pathogenic organism. The nucleic acid sequences of many pathogenic organisms have been described, including the malaria organism, Plasmodium falciparum , and many pathogenic bacteria, including but not limited to Mycobacterium tuberculosis , Escherichia coli, and Salmonella typhimurium .

Oligonucleotide sequences complementary to nucleic acid sequences from any such pathogenic organism can be used in oligonucleotides according to the invention. Examples of pathogenic eucaryotes having known nucleic acid sequences against which antisense oligonucleotides can be prepared include Trypanosoma brucei gambiense and Leishmania (see, Campbell et al. (1984) Nature 311:350), Fasciola hepatica (see, Zurita et al . (1987) Proc. Natl. Acad. Sci. (USA)

84:2340) . Antifungal oligonucleotides can be prepared using a target hybridizing region having an oligonucleotide sequence that is complementary to a nucleic acid sequence from, e.g., the chitin synthetase gene, and antibacterial oligonucleotides can be prepared using, e.g., the alanine racemase gene.

Additionally, oligonucleotides according to the invention can have an oligonucleotide sequence complementary to a cellular gene or gene transcript, the abnormal expression or product of which results in a disease state. The nucleic acid sequences of several such cellular genes have been described, including prion protein (Stahl and Prusiner (1991) FASEB J. 5:2799-2807), the amyloid¬ like protein associated with Alzheimer's disease (U.S. Patent No. 5,015,570, and various well-known oncogenes and proto-oncogenes, such as c-myb, c-myc, c-abl, and n-ras , and the genes encoding protein kinase A, DNA methyltransferase, ApoE4 protein, BCL-2 protein, CAPL, p-glycoprotein, and VEGF (U.S. Ser. nos. 08/378,860 and 08/398,445) .

Hypertension can be controlled by oligodeoxynucleotides that suppress the synthesis of angiotensin converting enzyme or related enzymes in the renin/angiotensin system; platelet aggregation can be controlled by suppression of the synthesis of enzymes necessary for the synthesis of thromboxane A2 for use in myocardial and cerebral circulatory disorders, infarcts, arteriosclerosis, embolism and thrombosis; deposition of cholesterol in arterial wall can be inhibited by suppression of the synthesis of fattyacryl co-enzyme A:cholesterol acyl transferase in arteriosclerosis; inhibition of the synthesis of cholinephosphotransferase may be useful in hypolipidemia.

There are numerous neural disorders in which hybridization arrest can be used to reduce or eliminate adverse effects of the disorder. For example, suppression of the synthesis of monoamine oxidase can be used in Parkinson's disease; suppression of catechol O-methyl transferase can be used to treat depression; and suppression of indole N-methyl transferase can be used in treating schizophrenia.

Suppression of selected enzymes in the arachidonic acid cascade which leads to prostaglandins and leukotrienes may be useful in the control of platelet aggregation, allergy, inflammation, pain and asthma. Suppression of the protein expressed by the multidrug resistance (mdr) gene, which is responsible for development of resistance to a variety of anti-cancer drugs and is a major impediment in chemotherapy may prove to be beneficial in the treatment of cancer. Oligonucleotide sequences complementary to nucleic acid sequences from any of these genes can be used for oligonucleotides useful according to the invention, as can be oligonucleotide sequences complementary to any other cellular gene or gene transcript, the abnormal expression or product of which results in a disease state.

One aspect of the invention provides therapeutic compositions suitable for treating human diseases and disorders caused by expression of an aberrant endogenous or aberrant exogenous gene comprise at least one oligonucleotide in accordance with the invention (as described above) capable of specifically down-regulating expression of the aberrant gene; and a pharmaceutically acceptable carrier or diluent. As described above, it is preferred that an oligonucleotide used in the therapeutic composition of the invention be complementary to at least a portion of the targeted genomic region, gene, or RNA transcript thereof. As used herein, a "pharmaceutically or physiologically acceptable carrier" includes any and all solvents (including but not limited to lactose) , dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions of the invention is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

One useful therapeutic composition of the invention suitable for treating HIV-1 in humans in accordance with the methods of the invention comprises about 10 to 100 mg, preferably about 25 to 75 mg, and more preferably about 40 to 60 mg of a lyophilized oligonucleotide having SEQ ID NO:l and 20-75 mg lactose, USP, which is reconstituted with sterile normal saline to the therapeutically effective dosages described herein. One preferred therapeutic composition of the invention comprises about 50 mg of an oligonucleotide having SEQ ID NO:l and about 40 mg lactose.

Another aspect of the invention provides methods for treating humans suffering from a disease or disorder caused by expression of an aberrant gene comprising administering to the human a therapeutically effective amount of a composition of the invention. Such methods of treatment according to the invention, may be administered in conjunction with other therapeutic agents, e.g., ribavirin, dideoxynucleoside analogs such as ddC, ddl, AZT, d4T and others, protease inhibitors such as saquinavir, mesylate, indinavir, and ritonavir, and non-nucleoside reverse transcriptase inhibitors such as nevirapine, in the case of AIDS.

As used herein, the term "therapeutically effective amount" means the total amount of each active component of the pharmaceutical formulation or method that is sufficient to show a meaningful subject or patient benefit, i.e., healing of disease conditions characterized by the disease being treated and/or an increase in rate of healing of such conditions, a reduction in the expression of proteins, or cells, or viral infectivity which cause or characterize the disease or disorder being treated. When applied to an individual active ingredient, administered alone, the term refers to that ingredient alone. When applied to a combination of active ingredients, the term refers to combined amounts of the active ingredients that result in the therapeutic effect, whether administered in combination, serially or simultaneously.

A "therapeutically effective manner" refers to a route, duration, and frequency of administration of the pharmaceutical formulation which ultimately results in meaningful patient benefit, as described above. In some embodiments of the invention, the pharmaceutical formulation is administered via injection, sublingually, rectally, intradermally, orally, or enterally in bolus, continuous, intermittent, or continuous, followed by intermittent regimens.

The therapeutically effective amount of synthetic oligonucleotide in the pharmaceutical composition of the present invention will depend upon the nature and severity of the condition being treated, and on the nature of prior treatments which the patent has undergone. It is contemplated that the dosages of the pharmaceutical compositions administered in the method of the present invention should contain about 0.1 to 10.0 mg/kg body weight, preferably 0.1 to 8.0 mg/kg body weight per day, more preferably 0.5 to 6.0 mg/kg body weight/day, even more preferably 2.0 to 4.4 mg/kg body weight per day, and most preferably 3.0 to 4.0 mg/kg body weight per day. Ultimately, the attending physician will decide the amount of synthetic oligonucleotide with which to treat each individual patient. Initially, the attending physician may administer low doses of the synthetic oligonucleotide and observe the patient's response. Larger doses of synthetic oligonucleotide may be administered until the optimal therapeutic effect is obtained for the patient, and at that point the dosage is not increased further. Alternatively, doses as high as 10 mg/kg may be temporarily administered at the initiation of therapy for from one to several days, followed by maintenance doses containing about 0.1 to 8.0 mg/kg body weight, preferably 0.5 to 6.0 mg/kg body weight per day, more preferably 2.0 to 4.4 mg/kg body weight per day, and most preferably 3.0 to 4.0 mg/kg body weight per day. When administered systemically, the therapeutic composition is preferably administered at a sufficient dosage to attain a blood level of oligonucleotide from about 0.01 μM to about 10 μM. Preferably, the concentration of oligonucleotide at the site of aberrant gene expression should be from about 0.01 μM to about 10 μM, and most preferably from about 0.05 μM to about 5 μM. However, for localized administration, much lower concentrations than this may be effective, and much higher concentrations may be tolerated. It may be desirable to administer simultaneously or sequentially a therapeutically effective amount of one or more of the therapeutic compositions of the invention when individual as a single treatment episode.

Administration of pharmaceutical compositions in accordance with invention or to practice the method of the present invention can be carried out in a variety of conventional ways, such as by oral ingestion, enteral, rectal, or transdermal administration, inhalation, sublingual administration, or cutaneous, subcutaneous, intramuscular, intraocular, intraperitoneal, or intravenous injection, or any other route of administration known in the art for administrating therapeutic agents.

When the composition is to be administered orally, sublingually, or by any non-injectable route, the therapeutic formulation will preferably include a physiologically acceptable carrier, such as an inert diluent or an assimilable edible carrier with which the composition is administered. Suitable formulations that include pharmaceutically acceptable excipients for introducing compounds to the bloodstream by other than injection routes can be found in Remington's Pharmaceutical Sciences (18th ed. ) (Genarro, ed. (1990) Mack Publishing Co., Easton, PA) . The oligonucleotide and other ingredients may be enclosed in a hard or soft shell gelatin capsule, compressed into tablets, or incorporated directly into the individual's diet. The therapeutic compositions may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. When the therapeutic composition is administered orally, it may be mixed with other food forms and pharmaceutically acceptable flavor enhancers. When the therapeutic composition is administered enterally, they may be introduced in a solid, semi-solid, suspension, or emulsion form and may be compounded with any number of well-known, pharmaceutically acceptable additives. Sustained release oral delivery systems and/or enteric coatings for orally administered dosage forms are also contemplated such as those described in U.S. Patent Nos. 4,704,295, 4,556,552, 4,309,404, and 4,309,406.

When a therapeutically effective amount of composition of the invention is administered by injection, the synthetic oligonucleotide will preferably be in the form of a pyrogen-free, parenterally-acceptable, aqueous solution. The preparation of such parenterally-acceptable solutions, having due regard to ph, isotonicity, stability, and the like, is within the skill in the art. A preferred pharmaceutical composition for injection should contain, in addition to the synthetic oligonucleotide, an isotonic vehicle such as Sodium Chloride Injection, Ringer's Injection, Dextrose Injection, Dextrose and Sodium Chloride Injection, Lactated Ringer's Injection, or other vehicle as known in the art. The pharmaceutical composition of the present invention may also contain stabilizers, preservatives, buffers, antioxidants, or other additives known to those of skill in the art.

The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile. It must be stable under the conditions of manufacture and storage and may be preserved against the contaminating action of microorganisms, such as bacterial and fungi. The carrier can be a solvent or dispersion medium. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents. Prolonged absorption of the injectable therapeutic agents can be brought about by the use of the compositions of agents delaying absorption. Sterile injectable solutions are prepared by incorporating the oligonucleotide in the required amount in the appropriate solvent, followed by filtered sterilization.

The pharmaceutical formulation can be administered in bolus, continuous, or intermittent dosages, or in a combination of continuous and intermittent dosages, as determined by the physician and the degree and/or stage of illness of the patient. The duration of therapy using the pharmaceutical composition of the present invention will vary, depending on the unique characteristics of the oligonucleotide and the particular therapeutic effect to be achieved, the limitations inherent in the art of preparing such a therapeutic formulation for the treatment of humans, the severity of the disease being treated and the condition and potential idiosyncratic response of each individual patient. Ultimately the attending physician will decide on the appropriate duration of intravenous therapy using the pharmaceutical composition of the present invention.

Human diseases and disorders which are caused by expression of an aberrant gene may be treated in accordance with the methods of the invention and have been discussed earlier in this disclosure.

As discussed in the Examples, infra , the present inventors are the first to demonstrate that treatment of humans in accordance with the present invention via systemic administration of therapeutic compositions comprising at least one antisense oligonucleotide, have a biological effect in humans with therapeutic benefit. In addition, the present inventors are the first to demonstrate such treatment in humans at a dosage level of antisense oligonucleotide that is consonant with a gene-specific antisense mechanism .

HIV-1 is an example of a virus which can infect a human with foreign nucleic acids and/or genes which cause disease in the human. Novel chemotherapeutic agents have been designed which inhibit HIV-1 replication. These agents are synthetic, modified oligonucleotides having non- phosphodiester internucleotide linkages and a nucleotide sequence that is complementary to a portion of the conserved gag region of the HIV-1 genome. Gag is part of the structural gene of HIV-1 which is common to all retroviruses. Sequences situated around the gag initiation codon are known to be essential for viral packaging. The antisense oligonucleotide agent acts by binding to the target DNA or RNA, thereby inhibiting initiation of DNA replication and DNA expression, and inhibiting viral packaging by disrupting the secondary structure of its DNA.

Oligonucleotides in accordance with the invention are more specific, less toxic, and have greater nuclease resistance than many other chemotherapeutic agents designed to inhibit HIV-1 replication. In particular, compounds in accordance to the invention having non- phosphodiester linkages are more resistant to nucleolytic degradation than are compounds having solely phosphodiester linkages. In addition, they are more active in inhibiting viral replication than other known antisense oligonucleotides containing a nucleotide sequence complementary to less than the 324 to 348 HIV-1 gag sequence. A preferred oligonucleotide suitable in compositions and methods for treating humans in accordance with the invention is referred to as a "25mer" or "Oligo 1." The nucleotide sequence of this 25mer is set forth in the Sequence Listing as SEQ ID N0:1. Other preferred oligonucleotides include phosphorothioate oligonucleotides having 26, 27, 28, 29, or 30 nucleotides, the sequences of which are complementary to nucleotides 324-348 of HIV-1 in addition to other flanking nucleotides. The sequences of two preferred 26mers are set forth in the Sequence Listing as SEQ ID NOS:2 and 3; that of a preferred 27mer are found in SEQ ID NO:4; those of preferred 28mers are found in SEQ ID NOS: 5 and 6; that of a preferred 29mer is set forth in SEQ ID NO:7; and those of preferred 30mers are found in SEQ ID NOS:8 and 9. These preferred sequences are targeted to the region around the gag initiation codon of the HIV-1 genome. Sequences situated in this region have been demonstrated to be essential for viral packaging. These sequences form a stable secondary structure (Harrison et al. (1991) in RNA Tumor Viruses (Coffin et al., eds . ) Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, pp. 235) . These oligonucleotides have been designed to bind to this region, thereby disrupting its natural stability and resulting ultimately in the inhibition of viral packaging and translation of gag mRNA.

The oligonucleotides are complementary to at least sequence 324-348 of the gag region (SEQ ID NO:ll) of HIV-1 (FIG. 2) (Muessing et al. (1985) Nature (London) 313:450-458) . Sequence 324-348 is very conserved among strains of HIV-1, as shown below in TABLE 1.

TABLE 1

Sequence of:

324-348 → TCTTCCTCTCTCTACCCACGCTCTC CONSENSUS → CGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTA

Strains of HIV-1

HTLV3/LLAV G A

HIVLAI G A

HIVNL43 G G

HIVMN G

HIVJH3 G A

HIVOYI G A

HIVCDC4 G A

HIVRF A

HIVMAL G A (African)

HIVU455 A A CCTCAG (Ugandan)

HIVSF2 (GA) 4G G

HIVNDK G A

Targeting an antisense oligonucleotide to such a conserved region including an active gene allows for efficient inhibition of HIV proliferation without the generation of "escape mutants." Escape mutants arise when a mutation occurs in a region of the genome targeted by the antisense oligonucleotide. They occur at a higher frequency in non-coding regions (like the SA region of HIV-1) than in regions encoding a

10 protein.

The nucleotide sequences of the oligonucleotides used in accordance with the invention each are complementary to at least nucleotides 324-348 of the HIV-1 genome. One aspect of the invention is an oligonucleotide consisting essentially of this sequence and is referred to herein as a 25mer. The sequence of the 25mer is set forth in the Sequence Listing as SEQ ID NO:l. Other claimed oligonucleotides with the ability to inhibit HIV-1 replication contain the sequence of the 25mer flanked in the 3 ' and/or 5 ' direction by additional nucleotides complementary to nucleotides flanking the 324 to 348 region of HIV-1. The sequence of these oligonucleotides is set forth in TABLE 2 and in the Sequence Listing as SEQ ID NOS:2-9. Also listed for comparison is the sequence of a 20mer, (Agrawal et al. (1992) Gene Regulation: Biology of Antisense DNA and RNA (Erickson and Izant, eds.) Raven Press, Ltd., New York, pp 273-283 (SEQ ID NO:10) .

TABLE 2

SEQ ID Oligonucleotide Sequence (5 ' - 3 ' ) No.

25mer CTCTCGCACCCATCTCTCTCCTTCT 1 2 266mmeerr CTCTCGCACCCATCTCTCTCCTTCTA 2

26mer GCTCTCGCACCCATCTCTCTCCTTCT 3

27mer GCTCTCGCACCCATCTCTCTCCTTCTA 4

28mer GCTCTCGCACCCATCTCTCTCCTTCTAG 5

28mer CGCTCTCGCACCCATCTCTCTCCTTCTA 6 2 299mmeerr CGCTCTCGCACCCATCTCTCTCCTTCTAGC 7

30mer ACGCTCTCGCACCCATCTCTCTCCTTCTAG 8

30mer ACGCTCTCGCACCCATCTCTCTCCTTCTAGC 9

20mer TCCTCTCTCTACCCACGCTC 10

Studies of the mechanism and efficiency of compositions of the invention comprising antisense oligonucleotides in inhibiting viral replication can be approached effectively in several in vitro systems . One system uses chronically infected human T lymphocytes such as CEM cells . In such a system the infected cells are cultured in the absence and presence of different concentrations of the antisense oligonucleotide for varying lengths of time. Unlike the oligonucleotides described herein, nucleotide analogs alone, such as AZT, ddl, and ddC do not inhibit HIV replication in this particular in vivo system.

However, because chronically infected cells are CD4-, reinfection cannot occur. Thus, such an in vitro culture does not parallel the in vivo conditions present in an HIV-infected person, where only a small percentage of their CD4+ cells are infected and producing virus. A model for drug studies which more closely approaches in vivo condition is a cell culture with an acute, low multiplicity of infection (MOD . In this system only a fraction of the cell population harbors virus while the other cell are uninfected and are CD4+. Human T cell lines such as CEM or H9 (ATCC HTB 176) are infected with HIV for one to several hours and then cultured in the absence or presence of varying concentrations of oligonucleotide for different period of time.

The ability of compositions of the invention to inhibit HIV-1 replication can be measured by determining the level of HIV expression and the cytotoxic effect of the oligonucleotides on the infected cells in vivo or in vitro. HIV expression can be monitored by quantitative measures of plasma and cellular viremia (i.e., the number of infectious units per million mononuclear cells in the plasma or peripheral blood mononuclear cells, respectively), and of CD4+ counts. Other parameters which can be used to monitor HIV expression include syncytia formation, p24 expression, pl7 expression, reverse transcriptase activity (see Agrawal et al (1991) Adv. Drug Delivery Rev. 6:251-270; Sarin et al. (1985) Biochem. Pharmacol. 34:4075-4079; and Sarin et al . (1987) J. Natl. Cancer Inst. 78:663-666), and the expression of viral DNA (Urdea et al . (1993) AIDS (Suppl. 2) :S11-S14) .

Preferred parameters include quantitative measures of plasma and cellular viremia, and CD4+ counts. The inhibition of viral cryopathic effect (CPE) by the oligonucleotides can be studied by the MTT or trypan blue exclusion method.

The compositions of the invention may be used to inhibit the proliferation of HIV-1 in infected cells . In this method, a therapeutic formulation including an antisense oligonucleotide described herein is provided in a physiologically acceptable carrier. HIV-1 infected cells are then treated with the therapeutic formulation in an amount sufficient to enable the binding of the oligonucleotide to the gag region of HIV-1 proviral DNA and or mRNA in the infected cells. In this way, the binding of the oligonucleotide to the HIV-1 DNA or mRNA inhibits the expression and replication of the virus.

Compositions of the invention are useful for treating HIV-1 infection in humans. In this method, a therapeutic formulation including an antisense oligonucleotide of the invention is provided in a physiologically acceptable carrier. The individual is then treated with the therapeutic formulation in an amount sufficient to enable the binding of the oligonucleotide to the gag region of HIV-1 proviral DNA and/or mRNA in the infected cells. In this way, the binding of the oligonucleotide inhibits HIV-1 DNA expression and replication of the virus.

In practicing the method of treatment or use of the present invention, a therapeutically effective amount of at least one or more therapeutic compositions of the invention is administered to a subject afflicted with a disease or disorder related to AIDS.

At least one therapeutic composition of the invention may be administered in accordance with the method of the invention either alone or in combination with other known therapies for AIDS, e.g. but not limited to, ribavirin, dideoxynucleoside analogs such as ddC, ddl, AZT, d4T and others, protease inhibitors such as saquinavir, mesylate, indinavir, and ritonavir, and non-nucleoside reverse transcriptase inhibitors such as nevirapine. When co- administered with one or more other therapies, the compositions of the invention may be administered either simultaneously with the other treatment(s) , or sequentially. If administered sequentially, the attending physician will decide on the appropriate sequence of administering the compositions of the invention in combination with the other therapy.

It may be desirable to treat AIDS patients with other forms of therapy in combination with administration of pharmaceutical compositions of the invention. This is because HIV has a high mutational rate, and therefore many drugs designed to treat virus infection may induce the formation of escape mutants. To overcome this problem, combination chemotherapy has been suggested for treatment of HIV-infected patients. This therapy involves more than one drug directed against different targets, such as reverse transcriptase inhibitors combined with protease inhibitors. Alternatively, antisense treatment targeting different sequences either in combination or in sequential treatment schedules can be administered, resulting in different selection pressures on the virus with little time to develop escape mutants. Accordingly, the first treatments may consist of a mixture of oligonucleotides of the invention, followed by sequential administration of oligonucleotides targeted to other conserved regions of the HIV-1 genome. Also contemplated is therapy including antisense oligonucleotides in combination with other AIDS drugs such as protease inhibitors, etc. The following examples illustrate the preferred modes of making and practicing the present invention, but are not meant to limit the scope of the invention since alternative methods may be utilized to obtain similar results.

EXAMPLE 1

SYNTHESIS OF THE OLIGODEOXYNUCLEOTIDE PHOSPHOROTHIOATES

Phosphorothioate-modified oligodeoxynucleotides were synthesized using H- phosphonate chemistry on an automated synthesizer (Millipore 8700, Bedford, MA) on a 5 to 10 mmol scale. After the. assembly of the required sequence, the CPG-bound oligonucleotide H- phosphonate was oxidized with sulphur in pyridine/triethylamine/carbon disulfide to generate phosphorothiote linkages. The deprotection was completed in concentrated ammonia at 40°C for 48 hr. Purification was carried out by preparative reverse-phase chromatography followed by ion exchange chromatography. Finally, purified oligonucleotides were dialyzed against water and lyophilized. Oligonucleotide phosphorothioates were checked for their purity by HPLC and PAGE (Agrawal et al . (1989) Proc. Natl. Acad. Sci. (USA) 86:7790-7794) .

The oligonucleotide used for comparison in these experiments was the phosphorothioate 20mer, whose nucleotide sequence (SEQ ID NO: 10) is complementary to a portion of the gag region (nucleotides numbers 327 - 346) of the HIV-1 genome (see SEQ ID NO:11) . Like the oligonucleotides of the invention, this 20mer has phosphorothioate internucleotide linkages. However, as shown in the experiments described in the exemplification which follows, it has less HIV-1 inhibitory activity than the oligonucleotides of the invention.

EXAMPLE 2

SPECIFICITY OF ANTISENSE AND CONTROL OLIGONUCLEOTIDES

To determine the specificity of the antisense oligonucleotides, their biological effect may be compared to the same sized oligonucleotide which is not complementary to any known cellular or viral genes. Three such nonspecific control oligonucleotides are chosen, of which one having a "random" sequence is theoretically the best. The random sequence is synthesized as a degenerate oligonucleotide, by coupling a mixture of four nucleotides at each stage (theoretically it contains 4²⁸ = 7.2 x 10¹⁶ sequences), and thus measures the extent of sequence nonspecific inhibition.

EXAMPLE 3

HIV-1 INHIBITION ASSAYS

The following assays were used to measure the ability of the oligonucleotide of the invention to inhibit HIV-1 replication. A. Syncytia Assay

The ability of the oligonucleotides of the invention to inhibit HIV-1 replication, and thus syncytia formation, in tissue culture is tested in T cell cultures according to the method of Agrawal and Sarin (1991, ibid. ) Briefly, CEM cells are infected with HIV-1 virions (0.01 - 0.1 TCID₅₀/cell) for one hour at 37°C. After one hour, unadsorbed virions are washed and the infected cells are divided among wells of 24 wellplates. To the infected cells, an appropriate concentration (from stock solution) of oligonucleotide is added to obtain the required concentration in 2 ml medium. The cells are then cultured for three days. At the end of three days, infected cells are examined visually for syncytium formation or stained with trypan blue or CTT for cytopathic effect determination.

B. p24 Expression Assay

HIV expression can be determined by measuring the level of viral protein p24 expression in CEM cells essentially as described by Agrawal and Sarin (Adv. Drug Delivery Rev. (1991) 6:251-270) . Briefly, cells are pelleted and the resuspended in phosphate saline at a concentration of about 10⁶ /ml. The cells are spotted on toxoplasmosis slides, air dried, and fixed in methanol/acetone (1:1) for 15 min at room temperature (RT) . The slides are next incubated with 10% normal goat serum at RT for 30 min and washed with phosphate buffered saline (PBS) . Anti-p24 monoclonal antibody is added to each well, and the slides are incubated in a humid chamber at 37°C. The slides are labelled with goat anti-mouse IgG for 30 min and then washed in PBS overnight. The percentage of cells fluorescing in oligonucleotide-treated and untreated cells is compared.

C. Cytopathic Effect (CPE)

HIV-induced cytopathic effect is determined by measuring the decrease in the number of viable cells after infection. The cells are counted by adding MTT or trypan blue dye to the cells and determining how may cells (dead) take up the dye. The assay is done in triplicate.

D. Reverse Transcriptase Assay

This assay is performed essentially as described in Agrawal et al . (Adv. Drug Delivery Rev. (1991) 6:251-270) . Supernatants from virus- infected cultures in the presence and absence of oligonucleotide are collected and virus particles precipitated with poly(ethyleneglycol) . The virus pellet is suspended in 300 μl of buffer containing 50 mM Tris-HCl (pH 6.8), 5 mM dithiothreitol (DTT) , 250 mM KC1, and 25% Triton X-100. Reverse transcriptase activity in the solubilized pellet is assayed in a 50 μl reaction mixture containing 50 mM Tris-HCl (pH 7.8), 5 mM DTT, 100 mM KC1, 0.01% Triton X-100, 5 μg dtl5.rAn as template primer, 10 mM MgC12, 15 μM [³H]dTTP (15 Ci/mmol) , and 10 μl of the disrupted virus suspension. After incubation for 1 hr at 37°C and subsequent addition of 50 μg yeast tRNA, the incorporation into the cold trichloroacetic acid-insoluble DNA fraction is assayed by counting in a β scintillation counter.

E. AMES Test for Mutagenicity

Oligo 1 was tested in the salmonella mutagenicity assay using five tester strains in the presence and absence of rat liver microsomal enzymes. The maximum dose tested was 400 μg per plate. The results of the mutagenicity assay indicate that neither precipitate nor appreciable toxicity was observed (Salmonella/Mammalian- Microsome Plate Incorporation Mutagenicity Assay (AMES Test), 1993 (On file at Hybridon, Inc., Worcester, MA - TC 678 501 098) .

Micronucleus Test

Male and female mice were treated with 419, 838, or 1,675 mg/kg Oligo 1, and their bone marrow examined 24, 48, and 72 hours after treatment. No significant increase in micronuclei formation was observed (Micronucleus Cytogenic Assay in Mice, 1993 (On file at Hybridon, Inc., Worcester, MA . TE 678 1212) .

EXAMPLE 3 INHIBITION OF HIV-1 REPLICATION IN VITRO

The ability of the antisense oligonucleotides of the invention to inhibit HIV-1 infection in a number of established cell lines can be established by performing the short term (acute infection) and long term assays described below.

A. Short Term (acute infection) Assays

1. In CEM Cells:

CEM cells (5 x 10⁴ cells/ml) were infected with HIV-1 (HTLV IIIB strain) for 4 hours at 37°C. Infected and uninfected cells were then cultured in the presence and absence of oligonucleotide such as 25mer or a control oligonucleotide that has no activity (e.g., a 20mer with SEQ ID NO:10) for up to 6 days at 37°C (in triplicate) . The concentrations at which the 25mer were tested are 0.32 μg/ml (0.05 μM) , 1.00 μg/ml (0.2 μM) , 3.2 μg/ml (0.04 μM) , 10 μg/ml (1.5 μM) , 32 μg/ml (4 μM) , and 100 μg/ml (10.5 μM) . The effective concentration to cause 50% inhibition of virus replication (EC₅₀) was determined graphically. After the experiment the level of HIV-1 expression was measured by the syncytia formation assay (TABLE 3A) and the p24 expression assay (TABLE 3B) . Cytotoxicity was measured by colorimetric analysis after addition of MTT to wells as described above (TABLE 3C) . TABLE 3A Syncytia Inhibition Assay

Cone. Avg.#^* % Inhib. Reduct. EC₅₀ Oligo. (μg/ml) Svncvtia Svncvtia (%) μg/ml

20mer 0 0..3322 1 14477 0 0 4 4 1.81

1.00 153 0 0

3.2 0 100 98

10 0 100 100

32 0 100 100

100 0 100 100 25mer 00..3322 114455 66 66 1.41

1.00 108 30 29

3.2 0 100 100

10 0 100 100

32 0 100 100

100 0 100 100

* Average number of syncytia formed in control (infected but untreated cells) was 153.

These results demonstrate that an oligonucleotide of the invention, the 25mer, partially inhibits (30%) syncytia formation at a lower concentration (1.00 μg/ml) than does the 20mer. In addition, the effective concentration of oligonucleotide to cause 50% inhibition of virus replication (EC₅₀) was lower for the 25mer than for 20mer, indicating that the 25mer has more activity.

TABLE 3B HIV p24 Antigen Assay

p24 expression Reduct.of p24 Cone. % of virus expression

Oligo. ( μg/ml) control (_%J

20mer 0.32 133

1.00 114 3 3..2200 9 933 7

10 44 56

32 53 47

100 62 38

25mer 0.32 115

1 1..0000 1 11155

3.20 57 46

10.00 59 41

32 43 57 1 10000 3 355 65

The 25mer was able to reduce p24 expression by nearly 50% at a lower concentration than was the 20mer. Furthermore, at high concentrations (100 μg/ml) the 25mer was nearly twice as effective in reducing p24 expression as the 20mer, indicating that it is highly active in inhibiting HIV-1 expression.

TABLE 3C HIV Cytopathic Assay

Reduction in viral Cone. cytopathic effect

Oligo. ⁽μσ/ml⁾ L%i EC SO-

Experiment 1

20mer 0.32 0 7.75 1.00 6

3.2 28 10.0 62 32.0 84

100 87

25mer 0.32 4 2.54 1.00 26

3.2 56 10.0 87 32.0 95

100 87

Experiment 2

20mer 0.32 0 3.91 1.00 0 3.2 41 10.0 100 32.0 100 100 100

25mer 0.30 0 1.00 0 3.2 70 10.0 100 32.2 100 100 100 TABLE 3C . conti ' .

Reduction in viral Cone. cytopathic effect Oligo. (ug/ml) (JD EC,₅ EC₅₀ EC₉

Experiment 3

20mer 0 0..3322 6 1.36 1.84 3.20

1.00 0

3.2 95

10.0 100

32.0 100

100 100

25mer 00..3322 00 1.29 1.75 3.01

1.00 4

3.2 100

10.0 100

32.0 100

100 100

The EC₅₀ of the 25mer required to reduce viral cytopathic effect was significantly lower than that of the 20mer in each of three experiments performed, indicating that it has less cytotoxicity than 20mer.

2. In H9 Cells

H9 cells were infected with HIV-1 (HTLVIII_B or HTLVIIIr_ø, strains) with 0.01-0.lTCID₅₀/cell for 1 hour at 37°C. TCID₅₀ was determined by infection of H9 cells with limiting dilutions of virus and subsequent cultures for two weeks. The cultures were prepared in quadruplicate at 10-fold dilution of HIV-1. After infection, unabsorbed virions were removed by washing. Infected cells were cultured in the presence of oligonucleotide concentrations (0.005, 0.02, 0.13, and 0.6 μM) for 3 to 4 days at 37°C. The level of HIV-1 expression was monitored by measuring p24 in supernatant with a monoclonal antibody-based p24 antigen capture test (DuPont, Boston, MA) . The results are summarized in TABLE 4. Cytotoxicity is determined by eulturing uninfected cells with the 25mer for 3 to 4 days and counting the cells with a Coulter counter. The results are also shown in TABLE 4 and in FIG. 5.

TABLE 4 HIV p24 Antigen Assay

Inhibition

Cone . % Cell of p24

Expt. # Oligo μg/ml U.M Survival (%)

25mer 25.0 2.9 0.93 90

5.0 0.5 1.03 89

1.0 0.1 0.94 15

0.2 0.02 0.97 26

AZT 0.2 0.6 0.95 90

0.04 0.1 0.98 73

0.008 0.02 1.04 44

0.0016 0.005 1.08 6

2 25mer 5.0 0.93 66

11.0 1.01 20 0.2 1.07 21

0.04 1.02

3 25mer 10.0 1.0 88 1.0 1.0 12

0.1 1.0

0.01 1.0 These results show that the 25mer is more effective at inhibiting p24 expression, and thus HIV-1 replication at lower concentrations than is AZT.

3. In Chronically Infected CEM Cells:

Chronically infected CEM cells were cultured in the presence of the 25mer at concentration of 200, 64 and 20 μg/ml. Cells were then cultured at 37°C. At 24 and 48 hours of treatment, supernatants from treated cells were removed and assayed for the level of reverse transcriptase (RT) activity as described by Sarin et al . (J. Natl. Cancer lnst. (1987) 78:663-666) . The level was compared to the level of RT in control untreated infected cells . The results are summarized in TABLE 5.

TABLE 5

Anti-HIV Activity of the 25mer In Chronically Infected Cells

Cone. Time % Inhibition of

Oligo. μg/ml) (hour) of RT

25mer 200 24 92

64 49

20 —

25mer 200 48 87

64 53

20 —

The 25mer was able to inhibit RT activity in this in vivo system, even after 2 days, unlike nucleotide analogs which appear to have no affect chronically infected cells .

B. Long term Infection Assays

H9 cells were infected with HIV-1 (HTLVIII_B) at 0.01-0.1 TCID₅₀/cell for 2 hours, washed to removed unabsorbed virions, diluted to 2 x 10^s cells/ml and cultured at 37°C. Every 3 to 4 days cells were diluted to 2 x 10⁵/ml then cultured in fresh medium containing 5 μg/ml (0.7 μM) of the 25mer or ddC. At the time of splitting of cells, supernatant was removed and the level of p24 expression measured by the antigen capture assay (Dupont) . Results are shown in FIG. 7 and are summarized in TABLE 6.

TABLE 6 Inhibition of HIV-1 Replication by 25mer

In Long Term Culture concentration (μM) Control 25mer ddC p24 expression - 0.60 0.05

(pg/ml) day 3 489 21 (95*) 124 (75*) day 7 188,800 790 (99*) 10,800 (94*) day 10 210,400 380 (99*) 17,300 (91*) day 14 130,400 870 (95*) 60,000 (56*) day 17 95,600 5,800 (94*) 54,000 (44*)

* % inhibition of p24 compound compare with control

These results indicate that the 25mer can inhibit p24 expression, and hence HIV-1 replication, with more efficiency than can ddC, and is much more active than ddC in the long term (> ten days) . This may be because nucleotide analogs are more susceptible to nuclease digestion than are oligonucleotides with phosphorothioate linkages .

Thus, oligonucleotides of the invention are more specific, less toxic, and have greater nuclease resistance than many other chemotherapeutic agents designed to inhibit HIV-1 replication. In addition, they are more active in inhibiting viral replication than other known antisense oligonucleotides containing less than the 324 to 348 HIV- 1 gag sequence. For example, the 20mer set forth in the Sequence Listing as SEQ ID NO:10 is less active than the 25mer of the invention. Additionally, a 28mer described by Maktsukura et al. (in Prospects for Antisense Nucleic Acid Therapy of Cancer and AIDS Wiley-Liss, Inc., (1991) pp.159-178) (FIG. 3) which is complementary to a portion of the gag region overlapping region 324-

348 is also much less active. This may be because the ribosome binding site (AUG) and regions flanking it are securely masked by the oligonucleotides of the invention that are at least 25 nucleotides in length. Also, when hybridized to this region, the oligonucleotides of the invention cannot be easily replaced by the ribosome, hence thwarting HIV infection.

Furthermore, the conservation of this gag region results in the avoidance of escape mutants. This effect can be further increased by using oligonucleotides of the invention in conjunction with other anti-HIV oligonucleotides or anti-HIV drugs.

EXAMPLE 4 TREATMENT OF HIV-1 INFECTION IN HUMANS

Subjects treated were HIV-positive men and women, > 18 years of age, able to give informed consent, and not having been treated with other antiretroviral therapy for 2 weeks before and during Oligo 1 therapy. Subjects had a CD4+ lymphocyte count of 50 or 100 to 500 mm³, and >

25,000 copies/ml plasma of HIV by the Chiron b-DNA method (Urdea et al. (1993) AIDS (Suppl. 2) :S11- S14) . Subjects also had serum creatinine < 1.5 mg/ml and other measures of renal function that were within normal limits at screening. For some subjects, PTT was < 125% control. Subjects displayed no evidence of active hepatitis and no hepatitis B surface antigenemia upon screening, no active AIDS-related illness that requires systemic therapy during study drug administration, and no system prophylaxis for fungal infection or for Mycobacterium-avium complex for the duration of study drug administration.

An objective of these studies is to examine the treatments for efficacy measures as defined as change from baseline in virology and imrnunologic surrogate markers of anti-retroviral activity.

For a given subject, potential indicators of a positive clinical effect include a drop in the level of particular indicators relative to baseline at certain times after the initiation of therapy. Such positive indicators may include a drop in the level of plasma and/or cellular viremia. Another potential measure may be a change in the level of plasma HIV RNA. Also, in a positive clinical setting, CD4+ counts (lymphocyte values) are expected to increase. Tabulations of the incidence of this effect were performed throughout the study. An assessment of the duration of this effect, through post treatment periods were provided for each dose group. For each subject, onset was defined as the first day, post baseline, or offset where a clinical effect is established. Offset of clinical effect for each subject was defined as the first day, post onset, that an HIV RNA level decrease is found. Duration of clinical effect for each subject was calculated as the longest period from consecutive onset to offset.

Baseline measurements were taken twice within the month before study drug therapy (at least 14 days after discontinuation of any prior antiretroviral therapy) , and followed at two week intervals during and for 4 weeks following cessation of Oligo 1 therapy. PBMC were cultured to monitor in vitro sensitivity of HIV isolates. The concentration of CD4+ and CD8+ lymphocyte populations pre-, during, and post-treatment was measured to assess immunologic status .

The pharmacokinetics profile of Oligo 1 was the secondary objective of these studies. Plasma concentrations of Oligo 1 were analyzed using standard pharmacokinetic techniques including assessment of dose proportionally. These data were graphed versus time for each subject and the entire treatment group. Variables of interest included C,,^, T,^, AUC, clearance, volume of distribution, estimated half-life, and total clearance.

In all studies, 50 mg of lyophilized Oligo 1 (25mer with SEQ ID NO:l) with 40 mg lactose, USP, was used and stored at -20°C or at room temperature. Lyophilized Oligo 1 was reconstituted by adding 5 ml of sterile normal saline. This prepares a solution containing 10 mg/ml Oligo 1. After checking for complete dissolution, the calculated amount of Oligo 1 was removed and diluted in 250 ml of sterile 0.9% saline for intravenous administration.

A. Single-Dose Administration

A single-dose escalating Oligo 1 dose study in 42 clinically-stable HIV-positive adult men and women was performed (Protocol 91-003) . Six subjects were administered Oligo 1 at each of three dose levels (0.1, 0.3, and 0.5 mg/kg) . Subjects were randomly selected to receive the assigned dose initially as a subcutaneous injection or an intravenous infusion, given over two hours. After two weeks of safety assessment and washout, the same dose was administered by the alternate route. Safety was again assessed for two weeks. At higher doses, only the IV route was employed. Twelve subjects received 1.0 mg/kg, 6 subjects received 2.0 mg/kg, and 6 subjects received 2.5 mg/kg. No drug related adverse clinical events were reported. At 2.0 and 2.5 mg/kg doses, activated partial thromboplastin times (PTT) were prolonged for brief periods (2 hr or less) while plasma concentrations of Oligo 1 were at peak levels . Other measures of coagulation (prothrombin time; platelet counts) did not change.

Following each dose, blood was obtained at intervals to follow pharmacokinetics of Oligo 1 as measured by HPLC methods, with a detection limit of >50 ng/ml. Intact Oligo 1 was not detected in the urine, and there were no measures of antiviral effect incorporated in the study. Pharmacokinetic parameters could be determined readily only after I.V. infusion. Plasma levels of Oligo 1 decreased rapidly following the end of infusion, with a termination elimination half-life ranging from less than 30 minutes to longer than one hour. The peak Oligo 1 concentrations achieved following infusion varied somewhat between individuals in each dosing group, but the range of values observed generally increased as the dose administered increased. At 0.3 mg/kg, peak plasma levels range around 900 ng/ml and peak levels increase to around 2,000 ng/ml when the dose is

0.5 mg/kg and 7,500 ng/ml at a dose of 1.0 mg/kg, 17,000 ng/ml at 2.0 mg/kg and 25,000 ng/ml at 2.5 mg/kg. Evaluation of the pharmacokinetic values obtained after single dose injection by the subcutaneous route revealed that the peak levels (C-_a*) and the total bioavailability (AUC) were substantially lower than when the same dose was given intravenously. In a single-dose second clinical study, conducted in the USA, 6 HIV-positive subjects received single doses of ³⁵S-Oligo 1 at 0.1 mg/kg, to study the distribution and metabolism of the drug in humans . Present information about the distribution and pharmacokinetics of ³⁵S-01igo 1 in humans indicates that, when administered by intravenous infusion over a two hour period, the post-infusion levels of ³⁵S rapidly decrease in the plasma (alpha-half life in plasma < 1 hr) , followed by a more prolonged terminal plasma half- life (>20 hours) . The relatively rapid appearance in the urine of ³⁵S (40 to 80% in the first 24 hours after administration) in the absence of detectable intact compound in the urine suggests that metabolism may be an important route of elimination. There have been no clinically- significant drug-associated adverse effects noted among the initial 48 subjects treated with single- dose administration.

Continuous Intravenous Infusion (Protocol 91-007)

Subjects had an indwelling intravenous catheter inserted prior to the initiation of the continuous infusion phase of dosing. To facilitate the continuous administration of Oligo 1, a suitable catheter (e.g., Groshong PICC Line, C.R. Bard, Murray Hill, NJ, or other suitable catheter) may be inserted to provide intravenous access for infusion. Blood specimens for pharmacokinetic measurements were obtained from a separate intravenous access (in another extremity) through an indwelling catheter or by repeated venipuncture.

All subjects received the assigned therapy shown in Table 7 by continuously-administered intravenous infusion for two weeks. A constant rate infusion pump was used. In group A, treatment began at 0.1 mg/kg/day, initially, by continuous IV infusion. Escalation of drug dosage to 0.2 mg/kg/day occurred at day 8.

Administration was terminated on the morning of day 14 to allow for washout pharmacokinetic blood samples to be taken.

Table 7

Group Dose Number of Subjects

A 0.1/0.2 mg/kg/day 6 active, 3 placebo

B 0.4 mg/kg/day 6 active, 3 placebo

C 0.8 mg/kg/day 6 active, 3 placebo D 1.2 mg/kg/day 6 active, 3 placebo

E 1.6 mg/kg/day 6 active, 3 placebo

The initial dose level chosen, 0.1 mg/kg/day, has a large margin of safety as determined by the dose (ca. 5 mg/kg) and the rate of infusion (ca. 2.5 mg/kg/hr) in the monkey at which serum complement activation begins to occur. In the monkey, activation of complement is associated with margination of neutrophils, presumed release of vasoactive mediators from the neutrophils, and hypotension (Galbraith et al . (1994) Antisense Res. Dev. 4:201-207) . C. Continuous/Intermittent Intravenous Administration

Subjects had an indwelling intravenous catheter inserted prior to the initiation of dosing, as described in EXAMPLE 5B above. For the intermittent infusion of Oligo 1, an indwelling catheter was employed with a heparin lock to maintain patency, as described above in EXAMPLE 4B.

All subjects in this study received the initially assigned therapy by continuously administered intravenous infusion. A calibrated constant rate infusion pump was used, adjusted to administer the Oligo 1 daily dose in 1,000 ml volume infused over 24 hours . Study drug was administered for 14 days. Administration was terminated on the morning of day 14 to allow for the washout pharmacokinetic blood samples to be obtained.

Therapy was continued by administration of the specified dose of Oligo 1 as a 120 minute IV infusion, every-other-day. Treatment began at 0.4 mg/kg/day, initially, by continuous I.V. infusion for two weeks. 0.8 mg/kg was given as 2 hour

every other day intermittent infusions for 2 weeks or longer.

D. Continuous Infusion Study (Protocol 91-007)

This ongoing double blind placebo study was an intravenous continuous infusion study. A constant rate infusion pump was used. An objective of this study was to examine the treatments for efficacy measures as defined by change from baseline virology and immunologic surrogate markers of anti-retroviral activity.

In one study, Oligo 1 prepared as described above was administered continuously for 8 days to 6 male patients at a dose level of 3.2 mg/kg/day. Blood was obtained from the group for virology assessment according to the following schedule:

TABLE 8 BLOOD DRAWING

Measures of antiviral effect include quantitative measures of plasma and cellular viremia, CD4+ counts, and p24 antigen levels. Baseline level was established by sampling on Day -7 and on the day of study drug administration (Day 1) . Subsequent samples were obtained in accordance with the table above. Quantitative culture of PBMC-associated virus was also obtained before therapy, immediately after therapy and during the follow-up period (after Day 8 up to Day 14) in accordance with the Table above.

For quantitative culture of PBMC associated virus (plasma and cellular viremia described in Examples 4E and 4F, below) , a decline of one log₁₀ is considered to be a decrease in viremia. In this cohort of 6 patients there is a strong trend supporting a decrease in the infectivity of the virus by both the quantitative plasma culture assay (plasma viremia) as well as the quantitative cell culture assay (cell viremia) . Such decrease in infectivity of the virus may be indicative of a biological antiviral effect in humans as a result of antisense therapy using Oligo 1.

In some other related studies, 18 subjects were continuously administered higher dose levels of Oligo 1: 8 males and 1 female received 3.6 mg/kg and 8 males and 1 female received 4.0 mg/kg, over an 8 day period. Measurements of antiviral effect including cellular viremia was taken and compared to baseline as described above for the 3.2 mg/kg study. The 3.2, 3.6, and 4.0 mg/kg cohort groups were pooled in subsequent analyses because results from each were comparable at the baseline variable level; analysis of these variables on the dose factor showed no significant differences (data not shown) . Pooling was also considered to be legitimate because the increase in dosage between the groups was proportionately small, and the plasma levels reached by the treated subjects were comparable in range.

The preliminary data obtained clearly distinguished two groups of patients: one receiving Oligo 1 and one receiving placebo (data not shown) . The former showed a significant drop in cellular viremia, particularly between Days 4-8 (see FIG. 6 for representative data) . These findings are indicative of the efficacy of Oligo 1.

In a subsequent study, the 3.2 mg/kg continuous dose was expanded to 14 days of treatment. It is expected that the reduction in cellular viremia observed will continue over the period of treatment. In another study a 4.4 mg/kg subject dose level is being administered for 8 to 14 days. A similar reduction in cellular viremia is expected.

E. Quantitative Plasma Culture (Plasma Viremia) Assay

The quantitative plasma culture assay for HIV measured the amount of cell-free infectious HIV present in patient plasma and was a measure of plasma viremia. The assay was performed in duplicate in a 24-well tissue culture plate using five 5-fold dilutions of plasma after beginning with an undiluted sample in the first well. Each sample of patient plasma was cultured for 14 days with PHA-stimulated normal donor PBMC. Supernatant from each individual culture well was assayed for viral expression of HIV-1 p24 antigen by the standard p24 antigen EIA assay.

Plasma was collected on two occasions, within one month prior to the start of therapy. One determination was obtained within 14 days of starting therapy. Anticoagulated blood was sent at ambient temperature to the testing laboratory and the plasma separated within 4 to 6 hours from the time of the blood draw. Whole blood was collected in acid-citrate-dextrose (ACD) .

Plasma was separated from 2-10 ml anticoagulated blood by centrifugation at 400 to 800 x g for 20 minutes at 20 to 24°C. The separated plasma was removed and recentrifuged at 800 x g for an additional 20 minutes to completely remove platelets and cell debris. The plasma was then dispensed into 1.25 to 2.5 ml aliquots. One portion was assayed, and the remaining vials were frozen at -70°C or lower.

The stimulation medium for donor PBMC was RPMI 1640 with glutamine: 20% fetal bovine serum (heat-inactivated); PHA-P (5 μg/ml, Sigma, St. Louis, MO) ; IL-2; penicillin (100 units/ml)/ streptomycin (100 μg/ml), or gentamicin (50 μg/ml) . IL-2 was preferably a purified, delectinated human preparation. Cells were not frozen-thawed donor cells or pooled donor PBMC.

The maximum PBMC concentration in the stimulation culture was preferably 2 million PBMC/ml . The plasma culture medium was RPMI-1640 with glutamine: 20% fetal bovine serum (heat- inactivated); 5% natural, delectinated IL-2; 0.001% DEAE-Dextran; penicillin (100 units/ml) /streptomycin (100 μg/ml) . Five 5-fold serial dilutions were made per plasma sample. A minimum of 1040 μl of plasma is required (Tube A) . 960 μl of plasma culture medium was added to each of five 12 x 75 mm sterile tubes labeled B to F. 240 μL of the processed patient plasma was added to tube B and mixed thoroughly. 240 μl was then removed from tube B and added to tube C. This process was repeated for a total of five dilutions. The resulting dilution scheme was 1:5, 1:25, 1:625, and 1:3,125. One to three day old

PHA-stimulated donor PBMC were sedimented at 400 x g for 10 minutes at 20 to 24°C. The supernatant was removed and discarded, and the cells resuspended in plasma culture medium and enumerated. The sample was adjusted with plasma culture medium to a concentration of 1.25 x 10⁶ PBMC/ml.

For the testing of two patient specimens, 1.6 ml of PHA-stimulated normal donor cells (2 x 10⁶) was added to each well of a 24-well microculture plate. 400 μl of the undiluted plasma was dispensed in duplicate and each subsequent dilution was dispensed to consecutive wells or tubes. The initial starting dilution in the first set of wells was 1:5. The plate or tubes were incubated in a 5% C0₂, humidified chamber or covered with a 5 x 8 inch low-density polyethylene bag (Nalgene 6255-0508), and placed in a 5% C0₂, nonhumidified chamber. The samples are then incubated at 37°C.

On day 1, one-half of the medium (1 ml) was removed and replaced with 1 ml of fresh plasma culture medium. On day 7, one half of the medium (1 ml) was removed and replaced with 1 ml fresh plasma culture medium containing 5 x 10⁵, 1 to 3 day old, PHA-stimulated normal donor PBMC. Cultures were terminated on day 14, at which time 1.0 ml of medium was withdrawn and stored at -70°C for subsequent HIV p24 antigen testing.

A plasma culture well was scored positive if > 30 pg/ml of VQA standardized HIV p24 antigen is detected. The titer of plasma HIV was expressed as the reciprocal of the highest dilution giving a corrected HIV p24 antigen level that was > 30 pg/ml. The TCID₅₀ (highest dilution of patient plasma containing at least one infectious unit) was determined by the maximum likelihood applied to a simple product binomial model and was reported as infectious units per milliliter of plasma (IU/ml) . The Dataworks RLMP™ automatically calculated the TCID₅₀ in IU/ml. In general, this correlated with the highest dilution (lowest concentration) of patient plasma giving a positive result.

F. Quantitative PBMC Microculture (Cellular

Viremia) Assay

The quantitative PBMC microculture assay estimated the number of infectious units per 795 PC17US97/10143

million (IUPM) mononuclear cells in the peripheral blood. The greater the number of cells needed to produce a positive result, the lower the virus load in the PBMC. The assay, as described in detail below, was performed in duplicate in a 24- well tissue culture plate using six 5-fold dilutions, beginning with one million patient PBMC. Each sample of patient cells was cocultured with PHA-stimulated normal donor PBMC for 14 days. The supernatant from each individual well was assayed for viral expression of HIV-1 p24 antigen by the standard p24 antigen EIA assay.

The assay utilized heparinized, ACD or CPD anticoagulated peripheral blood (minimum volume of 10 ml in adults or children and 2 ml in infants) from which PBMC are isolated preferably by a Ficoll-Hypaque gradient. Blood was processed within 30 hours and PBMC that were not used in the assay are frozen in liquid nitrogen.

The donor and patient PBMC' s were processed as follows. Random buffy coats (40-60 ml of leukocyte-enriched whole blood in heparin ACD or CPD anticoagulant from an anti-HIV negative donor) were requisitioned from a blood bank for processing within 12 hours of collection. Patient specimens were collected in heparin, ACD, or CPD and processed within 30 hours of collection. To facilitate removal of the plasma from these whole blood samples, the samples were centrifuged at 400 x g for 10 minutes at 20-24°C, following which the plasma was aliquoted and frozen at -70°C or lower. To one part centrifuged blood, from which most of the plasma has been removed, was added one part diluent (saline or PBS) e.g., 8 ml diluent to 8 ml centrifuged blood. Four parts of diluted blood were layered over 4 parts lymphocyte separation solution (LSS) (e.g., 16 ml diluted blood over 12 ml LSS from Organon or Pharmacia) . Alternatively, the LSS was layered underneath the blood using a capillary pipette. This was centrifuged at 400 x g for 30 minutes at 20-24°C. The PBMC' s were removed and washed twice in two volumes of PBS or Hanks balanced salt solution (without Ca** or Mg**) , centrifuging at 400 x g for 10 minutes at 20-24°C to pellet the cells. The cells were enumerated and the sample adjusted with coculture medium (see below) to achieve a concentration of 2 million PBMC per ml. The manufacturer's lysis solution was added and the cells counted. For a manual hemacytometer counter, 90 μl of Turk's Solution (2% glacial acetic acid plus Crystal Violet Stain) was added to a small tube, followed by 10 μl of the PBMC suspension. The hemacytometer was loaded with the treated cells and the cell suspension counted as usual. The patient PBMC's were cocultured within 8 hours of processing the whole blood.

The stimulation medium for donor PBMC was RPMI 1640 with glutamine: 20% fetal bovine serum (heat-inactivated); PHA-P (5 μg/ml, Sigma, St. Louis, MO) ; 3% IL-2; penicillin (100 units/ml)/ streptomycin (100 μg/ml) or gentamicin (50 μg/ml) . IL-2 was preferably a purified, delectinated human preparation. Frozen-thawed donor cells or pooled donor PBMC were not used. The maximum PBMC concentration in stimulation culture was 2 million PBMC/ml.

The coculture medium for HIV isolation was RPMI-1640 with glutamine: 20% fetal bovine serum (heat-inactivated); 5% IL-2; penicillin/ streptomycin or gentamicin. Five 5-fold serial dilutions per patient PBMC sample were prepared in sterile 15-ml conical centrifuge tubes starting at a concentration of 1.0 x 10⁶ cells/ml, i.e. (tube A) . A minimum of 2.7 x 10⁶ patient PBMC's (in 2.7 ml were required. If fewer than 2.7 x 10⁶ but > 2 x 10⁶ PBMC were recovered from a sample, tube A was adjusted to contain 2.0 x 10^ε PBMC in 2.0 ml of coculture medium. Because of this level of recovery of PBMC, the first well was tested in singleton (see below) . If fewer than 2 x 10⁶ PBMC was isolated, the total number of cells were diluted in 3.0 ml of coculture medium and diluted 5-fold dilutions. Instead of defaulting to 1 x 10^€ in the RLMP Dataworks software field "# Cells 1:1 Dil", the new estimated concentration per ml (total number of PBMC recovered divided by 3) was entered. 2.4 ml of coculture medium was added to each of five sterile tubes labeled B to F. 0.6 ml from tube A was added to the first tube containing medium (tube B) and mixed thoroughly. 0.6 ml was then removed from tube B and added to tube C. Four additional dilutions were made. The resulting dilution scheme was 1:1, 1:5, 1:25, 1:125, 1:625, and 1:3125, and results in 1,000,000, 200,000, 40,000, 8,000, 1600 and 320 patient PBMC per ml . Cells were usually tested in duplicate. One to three day old PHA-stimulated donor cells were sedimented at 400 x g for 10 minutes at 20 to 24°C, resuspended in coculture medium, and enumerated prior to their addition to the microculture wells. The samples were then be adjusted to a concentration of 1.0 x 10⁶ PBMC/ml with coculture medium. Donor PBMC's were cultured separately to verify absence of HIV infectivity. One ml of PHA-stimulated normal PBMC (1.0 x 10⁶) and 1 ml of patient PBMC from tubes A to F were added, in duplicate, to consecutive wells of a 24- well microculture plate. Two patient specimens were assayed per plate. Should tube A contain only 1.4 ml of resuspended PBMC, because of insufficient recovery of cells, the first set of wells included only a single sample of 1 x 10⁶ PBMC. All subsequent dilutions were done in duplicate. The plate was placed into a 5% C0₂, humidified chamber or covered with a 5 x 8 inch low-density polyethylene bag (Nalgene 6255-0508) , placed in a 5% C0₂, nonhumidified chamber, and incubated at 37°C. On day 7, one half of the medium (1.0 ml) was removed from each well and replaced with 1.0 ml of fresh coculture medium containing 5.0 x 10⁵ 1 to 3 day old PHA-stimulated normal PBMC. Microcultures were terminated on day 14 unless ministocks are to be prepared. Supernatant fractions from day 14 were saved, and fresh or frozen (-30°C or lower) medium was tested for HIV p24 antigen.

A microculture well was scored positive if > 30 pg/ml HIV p24 antigen was present (as determined by the VQA standardized HIV p24 EIA procedure) . The titer (number of IUPM) was determined by the maximum likelihood applied to a simple product binomial model. The Dataworks RLMP™ software automatically calculates the IUPM. In general, this correlated with the lowest concentration of patient cells giving a positive result.

EQUIVALENTS

Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific substances and procedures described herein. Such equivalents are considered to be within the scope of this invention, and are covered by the following claims.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: Hybridon, Inc.

(ii) TITLE OF INVENTION: COMPOSITIONS AND METHODS FOR TREATING SPECIFIC GENE EXPRESSION-RELATED DISEASES AND DISORDERS IN HUMANS

(iii) NUMBER OF SEQUENCES: 11

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Hale and Dorr LLP

(B) STREET: 60 State Street

(C) CITY: Boston

(D) STATE: Massachusetts

(E) COUNTRY: USA

(F) ZIP: 02109

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

( D ) SOFTWARE : Patentln Release #1.0, Version #1.25

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(C) CLASSIFICATION:

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Kerner, Ann-Louise

(B) REGISTRATION NUMBER: 33,523

(C) REFERENCE/DOCKET NUMBER:

HYZ-049CP2PCT

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 617-526-6000

(B) TELEFAX: 617-526-5000

(2) INFORMATION FOR SEQ ID NO:l:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(ix) FEATURE

(B) LOCATION: complementary to bp324-348 of HIV-1 DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:

CTCTCGCACC CATCTCTCTC CTTCT 25

(2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 26 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(ix) FEATURE:

(B) LOCATION: complementary to bp 323-348 of HIV-1 DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

CTCTCGCACC CATCTCTCTC CTTCTA 26

(2) INFORMATION FOR SEQ ID NO:3 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 26 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (ix) FEATURE:

(B) LOCATION: complementary to bp 324-349 of HIV-1 DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3 :

GCTCTCGCAC CCATCTCTCT CCTTCT 26

(2) INFORMATION FOR SEQ ID NO:4 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 27 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(ix) FEATURE:

(B) LOCATION: complementary to bp 323-349 of HIV-1 DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

GCTCTCGCAC CCATCTCTCT CCTTCTA 27

(2) INFORMATION FOR SEQ ID NO:5 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 28 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(ix) FEATURE:

(B) LOCATION: complementary to bp 322-349 of HIV-1 DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: GCTCTCGCAC CCATCTCTCT CCTTCTAG 28

(2) INFORMATION FOR SEQ ID NO:6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 28 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(ix) FEATURE:

(B) LOCATION: complementary to bp 323-350 of HIV-1 DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:

CGCTCTCGCA CCCATCTCTC TCCTTCTA 28

(2) INFORMATION FOR SEQ ID NO:7 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 29 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(ix) FEATURE:

(B) LOCATION: complementary to bp 322-350 of HIV-1 DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7 :

CGCTCTCGCA CCCATCTCTC TCCTTCTAG 29

(2) INFORMATION FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 30 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: 1inear

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(ix) FEATURE:

(B) LOCATION: complementary to bp 321-350 of HIV-1 DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:

CGCTCTCGCA CCCATCTCTC TCCTTCTAGC 30

(2) INFORMATION FOR SEQ ID NO:9 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 30 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(ix) FEATURE:

(B) LOCATION: complementary to bp 322-351 of HIV-1 DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9 :

ACGCTCTCGC ACCCATCTCT CTCCTTCTAG 30

(2) INFORMATION FOR SEQ ID NO:10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(ix) FEATURE:

(B) LOCATION: complementary to bp 327-346 Of HIV-1 DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:

CTCGCACCCA TCTCTCTCCT 20

(2) INFORMATION FOR SEQ ID NO:11:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 70 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA to genomic RNA (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE: HIV-1

(viii) POSITION IN GENOME: 311-380

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: ACTAGCGGAG GCTAGAAGGA GAGAGATGGG TGCGAGAGCG 40 TCAGTATTAA GCGGGGGAGA ATTAGATCGA 70

Claims

What is claimed is :

1. A therapeutic composition for treating humans suffering from a disease or disorder caused by expression of an aberrant exogenous gene or an aberrant endogenous gene comprising an oligonucleotide capable of specifically down- regulating expression of the aberrant gene.

2. The therapeutic composition of claim 1 wherein the exogenous gene is selected from the group consisting of: a cytomegalovirus gene, a hepatitis C gene, a hepatitis B gene, a respiratory syncytial virus gene, a herpesvirus gene, an influenza virus gene, an Epstein-Barr virus gene, and an HIV type 1 or type 2 virus gene.

3. The therapeutic composition of claim 1 wherein the aberrant endogenous gene is selected from the group consisting of: genes encoding VEGF, DNA methyltransferase, prion protein, globin, ApoE4 protein, BCL-2 protein, CAPL protein, p-glycoprotein, protein kinase A, beta amyloid, c-MYC protein, monoamine oxidase, catechol O- methyl transferase, indole N-methyl transferase, arachidonic acid cascade enzymes, thromboxane A2, fattyacryl co-enzyme A, cholesterol acyl transferase, and cholinephosphotransferase.

4. A method of treating a human suffering from a disease or disorder caused by expression of an aberrant exogenous gene or an aberrant endogenous gene, comprising the step of administering to the human a therapeutic composition comprising an oligonucleotide capable of specifically down- regulating the expression of the aberrant gene.

5. The method of claim 4 wherein the exogenous gene is selected from the group consisting of: a cytomegalovirus gene, a hepatitis C gene, a hepatitis B gene, a respiratory syncytial virus gene, a herpesvirus gene, an influenza virus gene, an Epstein-Barr virus gene, and an HIV type 1 or type 2 virus gene.

6. The method of claim 4 wherein the aberrant endogenous gene is selected from the group consisting of genes encoding: VEGF, DNA methyltransferase, prion protein, globin, ApoE4 protein, BCL-2 protein, CAPL protein, p-glycoprotein, protein kinase A, beta amyloid, c-MYC protein, monoamine oxidase, catechol O- methyl transferase, indole N-methyl transferase, arachidonic acid cascade enzymes, thromboxane A2, fattyacryl co-enzyme A:cholesterol acyl transferase, and cholinephosphotransferase.

7. The method of claim 4 wherein the oligonucleotide is complementary to at least a portion of the aberrant genomic region, gene, or RNA transcript thereof.

8. A method of treating a human suffering from a disease or disorder caused by the expression of an aberrant exogenous gene or an aberrant endogenous gene, comprising the step of systemically administering to the human a therapeutic composition comprising an oligonucleotide capable of specifically down-regulating the expression of the aberrant gene.

9. The method of claim 8 wherein the exogenous gene is selected from the group consisting of: a cytomegalovirus gene, a hepatitis C gene, a hepatitis B gene, a respiratory syncytial virus gene, a herpesvirus gene, an influenza virus gene, an Epstein-Barr virus gene, and an HIV type 1 or type 2 virus gene.

10. The method of claim 8 wherein the aberrant endogenous gene is selected from the group consisting of genes encoding: VEGF, DNA methyltransferase, prion protein, globin, ApoE4 protein, BCL-2 protein, CAPL protein, p-glycoprotein, protein kinase A, beta amyloid, c-MYC protein, monoamine oxidase, catechol O- methyl transferase, indole N-methyl transferase, arachidonic acid cascade enzymes, thromboxane A2, fattyacryl co-enzyme A, cholesterol acyl transferase, and cholinephosphotransferase.

11. A therapeutic composition for systemically treating humans suffering from a disease or disorder caused by expression of an aberrant exogenous gene or an aberrant endogenous gene comprising an oligonucleotide capable of specifically down-regulating expression of the aberrant gene.

12. A method of treating a human suffering from a disease or disorder caused by an aberrant exogenous gene or an aberrant endogenous gene, comprising the step of administering to the human a therapeutic composition comprising oligonucleotide capable of specifically down- regulating the expression of the aberrant gene wherein the concentration of oligonucleotide at the site of aberrant gene expression is about 0.01 μM to about 10 μM.

13. The method of claim 12 wherein the exogenous gene is selected from the group consisting of: a cytomegalovirus gene, a hepatitis C gene, a hepatitis B gene, a respiratory syncytial virus gene, a herpesvirus gene, an influenza virus gene, an Epstein-Barr virus gene, and an HIV type 1 or type 2 virus gene.

14. The method of claim 12 wherein the aberrant endogenous gene is selected from the group consisting of genes encoding: VEGF, DNA methyltransferase, prion protein, globin, ApoE4 protein, BCL-2 protein, CAPL protein, p-glycoprotein, protein kinase/A, beta amyloid, c-MYC protein, monoamine oxidase, catechol 0- methyl transferase, indole N-methyl transferase, arachidonic acid cascade enzymes, thromboxane A2, fattyacryl co-enzyme A, cholesterol acyl transferase, and cholinephosphotransferase.

15. The therapeutic composition of claim 1 wherein the aberrant exogenous gene is an HIV-1 gene.

16. The therapeutic composition of claim 15 wherein the aberrant exogenous gene is gag .

17. The therapeutic composition of claim 16 comprising:

(a) 25-75 mg oligonucleotide 1 having SEQ ID NO: 1; and

(b) 20-75 mg lactose.

18. The therapeutic composition of claim 17 comprising:

(a) about 50 mg oligonucleotide 1 having SEQ ID NO:l; and

(b) about 40 mg lactose.

19. A method of treating HIV-1 infection in a human subject comprising the steps of:

(a) providing a therapeutic formulation comprising an oligonucleotide in a physiologically acceptable carrier, the oligonucleotide having a nucleotide sequence complementary to nucleotides 324 to 348 of a conserved gag region of the HIV-1 genome, and having at least one non- phosphodiester, internucleotide linkage, the linkage rendering the oligonucleotide resistant to nuclease digestion; and

(b) administering to the subject the therapeutic formulation in a therapeutically effective amount and via a therapeutically effective manner.

20. The method of claim 19 wherein from 0.1 to 10 mg oligonucleotide per kg subject is administered.

21. The method of claim 19 wherein the therapeutic formulation is administered by continuous intravenous infusion.

22. The method of claim 20 wherein from 0.1 to 10 mg oligonucleotide per kg subject is administered.

23. The method of claim 22 wherein from 1.0 to 4.4 mg oligonucleotide per kg subject is administered.

24. The method of claim 23 wherein from 3.2 to 4.0 mg oligonucleotide per kg subject is administered.

25. The method of claim 22 wherein the oligonucleotide consists essentially of SEQ ID N0:1.

26. The method of claim 19 wherein the therapeutic formulation is administered in a dose which results in a concentration of oligonucleotide at a site of HIV infection of about 0.01 uM to about 10 uM.

27. The method of claim 19 wherein the providing step comprises providing an oligonucleotide having 25 nucleotides.

28. The method of claim 19 wherein the providing step comprises providing a modified oligonucleotide.

29. The method of claim 28 wherein the providing step comprises providing a modified oligonucleotide having at least one phosphorothioate linkage.

30. The method of claim 29 wherein the providing step comprises providing a modified oligonucleotide having phosphorothioate internucleotide linkages.

31. The method of claim 30 wherein the providing step comprising providing a modified oligonucleotide having at least one 2-0-alkyl ribonucleotide.

32. The method of claim 31 wherein the providing step comprises providing an inverted hybrid oligonucleotide.

33. The method of claim 19 wherein the oligonucleotide has a nucleic acid sequence set forth in the Sequence Listing as SEQ ID NO:l.

34. The method of claim 19 wherein the providing step comprises providing an oligonucleotide having

25 nucleotides linked by at least one phosphorothioate linkage, the sequence of the oligonucleotide being set forth in the Sequence Listing as SEQ ID NO:l.

35. The method of claim 19 wherein the therapeutic formulation is administered via injection, sublingual administration, rectal administration, intradermal administration, oral administration, or enteral administration.

36. The method of claim 35 wherein the therapeutic formulation is administered via intravenous, intramuscular, subcutaneous, intraperitoneal, or intraocular injection.

37. The method of claim 36 wherein the therapeutic formulation is administered in a bolus, intermittent, or continuous dose.

38. The method of claim 19 wherein the providing step further comprises providing a first anti-HIV- 1 antisense oligonucleotide and a second anti-HIV- 1 antisense oligonucleotide, the first oligonucleotide having SEQ ID N0:1, and the administering step further comprising administering the second oligonucleotide to the human.

39. A therapeutic composition for treating humans suffering from a disease or disorder caused by expression of an aberrant exogenous gene or an aberrant endogenous gene comprising an oligonucleotide capable of specifically down- regulating expression of the aberrant gene, wherein the concentration of oligonucleotide at the site of aberrant gene expression is about 0.01 μM to about 10 μM.