WO1997045423A1 - Pharmaceutical for treating of neurological and neuropsychiatric disorders - Google Patents

Pharmaceutical for treating of neurological and neuropsychiatric disorders Download PDF

Info

Publication number
WO1997045423A1
WO1997045423A1 PCT/US1997/009346 US9709346W WO9745423A1 WO 1997045423 A1 WO1997045423 A1 WO 1997045423A1 US 9709346 W US9709346 W US 9709346W WO 9745423 A1 WO9745423 A1 WO 9745423A1
Authority
WO
WIPO (PCT)
Prior art keywords
compound
ring
substituted
alkyl
nitrogen
Prior art date
Application number
PCT/US1997/009346
Other languages
French (fr)
Inventor
Vassil Iliya Ognayanov
Laurence Borden
Stanley Charles Bell
Jing Zhang
Original Assignee
Trophix Neuroscience Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Trophix Neuroscience Inc. filed Critical Trophix Neuroscience Inc.
Priority to JP54300197A priority Critical patent/JP4403212B2/en
Priority to EP97926837A priority patent/EP0918767A4/en
Priority to AU31510/97A priority patent/AU737095B2/en
Priority to CA002255727A priority patent/CA2255727A1/en
Publication of WO1997045423A1 publication Critical patent/WO1997045423A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D405/00Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/02Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings
    • C07D405/04Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • A61P21/02Muscle relaxants, e.g. for tetanus or cramps
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/04Centrally acting analgesics, e.g. opioids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/08Antiepileptics; Anticonvulsants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/18Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/24Antidepressants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/18Antivirals for RNA viruses for HIV
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D207/00Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D207/02Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D207/04Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D207/06Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with radicals, containing only hydrogen and carbon atoms, attached to ring carbon atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D211/00Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/04Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D211/06Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D211/08Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms
    • C07D211/10Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with radicals containing only carbon and hydrogen atoms attached to ring carbon atoms
    • C07D211/14Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with radicals containing only carbon and hydrogen atoms attached to ring carbon atoms with hydrocarbon or substituted hydrocarbon radicals attached to the ring nitrogen atom
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D211/00Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/04Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D211/06Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D211/08Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms
    • C07D211/18Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with substituted hydrocarbon radicals attached to ring carbon atoms
    • C07D211/20Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with substituted hydrocarbon radicals attached to ring carbon atoms with hydrocarbon radicals, substituted by singly bound oxygen or sulphur atoms
    • C07D211/22Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with substituted hydrocarbon radicals attached to ring carbon atoms with hydrocarbon radicals, substituted by singly bound oxygen or sulphur atoms by oxygen atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D211/00Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/04Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D211/06Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D211/36Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D211/40Oxygen atoms
    • C07D211/42Oxygen atoms attached in position 3 or 5
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D211/00Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/04Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D211/68Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having one double bond between ring members or between a ring member and a non-ring member
    • C07D211/70Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having one double bond between ring members or between a ring member and a non-ring member with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to ring carbon atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D491/00Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00
    • C07D491/02Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00 in which the condensed system contains two hetero rings
    • C07D491/04Ortho-condensed systems

Definitions

  • the present invention relates to a class of substituted cyclic amines, pharmaceutical compositions and methods of treating neurological and neuropsychiatric disorders
  • Synaptic transmission is a complex form of intercellular communication that involves a considerable array of specialized structures in both the pre- and post-synaptic neuron
  • High- affinity neurotransmitter transporters are one such component, located on the pre-synaptic terminal and surrounding glial cells (Kanner and Schuldiner, CRC Critical Reviews in Biochemistry, 22, 1032 (1987))
  • Transporters sequester neurotransmitter from the synapse, thereby regulating the concentration of neurotransmitter in the synapse, as well as its duration therein, which together influence the magnitude of synaptic transmission Further, by preventing the spread of transmitter to neighboring synapses, transporters maintain the fidelity of synaptic transmission Last, by sequestering released transmitter into the presynaptic terminal, transporters allow for transmitter
  • Neurotransmitter transport is dependent on extracellular sodium and the voltage difference across the membrane, under conditions of intense neuronal firing, as, for example, during a seizure, transporters can function in reverse, releasing neurotransmitter in a calcium- independent non-exocytotic manner (Attwell et al , Neuron. H, 401-407 (1993))
  • Pharmacologic modulation of neurotransmitter transporters thus provides a means for modifying synaptic activity, which provides useful therapy for the treatment of neurological and psychiatric disturbances
  • the ammo acid glycine is a major neurotransmitter in the mammalian central nervous system, functioning at both inhibitory and excitatory synapses By nervous system, both the central and peripheral portions of the nervous system are intended
  • These distinct functions of glycine are mediated by two different types of receptor, each of which is associated with a different class of glycine transporter
  • the inhibitory actions of glycine are mediated by glycine receptors that are sensitive to the convulsant alkaloid strychnine, and are thus referred to as "strychnine-sensitive"
  • Such receptors contain an intrinsic chloride channel that is opened upon binding of glycine to the receptor, by increasing chloride conductance, the threshold for firing of an action potential is increased
  • Strychnine-sensitive glycine receptors are found predominantly in the spinal cord and brainstem, and pharmacological agents that enhance the activation of such receptors will thus increase inhibitory neurotransmission in these regions
  • Glycine functions in excitatory transmission by modulating the actions of giutamate, the major excitatory neurotransmitter in the central nervous system See Johnson and Ascher,
  • NMDA N-methyl-D-aspartate
  • GlyT-1 is found predominantly in the forebrain, and its distribution corresponds to that of glutamatergic pathways and NMDA receptors (Smith, et al., Neuron. ⁇ , 927-935 (1992)).
  • GlyT-1a is found predominantly in the forebrain, and its distribution corresponds to that of glutamatergic pathways and NMDA receptors (Smith, et al., Neuron. ⁇ , 927-935 (1992)).
  • GlyT-1a is three variants of GlyT-1, termed GlyT-1a, GlyT-1b and GlyT-1c (Kim, et al., Molecular Pharmacology. 45, 608-617 (1994)), each of which displays a unique distribution in the brain and peripheral tissues.
  • GlyT-2 in contrast, is found predominantly in the brain stem and spinal cord, and its distribution corresponds closely to that of strychnine-sensitive glycine receptors (Liu et al., 1 Biological Chemistry. 268. 22802-22808 (1993); Jursky and Nelson, J. Neurochemistrv. 64, 1026-
  • GlyT-2 can be used to diminish the activity of neurons having strychnine-sensitive glycine receptors via increasing synaptic levels of glycine, thus diminishing the transmission of pain-related (i.e., nociceptive) information in the spinal cord, which has been shown to be mediated by these receptors.
  • pain-related i.e., nociceptive
  • enhancing inhibitory glycinergic transmission through strychnine-sensitive glycine receptors in the spinal cord can be used to decrease muscle hyperactivity, which is useful in treating diseases or conditions associated with increased muscle contraction, such as spasticity, myoclonus, and epilepsy (Truong et al., Movement Disorders. 3, 77-87 (1988); Becker, FASEB J.. 4, 2767-2774 (1990)).
  • Spasticity that can be treated via modulation of glycine receptors is associated with epilepsy, stroke, head trauma, multiple sclerosis, spinal cord injury, dystonia, and other conditions of illness and injury of the nervous system.
  • NMDA receptors are critically involved in memory and learning (Rison and Stanton, Neurosci. Biob ⁇ hav. Rev.. 19_, 533-552 (1995); Danysz et al., Behavioral Pharmacol.. ⁇ , 455-474 (1995)); and, furthermore, decreased function of NMDA-mediated neurotransmission appears to underhe, or contribute to, the symptoms of schizophrenia (Olney and Farber, Archives General Psychiatry.
  • agents that inhibit GlyT-1 and thereby increase glycine activation of NMDA receptors can be used as novel antipsychotics and anti-dementia agents, and to treat other diseases in which cognitive processes are impaired, such as attention deficit disorders and organic brain syndromes
  • over-activation of NMDA receptors has been implicated in a number of disease states, in particular the neuronal death associated with stroke and possibly neurodegenerative diseases, such as Alzheimer's disease, multi-infarct dementia, AIDS dementia, Huntington's disease, Parkinson's disease, amyotrophtc lateral sclerosis or other conditions in which neuronal cell death occurs, such as stroke or head trauma Coyle & Puttfarcken, Science. 2S2, 689-695 (1993), Lipton and Rosenberg, New Enol J of Medicine. 330.
  • the present invention provides a class of compounds that inhibit glycine transport via the GlyT-1 or GlyT-2 transporters, are precursors, such as pro-drugs, to compounds that inhibit such transport, or are synthetic intermediates for preparing compounds that inhibit such transport
  • the invention provides a class of compounds formulas
  • the present invention provides compound of one of the following formulas I and II
  • R 2 is hydrogen, (C1-C6) alkyl, (C1-C6) alkoxy, cyano, (C2-C7) alkanoyl, aminocarbonyl, (C1-C6) alkylaminocarbonyl or dialkylaminocarbonyl wherein each alkyl is independently C1 to C6, (b) comprises (where R 1 is not -0-R 8 or -S-R 8" ) hydroxy, fluoro, chloro, bromo or (C2-C7) alkanoyloxy, (c) forms a double bond with an adjacent carbon or nitrogen from one of either R 1 , R xb or R yb , (d) is oxygen forming an oxa linkage with R 1 or integrated into ring E (see, for example, Compound C6) or (e) is R 2a linked by R 26 to X, (2') R x is a ring-containing structure R x
  • R xa , R ya and R 2a are independently aryl, heteroaryl, adamantyl or a 5 to 7-membered non-aromatic ring having from 0 to 2 heteroatoms selected from the group consisting of oxygen, sulfur and nitrogen, wherein
  • aryl is phenyl or naphthyl
  • heteroaryl comprises a five-membered ring, a six-membered ring, a six- membered ring fused to a five-membered ring, a five-membered ring fused to a six-membered ring, or a six-membered ring fused to a six-membered ring, wherein the heteroaryl is aromatic and contains heteroatoms selected from the group consisting of oxygen, sulfur and nitrogen, with the remaining ring atoms being carbon,
  • each of R xa , R ya and R 2a can be independently substituted with one of R q , R r O- or R S S-, wherein Rq, Rr and Rs are independently aryl, heteroaryl, adamantyl or a 5 to 7-membered non-aromatic ring as these structures are defined for R xa , and
  • R xa , R ya , R 2a , R q , R r and R s can be additionally substituted with substituents selected from the group consisting of fluoro, chloro, bromo, nitro, hydroxy, cyano, tnfluoromethyl, amidosulfonyl which can have up to two independent
  • ring D is a 3 to 8-membered ring, a 3 to 8-membered ring substituted with a 3 to 6-membered spiro ring, or a 3 to 8-membered ring fused with a 5 to 6-membered ring, wherein the fused ring lacking the illustrated tertiary nitrogen can be aromatic or heteroaromatic, wherein for each component ring of ring D there are up to two heteroatoms selected from oxygen, sulfur or nitrogen, including the illustrated nitrogen, and the rest carbon, with the proviso that the ring atoms include no quaternary nitrogens, with the proviso that, in saturated rings, ring nitrogen atoms are separated from other ring heteroatoms by at least two intervening carbon atoms wherein the carbon and nitrogen ring atoms of ring D can be substituted with substituents selected from (C1-C6) alkyl, (C2-C6) alkenylene, cyano, nitro, t ⁇ fluoromethyl, (C1-
  • ring E is a 3 to 8-membered ring, a 3 to 8-membered ring substituted with a 3 to 6-membered spiro ring, or a 3 to 8-membered ring fused with a 5 to 6-membered ring, wherein the fused ring lacking the illustrated tertiary nitrogen can be aromatic or heteroaromatic, wherein for each component ring of ring E there are up to two heteroatoms selected from oxygen, sulfur or nitrogen, including the illustrated nitrogen, and the rest carbon, with the proviso that the ring atoms include no quaternary nitrogens, with the proviso that, in saturated rings, ⁇ ng nitrogen atoms are separated from other ring heteroatoms by at least two intervening carbon atoms wherein the carbon and nitrogen ring atoms of ring E can be substituted with substituents selected from (C1-C6) alkyl, (C2-C6) alkenylene, cyano, nitro, t ⁇ fiuoro
  • R 4 and R 4' are independently hydrogen or (C1-C6) alkyl, or one of R 4 and R 4" can be (C1-C6) hydroxyalkyl, and
  • R5 is (CO)NR 13 R 14 , (CO)OR 15 , (CO)SR 16 , (S0 2 )NR 17 R 18 , (PO)(OR 19 )(OR 20 ), (CR 22 )(OR 23 )(OR 24 ), CN or tetrazol-5-yl, wherein R 13 , R 14 , R 15 , R 16 , R 17 , R 18 , R 19 and R 20 are independently hydrogen, (C1-C8) alkyl which can include a (C3-C8) cycloalkyl, wherein the carbon linked to the oxygen of R15 or the sulfur of R16 has no more than secondary branching and , (C2-C6) hydroxyalkyl, aminoalkyl where the alkyl is C2 to C6 and the ammo can be substituted with up to two independent (C1-C6) alkyls, arylalkyl wherein the alkyl is C1-C6, heteroarylalkyl wherein the alkyl is C1 to
  • R xa , R ya and R 2a is substituted with fluoro, trifluoromethyl, tnfluoromethoxy, nitro, cyano, or (C3-C8) alkyl
  • at least one of R xa , R ya and R 2a is substituted with R q , R r O-, or R S S-.
  • an aryl or heteroaryl of at least one of R xa , R ya and R 2a is phenyl.
  • R yb is oxa, methyleneoxy, thia, methylenethia.
  • R yb is oxa or thia.
  • R 5 is (CO)NR 13 R 14 , (CO)OR 15 or (CO)SR 16
  • R 15 is (C2-C6) alkyl, (C2-C4) hydroxyalkyl, phenyl, phenylalkyl wherein the alkyl is C1-C3, or aminoalkyl where the alkyl is C2-C6 and the ammo can be substituted with up to two independent (C1-C3) alkyls, wherein the phenyl or the phenyl of phenylalkyl can be substituted.
  • n is zero.
  • R 15 is hydrogen.
  • R 4 is hydrogen, methyl or hydroxymethyl and R 4" is hydrogen.
  • R xa , R ya and R 2a is a heteroaryl comprising diazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, thiolyl, diazmyl, t ⁇ azinyl, benzoazolyl, benzodiazolyl, benzothiazolyl, benzoxazolyl, benzoxolyl, benzothiolyl, quinolyl, isoquinolyl, benzodiazinyl, benzotriazmyl, py ⁇ dyl, thienyl, furanyl, pyrrolyl, indolyl, isoindoyl or py ⁇ midyl.
  • R 1 is -O-R 8 or -S-R 8"
  • the second bridge between two of R xa , R ya and R 2a is L, and satisfies the following formula:
  • the alkylenedioxy substitution of R xa , R ya or R 2a is as follows:
  • ring D is according to one of formulas A' and B':
  • the ring system comprising G * is according to one of formulas C and D'
  • ring D or ring E is substituted with up to three substituents.
  • R xa and R ya together can be substituted with up to six substituents
  • R 2a , R q , R r and R s can each be substituted with up to 3 substituents, and wherein the presence of each of R q , R r or R s is considered a substitution to the respective ring structure of R xa , R ya and R 2a
  • the aryl, heteroaryl, aryl of arylalkyl or the heteroaryl of heteroarylalkyl of R 13 , R 14 , R 15 , R 16 R 17 , R 18 R 19 or R 20 is substituted with up to three substituents
  • the compound is an optically pure enantiomer
  • the compound is an optically pure enantiomer (i e , at least about 80% ee, preferably at least about 90% ee, more preferably at least about 95% ee)
  • the invention provides a pharmaceutical composition comprising the compound and a pharmaceutically acceptable excipient
  • the compound of the invention is present in an effective amount for (1) treating or preventing schizophrenia, (2) enhancing treating or preventing dementia, (3) treating or preventing epilepsy, (4) treating or preventing spasticity, (5) treating or preventing muscle spasm, (6) treating or preventing pain, (7) preventing neural cell death after stroke, (8) preventing neural cell death in an animal suffering from a neurodegenerative disease, (9) treating or preventing mood disorders such as depression, (10) enhancing memory or learning, or (11) treating or preventing learning disorders
  • the invention further provides a method (1) of treating or preventing schizophrenia comprising administering a schizophrenia treating or preventing effective amount of a compound, (2) of treating or preventing dementia comprising administering a dementia treating or preventing effective amount of a compound, (3) of treating or preventing epilepsy comprising administering an epilepsy treating or preventing effective amount of a compound, (4) of treating or preventing spasticity comprising administering a spasti
  • the invention also provides a method of synthesizing a compound of the invention comprising reductively alkylating R d NH 2 with a compound of the formula
  • R c and R are independently the same as defined for R x
  • R r has the same definition as R 1 except that it does not include a nitrogen, oxygen or sulfur, and does not include any double bonds conjugated with the above-illustrated carbonyl
  • the invention also provides a method of synthesizing a compound of the invention comprising reacting R f OH or R r SH with a compound of the formula
  • the method further comprises synthesizing the compound of formula
  • the method comprises reacting a compound of formula
  • the invention also provides a method of synthesizing a compound of the invention comprising reacting R e M with a compound of the formula
  • R e is independently the same as defined for R x , wherein M is a metal-containing substituent such that R e M is a organometallic reagent
  • the invention also provides a method of synthesizing a compound of the invention comprising dehydrating a compound of the formula
  • C * (the tertiary carbon marked with an adjacent " * ") has a double bond with an adjacent carbon
  • R 27 and R 27" have the same definition as R 1 except that R 27 and R 27" do not include a nitrogen, oxygen or sulfur
  • the invention also provides a method of synthesizing a compound of the invention comprising reducing a compound of the formula
  • the invention also provides a method of synthesizing a compound of the invention comprising reducing a compound of one of the following formulas
  • ring C" or ring C ⁇ x can include a fused phenyl and can be substituted as follows the carbon and nitrogen ring atoms of ring C" or ring C' x can be substituted with up to two substituents selected from (C1-C6) alkyl, (C2-C6) alkenylene, cyano, nitro, trifluoromethyl, and (C2-C7) alkyloxycarbonyl, and wherein I is a negative counter-ion
  • the compound reduced is that containing ring C"
  • the invention also provides a compound according to the following formula
  • the invention also provides a method of synthesizing this compound comprising reacting a compound of the formula
  • L is a nucleophilic substitution leaving group and wherein ring C can be fused with phenyl or substituted, the same as defined for ring C"
  • the invention also provides a compound of the invention according to the following formula
  • ring C ⁇ x can be fused with phenyl or substituted, the same as defined for ring C", and is mono or di-unsaturated at one or more of the bonds indicated with the dased lines with the double bonds formed between ring carbons and no two double bonds are adjacent
  • the invention also provides a compound of the following formula
  • the invention also provides a method of synthesizing this compound comprising reacting a compound of the formula
  • the invention also provides a compound of the following formula
  • the invention also provides a method of synthesizing this compound, the method comprising reducing a compound of the following formula
  • the invention also provides a method of synthesizing a compound that can be used to synthesize the compound of the invention, the method comprising synthesizing a compound of formula
  • the invention also provides a method of synthesizing of a compound of the invention, the method comprising reacting a compound of formula
  • Ar is aryl which is substituted with an electron-withdrawing group or heteroaryl and is substituted with an electron-withdrawing group, and wherein Q is halide (preferably fluoro or chloro), to form
  • the invention also provides a method of synthesizing a compound that can be used to synthesize the compound of the invention, the method comprising synthesizing a compound of formula X
  • the method further comprises converting the compound of formula X to
  • the invention also provides a method of synthesizing a compound that can be used to synthesize the compound of the invention, the method comprising reacting a compound of formula
  • the invention also provides a method of synthesizing a compound that can be used to synthesize the compound of the invention, the method comprising synthesizing the compound of formula:
  • said synthesis comprising reducing the ketone of a compound of formula
  • the invention also provides a compound of the following formula
  • the invention also provides a method of synthesizing this compound, comprising reacting a compound of the formula
  • the invention also provides a compound of the following formula
  • ring C x can be fused with phenyl or substituted, the same as defined for ring C"
  • Excipients are pharmaceutically acceptable organic or inorganic carrier substances suitable for parenterai, enteral (e g , oral or inhalation) or topical application that do not deletereiously react with the active compositions
  • Suitable pharmaceutically acceptable carriers include but are not limited to water, salt solutions, alcohols, gum arable, benzyl alcohols, gelatine, carbohydrates such as lactose, amylose or starch, magnesium stearate, talc, silicic acid, hydroxymethylcellulose, polyvmylpyrrolidone, and the like
  • Neuronal cell death is "prevented” if there is a reduction in the amount of cell death that would have been expected to have occurred but for the administration of a compound of the invention
  • L 1 and L 2 are good nucleophilic substitution leaving groups such as a halide, especially a bromide, a tosylate, a brosylate (p-bromobenzenesulfonate), and the like.
  • the reaction is preferably conducted in the presence of a base such as potassium carbonate or a tertiary amine such as diisopropylethylamine.
  • the leaving group is a halide
  • the reaction can be conducted in the presence of an iodide salt such as potassium iodide.
  • Suitable organic solvents include, for example, methanol, dioxane, acetonitrile or dimethyformamide.
  • the reaction is favorably conducted at a temperature range of about 15 * C to about 40°C. Avoiding more elevated temperatures helps avoid producing the quaternary ammonium salt resulting from bis-alkylation.
  • Cmpound I 1 can be reduced further, for instance in a Reaction 5 that produces
  • a further Reaction 6 can be used to fully reduce ring C v
  • the bond between R 1 and the ring is either at the 2, 3 or 4 position of the ring
  • L 4 is a good nucleophihc substitution leaving group such as a halide, especially a bromide
  • the ring C can be substituted Suitable organic solvents include, for example, those that effectively solubilize the starting materials and are unreactive to the alkylation reagent Depending on the reactants, such solvents can include benzene, acetonit ⁇ le, tetrahydrofuran or ethanol The reaction is favorably conducted at a temperature range of about 20 ⁇ C to about 100 ⁇ C
  • the ring C is reduced by one of a number of reduction procedures known in the art, such as, for instance, reaction with a metal hydride such as sodium borohyd ⁇ de See R M Acheson, G Paghetti, J Chem Soc . Perkm I.
  • a metal hydride such as sodium borohyd ⁇ de See R M Acheson, G Paghetti, J Chem Soc . Perkm I.
  • R c and R d are independently the same as defined for R x
  • the starting material III can be synthesized, for instance, using the chemistry of Reaction 15 (similar to Reaction 1), as follows
  • R has the same definition as R except that it does not include a nitrogen, does not include an oxygen linked to the above-illustrated carbonyl and does not include any double bonds conjugated with the above-illustrated carbonyl, and wherein L 3 is a good nucleophilic substitution leaving group such as a halide, especially a bromide, a tosylate, a brosylate (p- bromobenzenesulfo ⁇ ate), and the like
  • Reaction 7 shown in the Figure, R d -NH 2 is reacted with III to form IV under conditions that effect a reductive alkylation
  • the reductive alkylation can be effected by several known methods (see, for example, "Reductive Alkylation,” W S Emerson in Organic Reactions.
  • Suitable solvents using catalytic hydrogenation to reduce the Schiffs base include ethanol.
  • Suitable solvents using a borohydride to reduce the Schiffs base include alcoholic solvents such as methanol or ethanol.
  • a drying process can be employed during the reaction to promote the dehydration reaction that forms the Schiffs base that is reduced. Such drying processes include refluxing under conditions selected to remove water as an azeotrope or the use of molecular sieves or other drying reagents. Suitable reaction temperatures include the range from about 20°C to the reflux temperature of the solvent employed.
  • IV can be synthesized via Reaction 16, shown in the Figure, by reacting R d -NH 2 with X under the conditions described for Reaction 1 or Reaction 2
  • starting material III 1 is prepared as follows: Reaction 17
  • Reactions 17 and 18 use chemistry described above for Reactions 3 and 6, respectively
  • This compound III' can be substituted for III in Reactions 7, 8 and 12, shown in the Figure.
  • R e is independently the same as defined for R 1 .
  • III or III' is reacted with a organometallic reagent such as an aryllithium or an aryl or arylalkyl Grignard reagent to form V, as described, for instance, in Section 5.1.2 of Cary and Sundberg, Advanced Organic Chemistry, Part 2, Plenum, New York, 1977, pp. 170-180, and references cited therein.
  • the organometallic reagent may react with the ester group; in those such cases where the yield of the desired product is too low, the solvent, the organometallic reagent or the ester substitution can be varied.
  • V is subjected to conditions suitable for dehydration to form a double bond.
  • conditions suitable for dehydration to form a double bond are, for instance, those described in H. Weiland, B_SL
  • reaction 11 V is acylated, for instance, with acetic anhydride in the presence of an acylation catalyst such as 4-dimethylaminopyridine.
  • reaction 12 shown in the Figure, the ketone moiety of III or III' is reduced, for instance by any of a number of known methods for selectively reducing ketones, such as reaction with lithium tri-tert-butoxyaluminohydride.
  • reaction 13 shown in the Figure, the hydroxyl of IX is replaced by a leaving group L 6 , wherein the leaving group is, for instance, chloro or bromo, by reacting IX with, for instance, thionyl chloride or thionyl bromide.
  • R f independently satisfies the definition of R x .
  • X is reacted with R f OH in the presence of a base such as K 2 C0 3 or sodium hydride.
  • a base such as K 2 C0 3 or sodium hydride.
  • the thio-containing analog of XI can be synthesized by reacting X with R f SH.
  • reaction 19 IX is reacted with R ⁇ HSO ⁇ r to yield XII, for instance for instance under the conditons of Mitzunobu reaction, and further converted into IV by reacton 20, analogously to the procedure described in J.R. Henry et al., Tetrahedron Letters 30: 5709-5712, 1989.
  • acids can be formed by the hydrolysis of the corresponding esters.
  • Amine derivatives can be formed by the alkylation of primary, secondary or tertiary amines.
  • a number of double bond containing compounds can be hydrogenated to form the corresponding single bond.
  • R 13 , R' 5 , R' 6 , R 17 and R 20 can be residues other than hydrogen representing functionalized resin or suitably selected linker attached to functionalized resin
  • the linker and the functional group represented by R 5 should be stable under the conditions employed for the above-described reactions
  • the compounds of the invention where R 13 , R 15 , R 16 , R 17 is R 20 is hydrogen, are then cleaved from the resin or the linker leaving the remainder of the molecule intact
  • solid-phase synthesis of peptoids [ol ⁇ go(N-subst ⁇ tuted glycines)] using robotic synthesizer was described by Zuckermann et al , J.
  • the chemistries outlined above may have to be modified, for instance by use of protective groups, to prevent side reactions due to reactive groups, such as reactive groups incorporated into heterocyclic rings or attached as substituents Using the reactions described herein, hydrolysis of esters, alkylation of amines, or hydrogenation reactions, the following compounds of the invention have been synthesized
  • Enantiome ⁇ c excess (“ee") can be enhanced by purification techniques such as crystallization or chromatography on chiral supports Enantiome ⁇ c excess can be quantitated by a number of analytic techniques including NMR, optical rotation measurements and appropriate chromatography.
  • the D ring or the E ring is substituted with at most one of aryl or heteroaryl
  • glycine transporter genes and their respective gene products are responsible for the reuptake of glycine from the synaptic cleft into presynaptic nerve endings or ghal cells, thus terminating the action of glycine Neurological disorders or conditions associated with improperly controlled glycine receptor activity, or which could be treated with therapeutic agents that modulate glycine receptor activity, include spasticity (Becker, FASEB Journal, 4, 2767-2774 (1990)) and pain realization (Yaksh, Pajn, 37, 111-123 (1989)) Additionally, glycine interacts at N-methyl-D-aspartate (NMDA) receptors, which have been implicated in learning and memory disorders and certain clinical conditions such as epilepsy, Alzheimer's and other cognition-related diseases, and schizophrenia See Rison and Stanton, Neurosci Biobehav Rev . 19, 533-552 (1995), Danysz et al , Behavioral Pharmacol . 6, 455-474 (1995)
  • NMDA N
  • NMDA receptors which receptors are located in the forebrain, among other locations
  • This concentration increase elevates the activity of NMDA receptors, thereby alleviating schizophrenia and enhancing cognitive function
  • compounds that interact directly with the glycine receptor component of the NMDA receptor can have the same or similar effects as increasing or decreasing the availability of extracellular glycine caused by inhibiting or enhancing GlyT-1 activity, respectively See, for example, Pitkanen et al , Eur J Pharmacol . 253. 125-129 (1994), Thiels et al , Neuroscience. 46, 501-509 (1992), and Kretschmer and Schmidt, J Neurosci..
  • the compounds of the invention are, for instance, administered orally, sublmgually, rectally, nasally, vaginally, topically (including the use of a patch or other transdermal delivery device), by pulmonary route by use of an aerosol, or parenterally, including, for example, intramuscularly, subcutaneously, intrape ⁇ toneally, intraarte ⁇ ally, intravenously or intrathecally Administration can be by means of a pump for periodic or continuous delivery
  • the compounds of the invention are administered alone, or are combined with a pharmaceutically-acceptable carrier or excipient according to standard pharmaceutical practice
  • the compounds of the invention are used in the form of tablets, capsules, lozenges, chewing gum, troches, powders, syrups, elixirs, aqueous solutions and suspensions, and the like
  • carriers that are used include lactose, sodium citrate and salts of phosphoric acid
  • Various dismtegrants such as starch, and lubricating agents such as magnesium stea
  • Suppository forms of the compounds of the invention are useful for vaginal, urethral and rectal administrations
  • Such suppositories will generally be constructed of a mixture of substances that is solid at room temperature but melts at body temperature
  • the substances commonly used to create such vehicles include theobroma oil, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weight and fatty acid esters of polyethylene glycol See, Remington's Pharmaceutical Sciences, 16th Ed , Mack Publishing, Easton, PA, 1980, pp 1530-1533 for further discussion of suppository dosage forms
  • Analogous gels or cremes can be used for vaginal, urethral and rectal administrations
  • Numerous administration vehicles will be apparent to those of ordinary skill in the art, including without limitation slow release formulations, liposomal formulations and polymeric matrices
  • Examples of pharmaceutically acceptable acid addition salts for use in the present invention include those derived from mineral acids, such as hydrochloric, hydrobromic, phosphoric, metaphospho ⁇ c, nitric and sulfunc acids, and organic acids, such as tarta ⁇ c, acetic, citric, malic, lactic, fuma ⁇ c, benzoic, glycolic, gluconic, succmic, p-toluenesulphonic and arylsulphonic acids, for example
  • Examples of pharmaceutically acceptable base addition salts for use in the present invention include those derived from non-toxic metals such as sodium or potassium, ammonium salts and organoamino salts such as tnethylamine salts Numerous appropriate such salts will be known to those of ordinary skill
  • Dosages will generally be selected to maintain a serum level of compounds of the invention between about 0 01 ⁇ g/cc and about 1000 ⁇ g/cc, preferably between about 0 1 ⁇ g/cc and about 100 ⁇ g/cc
  • an alternative measure of preferred amount is from about 0 01 mg/kg to about 10 mg/kg, more preferably from about 0 1 mg/kg to about 1 mg/kg, will be administered
  • an alternative measure of preferred administration amount is from about 0 1 mg/kg to about 10 mg/kg, more preferably from about 0 1 mg/kg to about 1 mg/kg
  • an alternative measure of preferred administration amount is from about 0 1 mg/kg to about 10 mg/kg, more preferably from about 0 1 mg/kg to about 1 mg/kg
  • an alternative measure of preferred administration amount is from about 0 1 mg/kg to about 10 mg/kg, more preferably from about 0 1 mg/kg to about 1 mg/kg
  • eukaryokic cells For use in assaying for activity in inhibiting glycine transport, eukaryokic cells, preferably QT-6 cells derived from quail fibroblasts, have been transfected to express one of the three known variants of human GlyT-1, namely GlyT-1a, GlyT-1b or GlyT-1c or human GlyT-2
  • the sequences of these GlyT-1 transporters are described in Kim et al , Molec Pharm 45 608-617, 1994, excepting that the sequence encoding the extreme N-terminal of GlyT-1a was merely inferred from the corresponding rat-derived sequence
  • This N-terminal protein-encoding sequence has now been confirmed to correspond to that inferred by Kim et al
  • the sequence of the human GlyT-2 is described by Albert et al., U S.
  • Suitable expression vectors include pRc/CMV (Invitrogen), Zap Express Vector (Stratagene Cloning Systems, LaJolla, CA, hereinafter "Stratagene"), pBk/CMV or pBk-RSV vectors (Stratagene), Bluesc ⁇ pt II SK -n'- Phagemid Vectors (Stratagene), LacSwitch (Stratagene), pMAM and pMAM neo (Clontech), among others
  • a suitable expression vector is capable of fostering expression of the included GlyT DNA in a suitable host cell, preferably a non-mammalian host cell, which can be eukaryotic, fungal, or prokaryotic
  • suitable host cells include amphibian, avian, fungal, insect, and reptilian cells
  • the compounds of the invention have a number of pharmacological actions
  • the relative effectiveness of the compounds can be assessed in a number of ways, including the following
  • test compound that increases calcium flux either (a) has little or no antagonist activity at the NMDA receptor and should not affect the potentiation of glycine activity through GlyT-1 transporter inhibition or (b), if marked increases are observed over GlyT-1 inhibitors used for comparison and that have little direct interaction with NMDA receptors, then the compound is a receptor agonist
  • the test confirms activity in treating or preventing schizophrenia, increasing cognition, or enhancing memory
  • a test compound that decreases calcium flux has a net effect wherein receptor antagonist activity predominates over any activity the compound has in increasing glycine activity through inhibiting glycine transport
  • the test confirms activity in limiting or preventing the cell damage and cell death arising after stroke or other ischemia- mducing conditions, or in limiting or preventing the cell damage associated with neurodegenerative diseases All animal methods of treatment or prevention described herein are
  • Reagent A) ethyl bromoacetate (Aldrich); B) benzyl 2-bromoacetate (Aldrich) Solvent X) acetonit ⁇ le
  • Step 1 A mixture of 0490 g (2 mmol) 3-d ⁇ phenylmethylpyr ⁇ d ⁇ ne (Sigma-Aldrich Library of Rare Chemicals) and 0334 g (4 mmol) ethyl bromoacetate (Aldrich) in 2 ml acetonit ⁇ le was heated under reflux for 1 hour The solvent was evaporated, the residue suspended in diethyl ether and filtered to give 08 g 1-ethoxycarbonylmethyl-3-diphenylmethylpyndinium bromide as a yellow powder ⁇ NMR (CD 3 OD, 300 MHz) ⁇ 887 (d, 1 H), 877 (s, 1 H), 842 (d, 1 H), 8 10
  • Example 3 Example 5 - Hydrogenation of compound C1 to form 3-diphenylmethylp ⁇ pe ⁇ d ⁇ n-1-yl acehc acid ethyl ester (compound C2)
  • Example 6A - Additional syntheses Compound C7 is prepared by hydrogenation of compound C8 using the methodology of
  • Example 6B Additional Syntheses Using the Procedure of Example 6A
  • Compound C11 was prepared by hydrolysis of Compound C2, followed by acidification
  • Compound C12 was prepared by hydrolysis of Compound C1, followed by acidification
  • This example sets forth methods and materials used for growing and transfecting QT-6 cells.
  • QT-6 cells were obtained from American Type Culture Collection (Accession No. ATCC CRL-1708) Complete QT-6 medium for growing QT-6 is Medium 199 (Sigma Chemical Company, St. Louis, MO, hereinafter "Sigma") supplemented to be 10% tryptose phosphate, 5% fetal bovine serum (Sigma); 1% penicillin-streptomycin (Sigma); and 1% sterile dimethylsulfoxide (DMSO; Sigma) Other solutions required for growing or transfecting QT-6 cells included.
  • DNA/DEAE Mix 450 ⁇ l TBS, 450 ⁇ l DEAE Dextran (Sigma), and 100 ⁇ l of DNA (4 ⁇ g) in TE, where the DNA includes GlyT-1a, GlyT-1b , GlyT-1c, or GlyT-2, in a suitable expression vector
  • PBS Standard phosphate buffered saline, pH 7.4 including 1 mM CaCI 2 and 1 mM MgCI 2 sterilized through 0.2 ⁇ filter.
  • TBS One ml of Solution B, 10 ml of Solution A; brought to 100 ml with distilled H 2 0; filter-sterilized and stored at 4°C.
  • IE 0.01 M Tris, 0.001 M EDTA, pH 8.0.
  • DEAE dextran Sigma, #D-9885.
  • a stock solution was prepared consisting of 0.1% (1 mg/ml) of the DEAE dextran in TBS. The stock solution was filter sterilized and frozen in 1 ml aliquots.
  • Chloroquine Sigma, #C-6628. A stock solution was prepared consisting of 100 mM chloroquine in H 2 0. The stock solution was filter-sterilized and stored in 0.5 ml aliquots, frozen.
  • Solution B M00)Q The solution was adjusted to pH 7.5 with HCI, brought to 100.0 ml with distilled H 2 0, and filter-sterilized and stored at room temperature.
  • the solution was brought to 100 ml with distilled H 2 0, and filter-sterilized; the solution was then stored at room temperature.
  • HBSS 150 mM NaCI, 20 mM HEPES, 1 mM CaCI 2 , 10 mM glucose, 5 mM KCI, 1 mM MgCI 2 « H 2 0; adjusted with NaOH to pH 7.4. Standard growth and passaging procedures used were as follows: Cells were grown in
  • rat GlyT-2 (rGlyT-2) clone used contains the entire sequence of rGlyT-2 cloned into pBluescnpt SK+(Stratagene) as an Eco Rl - Hind III fragment, as described in Liu et al , J Biol Chem 268.
  • GlyT-2 was then subcloned into the pRc/RSV vector as follows A PCR fragment corresponding to nucleotides 208 to 702 of the rGlyT-2 sequence was amplified by PCR using the oiigonucleotide 5'GGGGGAAGCTTATGGATTGCAGTGCTCC 3' as the 5' primer and the oiigonucleotide
  • This cDNA encoding GlyT-1a actually contained the first 17 nucleotides (corresponding to the first 6 ammo acids) of the GlyT-1a sequence from rat
  • the 5' region of hGlyT-1a from nucleotide 1 to 212 was obtained by rapid amplification of cDNA end using the 5' RACE system supplied by Gibco BRL (Gaithersburg, MD)
  • the gene specific primer 5' CCACATTGTAGTAGATGCCG 3' corresponding to nucleotides 558 to 539 of the hGlyT-1a sequence was used to prime cDNA synthesis from human brain mRNA, and the gene specific primer 5' GCAAACTGGCCGAAGGAGAGCTCC 3', corresponding to nucleotides 454 to 431 of the hGlyT-1a sequence, was used for PCR amplification Sequencing of this 5' region of GlyT-1a confirmed that the
  • the human GlyT-1b (hGlyT-1b) clone used contains the sequence of hGlyT-1b from nucleotide position 213 to 2274 cloned into the pRc/CMV vector as a Hind III - Xba I fragment as described in Kim et al , Mol Pharmacol . 4JS, 608-617, 1994
  • the human GtyT-1c (hGlyT-1c) clone used contains the sequence of hGlyT-1c from nucleotide position 213 to 2336 cloned into the pRc/CMV vector (Invitrogen) as a Hind III - Xba I fragment as described in Kim et al , Mol Pharmacol.. 45, 608-617, 1994
  • the Hind lll - Xba fragment of hGlyT-1c from this clone was then subcloned into the pRc/RSV vector
  • Transfection experiments were performed with GlyT-1c in both the pRc/RSV and pRc/CMV expression vectors The following four day procedure for the tranfections was used. On day 1, QT-6 cells were plated at a density of 1 x 10 6 cells in 10 ml of complete QT- 6 medium in 100 mm dishes
  • the media was aspirated and the cells were washed with 10 ml of PBS followed by 10 ml of TBS
  • the TBS was aspirated, and then 1 ml of the DEAE/DNA mix was added to the plate
  • the plate was swirled in the hood every 5 minutes.
  • 8 ml of 80 ⁇ M chloroquine, in QT-6 medium was added and the culture was incubated for 2.5 hours at 37"C and 5% C0 2
  • the medium was then aspirated and the cells were washed two times with complete QT-6 media, then 100 ml complete QT-6 media was added and the cells were returned to the incubator
  • This example illustrates a method for the measurement of glycine uptake by transfected cultured cells
  • Transient GlyT-transfected cells grown in accordance with Example 7 were washed three times with HEPES buffered saline (HBS)
  • HBS HEPES buffered saline
  • the cells were then incubated 10 minutes at 37°C, after which a solution was added containing 50 nM [ 3 H]glyctne (17 5 Ci/mmol) and either (a) no potential competitor, (b) 10 mM nonradioactive glycine or (c) a concentration of a candidate drug
  • a range of concentrations of the candidate drug was used to generate data for calculating the concentration resulting in 50% of the effect (e.g., the IC 50 s, which are the concentrations of drug inhibiting glycine uptake by 50%)
  • the cells were then incubated another 10 minutes at 37°C, after which the cells were aspirated and washed three times with ice-cold HBS
  • the cells were harvested, s ⁇ ntillant was added to the cells, the cells
  • This example illustrates binding assays to measure interaction of compounds with the glycine site on the NMDA receptor
  • Direct binding of [ 3 H]glycine to the NMDA-giycine site was performed according to the method of Grimwood et al., Molecular Pharmacology. 41, 923-930 (1992); Yoneda et al., i Neurochem. 62, 102-112 (1994).
  • the third binding test was operated to identify antagonists as follows 100 ⁇ g of membranes were added to wells of a 96-well plate, along with glutamate (10 ⁇ M) and glycine (200 nM) and various concentrations of the ligand to be tested
  • the assay was started by the addition of 5 nM [ 3 H]MK-801 (239 Ci/mmol), which binds to the ion channel associated with NMDA receptors
  • the final volume of the assay was 200 ⁇ l
  • Bound radioactivity was separated from free by filtration, using a TOMTEC harvester Antagonist activity was indicated by decreasing radioactivity associated with the NMDA receptor with increasing concentration of the tested ligand
  • the third binding test was operated to identify agonists by performing the test as above, except that the concentration of glycine was 200 nM Agonist activity was indicated by increasing radioactivity associated with the NMDA receptor with increasing concentration of the tested ligand Example 10 - Assay of Calcium Flux
  • This example illustrates a protocol for measuring calcium flux in primary neuronal calls
  • the calcium flux measurement is performed in primary neuronal cell cultures, which are prepared from rat fetal cortices dissected from pregnant rats using standard procedures and techniques that require sterile dissecting equipment, a microscope and defined medium
  • the protocol used was adapted from Lu et al , Proc Nat'l Acad. Sci USA. 88, 6289-6292 (1991) Defined medium is prepared in advance in accordance with the following recipe
  • tissue culture plates were treated with polylysine (100 ⁇ g/ml for at least 30 minutes at 37°C) and washed with distilled water Also, a metal tray containing two sets of sterile crude dissecting equipment (scissors and tweezers) and several sets of finer dissecting tools was autoclaved A pair of scissors and tweezers were placed into a sterile beaker with 70% alcohol and brought to the dissecting table A pet ⁇ dish with cold phosphate buffered saline (PBS) was placed on ice next to the place of dissection A pregnant rat (E15 or 16 on arrival from Hilltop Lab Animals (Scottdale, PA), E17 or 18 at dissection) was placed in a CO ⁇ dry ice chamber until it was unconscious The rat was removed, pinned to a backing, the area of dissection was swabbed with 70% alcohol, and skin was cut and removed from the area of interest A second pair of scissors was used to cut through and remove the pre
  • the cortical cultures for the standard calcium flux assay were grown in 24-well plates in the defined medium described above for 7 days and fed once with serum containing media (10% heat inactivated fetal calf serum, 06% glucose in MEM) by exchanging half of the medium Cultures were used after 12 days of incubation in vitro The cultures were rinsed three times with HCSS ( ⁇ e HEPES-buffered control salt solution, containing 120 mM NaCI, 54 mM KCI, 1 8 mM CaCI 2 25 mM HEPES, and 15 mM glucose, in HPLC water and adjusted to pH 7 4 by NaOH, which was also made in HPLC water) In the third wash, the culture was incubated at 37"C for

Landscapes

  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Biomedical Technology (AREA)
  • Pain & Pain Management (AREA)
  • Psychiatry (AREA)
  • Virology (AREA)
  • Psychology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • AIDS & HIV (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Hospice & Palliative Care (AREA)
  • Molecular Biology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Plural Heterocyclic Compounds (AREA)
  • Pyrrole Compounds (AREA)
  • Nitrogen Condensed Heterocyclic Rings (AREA)
  • Hydrogenated Pyridines (AREA)

Abstract

The invention provides a pharmaceutical for treatment of neurological and neuropsychiatric disorders comprising a compound of formulas (I and II) or a pharmaceutically acceptable salt thereof.

Description

PHARMACEUTICAL FOR TREATING OF NEUROLOGICAL AND NEUROPSYCHIATRIC DISORDERS
The present invention relates to a class of substituted cyclic amines, pharmaceutical compositions and methods of treating neurological and neuropsychiatric disorders
Synaptic transmission is a complex form of intercellular communication that involves a considerable array of specialized structures in both the pre- and post-synaptic neuron High- affinity neurotransmitter transporters are one such component, located on the pre-synaptic terminal and surrounding glial cells (Kanner and Schuldiner, CRC Critical Reviews in Biochemistry, 22, 1032 (1987)) Transporters sequester neurotransmitter from the synapse, thereby regulating the concentration of neurotransmitter in the synapse, as well as its duration therein, which together influence the magnitude of synaptic transmission Further, by preventing the spread of transmitter to neighboring synapses, transporters maintain the fidelity of synaptic transmission Last, by sequestering released transmitter into the presynaptic terminal, transporters allow for transmitter
Figure imgf000003_0001
Neurotransmitter transport is dependent on extracellular sodium and the voltage difference across the membrane, under conditions of intense neuronal firing, as, for example, during a seizure, transporters can function in reverse, releasing neurotransmitter in a calcium- independent non-exocytotic manner (Attwell et al , Neuron. H, 401-407 (1993)) Pharmacologic modulation of neurotransmitter transporters thus provides a means for modifying synaptic activity, which provides useful therapy for the treatment of neurological and psychiatric disturbances
The ammo acid glycine is a major neurotransmitter in the mammalian central nervous system, functioning at both inhibitory and excitatory synapses By nervous system, both the central and peripheral portions of the nervous system are intended These distinct functions of glycine are mediated by two different types of receptor, each of which is associated with a different class of glycine transporter The inhibitory actions of glycine are mediated by glycine receptors that are sensitive to the convulsant alkaloid strychnine, and are thus referred to as "strychnine-sensitive " Such receptors contain an intrinsic chloride channel that is opened upon binding of glycine to the receptor, by increasing chloride conductance, the threshold for firing of an action potential is increased Strychnine-sensitive glycine receptors are found predominantly in the spinal cord and brainstem, and pharmacological agents that enhance the activation of such receptors will thus increase inhibitory neurotransmission in these regions
Glycine functions in excitatory transmission by modulating the actions of giutamate, the major excitatory neurotransmitter in the central nervous system See Johnson and Ascher,
Nature, 325. 529-531 (1987), Fletcher et al , Glycine Transmission. (Otterson and Storm-Mathisen, eds., 1990), pp. 193-219. Specifically, glycine is an obligatory co-agonist at the class of glutamate receptor termed N-methyl-D-aspartate (NMDA) receptor. Activation of NMDA receptors increases sodium and calcium conductance, which depolarizes the neuron, thereby increasing the likelihood that it will fire an action potential. NMDA receptors are widely distributed throughout the brain, with a particularly high density in the cerebral cortex and hippocampal formation. Molecular cloning has revealed the existence in mammalian brains of two classes of glycine transporters, termed GlyT-1 and GlyT-2. GlyT-1 is found predominantly in the forebrain, and its distribution corresponds to that of glutamatergic pathways and NMDA receptors (Smith, et al., Neuron. §, 927-935 (1992)). Molecular cloning has further revealed the existence of three variants of GlyT-1, termed GlyT-1a, GlyT-1b and GlyT-1c (Kim, et al., Molecular Pharmacology. 45, 608-617 (1994)), each of which displays a unique distribution in the brain and peripheral tissues. These variants arise by differential splicing and exon usage, and differ in their N-terminal regions. GlyT-2, in contrast, is found predominantly in the brain stem and spinal cord, and its distribution corresponds closely to that of strychnine-sensitive glycine receptors (Liu et al., 1 Biological Chemistry. 268. 22802-22808 (1993); Jursky and Nelson, J. Neurochemistrv. 64, 1026-
1033 (1995)). These data are consistent with the view that, by regulating the synaptic levels of glycine, GlyT-1 and GlyT-2 selectively influence the activity of NMDA receptors and strychnine- sensitive glycine receptors, respectively.
Compounds that inhibit or activate glycine transporters would thus be expected to alter receptor function, and provide therapeutic benefits in a variety of disease states. For example, inhibition of GlyT-2 can be used to diminish the activity of neurons having strychnine-sensitive glycine receptors via increasing synaptic levels of glycine, thus diminishing the transmission of pain-related (i.e., nociceptive) information in the spinal cord, which has been shown to be mediated by these receptors. Yaksh, Pain. 3_Z, 111-123 (1989). Additionally, enhancing inhibitory glycinergic transmission through strychnine-sensitive glycine receptors in the spinal cord can be used to decrease muscle hyperactivity, which is useful in treating diseases or conditions associated with increased muscle contraction, such as spasticity, myoclonus, and epilepsy (Truong et al., Movement Disorders. 3, 77-87 (1988); Becker, FASEB J.. 4, 2767-2774 (1990)). Spasticity that can be treated via modulation of glycine receptors is associated with epilepsy, stroke, head trauma, multiple sclerosis, spinal cord injury, dystonia, and other conditions of illness and injury of the nervous system.
NMDA receptors are critically involved in memory and learning (Rison and Stanton, Neurosci. Biobβhav. Rev.. 19_, 533-552 (1995); Danysz et al., Behavioral Pharmacol.. §, 455-474 (1995)); and, furthermore, decreased function of NMDA-mediated neurotransmission appears to underhe, or contribute to, the symptoms of schizophrenia (Olney and Farber, Archives General Psychiatry. 52, 998-1007 (1996) Thus, agents that inhibit GlyT-1 and thereby increase glycine activation of NMDA receptors can be used as novel antipsychotics and anti-dementia agents, and to treat other diseases in which cognitive processes are impaired, such as attention deficit disorders and organic brain syndromes Conversely, over-activation of NMDA receptors has been implicated in a number of disease states, in particular the neuronal death associated with stroke and possibly neurodegenerative diseases, such as Alzheimer's disease, multi-infarct dementia, AIDS dementia, Huntington's disease, Parkinson's disease, amyotrophtc lateral sclerosis or other conditions in which neuronal cell death occurs, such as stroke or head trauma Coyle & Puttfarcken, Science. 2S2, 689-695 (1993), Lipton and Rosenberg, New Enol J of Medicine. 330.
613-622 (1993), Choi, Neuron. 1, 623-634 (1988) Thus, pharmacological agents that increase the activity of GlyT-1 will result in decreased glycine-activation of NMDA receptors, which activity can be used to treat these and related disease states Similarly, drugs that directly block the glycine site on the NMDA receptors can be used to treat these and related disease states SUMMARY OF THE INVENTION
By the present invention, a class of compounds has been identified that inhibit glycine transport via the GlyT-1 or GlyT-2 transporters, are precursors, such as pro-drugs, to compounds that inhibit such transport, or are synthetic intermediates for preparing compounds that inhibit such transport Thus, the invention provides a class of compounds formulas The present invention provides compound of one of the following formulas I and II
Figure imgf000005_0001
or a pharmaceutically acceptable salt thereof, wherein
(1) X is nitrogen or carbon, and R2 is not present when X is nitrogen, (2) R2 (a) is hydrogen, (C1-C6) alkyl, (C1-C6) alkoxy, cyano, (C2-C7) alkanoyl, aminocarbonyl, (C1-C6) alkylaminocarbonyl or dialkylaminocarbonyl wherein each alkyl is independently C1 to C6, (b) comprises (where R1 is not -0-R8or -S-R8") hydroxy, fluoro, chloro, bromo or (C2-C7) alkanoyloxy, (c) forms a double bond with an adjacent carbon or nitrogen from one of either R1, Rxb or Ryb, (d) is oxygen forming an oxa linkage with R1 or integrated into ring E (see, for example, Compound C6) or (e) is R2a linked by R26 to X, (2') Rx is a ring-containing structure Rxa linked by Rxb to X, (2") Ry is a ring-containing structure Rya linked by Ryb to X,
(2'") Rxa, Rya and R2a, are independently aryl, heteroaryl, adamantyl or a 5 to 7-membered non-aromatic ring having from 0 to 2 heteroatoms selected from the group consisting of oxygen, sulfur and nitrogen, wherein
(a) aryl is phenyl or naphthyl,
(b) heteroaryl comprises a five-membered ring, a six-membered ring, a six- membered ring fused to a five-membered ring, a five-membered ring fused to a six-membered ring, or a six-membered ring fused to a six-membered ring, wherein the heteroaryl is aromatic and contains heteroatoms selected from the group consisting of oxygen, sulfur and nitrogen, with the remaining ring atoms being carbon,
(c) each of Rxa, Rya and R2a can be independently substituted with one of Rq, RrO- or RSS-, wherein Rq, Rr and Rs are independently aryl, heteroaryl, adamantyl or a 5 to 7-membered non-aromatic ring as these structures are defined for Rxa, and
(d) Rxa, Rya, R2a, Rq, Rr and Rs can be additionally substituted with substituents selected from the group consisting of fluoro, chloro, bromo, nitro, hydroxy, cyano, tnfluoromethyl, amidosulfonyl which can have up to two independent
(CI-C6) N-alkyl substitutions, adamantyl, (C1-C12) alkyl [preferably (C1-C6) or (C1-C8), (C1-C12) alkenyl [preferably (C1-C6) or (C1-C8)], ammo, (C1-C6) alkylamino, dialkylamino wherein each alkyl is independently C1 to C6, (C1-C6) alkoxy, (C2-C7) alkanoyl, (C2-C7) alkanoyloxy, tπfluoromethoxy, hydroxycarbonyl, (C2-C7) alkyloxycarbonyl, aminocarbonyl that can be substituted for hydrogen with up to two independent (C1-C6) alkyl, (C1-C6) alkylsulfonyl, amidino that can independently substituted with up to three (C1-C6) alkyl, or methyienedioxy or ethylenedioxy with the two oxygens bonded to adjacent positions on the aryl or heteroaryl ring structure, which methylenedioxy or ethylenedioxy can be substituted with up to two independent (C1-C6) alkyl, wherein (i.) the substitutions of Rxa, Rya and R2a can be combined to form a second bridge between two of Rxa, Rya and R2a comprising (1) (C1-C2) alkyl or alkenyl, which can be independently substituted with one or more (C1-
C6) alkyl, (2) sulfur, (3) oxygen, (4) ammo, which can be substituted for hydrogen with one (C1-C6) alkyl, (5) carbonyl, (6) -CH2C(=0)-, which can be substituted for hydrogen with up to two independent (C1-C6) alkyl, (7) -C(=0)-0-, (8) -CH2-0-, which can be substituted for hydrogen with up to two independent (C1-C6) alkyl, (9) -C(=0)-N(R24)-, wherein
R24 is hydrogen or (C1-C6) alkyl, (10) -CH2-NH-, which can be substituted for hydrogen with up to three (C1-C6) alkyl, or (11) -CH=N-, which can be substituted for hydrogen with (C1-C6) alkyl, or wherein two of Rxa, Rya and R2a can be directly linked by a single bond, (2*) Rxb and R* are independently a single bond or (C1-C2) alkylene,
(2V) Ryb is a single bond, oxa p e , -0-], (C1-C2) alkylene, ethenylene or -CH= (where the double bond is with X), thia (i e , -S-], methyleneoxy or methylenethio, or either -N(R6)- or -CH2- N(R6*)-, wherein R6 and R6* are hydrogen or (C1-C6) alkyl, wherein when X is nitrogen X is not bonded to another heteroatom, (3) R1 comprises a single bond or double bond, a straight-chained (C1-C3) aliphatic group, or (where X is carbon and R^ does not include a heteroatom attached to X) -O-R8 or -S-R8 wherein either R8 or R8 is a single bond, (C1-C3) alkylene or (C2-C3) alkenylene and 0 or S is bonded to X wherein R1 can be substituted with up to one hydroxy, up to one (C1-C6) alkoxy or up to one (C2-C7) alkanoyloxy, with up to two independent (C1-C6) alkyl, with up to one oxo, up to one (C1-C6) alkyhdene, with the proviso that the hydroxy, alkoxy, alkanoyloxy, oxo substituents are not bonded to a carbon that is bonded to a nitrogen or oxygen, or (where R1 is -O-R8 and X is carbon) an oxa linkage to X forming a 1,3- dioxolane, wherein the alkyl or alkylidene substituents of R1 can be linked to form a 3 to 7- membered non-aromatic ring, and wherein if X is nitrogen, X is linked to R1 by a single bond and the terminal carbon of R1 that links R1 to N is saturated, (4) n is 0 or 1, and where if n is 1, R3' is either (C1-C6) alkyl (with the attached nitrogen having a positive charge) or oxygen (forming an N-oxide) and X is carbon,
(5) wherein ring D is a 3 to 8-membered ring, a 3 to 8-membered ring substituted with a 3 to 6-membered spiro ring, or a 3 to 8-membered ring fused with a 5 to 6-membered ring, wherein the fused ring lacking the illustrated tertiary nitrogen can be aromatic or heteroaromatic, wherein for each component ring of ring D there are up to two heteroatoms selected from oxygen, sulfur or nitrogen, including the illustrated nitrogen, and the rest carbon, with the proviso that the ring atoms include no quaternary nitrogens, with the proviso that, in saturated rings, ring nitrogen atoms are separated from other ring heteroatoms by at least two intervening carbon atoms wherein the carbon and nitrogen ring atoms of ring D can be substituted with substituents selected from (C1-C6) alkyl, (C2-C6) alkenylene, cyano, nitro, tπfluoromethyl, (C2-C7) alkyloxycarbonyl, (C1-C6) alkyhdene, hydroxyl, (C1-C6) alkoxy, oxo, hydroxycarbonyl, aryl wherein the aryl is as defined for Ra or heteroaryl wherein the heteroaryl is as defined for Ra, with the proviso that ring atoms substituted with alkyhdene, hydroxycarbonyl or oxo are carbon, with the further proviso that ring atoms substituted with hydroxyl or alkoxy are separated from other ring heteroatoms by at least two intervening carbon atoms [where R3 is preferably a single bond or (C1-C2) alkyl or alkenyl], and wherein R1, R3 and G are such that at least two atoms separate X and the illustrated ring nitrogen,
(6) wherein ring E is a 3 to 8-membered ring, a 3 to 8-membered ring substituted with a 3 to 6-membered spiro ring, or a 3 to 8-membered ring fused with a 5 to 6-membered ring, wherein the fused ring lacking the illustrated tertiary nitrogen can be aromatic or heteroaromatic, wherein for each component ring of ring E there are up to two heteroatoms selected from oxygen, sulfur or nitrogen, including the illustrated nitrogen, and the rest carbon, with the proviso that the ring atoms include no quaternary nitrogens, with the proviso that, in saturated rings, πng nitrogen atoms are separated from other ring heteroatoms by at least two intervening carbon atoms wherein the carbon and nitrogen ring atoms of ring E can be substituted with substituents selected from (C1-C6) alkyl, (C2-C6) alkenylene, cyano, nitro, tπfiuoromethyl, (C2-C7) alkyloxycarbonyl, (C1-C6) alkyhdene, hydroxyl, (C-C6) alkoxy, oxo p e , oxygen of carbonyl], hydroxycarbonyl, (C1-C6) alkoxycarbonyl, aryl wherein the aryl is as defined for Ra or heteroaryl wherein the heteroaryl is as defined for Ra, with the proviso that ring atoms substituted with alkyhdene, hydroxycarbonyl or oxo are carbon, with the further proviso that ring atoms substituted with hydroxyl or alkoxy are separated from other ring heteroatoms by at least two intervening carbon atoms [where preferably R18 is a single bond or (C1-C3) alkyl or alkenyl], and wherein G* and R18 are such that at least two atoms separate the illustrated ring nitrogen from the carbon linked to Rx and Ry, (7) R19 (a) forms a double bond with R1, R3 or G, (b) is hydrogen (c) is (C1 - C3) alkyl or alkylene, or (d) is incorporated into a fused ring,
(8) R4 and R4' are independently hydrogen or (C1-C6) alkyl, or one of R4 and R4" can be (C1-C6) hydroxyalkyl, and
(9) R5 is (CO)NR13R14, (CO)OR15, (CO)SR16, (S02)NR17R18, (PO)(OR19)(OR20), (CR22)(OR23)(OR24), CN or tetrazol-5-yl, wherein R13, R14, R15, R16, R17, R18, R19 and R20 are independently hydrogen, (C1-C8) alkyl which can include a (C3-C8) cycloalkyl, wherein the carbon linked to the oxygen of R15 or the sulfur of R16 has no more than secondary branching and , (C2-C6) hydroxyalkyl, aminoalkyl where the alkyl is C2 to C6 and the ammo can be substituted with up to two independent (C1-C6) alkyls, arylalkyl wherein the alkyl is C1-C6, heteroarylalkyl wherein the alkyl is C1 to C6, aryl or heteroaryl, R22 is hydrogen or OR25 and R23, R24 and R25 are (C1-C6) alkyl, phenyl, benzyl, acetyl or, where R22 is hydrogen, the alkyls of R23 and R24 can be combined to include 1,3-dιoxylane or 1,3-dιoxane wherein the aryl is phenyl or naphthyl and the heteroaryl is a five-membered ring, a six-membered ring, a six-membered ring fused to a five-membered ring, a five- membered ring fused to a six-membered ring, or a six-membered ring fused to a six- membered ring, wherein the heteroaryl is aromatic and contains heteroatoms selected from the group consisting of oxygen, sulfur and nitrogen, with the remaining ring atoms being carbon, wherein the aryl, heteroaryl, aryl of arylalkyl or the heteroaryl of heteroarylalkyl can be substituted with [preferably up to three] substituents selected from the group consisting of fluoro, chloro, bromo, nitro, cyano, trifluoromethyl, amidosulfonyl which can have up to two independent (C1-C6) N-alkyl substitutions, (C1-C6) alkyl, (C2-C6) alkenyl, (C1-C6) alkylamme, dialkylamme wherein each alkyl is independently C1 to C6, ammo, (C1-C6) alkoxy, (C2-C7) alkanoyl, (C2-C7) alkanoyloxy, tπfluoromethoxy, hydroxycarbonyl, (C2-C7) alkyloxycarbonyl, aminocarbonyl that can be N-substituted with up to two independent (C1-C6) alkyl, (C1-C6) alkylsulfonyl, amidino that can substituted with up to three (C1-C6) alkyl, or methylenedioxy or ethylenedioxy with the two oxygens bonded to adjacent positions on the aryl or heteroaryl ring structure, which methylenedioxy or ethylenedioxy can be substituted with up to two independent (C1-C6) alkyl; and wherein R13 and R14 together with the nitrogen can form a 5 to 7-membered ring that can contain one additional heteroatom selected from oxygen and sulfur In a preferred embodiment, (A) at least one of Rxa, Rya and R2a is substituted with fluoro, chloro, bromo, hydroxy, trifluoromethyl, tnfluoromethoxy, nitro, cyano, (C3-C8) alkyl, Rq, RrO-, RSS-, or (B) the ring structures of Rxa, Rya and R2a, including substituents thereto, otherwise include at least two aromatic ring structures that together include from 15 to 20 ring atoms. Preferably, at least one of Rxa, Rya and R2a is substituted with fluoro, trifluoromethyl, tnfluoromethoxy, nitro, cyano, or (C3-C8) alkyl Preferably, at least one of Rxa, Rya and R2a is substituted with Rq, RrO-, or RSS-. Preferably, an aryl or heteroaryl of at least one of Rxa, Rya and R2a is phenyl. Preferably, Ryb is oxa, methyleneoxy, thia, methylenethia. Preferably, Ryb is oxa or thia. Preferably, R5 is (CO)NR13R14, (CO)OR15 or (CO)SR16 Preferably, R15 is (C2-C6) alkyl, (C2-C4) hydroxyalkyl, phenyl, phenylalkyl wherein the alkyl is C1-C3, or aminoalkyl where the alkyl is C2-C6 and the ammo can be substituted with up to two independent (C1-C3) alkyls, wherein the phenyl or the phenyl of phenylalkyl can be substituted. Preferably, n is zero. Preferably, R15 is hydrogen. Preferably, R4 is hydrogen, methyl or hydroxymethyl and R4" is hydrogen. Preferably, at least one of Rxa, Rya and R2a is a heteroaryl comprising diazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, thiolyl, diazmyl, tπazinyl, benzoazolyl, benzodiazolyl, benzothiazolyl, benzoxazolyl, benzoxolyl, benzothiolyl, quinolyl, isoquinolyl, benzodiazinyl, benzotriazmyl, pyπdyl, thienyl, furanyl, pyrrolyl, indolyl, isoindoyl or pyπmidyl. Preferably, R1 is -O-R8 or -S-R8"
Preferably, the second bridge between two of Rxa, Rya and R2a is L, and satisfies the following formula:
heteroaryl groups of Rxa and Rya, Rya-Ryb- and X form:
Figure imgf000010_0001
21
Figure imgf000010_0002
wherein Y is a carbon bonded to R1 by a single or double bond or a nitrogen that is bonded to R1 and wherein R21 either (i.) completes a single bond linking two aryl or heteroaryl rings of Rx and Rv, (ii.) is (C1-C2) alkylene or alkenylene, (iii.) is sulfur or (iv.) is oxygen, and wherein Rx and Ry can be substituted as set forth above, Preferably, R21 is CH2CH2 or CH=CH. Preferably, the alkylenedioxy substitution of Rxa, Rya or R2a is as follows:
Figure imgf000011_0001
wherein the alkylenedioxy can be substituted with up to two independent (C1-C3) alkyl. Preferably, ring D is according to one of formulas A' and B':
Figure imgf000011_0002
A' B'
, wherein Z represents carbon or nitrogen, wherein for each of formulas A' and B' up to two of the bonds indicated with the hashed lines can be double bonds provided no two double bonds are adjacent, and wherein the ring of formulas A' and B' can be substituted as set forth above for ring D. Preferably, the ring system comprising G* is according to one of formulas C and D'
Figure imgf000011_0003
, wherein Z represents carbon or nitrogen, wherein for formula C up to one of the bonds indicated with the hashed lines can be double bond and for formula D' up to two of the bonds indicated with the hashed lines can be double bonds, and wherein the ring can be substituted as set forth above for ring E. Preferably, ring D or ring E is substituted with up to three substituents. Preferably, Rxa and Rya together can be substituted with up to six substituents, R2a, Rq, Rr and Rs can each be substituted with up to 3 substituents, and wherein the presence of each of Rq, Rr or Rs is considered a substitution to the respective ring structure of Rxa, Rya and R2a Preferably, the aryl, heteroaryl, aryl of arylalkyl or the heteroaryl of heteroarylalkyl of R13, R14, R15, R16 R17, R18 R19 or R20 is substituted with up to three substituents Preferably, the compound is an optically pure enantiomer Preferably, the compound is an optically pure enantiomer (i e , at least about 80% ee, preferably at least about 90% ee, more preferably at least about 95% ee)
Preferably, the invention provides a pharmaceutical composition comprising the compound and a pharmaceutically acceptable excipient Preferably, the compound of the invention is present in an effective amount for (1) treating or preventing schizophrenia, (2) enhancing treating or preventing dementia, (3) treating or preventing epilepsy, (4) treating or preventing spasticity, (5) treating or preventing muscle spasm, (6) treating or preventing pain, (7) preventing neural cell death after stroke, (8) preventing neural cell death in an animal suffering from a neurodegenerative disease, (9) treating or preventing mood disorders such as depression, (10) enhancing memory or learning, or (11) treating or preventing learning disorders The invention further provides a method (1) of treating or preventing schizophrenia comprising administering a schizophrenia treating or preventing effective amount of a compound, (2) of treating or preventing dementia comprising administering a dementia treating or preventing effective amount of a compound, (3) of treating or preventing epilepsy comprising administering an epilepsy treating or preventing effective amount of a compound, (4) of treating or preventing spasticity comprising administering a spasticity treating or preventing effective amount of a compound, (5) of treating or preventing muscle spasm comprising administering a muscle spasm treating or preventing effective amount of a compound, (6) of treating or preventing pain comprising administering a pain treating or preventing effective amount of a compound, (7) of preventing neural cell death after stroke comprising administering a neural cell death preventing effective amount of a compound, (8) of preventing neural cell death in an animal suffering from a neurodegenerative disease, (9) treating or preventing mood disorders such as depression, (10) enhancing memory or learning, or (11) treating or preventing learning disorders, compπsing administering an amount effective for said treating, preventing or enhancing of the compound Preferably, the spasticity treated or prevented is associated with epilepsy, stroke, head trauma, multiple sclerosis, spinal cord injury or dystonia Preferably, the neurodegenerative disease treated or prevented is Alzheimer's disease, multi-mfarct dementia, AIDS dementia, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis or stroke or head trauma such as results in neuronal cell death The invention also provides a method of synthesizing a compound of the invention comprising
A) reacting a compound of the formula 1)
Figure imgf000013_0001
, wherein 1L is a nucleophihc substitution leaving group, with a compound of the formula
Figure imgf000013_0002
or B) reacting a compound of the formula
Figure imgf000013_0003
with a compound of the formula
Figure imgf000013_0004
, wherein 2L is a nucleophihc substitution leaving group The invention also provides a method of synthesizing a compound of the invention comprising reductively alkylating RdNH2 with a compound of the formula
Figure imgf000014_0001
, wherein Rc and R are independently the same as defined for Rx, and wherein Rr has the same definition as R1 except that it does not include a nitrogen, oxygen or sulfur, and does not include any double bonds conjugated with the above-illustrated carbonyl The invention also provides a method of synthesizing a compound of the invention comprising reacting RfOH or RrSH with a compound of the formula
Figure imgf000014_0002
to form an ether or a thioether, respectively, wherein Rf and Rr are independently the same as defined for Rx, and wherein R1 has the same definition as R1 except that it does not include a nitrogen, oxygen or sulfur, and does not include any double bonds at the atom bonded to the above-illustrated L6-substιtuted carbon Preferably, the method further comprises synthesizing the compound of formula
Figure imgf000014_0003
by replacing the hydroxyl of formula
Figure imgf000014_0004
with another nucleophilic substitution leaving group Preferably, the method comprises reacting a compound of formula
Figure imgf000015_0001
with an azodicarboxylate in the presence of a phosphine compound
The invention also provides a method of synthesizing a compound of the invention comprising reacting ReM with a compound of the formula
Figure imgf000015_0002
to form a compound of the formula
Figure imgf000015_0003
, wherein Re is independently the same as defined for Rx, wherein M is a metal-containing substituent such that ReM is a organometallic reagent
The invention also provides a method of synthesizing a compound of the invention comprising dehydrating a compound of the formula
Figure imgf000015_0004
to form a compound of the formula
Figure imgf000015_0005
wherein C* (the tertiary carbon marked with an adjacent "*") has a double bond with an adjacent carbon, wherein R27 and R27" have the same definition as R1 except that R27 and R27" do not include a nitrogen, oxygen or sulfur The invention also provides a method of synthesizing a compound of the invention comprising reducing a compound of the formula
wherein C has a double bond with an adjacent carbon, to form a compound of the formula
Figure imgf000016_0001
Figure imgf000016_0002
The invention also provides a method of synthesizing a compound of the invention comprising reducing a compound of one of the following formulas
Figure imgf000016_0003
to reduce a double bond in ring C" or ring Cιx, wherein R is the same as R except that the bond to the πng is not a double bond, wherein ring Cιx is mono or di-unsaturated at one or more of the bonds indicated with the dased lines with the double bonds formed between ring carbons and no two double bonds are adjacent, wherein ring C" or ring Cιx can include a fused phenyl and can be substituted as follows the carbon and nitrogen ring atoms of ring C" or ring C'x can be substituted with up to two substituents selected from (C1-C6) alkyl, (C2-C6) alkenylene, cyano, nitro, trifluoromethyl, and (C2-C7) alkyloxycarbonyl, and wherein I is a negative counter-ion Preferably, the compound reduced is that containing ring C" The invention also provides a compound according to the following formula
Figure imgf000016_0004
that can be used to synthesize a compound of the invention The invention also provides a method of synthesizing this compound comprising reacting a compound of the formula
Figure imgf000017_0001
with a compound of the formula
Figure imgf000017_0002
wherein L is a nucleophilic substitution leaving group and wherein ring C can be fused with phenyl or substituted, the same as defined for ring C"
The invention also provides a compound of the invention according to the following formula
Figure imgf000017_0003
wherein ring Cιx can be fused with phenyl or substituted, the same as defined for ring C", and is mono or di-unsaturated at one or more of the bonds indicated with the dased lines with the double bonds formed between ring carbons and no two double bonds are adjacent The invention also provides a compound of the following formula
Figure imgf000018_0001
that can be used to synthesize a compound of the invention, wherein I" is a negative counter-ion, wherein R ,28* is a (C1-C3) aliphatic group that can be substituted as defined for R , wherein ring Cv" can be fused with phenyl or substituted, the same as defined for ring C". The invention also provides a method of synthesizing this compound comprising reacting a compound of the formula
Figure imgf000018_0002
with a compound of the formula
Figure imgf000018_0003
, wherein L is a nucleophilic substitution leaving group, wherein ring C can be fused with phenyl or substituted, the same as defined for C".
The invention also provides a compound of the following formula
Figure imgf000018_0004
that can be used to synthesize a compound of the invention, wherein ring C" can be fused with phenyl or substituted, the same as defined for ring C" The invention also provides a method of synthesizing this compound, the method comprising reducing a compound of the following formula
Figure imgf000019_0001
, to reduce the double bonds in ring Cv", wherein ring Cv" can be fused with phenyl or substituted, the same as defined for ring C"
The invention also provides a method of synthesizing a compound that can be used to synthesize the compound of the invention, the method comprising synthesizing a compound of formula
Figure imgf000019_0002
by reacting a compound of the formula
Figure imgf000019_0003
with a compound of the formula
Figure imgf000019_0004
The invention also provides a method of synthesizing of a compound of the invention, the method comprising reacting a compound of formula
Figure imgf000020_0001
with Ar-Q wherein Ar is aryl which is substituted with an electron-withdrawing group or heteroaryl and is substituted with an electron-withdrawing group, and wherein Q is halide (preferably fluoro or chloro), to form
Figure imgf000020_0002
The invention also provides a method of synthesizing a compound that can be used to synthesize the compound of the invention, the method comprising synthesizing a compound of formula X
Figure imgf000020_0003
X by reacting a compound of formula
Figure imgf000020_0004
with RdNHSθ2Ar, wherein Ar is aryl or heteroaryl Preferably, the method further comprises converting the compound of formula X to
Figure imgf000021_0001
The invention also provides a method of synthesizing a compound that can be used to synthesize the compound of the invention, the method comprising reacting a compound of formula
Figure imgf000021_0002
with a compound of formula
Figure imgf000021_0003
, wherein L4 is a nucleophilic substitution leaving group, to form a compound of formula
Figure imgf000021_0004
The invention also provides a method of synthesizing a compound that can be used to synthesize the compound of the invention, the method comprising synthesizing the compound of formula:
Figure imgf000022_0001
said synthesis comprising reducing the ketone of a compound of formula
Figure imgf000022_0002
The invention also provides a compound of the following formula
Figure imgf000022_0003
that can be used to synthesize a compound of the invention, wherein I" is a negative counter-ion, wherein R28 is the same as R1 except that the bond to the ring is not a double bond, wherein ring Cx can be fused with phenyl or substituted, the same as defined for ring C". The invention also provides a method of synthesizing this compound, comprising reacting a compound of the formula
Figure imgf000022_0004
with a compound of the formula
Figure imgf000023_0001
, wherein L5 is a nucleophilic substitution leaving group, wherein ring C can be fused with phenyl or substituted, the same as defined for C"
The invention also provides a compound of the following formula
Figure imgf000023_0002
that can be used to synthesize a compound of the invention, wherein R28 is the same as R1 except that the bond to the ring is not a double bond, wherein ring Cx" can be fused with phenyl or substituted, the same as defined for ring C" The invention also provides a method of synthesizing this compound, the method comprising reducing a compound of the following formula
Figure imgf000023_0003
, to reduce the double bonds in ring Cx, ring Cx can be fused with phenyl or substituted, the same as defined for ring C"
BRIEF DESCRIPTION OF THE DRAWING
Figure depicts several reactions that can be employed in the synthesis of the compounds of the invention DEFINITIONS
The following terms shall have the meaning set forth below • accounting for ring heteroatoms
If two rings are linked to form a bicychc ring system, then a nitrogen located at one of the junctions is considered a heteroatom of each of the component rings excipient
Excipients are pharmaceutically acceptable organic or inorganic carrier substances suitable for parenterai, enteral (e g , oral or inhalation) or topical application that do not deletereiously react with the active compositions Suitable pharmaceutically acceptable carriers include but are not limited to water, salt solutions, alcohols, gum arable, benzyl alcohols, gelatine, carbohydrates such as lactose, amylose or starch, magnesium stearate, talc, silicic acid, hydroxymethylcellulose, polyvmylpyrrolidone, and the like
• effective amount
The meaning of "effective amount" will be recognized by clinicians but includes amount effective to (1) reduce, ameliorate or eliminate one or more symptoms of the disease sought to be treated, (2) induce a pharmacological change relevant to treating the disease sought to be treated, or (3) prevent or lessen the frequency of occurrence of a disease
• neuronal cell death prevention
Neuronal cell death is "prevented" if there is a reduction in the amount of cell death that would have been expected to have occurred but for the administration of a compound of the invention
• oxo substitution
References to oxo as a "substituβnt" refer to "=0" substitutions DETAILED DESCRIPTION The compounds of the invention are generally prepared according to one of the following synthetic schemes, although alternative schemes will be recognized by those of ordinary skill Reaction 1
Figure imgf000024_0001
Figure imgf000025_0001
In Reaction 1 and Reaction 2, L1 and L2 are good nucleophilic substitution leaving groups such as a halide, especially a bromide, a tosylate, a brosylate (p-bromobenzenesulfonate), and the like. The reaction is preferably conducted in the presence of a base such as potassium carbonate or a tertiary amine such as diisopropylethylamine. Where the leaving group is a halide, the reaction can be conducted in the presence of an iodide salt such as potassium iodide. Suitable organic solvents include, for example, methanol, dioxane, acetonitrile or dimethyformamide. The reaction is favorably conducted at a temperature range of about 15*C to about 40°C. Avoiding more elevated temperatures helps avoid producing the quaternary ammonium salt resulting from bis-alkylation. Reaction 3
Figure imgf000025_0002
Reaction 4
Figure imgf000026_0001
Figure imgf000026_0002
I"
Cmpound I1 can be reduced further, for instance in a Reaction 5 that produces
Figure imgf000026_0003
iii
A further Reaction 6 can be used to fully reduce ring Cv In the above-described Reactions 3 to 6, the bond between R1 and the ring is either at the 2, 3 or 4 position of the ring In the alkylation of Reaction 3, L4 is a good nucleophihc substitution leaving group such as a halide, especially a bromide Although not indicated above, the ring C can be substituted Suitable organic solvents include, for example, those that effectively solubilize the starting materials and are unreactive to the alkylation reagent Depending on the reactants, such solvents can include benzene, acetonitπle, tetrahydrofuran or ethanol The reaction is favorably conducted at a temperature range of about 20βC to about 100βC
In Reactions 4 and 5, the ring C is reduced by one of a number of reduction procedures known in the art, such as, for instance, reaction with a metal hydride such as sodium borohydπde See R M Acheson, G Paghetti, J Chem Soc . Perkm I. p 45, 1976 It will be recognized that, while the above reaction schemes describe the separate formation of various partially reduced compounds such as I1, I" and I"1, the ratio of these products and the ease with which they can be isolated will vary with each case, depending on such factors as the type of metal hydride used and the solvent used In Reaction 6, the ring Cv is further reduced by one of a number of reduction procedures known in the art, such as, for instance, hydrogenation in the presence of an appropriate hydrogenation catalyst For example, in many cases the hydrogenation can be conducted with a Pd/C catalyst and in an alcohol solvent
In Reaction 7, shown in the Figure, Rc and Rd are independently the same as defined for Rx The starting material III can be synthesized, for instance, using the chemistry of Reaction 15 (similar to Reaction 1), as follows
Reaction 15
Figure imgf000027_0001
wherein R has the same definition as R except that it does not include a nitrogen, does not include an oxygen linked to the above-illustrated carbonyl and does not include any double bonds conjugated with the above-illustrated carbonyl, and wherein L3 is a good nucleophilic substitution leaving group such as a halide, especially a bromide, a tosylate, a brosylate (p- bromobenzenesulfoπate), and the like
In Reaction 7, shown in the Figure, Rd-NH2 is reacted with III to form IV under conditions that effect a reductive alkylation The reductive alkylation can be effected by several known methods (see, for example, "Reductive Alkylation," W S Emerson in Organic Reactions. Vol 4, John Wiley & Sons, 1948, p 174 et sβq) including reaction with hydrogen in the presence of a catalyst such as palladium on carbon, reaction with sodium cyanoborohydπde or reaction with sodium triacetoxyborohydride when groups labile to catalytic hydrogenation are present It will be recognized that an intermediate Schiffs base is formed in the reaction, which Schiffs base is reduced to form the linkage The intermediate Schiffs base can be isolated and then reduced in a separate reaction. Solvent selection will vary with such factors as the solubility of the starting materials, the degree to which the solvent favors the dehydration reaction forming the Schiffs base, and the suitability of the solvent in the reduction process. Suitable solvents using catalytic hydrogenation to reduce the Schiffs base include ethanol. Suitable solvents using a borohydride to reduce the Schiffs base include alcoholic solvents such as methanol or ethanol. In some cases, a drying process can be employed during the reaction to promote the dehydration reaction that forms the Schiffs base that is reduced. Such drying processes include refluxing under conditions selected to remove water as an azeotrope or the use of molecular sieves or other drying reagents. Suitable reaction temperatures include the range from about 20°C to the reflux temperature of the solvent employed.
Alternatively, IV can be synthesized via Reaction 16, shown in the Figure, by reacting Rd-NH2 with X under the conditions described for Reaction 1 or Reaction 2 In another alternative, starting material III1 is prepared as follows: Reaction 17
Figure imgf000028_0001
Reaction 18
Figure imgf000028_0002
III1
These Reactions 17 and 18 use chemistry described above for Reactions 3 and 6, respectively This compound III' can be substituted for III in Reactions 7, 8 and 12, shown in the Figure. In Reaction 8, shown in the Figure, Re is independently the same as defined for R1. In Reaction 8, III or III' is reacted with a organometallic reagent such as an aryllithium or an aryl or arylalkyl Grignard reagent to form V, as described, for instance, in Section 5.1.2 of Cary and Sundberg, Advanced Organic Chemistry, Part 2, Plenum, New York, 1977, pp. 170-180, and references cited therein. Those of ordinary skill will be aware that in some cases where R5 includes an ester, the organometallic reagent may react with the ester group; in those such cases where the yield of the desired product is too low, the solvent, the organometallic reagent or the ester substitution can be varied.
In Reaction 9, shown in the Figure, V is subjected to conditions suitable for dehydration to form a double bond. Such conditions are, for instance, those described in H. Weiland, B_SL
45: 484 et seq. (1912), wherein V is refluxed with acetic anhydride. In the illustration, the double bond forms with the adjacent carbon atom of R1 . The double bond will typically form with this orientation where Rc and Re are aryl or heteroaryl and the adjacent carbon of Rr is saturated and not fully substituted, but other orientations are possible depending on the composition of Rc, Re and R1*. In reaction 10, shown in the Figure, VI is is reduced, for instance using any of a number of known methods for reducing carbon-carbon double bonds, such as catalytic hydrogenation in the presence of an appropriate catalyst.
In reaction 11, shown in the Figure, V is acylated, for instance, with acetic anhydride in the presence of an acylation catalyst such as 4-dimethylaminopyridine. In reaction 12, shown in the Figure, the ketone moiety of III or III' is reduced, for instance by any of a number of known methods for selectively reducing ketones, such as reaction with lithium tri-tert-butoxyaluminohydride. For reaction 13, shown in the Figure, the hydroxyl of IX is replaced by a leaving group L6, wherein the leaving group is, for instance, chloro or bromo, by reacting IX with, for instance, thionyl chloride or thionyl bromide. For reaction 14, shown in the Figure, Rf independently satisfies the definition of Rx. X is reacted with RfOH in the presence of a base such as K2C03 or sodium hydride. Alternatively, the thio-containing analog of XI can be synthesized by reacting X with RfSH.
In reaction 19, IX is reacted with R^HSO^r to yield XII, for instance for instance under the conditons of Mitzunobu reaction, and further converted into IV by reacton 20, analogously to the procedure described in J.R. Henry et al., Tetrahedron Letters 30: 5709-5712, 1989.
A number of other well-known synthetic approaches can be applied. For instance, acids can be formed by the hydrolysis of the corresponding esters. Amine derivatives can be formed by the alkylation of primary, secondary or tertiary amines. A number of double bond containing compounds can be hydrogenated to form the corresponding single bond. Compounds of the invention may also be prepared by adapting the classical solution chemistries outlined above into solid-phase synthetic techniques For example, R13, R'5, R'6, R17 and R20 can be residues other than hydrogen representing functionalized resin or suitably selected linker attached to functionalized resin The linker and the functional group represented by R5 should be stable under the conditions employed for the above-described reactions The compounds of the invention where R13, R15, R16, R17 is R20 is hydrogen, are then cleaved from the resin or the linker leaving the remainder of the molecule intact For example, solid-phase synthesis of peptoids [olιgo(N-substιtuted glycines)] using robotic synthesizer was described by Zuckermann et al , J. Am. Chem Soc . 114. 0646-10647, (1992) and Spellmeyer et al, WO 95/04072) Under analogous conditions, acylation reaction of Rink amide polystyrene resin with bromoacetic acid in the presence of N,N'-dιιsopropylcarbodιιmιde followed by displacement of the bromine with the amine component of reaction 1 or reaction 2, and cleavage can provide N-subsϋtutβd glycinamides (R13 and R14 are hydrogen)
In some cases, the chemistries outlined above may have to be modified, for instance by use of protective groups, to prevent side reactions due to reactive groups, such as reactive groups incorporated into heterocyclic rings or attached as substituents Using the reactions described herein, hydrolysis of esters, alkylation of amines, or hydrogenation reactions, the following compounds of the invention have been synthesized
Figure imgf000031_0001
Figure imgf000032_0001
Figure imgf000032_0002
It will be recognized that numerous salt forms of the compounds herein described are available and suitable for use in the invention or during the synthesis of compounds of the invention The invention contemplates that in certain instances where stereoisomers are available that one such isomer can be more active than another, in such a case, it will be desirable to isolate the particular isomeπc form The invention, of course, encompasses both the particular stereoisomers and racemic mixtures As described herein, chemical approaches, starting with for example commercially available, optically pure starting materials (or made using enantioselective reactions), can also used to synthesize optically pure versions of the compounds of the invention. It will be recognized that such optically pure compounds are within the invention Enantiomeπc excess ("ee") can be enhanced by purification techniques such as crystallization or chromatography on chiral supports Enantiomeπc excess can be quantitated by a number of analytic techniques including NMR, optical rotation measurements and appropriate chromatography.
Additional, related compounds are described in U.S. Patent Applications were filed concurrently with the parents hereof as U.S. Serial No. 08/656,063 (Docket No. 317743-103, Ognyanov et al.) U.S Serial No. 08/655,912 (Docket No. 317743-106, Ognyanov et al ), U S Serial No. 08/807,754 (PHARMACEUTICAL FOR TREATMENT OF NEUROLOGICAL AND NEUROPSYCHIATRIC DISORDERS, Docket No. 317743-103A, Ognyanov et al.) and U S Serial No 08/807,682 (PHARMACEUTICAL FOR TREATMENT OF NEUROPSYCHIATRIC AND NEUROLOGICAL DISORDERS, Docket No 317743-106A, Ognyanov et al ), which applications are also incorporated herein by reference in their entirety Further incorporated by reference in their entirety are U S Application No 08/655,847 (Docket No 317743-107, Ognyanov et al ) and U S Application No 08/807,681 (Docket No 317743-107A, Ognyanov et al ), the parents of the present application
It will be recognized that some combinations of components of the compounds of the invention will be less stabile than others For example, when the ring D or the ring E is fully saturated any two ring heteroatoms should typically be separated by at least two ring carbons to maintain stability The compounds having sufficient stability to be useful as pharmaceuticals are of greater usefulness
In a preferred embodiment, the D ring or the E ring is substituted with at most one of aryl or heteroaryl
The glycine transporter genes and their respective gene products are responsible for the reuptake of glycine from the synaptic cleft into presynaptic nerve endings or ghal cells, thus terminating the action of glycine Neurological disorders or conditions associated with improperly controlled glycine receptor activity, or which could be treated with therapeutic agents that modulate glycine receptor activity, include spasticity (Becker, FASEB Journal, 4, 2767-2774 (1990)) and pain realization (Yaksh, Pajn, 37, 111-123 (1989)) Additionally, glycine interacts at N-methyl-D-aspartate (NMDA) receptors, which have been implicated in learning and memory disorders and certain clinical conditions such as epilepsy, Alzheimer's and other cognition-related diseases, and schizophrenia See Rison and Stanton, Neurosci Biobehav Rev . 19, 533-552 (1995), Danysz et al , Behavioral Pharmacol . 6, 455-474 (1995)
Compounds that inhibit GlyT-1 mediated glycine transport will increase glycine concentrations at NMDA receptors, which receptors are located in the forebrain, among other locations This concentration increase elevates the activity of NMDA receptors, thereby alleviating schizophrenia and enhancing cognitive function Alternatively, compounds that interact directly with the glycine receptor component of the NMDA receptor can have the same or similar effects as increasing or decreasing the availability of extracellular glycine caused by inhibiting or enhancing GlyT-1 activity, respectively See, for example, Pitkanen et al , Eur J Pharmacol . 253. 125-129 (1994), Thiels et al , Neuroscience. 46, 501-509 (1992), and Kretschmer and Schmidt, J Neurosci.. 16, 1561-1569 (1996) Compounds that inhibit GlyT-2 mediated glycine transport will increase glycine concentrations at receptors located primarily in the brain stem and spinal cord, where glycine acts as an inhibitor of synaptic transmission These compounds are effective against epilepsy, pain and spasticity, myospasm and other such conditions See, for example, Becker, FASEB J . 4, 2767-2774 (1990) and Yaksh, Pain, 3Z, 111-123 (1989)
The compounds of the invention are, for instance, administered orally, sublmgually, rectally, nasally, vaginally, topically (including the use of a patch or other transdermal delivery device), by pulmonary route by use of an aerosol, or parenterally, including, for example, intramuscularly, subcutaneously, intrapeπtoneally, intraarteπally, intravenously or intrathecally Administration can be by means of a pump for periodic or continuous delivery The compounds of the invention are administered alone, or are combined with a pharmaceutically-acceptable carrier or excipient according to standard pharmaceutical practice For the oral mode of administration, the compounds of the invention are used in the form of tablets, capsules, lozenges, chewing gum, troches, powders, syrups, elixirs, aqueous solutions and suspensions, and the like In the case of tablets, carriers that are used include lactose, sodium citrate and salts of phosphoric acid Various dismtegrants such as starch, and lubricating agents such as magnesium stearate and talc, are commonly used in tablets For oral administration in capsule form, useful diluents are lactose and high molecular weight polyethylene glycols If desired, certain sweetening and/or flavoring agents are added For parenteral administration, sterile solutions of the compounds of the invention are usually prepared, and the pHs of the solutions are suitably adjusted and buffered For intravenous use, the total concentration of solutes should be controlled to render the preparation isotonic For ocular administration, ointments or droppable liquids may be delivered by ocular delivery systems known to the art such as applicators or eye droppers Such compositions can include mucomimetics such as hyaluronic acid, chondroitin sulfate, hydroxypropyl methylcellulose or polyvinyl alcohol, preservatives such as sorbic acid EDTA or benzylchromium chloride, and the usual quantities of diluents and/or carriers For pulmonary administration, diluents and/or carriers will be selected to be appropriate to allow the formation of an aerosol
Suppository forms of the compounds of the invention are useful for vaginal, urethral and rectal administrations Such suppositories will generally be constructed of a mixture of substances that is solid at room temperature but melts at body temperature The substances commonly used to create such vehicles include theobroma oil, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weight and fatty acid esters of polyethylene glycol See, Remington's Pharmaceutical Sciences, 16th Ed , Mack Publishing, Easton, PA, 1980, pp 1530-1533 for further discussion of suppository dosage forms Analogous gels or cremes can be used for vaginal, urethral and rectal administrations Numerous administration vehicles will be apparent to those of ordinary skill in the art, including without limitation slow release formulations, liposomal formulations and polymeric matrices
Examples of pharmaceutically acceptable acid addition salts for use in the present invention include those derived from mineral acids, such as hydrochloric, hydrobromic, phosphoric, metaphosphoπc, nitric and sulfunc acids, and organic acids, such as tartaπc, acetic, citric, malic, lactic, fumaπc, benzoic, glycolic, gluconic, succmic, p-toluenesulphonic and arylsulphonic acids, for example Examples of pharmaceutically acceptable base addition salts for use in the present invention include those derived from non-toxic metals such as sodium or potassium, ammonium salts and organoamino salts such as tnethylamine salts Numerous appropriate such salts will be known to those of ordinary skill
The physician or other health care profesional can select the appropriate dose and treatment regimen based on the subject's weight, age, and physical condition Dosages will generally be selected to maintain a serum level of compounds of the invention between about 0 01 μg/cc and about 1000 μg/cc, preferably between about 0 1 μg/cc and about 100 μg/cc For parenteral administration, an alternative measure of preferred amount is from about 0 01 mg/kg to about 10 mg/kg, more preferably from about 0 1 mg/kg to about 1 mg/kg, will be administered For oral administrations, an alternative measure of preferred administration amount is from about 0 1 mg/kg to about 10 mg/kg, more preferably from about 0 1 mg/kg to about 1 mg/kg For administrations in suppository form, an alternative measure of preferred administration amount is from about 0 1 mg/kg to about 10 mg/kg, more preferably from about 0 1 mg/kg to about 1 mg/kg
For use in assaying for activity in inhibiting glycine transport, eukaryokic cells, preferably QT-6 cells derived from quail fibroblasts, have been transfected to express one of the three known variants of human GlyT-1, namely GlyT-1a, GlyT-1b or GlyT-1c or human GlyT-2 The sequences of these GlyT-1 transporters are described in Kim et al , Molec Pharm 45 608-617, 1994, excepting that the sequence encoding the extreme N-terminal of GlyT-1a was merely inferred from the corresponding rat-derived sequence This N-terminal protein-encoding sequence has now been confirmed to correspond to that inferred by Kim et al The sequence of the human GlyT-2 is described by Albert et al., U S. Application No 08/700,013, filed August 20, 1996, which is incorporated herein by reference in its entirety Suitable expression vectors include pRc/CMV (Invitrogen), Zap Express Vector (Stratagene Cloning Systems, LaJolla, CA, hereinafter "Stratagene"), pBk/CMV or pBk-RSV vectors (Stratagene), Bluescπpt II SK -n'- Phagemid Vectors (Stratagene), LacSwitch (Stratagene), pMAM and pMAM neo (Clontech), among others A suitable expression vector is capable of fostering expression of the included GlyT DNA in a suitable host cell, preferably a non-mammalian host cell, which can be eukaryotic, fungal, or prokaryotic Such preferred host cells include amphibian, avian, fungal, insect, and reptilian cells
As discussed above, the compounds of the invention have a number of pharmacological actions The relative effectiveness of the compounds can be assessed in a number of ways, including the following
• comparing the activity mediated through GlyT-1 and GlyT-2 transporters This testing identifies compounds (a) that are more active against GlyT-1 transporters and thus more useful in treating or preventing schizophrenia, increasing cognition and enhancing memory or (b) that are more active against GlyT-2 transporters and thus more useful in treating or preventing epilepsy, pain, spasticity or myospasm
• testing for NMDA receptor binding This test establishes whether there is sufficient binding at this site, whether antagonist or agonist activity, to warrant further examination of the pharmacological effect of such binding
• testing the activity of the compounds in enhancing or diminishing calcium fluxes in primary neuronal tissue culture. A test compound that increases calcium flux either (a) has little or no antagonist activity at the NMDA receptor and should not affect the potentiation of glycine activity through GlyT-1 transporter inhibition or (b), if marked increases are observed over GlyT-1 inhibitors used for comparison and that have little direct interaction with NMDA receptors, then the compound is a receptor agonist In either of the above-described cases, the test confirms activity in treating or preventing schizophrenia, increasing cognition, or enhancing memory In contrast, a test compound that decreases calcium flux has a net effect wherein receptor antagonist activity predominates over any activity the compound has in increasing glycine activity through inhibiting glycine transport In this case, the test confirms activity in limiting or preventing the cell damage and cell death arising after stroke or other ischemia- mducing conditions, or in limiting or preventing the cell damage associated with neurodegenerative diseases All animal methods of treatment or prevention described herein are preferably applied to mammals, most preferably humans
The following examples further illustrate the present invention, but of course, should not be construed as in any way limiting its scope Example 1 - Synthesis of 3-bιs(4-fluorophenyl)methoxypιperidin-1-yl acetic acid ethyl ester (compound C5)
A mixture of 0 170 g (05 mmol) of 3-bιs(4-fluorophenyl)methoxypιpeπdine (prepared in three steps from 3-hydroxypιperιdιne hydrochlonde (Aldrich) using the synthetic scheme described by E. Falch, P Krogsgaard-Larsen, Eur. J. Med. Chem. 1991, 26, 69-78, for the synthesis of 3- diphenylmethoxypipeπdine], 0.092 g (0.55 mmol) ethyl bromoacetate (Aldrich) and 0.276 g
(2 mmol) potassium carbonate in 1 ml acetonitrile was stirred under argon for 20 hours The reaction mixture was filtered, the solvent evaporated and the residue purified by preparative TLC with 30% ethyl acetate in hexanes to give 0.150 g (yield 77%) 3-bιs(4-fluorophenyl) methoxypιperidιn-1-yl acetic acid ethyl ester (compound C5) as an oil. NMR spectra of the product showed 1H NMR (CDCI3, 300 MHz) s 7.60 - 7 35 (m, 4 H), 7.35 - 7.00 (m, 4 H), 572 (s, 1 H), 438 (q, 2 H), 390 - 3.65 (m, 1 H), 3.42 (br. s, 2 H), 325 (d, 1 H), 297 (d, 1 H), 242 (dt, 2 H), 2 17 (d, 1 H), 200 - 1 80 (m, 1 H), 1.70 (dt, 1 H), 1 60 -1.50 (m, 1 H), 1 46 (t, 3 H), 13C NMR (CDCIj, 75 MHz) δ 170 16, 163.52, 160.27, 138 14, 138.11, 128.50, 12840, 115.13, 114.85, 7930, 72 45, 60.27, 59.31, 57.83, 52.80, 3006, 23.12, 14.01
Example 2 - Additional Syntheses for Reactons 1 and 2:
Compounds were synthesized using Reaction 1 or Reaction 2, as follows
Compound Reaction Amine Reagent Solvent Yield
C3 1 2 A X 38%
C4 2 1 A X 58%
C6 2 3 A X 86%
C10 1 4 A X 89%
C14 2 5 B X 65%
C15 1 6 A X 67%
Amine: 1) 4,4-diphenylpipeπdιne (J.M. Wetzel et al , J Med. Chem . 38 1579-1581.
1995); 2) α,α-diphenyl-4-piperιdιnomethanol (Acros, Pittsburgh, PA); 3) 2,2-diphenyl-4A,5,6,7,8,8A-hexahydro-4H-1,3-dioxino[5,4-b]pyridine (Sigma-Aldrich Library of Rare Chemicals), 4) perhexiline maleate [2-(2,2-dicyclohexylethyl)pipendyne] (Sigma, St Louis), 5) 3,3-diphenyl-2-ethylpyrrolidine [prepared by sodium borohydride reduction of 3,3-dιphenyl-2- ethyl-1-pyrroline (Sigma-Aldrich Library of Rare Chemicals)]; 6) 2,2-dιphenyl-1,3-dioxolan-4- yl)pιpeπdine hydrochlonde (Sigma-Aldrich Library of Rare Chemicals)].
Reagent: A) ethyl bromoacetate (Aldrich); B) benzyl 2-bromoacetate (Aldrich) Solvent X) acetonitπle
Example 3 - Synthesis of 3-Diphenylmethyl-1,2.3.6.-tetrahydropyndin-1-yl acetic acid ethyl ester (Compound C1)
Step 1 A mixture of 0490 g (2 mmol) 3-dιphenylmethylpyrιdιne (Sigma-Aldrich Library of Rare Chemicals) and 0334 g (4 mmol) ethyl bromoacetate (Aldrich) in 2 ml acetonitπle was heated under reflux for 1 hour The solvent was evaporated, the residue suspended in diethyl ether and filtered to give 08 g 1-ethoxycarbonylmethyl-3-diphenylmethylpyndinium bromide as a yellow powder Η NMR (CD3OD, 300 MHz) δ 887 (d, 1 H), 877 (s, 1 H), 842 (d, 1 H), 8 10
(dd, 1 H), 750 - 7.10 (m, 10 H), 5.96 (s, 1 H), 555 (s, 2 H), 4.28 (q, 2 H), 1 29 (t, 3 H) Step 2 To an ice cooled solution of 0206 g (05 mmol) 1-ethoxycarbonylmethyl-3- diphenylmethylpyπdinium bromide (from step 1) was added 0 034 g (092 mmol) sodium borohydride in small portions with stirring over one hour The solvent was evaporated, the residue dissolved in diethyl ether, washed with water and dried with magnesium sulphate After evaporation of the solvent, the residue was chromatographed on silica gel column with 30% ethyl acetate in hexanes to give 0 107 g (64%) 3-dtpheny Imβthy I- 1 ,2,3,6-tβtrahydropy ridin- 1 -y I acetic acid ethyl ester (compound C1) as a pale yellow oil NMR spectra showed Η NMR (CDCI3, 300 MHz) δ 7 40 - 7 10 (m, 10 H), 522 (br s, 1 H), 461 (s, 1 H), 4 12 (q, 2 H), 3 25 (s, 2 H), 303 (s, 2 H), 268 (t, 2 H), 222 (br s, 2 H), 1 19 (t, 3 H), ,3C NMR (CDCI3 75 MHz) δ 17024, 141 86, 13789, 129 11, 128 10, 126 19, 12324, 6031, 5879, 56 24, 55 13, 4951, 2564, 1405 EI-MS 335 (10, IvT , C22H25N02), 262 (50)
Example 4 - Additional Syntheses
Compound C8 was prepared in 29% yield by sodium borohydride reduction of the corresponding quaternary salt of 4-dιphenylmethylpyrιdιne (Aldrich) using the methodology of
Example 3 Example 5 - Hydrogenation of compound C1 to form 3-diphenylmethylpιpeπdιn-1-yl acehc acid ethyl ester (compound C2)
0041 g (0 122 mmol) or 3-dιphenylmethyl-1, 2,3,6 -tetrahy dropy ridin- 1 -yl acetic acid ethyl ester (compound C1) was hydrogenated with 0040 g 10% Pd/C in 4 ml ethanol at 40 psi for 6 hours at room temperature The mixture was filtered from the catalyst through celite and the solvent evaporated to give 0038 g (yield 93%) 3-dιphenylmethylpιperιdιn-1-yl acetic acid ethyl ester (compound C2) as an oil NMR spectra of the product showed' 1H NMR (CDCI3, 300
MHz) δ 740 - 710 (m, 10 H), 411 (q, 2 H), 352 (d, 1 H), 310 (s, 2 H), 287 (d, 1 H), 272 (d,
1 H), 265 - 240 (m, 1 H), 220 - 200 (m, 1 H), 187 (t, 1 H), 170 - 150 (m, 3 H), 117 (t, 3 H), 1 00 - 08 (m, 1 H), 13C NMR (CDCI3, 75 MHz) δ 16889, 142 11, 141 81, 12692, 12690,
126 36, 126 28, 124.58, 12450, 5878, 5847, 57 29, 5534, 52.05, 37 97, 2786, 2358, 1257
EI-MS 337 (5, M* , C22H27N02), 264 (70)
Example 6A - Additional syntheses: Compound C7 is prepared by hydrogenation of compound C8 using the methodology of
Example 5
Example 6B - Additional Syntheses Using the Procedure of Example 6A
Compound C13 was prepared by hydrogenation of compound C14 (using the methodology of Example 6A), followed by acidification with HCI Example 6C - Synthesis of 2-(2.2-Dicyclohexylethyl)piperidin-1-yl acetic acid hydrochlonde (Compound C9)
To a solution of 0413 g (1 136 mmol) 2-(2,2-dιcyclohexylethyl)pιperιdιn-1-yl acetic acid ethyl ester (Compound C10) in 4 ml methanol was added 8 ml 1N sodium hydroxide and the mixture was heated under reflux for one hour The reaction mixture was concentrated to half volume, acidified with 4N hydrochloric acid, and extracted four times with methylene chloride. The combined extracts were dried and evaporated to give 0400 g (yield 95%) 2-(2,2- dιcyclohexylethyl)pιpeπdιn-1-yl) acetic acid hydrochlonde (Compound C9). Example 6D - Additional Syntheses Using the Procedure of Example 6C
Compound C11 was prepared by hydrolysis of Compound C2, followed by acidification
Compound C12 was prepared by hydrolysis of Compound C1, followed by acidification
Example 7 - Preparation of Cells Expressing GlvT-1 and GlvT-2
This example sets forth methods and materials used for growing and transfecting QT-6 cells.
QT-6 cells were obtained from American Type Culture Collection (Accession No. ATCC CRL-1708) Complete QT-6 medium for growing QT-6 is Medium 199 (Sigma Chemical Company, St. Louis, MO, hereinafter "Sigma") supplemented to be 10% tryptose phosphate, 5% fetal bovine serum (Sigma); 1% penicillin-streptomycin (Sigma); and 1% sterile dimethylsulfoxide (DMSO; Sigma) Other solutions required for growing or transfecting QT-6 cells included.
DNA/DEAE Mix. 450 μl TBS, 450 μl DEAE Dextran (Sigma), and 100 μl of DNA (4 μg) in TE, where the DNA includes GlyT-1a, GlyT-1b , GlyT-1c, or GlyT-2, in a suitable expression vector The DNA used was as defined below. PBS: Standard phosphate buffered saline, pH 7.4 including 1 mM CaCI2 and 1 mM MgCI2 sterilized through 0.2 μ filter.
TBS: One ml of Solution B, 10 ml of Solution A; brought to 100 ml with distilled H20; filter-sterilized and stored at 4°C. IE: 0.01 M Tris, 0.001 M EDTA, pH 8.0.
DEAE dextran: Sigma, #D-9885. A stock solution was prepared consisting of 0.1% (1 mg/ml) of the DEAE dextran in TBS. The stock solution was filter sterilized and frozen in 1 ml aliquots.
Chloroquine: Sigma, #C-6628. A stock solution was prepared consisting of 100 mM chloroquine in H20. The stock solution was filter-sterilized and stored in 0.5 ml aliquots, frozen.
Solution A f10X>:
NaCI 8.00 g
KCI 0.38 g
Tris base 3.00 g Na2HP04 0.20 g
The solution was adjusted to pH 7.5 with HCI, brought to 100.0 ml with distilled H20, and filter-sterilized and stored at room temperature. Solution B M00)Q:
CaCI22H20 1.5 g MgCI26H20 1.0 g
The solution was brought to 100 ml with distilled H20, and filter-sterilized; the solution was then stored at room temperature.
HBSS: 150 mM NaCI, 20 mM HEPES, 1 mM CaCI2, 10 mM glucose, 5 mM KCI, 1 mM MgCI2 «H20; adjusted with NaOH to pH 7.4. Standard growth and passaging procedures used were as follows: Cells were grown in
225 ml flasks. For passaging, cells were washed twice with warm HBSS (5 ml each wash). Two ml of a 0.05% trypsin/EDTA solution was added, the culture was swirled, then the trypsin/EDTA solution was aspirated quickly. The culture was then incubated about 2 minutes (until ceils lift off), then 10 ml of QT-6 media was added and the cells were further dislodged by swirling the flask and tapping its bottom. The cells were removed and transferred to a 15 ml conical tube, centrifuged at 1000 xg for 10 minutes, and resuspended in 10 ml of QT-6 medium. A sample was removed for counting, the cells were then diluted further to a concentration of 1 x 105 cells/ml using QT-6 medium, and 65 ml of the culture was added per 225 ml flask of passaged cells. Transfection was accomplished using cDNA's prepared as follows The rat GlyT-2 (rGlyT-2) clone used contains the entire sequence of rGlyT-2 cloned into pBluescnpt SK+(Stratagene) as an Eco Rl - Hind III fragment, as described in Liu et al , J Biol Chem 268. 22802-22808 (1993) GlyT-2 was then subcloned into the pRc/RSV vector as follows A PCR fragment corresponding to nucleotides 208 to 702 of the rGlyT-2 sequence was amplified by PCR using the oiigonucleotide 5'GGGGGAAGCTTATGGATTGCAGTGCTCC 3' as the 5' primer and the oiigonucleotide
5' GGGGGGGTACCCAACACCACTGTGCTCTG 3' as the 3' primer This created a Hind III site immediately upstream of the translation start site This fragment, which contained a Kpn I site at the 3' end, along with a Kpn 1 - Pvu II fragment containing the remainder of the coding sequence of rGlyT-2, were cloned into pBluescnpt SK+ previously digested with Hind III and Sma I, in a three part hgation A Hind III - Xba 1 fragment from this clone was then subcloned into the pRc/RSV vector The resulting construct contains nucleotides 208 to 2720 of the rGlyT-2 nucleic acid in the pRc/RSV expression vector The human GlyT-1a (hGlyT-1a) clone used contains the sequence of hGlyT-1a from nucleotide position 183 to 2108 cloned into the pRc/CMV vector (Invitrogen, San Diego, CA) as a Hind lll-Xba 1 fragment as described in Kim et al , Mol Pharmacol . 45, 608-617, 1994 This cDNA encoding GlyT-1a actually contained the first 17 nucleotides (corresponding to the first 6 ammo acids) of the GlyT-1a sequence from rat To determine whether the sequence of human GlyT-1a was different in this region, the 5' region of hGlyT-1a from nucleotide 1 to 212 was obtained by rapid amplification of cDNA end using the 5' RACE system supplied by Gibco BRL (Gaithersburg, MD) The gene specific primer 5' CCACATTGTAGTAGATGCCG 3' corresponding to nucleotides 558 to 539 of the hGlyT-1a sequence, was used to prime cDNA synthesis from human brain mRNA, and the gene specific primer 5' GCAAACTGGCCGAAGGAGAGCTCC 3', corresponding to nucleotides 454 to 431 of the hGlyT-1a sequence, was used for PCR amplification Sequencing of this 5' region of GlyT-1a confirmed that the first 17 nucleotides of coding sequence are identical in human and rat GlyT-1a
The human GlyT-1b (hGlyT-1b) clone used contains the sequence of hGlyT-1b from nucleotide position 213 to 2274 cloned into the pRc/CMV vector as a Hind III - Xba I fragment as described in Kim et al , Mol Pharmacol . 4JS, 608-617, 1994
The human GtyT-1c (hGlyT-1c) clone used contains the sequence of hGlyT-1c from nucleotide position 213 to 2336 cloned into the pRc/CMV vector (Invitrogen) as a Hind III - Xba I fragment as described in Kim et al , Mol Pharmacol.. 45, 608-617, 1994 The Hind lll - Xba fragment of hGlyT-1c from this clone was then subcloned into the pRc/RSV vector Transfection experiments were performed with GlyT-1c in both the pRc/RSV and pRc/CMV expression vectors The following four day procedure for the tranfections was used. On day 1, QT-6 cells were plated at a density of 1 x 106 cells in 10 ml of complete QT- 6 medium in 100 mm dishes
On day 2, the media was aspirated and the cells were washed with 10 ml of PBS followed by 10 ml of TBS The TBS was aspirated, and then 1 ml of the DEAE/DNA mix was added to the plate The plate was swirled in the hood every 5 minutes. After 30 minutes, 8 ml of 80 μM chloroquine, in QT-6 medium was added and the culture was incubated for 2.5 hours at 37"C and 5% C02 The medium was then aspirated and the cells were washed two times with complete QT-6 media, then 100 ml complete QT-6 media was added and the cells were returned to the incubator
On day 3, the cells were removed with trypsin/EDTA as described above, and plated into the wells of 96-well assay plates at approximately 2x105 cells/well On day 4, glycine transport was assayed as described in Example 8
Example 8 - Assay of Transport Via GlyT-1 or GlvT-2 transporters
This example illustrates a method for the measurement of glycine uptake by transfected cultured cells
Transient GlyT-transfected cells grown in accordance with Example 7 were washed three times with HEPES buffered saline (HBS) The cells were then incubated 10 minutes at 37°C, after which a solution was added containing 50 nM [3H]glyctne (17 5 Ci/mmol) and either (a) no potential competitor, (b) 10 mM nonradioactive glycine or (c) a concentration of a candidate drug A range of concentrations of the candidate drug was used to generate data for calculating the concentration resulting in 50% of the effect (e.g., the IC50s, which are the concentrations of drug inhibiting glycine uptake by 50%) The cells were then incubated another 10 minutes at 37°C, after which the cells were aspirated and washed three times with ice-cold HBS The cells were harvested, sαntillant was added to the cells, the cells were shaken for 30 minutes, and the radioactivity in the cells was counted using a scintillation counter. Data were compared between the same cells contacted or not contacted by a candidate agent, and between cells having GlyT-1 activity versus cells having GlyT-2 activity, depending on the assay being conducted.
Example 9 - Assay of Binding to NMDA Receptors
This example illustrates binding assays to measure interaction of compounds with the glycine site on the NMDA receptor Direct binding of [3H]glycine to the NMDA-giycine site was performed according to the method of Grimwood et al., Molecular Pharmacology. 41, 923-930 (1992); Yoneda et al., i Neurochem. 62, 102-112 (1994).
Preparation of membranes for the binding test required application of a series of standard methods. Unless otherwise specified, tissues and homogenates were kept on ice and centrifugations were conducted at 4°C. Homogenizations were conducted with an effort to minimize resulting rise in tissue/homogenate temperature. The membrane preparation included the following steps:
1. Sacrifice and decapitate four rats; remove cortices and hippocampi. 2. Homogenize tissue in twenty volumes of 0.32 M sucrose/5 mM Tris-
Acetate (pH 7.4) with 20 strokes of a glass/teflon homogenizer.
3. Centrifuge tissue at 1000 x g, 10 minutes. Save supernatant. Resuspend pellet in small volume of buffer and homogenize again. Centrifuge the homogenized pellet and combine the supernatant with the previous supernatant.
4. Centrifuge the combined supematants at 40,000 x g, for 30 minutes. Discard the supernatant.
5. Resuspend the pellet in 20 volumes of 5 mM Tris-Acetate (pH 7.4). Stir the suspension on ice for one hour. Centrifuge the suspension at 40,000 x g for 30 minutes. Discard the supernatant and freeze the pellet for at least 24 hours.
6. Resuspend the pellet from step 5 in Tris Acetate buffer (5 mM, pH 7.4) containing 0.1% saponin (w/v; Sigma Chemical Co., St. Louis) to a protein concentration of 1 mg/ml. Leave on ice for 20 minutes. Centrifuge the suspension at 40,000 x g for 30 minutes. Resuspend the pellet in saponin-free buffer and centrifuge again. Resuspend the pellet in Tris-Acetate buffer at a concentration of 10 mg/ml and freeze in aliquots.
7. On day three, remove an aliquot of membranes and thaw on ice. Dilute the suspension into 10 ml Tris-Acetate buffer and centrifuge at
40,000 x g for 30 minutes. Repeat the wash step twice more for a total of 3 washes. Resuspend the final pellet at a concentration of 1 mg/ml in glycine-free Tris-Acetate buffer. The binding test was performed in eppendorf tubes containing 150 μg of membrane protein and 50 nM [3H]glycιne in a volume of 05 ml Non-specific binding was determined with 1 mM glycine Drugs were dissolved in assay buffer (50 mM Tπs-acetate, pH 74) or DMSO (final concentration of 0 1%) Membranes were incubated on ice for 30 minutes and bound radioligand was separated from free radioligand by filtration on Whatman GF/B glass fiber filters or by centπfugation (18,000 x g, 20 mm) Filters or pellet was washed three times quickly with ice-cold 5 mM Tris-acetate buffer Filters were dried and placed in scintillation tubes and counted Pellets were dissolved in deoxycholate/NaOH (0 1 N) solution overnight, neutralized and radioactivity was determined by scintillation counting A second binding test for the NMDA-glycine site used [3H]dιchlorokynurenιc acid (DCKA) and membranes prepared as above See, Yoneda et al , J Neurochem . 60,634-645 (1993) The binding assay was performed as described for [3H]glycιne above except that [3H]DCKA was used to label the glycine site The final concentration of [3H]DCKA was 10 nM, and the assay was performed for 10 minutes on ice A third binding test used for the NMDA-glycine site used indirect assessment of affinity of ligands for the site by measuring the binding of [3H]MK-801 (dizocilpine) See, Palmer and Burns, J Neurochem . 62, 187-196 (1994) Preparation of membranes for the test was the same as above The binding assay allowed separate detection of antagonists and agonists
The third binding test was operated to identify antagonists as follows 100 μg of membranes were added to wells of a 96-well plate, along with glutamate (10 μM) and glycine (200 nM) and various concentrations of the ligand to be tested The assay was started by the addition of 5 nM [3H]MK-801 (239 Ci/mmol), which binds to the ion channel associated with NMDA receptors The final volume of the assay was 200 μl The assay was performed for 1 hour at room temperature Bound radioactivity was separated from free by filtration, using a TOMTEC harvester Antagonist activity was indicated by decreasing radioactivity associated with the NMDA receptor with increasing concentration of the tested ligand
The third binding test was operated to identify agonists by performing the test as above, except that the concentration of glycine was 200 nM Agonist activity was indicated by increasing radioactivity associated with the NMDA receptor with increasing concentration of the tested ligand Example 10 - Assay of Calcium Flux
This example illustrates a protocol for measuring calcium flux in primary neuronal calls The calcium flux measurement is performed in primary neuronal cell cultures, which are prepared from rat fetal cortices dissected from pregnant rats using standard procedures and techniques that require sterile dissecting equipment, a microscope and defined medium The protocol used was adapted from Lu et al , Proc Nat'l Acad. Sci USA. 88, 6289-6292 (1991) Defined medium is prepared in advance in accordance with the following recipe
Components Source (catatoαue #) Final Concentration D-glucose Sigma (G-7021) 06% traπsfernn Sigma (T-2252) 100 μg/ml insulin Sigma (I-5500) 25 μg/ml progesterone Sigma (P-6149) 20 nM putrescme Sigma (P-7505) 60 μM selenium Sigma (S-5261) 30 nM pen-strep4 GIBCO (15070-014) 0 5 U-05 μg/ml
L-glutamme* GIBCO (25030-016) 146 mg/l MEM GIBCO (11095 or 11090) 500 ml/l F-12 GIBCO (11765) 500 ml/l
» pen-strep 5,000 U/ml penicillin and 5,000 μg/ml steptomycin
* add only when MEM without L-glutamine is used ° with L-glutamme or without L-glutamine, respectively
Before starting the dissection, tissue culture plates were treated with polylysine (100 μg/ml for at least 30 minutes at 37°C) and washed with distilled water Also, a metal tray containing two sets of sterile crude dissecting equipment (scissors and tweezers) and several sets of finer dissecting tools was autoclaved A pair of scissors and tweezers were placed into a sterile beaker with 70% alcohol and brought to the dissecting table A petπ dish with cold phosphate buffered saline (PBS) was placed on ice next to the place of dissection A pregnant rat (E15 or 16 on arrival from Hilltop Lab Animals (Scottdale, PA), E17 or 18 at dissection) was placed in a CO^dry ice chamber until it was unconscious The rat was removed, pinned to a backing, the area of dissection was swabbed with 70% alcohol, and skin was cut and removed from the area of interest A second pair of scissors was used to cut through and remove the prenatal pups in their sacs The string of sacs was placed into the cold PBS and transported to a sterile hood
The prenatal pups were removed from the sacs and decapitated The skulls were then removed and the brains were carefully dislodged and placed into a clean petπ dish with cold PBS At this point, it was necessary to proceed with a dissecting microscope The brain was turned so that the cortices were contacting the plate and the tissue between the dissector and the cortex (stπatum and other brain parts) was scooped out The hippocampus and olfactory bulb were cut away from the cortex Then the tissue was turned over and the meninges were removed with tweezers The remaining tissue (cortex) was placed in a small petπ dish with defined media The tissue was chopped with a scalpel and then triturated with a glass pipet that had been fire polished The chopped, triturated tissue was then transferred to a sterile plastic tube and continued to be triturated with a glass pipet with a finer opening Cells were counted in a suitable counting chamber Cells were plated at roughly 40,000 cells/well in 100 μl of defined medium for 96-well plates, 200,000 cells/well in 500 μl in 24-well plates, 400,000 cells/well in
1 ml in 12-welt plates, 1 5 * 10β cells/35 mm dish in 1 5 ml and 10 * 108 cells/100 mm dish in 10 ml To inhibit glia growth, cultures were treated with 100 μM 5-flouro-2-deoxyurιdιne (FDUR, Sigma (F-0503)) or 50/μM undine (Sigma (U-3003)) and 50 μM FDUR
The cortical cultures for the standard calcium flux assay were grown in 24-well plates in the defined medium described above for 7 days and fed once with serum containing media (10% heat inactivated fetal calf serum, 06% glucose in MEM) by exchanging half of the medium Cultures were used after 12 days of incubation in vitro The cultures were rinsed three times with HCSS (ι e HEPES-buffered control salt solution, containing 120 mM NaCI, 54 mM KCI, 1 8 mM CaCI2 25 mM HEPES, and 15 mM glucose, in HPLC water and adjusted to pH 7 4 by NaOH, which was also made in HPLC water) In the third wash, the culture was incubated at 37"C for
20 to 30 minutes
Solutions containing 45Ca~ (5000 dpm/ml) and drugs for testing or controls were prepared in HCSS Immediately before the above 45Ca~ solutions were added, cultures were washed twice with HCSS, and 250 μl of 45Ca" solution per well was added, one plate at a time The cultures were incubated for 10 minutes at room temperature, rinsed three times with HCSS, and 1 ml scintillation liquid per well was added, followed by shaking for at least 15 minutes Retained radioactivity was counted in a scintillation counter
While this invention has been described with an emphasis upon preferred embodiments, it will be obvious to those of ordinary skill in the art that variations in the preferred compositions and methods may be used and that it is intended that the invention may be practiced otherwise than as specifically described herein Accordingly, this invention includes all modifications encompassed within the spirit and scope of the invention as defined by the claims that follow

Claims

What is claimed
1 A compound of one of the following formulas I and II
Figure imgf000047_0001
or a pharmaceutically acceptable salt thereof, wherein (1) X is nitrogen or carbon, and R2 is not present when X is nitrogen;
(2) R2 (a) is hydrogen, (C1-C6) alkyl, (C1-C6) aikoxy, cyano, (C2-C7) alkanoyl, aminocarbonyl, (C1-C6) alkylaminocarbonyl or dialkylaminocarbonyl wherein each alkyl is independently C1 to C6, (b) comprises (where R1 is not -0-R8or -S-R8') hydroxy, fluoro, chloro, bromo or (C2-C7) alkanoyloxy, (c) forms a double bond with an adjacent carbon or nitrogen from one of either R1, Rxb or Ryb, (d) is oxygen forming an oxa linkage with R1 or integrated into ring
E (see, for example, Compound C6) or (e) is R2a linked by RΆ to X,
(2') Rx is a ring-containing structure Rxa linked by Rxb to X,
(2") Ry is a ring-containing structure Rya linked by Ryb to X,
(2'") Rxa, Rya and R2a, are independently aryl, heteroaryl, adamantyl or a 5 to 7-membered non-aromatic ring having from 0 to 2 heteroatoms selected from the group consisting of oxygen, sulfur and nitrogen, wherein
(a) aryl is phenyl or naphthyl,
(b) heteroaryl comprises a five-membered πng, a six-membered ring, a six-membered ring fused to a five-membered ring, a five-membered ring fused to a six-membered ring, or a six-membered ring fused to a six-membered ring, wherein the heteroaryl is aromatic and contains heteroatoms selected from the group consisting of oxygen, sulfur and nitrogen, with the remaining ring atoms being carbon, (c) each of Rxa, Rya and R2a can be independently substituted with one of Rq, RO- or RSS-, wherein Rq, Rr and Rs are independently aryl, heteroaryl, adamantyl or a 5 to 7-membered non-aromatic ring as these structures are defined for Rxa, and
(d) Rxa, Rya, R2a, Rq, Rr and Rs can be additionally substituted with substituents selected from the group consisting of fluoro, chloro, bromo, nitro, hydroxy, cyano, trifluoromethyl, amidosulfonyl which can have up to two independent (CI-C6) N-alkyl substitutions, adamantyl, (C1-C12) alkyl, (C1-C12) alkenyl, ammo, (C1-C6) alkylamino, dialkylamino wherein each alkyl is independently C1 to C6, (C1-C6) alkoxy, (C2-C7) alkanoyl, (C2-C7) alkanoyloxy, tnfluoromethoxy, hydroxycarbonyl, (C2-C7) alkyloxycarbonyl, aminocarbonyl that can be substituted for hydrogen with up to two independent (C1-C6) alkyl, (C1-C6) alkylsulfonyl, amidino that can independently substituted with up to three (C1-C6) alkyl, or methylenedioxy or ethylenedioxy with the two oxygens bonded to adjacent positions on the aryl or heteroaryl ring structure, which methylenedioxy or ethylenedioxy can be substituted with up to two independent (C1-C6) alkyl, wherein
(i ) the substitutions of Rxa, Rya and R2a can be combined to form a second bridge between two of Rxa, Rya and R2a comprising (1) (C1-C2) alkyl or alkenyl, which can be independently substituted with one or more (C1-C6) alkyl, (2) sulfur, (3) oxygen, (4) ammo, which can be substituted for hydrogen with one (C1-C6) alkyl, (5) carbonyl, (6) -CH2C(=0)-, which can be substituted for hydrogen with up to two independent (C1-C6) alkyl, (7) -C(=0)-0-, (8) - CH2-0-, which can be substituted for hydrogen with up to two independent (C1-C6) alkyl, (9) -C(=0)-N(R24)-, wherein R24 is hydrogen or (C1-C6) alkyl, (10) -CH2-NH-, which can be substituted for hydrogen with up to three (C1-C6) alkyl, or (11) -CH=N-, which can be substituted for hydrogen with (C1-C6) alkyl, or wherein two of Rxa, Rya and R2a can be directly linked by a single bond, (2W) Rxb and R26 are independently a single bond or (C1-C2) alkylene, (2V) Ryb is a single bond, oxa, (C1-C2) alkylene, ethenylene or -CH= (where the double bond is with X), thia, methyleneoxy or methylenethio, or either -N(R6)- or -CH2-N(R6*)-, wherein R6 and R6" are hydrogen or (C1-C6) alkyl, wherein when X is nitrogen X is not bonded to another heteroatom,
(3) R1 comprises a single bond or double bond, a straight-chained (C1-C3) aliphatic group, or (where X is carbon and Ryb does not include a heteroatom attached to X) -O-R8 or -S-R8 , wherein either R8 or R8" is a single bond, (C1-C3) alkylene or (C2-C3) alkenylene and 0 or S is bonded to X: wherein R1 can be substituted with up to one hydroxy, up to one (C1-C6) alkoxy or up to one (C2-C7) alkanoyloxy, with up to two independent (C1-C6) alkyl, with up to one oxo, up to one (C1-C6) alkyhdene, with the proviso that the hydroxy, alkoxy, alkanoyloxy, oxo substituents are not bonded to a carbon that is bonded to a nitrogen or oxygen, or (where R1 is -O-R8 and X is carbon) an oxa linkage to X forming a 1 ,3-dioxolane, wherein the alkyl or alkyhdene substituents of R1 can be linked to form a 3 to 7- membered non-aromatic ring, and wherein if X is nitrogen, X is linked to R1 by a single bond and the terminal carbon of R1 that links R1 to N is saturated;
(4) n is 0 or 1, and where if n is 1, R3" is either (C1-C6) alkyl (with the attached nitrogen having a positive charge) or oxygen (forming an N-oxide) and X is carbon;
(5) wherein ring D is a 3 to 8-membered ring, a 3 to 8-membered ring substituted with a 3 to 6-membered spiro ring, or a 3 to 8-membered ring fused with a 5 to 6-membered ring, wherein the fused ring lacking the illustrated tertiary nitrogen can be aromatic or heteroaromatic, wherein for each component ring of ring D there are up to two heteroatoms selected from oxygen, sulfur or nitrogen, including the illustrated nitrogen, and the rest carbon, with the proviso that the ring atoms include no quaternary nitrogens, with the proviso that, in saturated rings, ring nitrogen atoms are separated from other ring heteroatoms by at least two intervening carbon atoms: wherein the carbon and nitrogen ring atoms of ring D can be substituted with substituents selected from (C1-C6) alkyl, (C2-C6) alkenylene, cyano, nitro, trifluoromethyl, (C2-C7) alkyloxycarbonyl, (C1-C6) alkyhdene, hydroxyl, (C1-C6) alkoxy, oxo, hydroxycarbonyl, aryl wherein the aryl is as defined for Ra or heteroaryl wherein the heteroaryl is as defined for Ra, with the proviso that ring atoms substituted with alkyhdene, hydroxycarbonyl or oxo are carbon, with the further proviso that ring atoms substituted with hydroxyl or alkoxy are separated from other ring heteroatoms by at least two intervening carbon atoms; and wherein R1, R3 and G are such that at least two atoms separate X and the illustrated ring nitrogen;
(6) wherein ring E is a 3 to 8-membered ring, a 3 to 8-membered ring substituted with a 3 to 6-membered spiro ring, or a 3 to 8-membered ring fused with a 5 to 6-membered ring, wherein the fused ring lacking the illustrated tertiary nitrogen can be aromatic or heteroaromatic, wherein for each component ring of ring E there are up to two heteroatoms selected from oxygen, sulfur or nitrogen, including the illustrated nitrogen, and the rest carbon, with the proviso that the ring atoms include no quaternary nitrogens, with the proviso that, in saturated rings, ring nitrogen atoms are separated from other ring heteroatoms by at least two intervening carbon atoms wherein the carbon and nitrogen ring atoms of ring E can be substituted with substituents selected from (C1-C6) alkyl, (C2-C6) alkenylene, cyano, nitro, trifluoromethyl,
(C2-C7) alkyloxycarbonyl, (C1-C6) alkyhdene, hydroxyl, (C-C6) alkoxy, oxo, hydroxycarbonyl, (C1-C6) alkoxycarbonyl, aryl wherein the aryl is as defined for Ra or heteroaryl wherein the heteroaryl is as defined for Ra, with the proviso that ring atoms substituted with alkyhdene, hydroxycarbonyl or oxo are carbon, with the further proviso that ring atoms substituted with hydroxyl or alkoxy are separated from other ring heteroatoms by at least two intervening carbon atoms, and wherein G and R18 are such that at least two atoms separate the illustrated ring nitrogen from the carbon linked to Rx and Ry,
(7) R19 (a) forms a double bond with R1, R3 or G, (b) is hydrogen (c) is (C1 - C3) alkyl or alkylene, or (d) is incorporated into a fused ring,
(8) R4 and R4 are independently hydrogen or (C1-C6) alkyl, or one of R4 and R4' can be (C1-C6) hydroxyalkyl, and
(9) R5 is (CO)NR13R14, (CO)OR15, (CO)SR16, (S02)NR17R18, (PO)(OR19)(OR20), (CR22)(OR23)(OR24), CN or tetrazol-5-yl, wherein R13, R14, R15, R16, R17, R18, R19 and R20 are independently hydrogen, (C1-C8) alkyl which can include a (C3-C8) cycloalkyl, wherein the carbon linked to the oxygen of R15 or the sulfur of R16 has no more than secondary branching and , (C2-C6) hydroxyalkyl, aminoalkyl where the alkyl is C2 to C6 and the ammo can be substituted with up to two independent (C1-C6) alkyls, arylalkyl wherein the alkyl is C1-C6, heteroarylalkyl wherein the alkyl is C1 to C6, aryl or heteroaryl, R22 is hydrogen or OR25 and R23, R24 and R25 are (C1-C6) alkyl, phenyl, benzyl, acetyl or, where R22 is hydrogen, the alkyls of R23 and R24 can be combined to include 1,3-dιoxylane or 1,3-dιoxane wherein the aryl is phenyl or naphthyl and the heteroaryl is a five-membered ring, a six-membered ring, a six-membered ring fused to a five-membered ring, a five- membered ring fused to a six-membered ring, or a six-membered ring fused to a six- membered ring, wherein the heteroaryl is aromatic and contains heteroatoms selected from the group consisting of oxygen, sulfur and nitrogen, with the remaining ring atoms being carbon, wherein the aryl, heteroaryl, aryl of arylalkyl or the heteroaryl of heteroarylalkyl can be substituted with substituents selected from the group consisting of fluoro, chloro, bromo, nitro, cyano, trifluoromethyl, amidosulfonyl which can have up to two independent (C1-C6) N-alkyl substitutions, (C1-C6) alkyl, (C2-C6) alkenyl, (C1-C6) alkylamine, dialkylamme wherein each alkyl is independently C1 to C6, ammo, (C1-C6) alkoxy, (C2- C7) alkanoyl, (C2-C7) alkanoyloxy, tnfluoromethoxy, hydroxycarbonyl, (C2-C7) alkyloxycarbonyl, aminocarbonyl that can be N-substituted with up to two independent
(C1-C6) alkyl, (C1-C6) alkylsulfonyl, amidino that can substituted with up to three (C1-C6) alkyl, or methylenedioxy or ethylenedioxy with the two oxygens bonded to adjacent positions on the aryl or heteroaryl ring structure, which methylenedioxy or ethylenedioxy can be substituted with up to two independent (C1-C6) alkyl; and wherein R13 and R14 together with the nitrogen can form a 5 to 7-membered ring that can contain one additional heteroatom selected from oxygen and sulfur
2 The compound of claim 1, wherein (A) at least one of Rxa, Rya and R2a is substituted with fluoro, chloro, bromo, hydroxy, trifluoromethyl, tnfluoromethoxy, nitro, cyano, (C3- C8) alkyl, Rq, R'O-, RSS-, or (B) the ring structures of Rxa, Rya and R2a, including substituents thereto, otherwise include at least two aromatic ring structures that together include from 15 to 20 ring atoms
3 The compound of claim 2, wherein at least one of Rxa, Rya and R2a is substituted with fluoro, trifluoromethyl, tnfluoromethoxy, nitro, cyano, or (C3-C8) alkyl
4 The compound of claim 1, wherein at least one of Rxa, Rya and R2a is substituted with Rq, RrO-, or RSS-
5 The compound of claim 1 , wherein an aryl or heteroaryl of at least one of Rxa, Rya and R2a is phenyl
6 The compound of claim 1, wherein Ryb is oxa, methyleneoxy, thia, methylenethia
7 The compound of claim 6, wherein Ryb is oxa or thia 8 The compound of claim 1, wherein R5 is (CO)NR13R14, (CO)OR15 or (CO)SR16
9 The compound of claim 8, wherein R15 is (C2-C6) alkyl, (C2-C4) hydroxyalkyl, phenyl, phenylalkyl wherein the alkyl is C1-C3, or aminoalkyl where the alkyl is C2-C6 and the ammo can be substituted with up to two independent (C1-C3) alkyls, wherein the phenyl or the phenyl of phenylalkyl can be substituted 10 The compound of claim 8, wherein R15 is hydrogen
11 The compound of claim 1, wherein R4 is hydrogen, methyl or hydroxymethyl and R4" is hydrogen
12 The compound of claim 1, wherein at least one of Rxa, Rya and R2a is a heteroaryl comprising diazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, thiolyl, diazmyl, tπazinyl, benzoazolyl, benzodiazolyl, benzothiazolyl, benzoxazolyl, benzoxolyl, benzothiolyl, qumolyl, isoquinolyl, benzodiazinyl, benzotπazinyl, pyπdyl, thienyl, furanyl, pyrrolyl, indolyl, isoindoyl or pyπmidyl
13 The compound of claim 1, wherein R1 is -O-R8 or -S-R8'
14 The compound of claim 1, wherein said second bridge between two of Rxa, Rya and R2a is L, and satisfies the following formula
Figure imgf000052_0001
wherein A and B are aryl or heteroaryl groups of Rxa and Rya, respectively
15 The compound of claim 14, wherein Rxa-Rxb-, Rya-Ryb- and X form
Figure imgf000052_0002
wherein Y is a carbon bonded to R by a single or double bond or a nitrogen that is bonded to R1 and wherein R21 either (i.) completes a single bond linking two aryl or heteroaryl rings of Rx and Ry, (n ) is (C1-C2) alkylene or alkenylene, (iii.) is sulfur or (iv.) is oxygen, and wherein Rx and Ry can be substituted as set forth above
16 The compound of claim 15, wherein R21 is CH2CH2 or CH=CH
17 The compound of claim 1, wherein the alkylenedioxy substitution of Rxa, Rya or R2a is as follows
Figure imgf000052_0003
wherein the alkylenedioxy can be substituted with up to two independent (C1-C3) alkyl
18 The compound of claim 1, wherein ring D is according to one of formulas A' and B'
Figure imgf000053_0001
, wherein Z represents carbon or nitrogen, wherein for each of formulas A' and B' up to two of the bonds indicated with the hashed lines can be double bonds provided no two double bonds are adjacent, and wherein the ring of formulas A' and B' can be substtuted as set forth above for ring D 19 The compound of claim 1, wherein the ring system comprising G* IS according to one of formulas C and D'
Figure imgf000053_0002
, wherein Z represents carbon or nitrogen, wherein for formula C up to one of the bonds indicated with the hashed lines can be double bond and for formula D' up to two of the bonds indicated with the hashed lines can be double bonds, and wherein the ring can be substituted as set forth above for ring E 20. The compound of claim 1, wherein ring D or ring E is substituted with up to three substituents.
21. The compound of claim 1, wherein Rxa and Rya together can be substituted with up to six substituents, R2a, Rq, Rr and Rs can each be substituted with up to 3 substituents, and wherein the presence of each of Rq, Rr or Rs is considered a substitution to the respective ring structure of Rxa, Rya and R2a.
22. The compound of claim 1 , wherein the aryl, heteroaryl, aryl of arylalkyl or the heteroaryl of heteroarylalkyl of R13, R14, R15, R16 R17, R18 R19 or R20 is subsϋtuted with up to three substituents. 23. The compound of claim 1 , wherein the compound is an optically pure enantiomer.
24. A pharmaceutical composition comprising the compound of claim 1 and a pharmaceutically acceptable excipient.
25. The pharmaceutical composition of claim 21, wherein the compound of claim 1 is present in an effective amount for: (1) treating or preventing schizophrenia,
(2) enhancing treating or preventing dementia,
(3) treating or preventing epilepsy,
(4) treating or preventing spasticity,
(5) treating or preventing muscle spasm, (6) treating or preventing pain,
(7) preventing neural cell death after stroke,
(8) preventing neural cell death in an animal suffering from a neurodegenerative disease,
(9) treating or preventing mood disorders,
(10) enhancing memory or learning, or (11) treating or preventing learning disorders.
26. A method (1) of treating or preventing schizophrenia comprising administering a schizophrenia treating or preventing effective amount of a compound, (2) of treating or preventing dementia comprising administering a dementia treating or preventing effective amount of a compound, (3) of treating or preventing epilepsy comprising administering an epilepsy treating or preventing effective amount of a compound, (4) of treating or preventing spasticity comprising administering a spasticity treating or preventing effective amount of a compound, (5) of treating or preventing muscle spasm comprising administering a muscle spasm treating or preventing effective amount of a compound, (6) of treating or preventing pain comprising administering a pain treating or preventing effective amount of a compound, (7) of preventing neural cell death after stroke comprising administering a neural cell death preventing effective amount of a compound, (8) of preventing neural cell death in an animal suffering from a neurodegenerative disease, (9) treating or preventing mood disorders, (10) enhancing memory or learning, or (11) treating or preventing learning disorders, comprising administering an amount effective for said treating, preventing or enhancing of a compound of claim 1
27 The method of claim 26, wherein the spasticity is associated with epilepsy, stroke, head trauma, multiple sclerosis, spinal cord injury or dystonia
28 The method of claim 26, wherein the neurodegenerative disease is Alzheimer's disease, multi-mfarct dementia, AIDS dementia, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis or stroke or head trauma
29 A method of synthesizing a compound of claim 1 comprising A) reacting a compound of the formula
D
Figure imgf000055_0001
, wherein 1L is a nucleophihc substitution leaving group, with a compound of the formula
2)
Figure imgf000055_0002
or B) reacting a compound of the formula
Figure imgf000055_0003
with a compound of the formula 2)
Figure imgf000056_0001
, wherein 2L is a nucleophihc substitution leaving group 30 A method of synthesizing a compound of claim 1 comprising reductively alkylating RdNH2 with a compound of the formula
Figure imgf000056_0002
, wherein Rc and Rd are independently the same as defined for Rx, and wherein Rr has the same definition as R1 except that it does not include a nitrogen, oxygen or sulfur, and does not include any double bonds conjugated with the above-illustrated carbonyl
31 A method of synthesizing a compound of claim 1 comprising reacting RfOH or RrSH with a compound of the formula
Figure imgf000056_0003
to form an ether or a thioether, respectively, wherein Rf and Rr are independently the same as defined for Rx, and wherein Rr has the same definition as R1 except that it does not include a nitrogen, oxygen or sulfur, and does not include any double bonds at the atom bonded to the above-illustrated L6-substιtuted carbon
32 The method of claim 31, further comprising synthesizing the compound of formula
Figure imgf000056_0004
by replacing the hydroxyl of formula with another nucleophilic substitution leaving group
Figure imgf000057_0001
33 The method of claim 32, comprising reacting a compound of formula
Figure imgf000057_0002
with an azodicarboxylate in the presence of a phosphine compound
34 A method of synthesizing a compound of claim 1 compπsing reacting ReM with a compound of the formula
Figure imgf000057_0003
to form a compound of the formula
Figure imgf000057_0004
, wherein Rc and Re are independently the same as defined for Rx, wherein M is a metal- containing substituent such that ReM is a organometallic reagent and wherein R1" has the same definition as R1 except that it does not include a nitrogen, oxygen or sulfur, and does not include any double bonds conjugated with the above-illustrated carbonyl. 35. A method of synthesizing a compound of claim 1 comprising dehydrating a compound of the formula
Figure imgf000058_0001
to form a compound of the formula
Figure imgf000058_0002
wherein C' has a double bond with an adjacent carbon, wherein Rc and Re are independently the same as defined for Rx, wherein R27 and R27* have the same definition as R1 except that R27 and R27" do not include a nitrogen, oxygen or sulfur. 36. A method of synthesizing a compound of claim 1 comprising reducing a compound of the formula
Figure imgf000058_0003
wherein C* has a double bond with an adjacent carbon, to form a compound of the formula
Figure imgf000058_0004
, wherein Rc and Rβ are independently the same as defined for Rx, wherein R27 and R27 have the same definition as R1 except that R27 and R27 do not include a nitrogen, oxygen or sulfur. 37 A method of synthesizing a compound of claim 1 comprising reducing a compound of one of the following formulas
Figure imgf000059_0001
to reduce a double bond in ring C" or ring C'x, wherein R28 is the same as R1 except that the bond to the ring is not a double bond, wherein ring Cιx is mono or di-unsaturated at one or more of the bonds indicated with the dashed lines with the double bonds formed between ring carbons and no two double bonds are adjacent, wherein ring C" or ring C'x can include a fused phenyl and can be substituted as follows the carbon and nitrogen ring atoms of ring C" or ring C,x can be substituted with up to two substituents selected from (C1-C6) alkyl, (C2-C6) alkenylene, cyano, nitro, trifluoromethyl, and (C2-C7) alkyloxycarbonyl, and wherein I is a negative counter-ion
38 The method of synthesizing a compound of claim 37, wherein the compound reduced is that containing ring C"
39 A compound according to the following formula
Figure imgf000059_0002
that can be used to synthesize a compound of claim 1, wherein I' is a negative counter-ion, wherein R28 is the same as R1 except that the bond to the ring is not a double bond, wherein ring C" can include a fused phenyl and can be substituted as follows the carbon and nitrogen ring atoms of ring C" can be substituted with up to two substituents selected from (C1-C6) alkyl, (C2-C6) alkenylene, cyano, nitro, trifluoromethyl, and (C2-C7) alkyloxycarbonyl
40 A method of synthesizing a compound of claim 39 comprising reacting a compound of the formula
Figure imgf000060_0001
with a compound of the formula
Figure imgf000060_0002
wherein L4 is a nucleophilic substitution leaving group and wherein ring C can be fused with phenyl or substituted, the same as defined for ring C".
41. A compound of claim 1 according to the following formula
Figure imgf000060_0003
wherein R28 is the same as R1 except that the bond to the ring is not a double bond, wherein ring C'x is mono or di-unsaturated at one or more of the bonds indicated with the dashed lines with the double bonds formed between ring carbons and no two double bonds are adjacent, wherein ring Cιx can include a fused phenyl and can be substituted as follows the carbon and nitrogen ring atoms of ring D can be substituted with up to 2 substituents selected from (C1-C6) alkyl, (C2-C6) alkenylene, cyano, nitro, trifluoromethyl, and (C2-
C7) alkyloxycarbonyl.
42. A compound of the following formula
Figure imgf000061_0001
that can be used to synthesize a compound of claim 1, wherein I" is a negative counter-ion, wherein R28 is a (C1-C3) aliphatic group that can be substituted as defined for R1, wherein ring C" can include a fused phenyl and can be substituted as follows the carbon and nitrogen ring atoms of ring Cv" can be substituted with up to 2 substituents selected from (C1-C6) alkyl, (C2-C6) alkenylene, cyano, nitro, trifluoromethyl, and (C2-C7) alkyloxycarbonyl.
43. A method of synthesizing a compound of claim 42 comprising reacting a compound of the formula
Figure imgf000061_0002
with a compound of the formula
Figure imgf000061_0003
, wherein L 5 ; is„ a nucleophilic substitution leaving group, wherein ring C can be fused with phenyl or substituted, the same as defined for Cv". 44. A compound of the following formula
Figure imgf000061_0004
,28" that can be used to synthesize a compound of claim 1, wherein R is a (C1-C3) aliphatic group that can be substituted as defined for R1, wherein ring C" can include a fused phenyl and can be substituted as follows the carbon and nitrogen ring atoms of ring C" can be substituted with up to 2 substituents selected from (C1-C6) alkyl, (C2-C6) alkenylene, cyano, nitro, trifluoromethyl, and (C2-C7) alkyloxycarbonyl.
45. A method of synthesizing the compound of claim 44, the method comprising reducing a compound of the following formula
Figure imgf000062_0001
, to reduce the double bonds in ring Cv", wherein I" is a negative counter-ion, and wherein ring Cv" can be fused with phenyl or substituted, the same as defined for ring C".
46. A method of synthesizing a compound that can be used to synthesize the compound of claim 1, the method comprising synthesizing a compound of formula
Figure imgf000062_0002
, wherein Rc is independently the same as Rx, wherein R1* has the same definition as R1 except that it does not include a nitrogen, oxygen or sulfur, and does not include any double bonds at
the atom bonded to the above-illustrated L6-substituted carbon, by reacting a compound of the formula
Figure imgf000063_0001
with a compound of the formula
Figure imgf000063_0002
wherein L3 is a nucleophilic leaving group.
47. A method of synthesizing of a compound of claim 1, the method comprising reacting a compound of formula
Figure imgf000063_0003
, wherein Rς is independently the same as Rx, with Ar-Q wherein Ar is aryl which is substituted with an electron-withdrawing group or heteroaryl and is substituted with an electron-withdrawing group, and wherein Q is fluoro or chloro, to form
Figure imgf000063_0004
wherein R27 has the same definition as R1 except that R27 does not include a nitrogen, oxygen or sulfur.
48. A method of synthesizing a compound that can be used to synthesize the compound of claim 1, the method comprising synthesizing a compound of formula X:
Figure imgf000064_0001
X by reacting a compound of formula:
Figure imgf000064_0002
with RdNHSθ2Ar, wherein Rc and Rd are independently the same as Rx, and Ar is aryl or heteroaryl, and wherein R27 has the same definition as R1 except that R27 does not include a nitrogen, oxygen or sulfur.
49. The method of claim 48, further comprising converting the compound of formula X to:
Figure imgf000064_0003
50. A method of synthesizing a compound that can be used to synthesize the compound of claim 1 , the method comprising reacting a compound of formula
Figure imgf000065_0001
with a compound of formula
Figure imgf000065_0002
, wherein L4 is a nucleophilic substitution leaving group and Rc is independently the same as Rx, and wherein R27 has the same definition as R1 except that R27 does not include a nitrogen, oxygen or sulfur, to form a compound of formula
Figure imgf000065_0003
51 A method of synthesizing a compound that can be used to synthesize the compound of claim 1, the method comprising synthesizing the compound of formula
Figure imgf000065_0004
"
wherein Rc is independently the same as Rx and Rr has the same definition as R1 except that Rr does not include a nitrogen, oxygen or sulfur and Rr does not include any double bonds at the atom bonded to the above-illustrated hydroxyl-substituted carbon, said synthesis comprising reducing the ketone of a compound of formula
Figure imgf000066_0001
52. A compound of the following formula
Figure imgf000066_0002
that can be used to synthesize a compound of claim 1, wherein I' is a negative counter-ion, wherein R28 is the same as R1 except that the bond to the ring is not a double bond, wherein ring Cx can include a fused phenyl and can be substituted as follows the carbon and nitrogen ring atoms of ring Cx can be substituted with up to 2 substituents selected from (C1-C6) alkyl, (C2-C6) alkenylene, cyano, nitro, trifluoromethyl, and (C2-C7) alkyloxycarbonyl
53. A method of synthesizing a compound of claim 52, comprising reacting a compound of the formula
Figure imgf000066_0003
with a compound of the formula
Figure imgf000067_0001
, wherein L 5 : is„ a nucleophilic substitution leaving group, wherein ring C can be fused with phenyl or substituted, the same as defined for Cx. 54. A compound of the following formula
Figure imgf000067_0002
that can be used to synthesize a compound of claim 1, wherein R28 is the same as R1 except that the bond to the ring is not a double bond, wherein ring Cx" can include a fused phenyl and can be substituted as follows the carbon and nitrogen ring atoms of ring Cx" can be substituted with up to 2 substituents selected from (C1-C6) alkyl, (C2-C6) alkenylene, cyano, nitro, trifluoromethyl, and (C2-C7) alkyloxycarbonyl.
55. A method of synthesizing the compound of claim 54, the method comprising reducing a compound of the following formula
Figure imgf000067_0003
, to reduce the double bonds in ring Cx, wherein I" is a negative counter-ion, and wherein ring Cx can be fused with phenyl or substituted, the same as defined for ring Cx".
PCT/US1997/009346 1996-05-31 1997-05-29 Pharmaceutical for treating of neurological and neuropsychiatric disorders WO1997045423A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
JP54300197A JP4403212B2 (en) 1996-05-31 1997-05-29 Pharmaceutical agents for the treatment of neurological and neuropsychological disorders
EP97926837A EP0918767A4 (en) 1996-05-31 1997-05-29 Pharmaceutical for treating of neurological and neuropsychiatric disorders
AU31510/97A AU737095B2 (en) 1996-05-31 1997-05-29 Pharmaceutical for treating of neurological and neuropsychiatric disorders
CA002255727A CA2255727A1 (en) 1996-05-31 1997-05-29 Pharmaceutical for treating of neurological and neuropsychiatric disorders

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US65584796A 1996-05-31 1996-05-31
US80768197A 1997-02-27 1997-02-27
US08/655,847 1997-02-27
US08/807,681 1997-02-27

Publications (1)

Publication Number Publication Date
WO1997045423A1 true WO1997045423A1 (en) 1997-12-04

Family

ID=27097055

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1997/009346 WO1997045423A1 (en) 1996-05-31 1997-05-29 Pharmaceutical for treating of neurological and neuropsychiatric disorders

Country Status (5)

Country Link
EP (1) EP0918767A4 (en)
JP (2) JP4403212B2 (en)
AU (1) AU737095B2 (en)
CA (1) CA2255727A1 (en)
WO (1) WO1997045423A1 (en)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999045011A1 (en) * 1998-03-06 1999-09-10 Janssen Pharmaceutica N.V. Glycine transport inhibitors
WO2000007978A1 (en) * 1998-07-31 2000-02-17 Akzo Nobel N.V. Aminomethylcarboxylic acid derivatives
WO2001017964A1 (en) * 1999-09-03 2001-03-15 Syngenta Participations Ag Tetrahydropyridines as pesticides
WO2002022581A1 (en) * 2000-09-14 2002-03-21 Gliatech, Inc. Nitrogen-containing compounds and their use as glycine transport inhibitors
WO2002064135A1 (en) * 2001-02-09 2002-08-22 Telik, Inc. Heterocyclic inhibitors of glycine transporter 2
WO2003016274A3 (en) * 2001-08-21 2003-10-16 Sepracor Inc 2-substituted piperidines that are ligands for monoamine receptors and transporters
US6720336B2 (en) 1998-09-09 2004-04-13 Pfizer, Inc. 4,4-biarylpiperidine derivatives
WO2005100301A1 (en) * 2004-03-31 2005-10-27 Eli Lilly And Company 2-aryloxyethyl glycine derivatives and their use as glycine transport inhibitors
US7049343B2 (en) 2000-09-08 2006-05-23 Merck & Co., Inc. Substituted hydrazine derivatives
US7358066B2 (en) 2001-07-24 2008-04-15 Serono Genetics Institute S.A. Variants and exons of the GlyT1 transporter
US7507824B2 (en) 1999-11-17 2009-03-24 N.V. Organon Spiro(2H-1benzopyran-2,4′-piperidine) derivates as glycine transport inhibitors
US7538114B2 (en) 2006-06-28 2009-05-26 Amgen Inc. Glycine transporter-1 inhibitors
US20110082166A1 (en) * 2008-03-05 2011-04-07 Neurosearch A/S Novel 4-benzhydryl-tetrahydro-pyridine derivatives and their use as monoamine neurotransmitter re-uptake inhibitors
US8258306B2 (en) 2007-12-12 2012-09-04 Amgen Inc. Glycine transporter-1 inhibitors
WO2019196898A1 (en) * 2018-04-12 2019-10-17 中国科学院大连化学物理研究所 2-(2,2-diarylethyl)-cyclic amine derivative or salt, synthesis thereof, and application and composition thereof

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0918767A4 (en) * 1996-05-31 2000-04-26 Allelix Neuroscience Inc Pharmaceutical for treating of neurological and neuropsychiatric disorders
DE602006007682D1 (en) * 2005-01-18 2009-08-20 Hoffmann La Roche 2.5-DISUBSTITUTED PHENYLMETHANONE DERIVATIVES AS GLYCINTRANSPORTER-1 INHIBITORS (GLYT-1) FOR THE TREATMENT OF NEUROLOGICAL AND NEUROPSYCHIATRIC DISORDER

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0349340A2 (en) * 1988-07-01 1990-01-03 Meiji Seika Kabushiki Kaisha Novel cephem compound, method for producing the same and anti-bacterial agent
EP0399414A1 (en) * 1989-05-22 1990-11-28 Hokuriku Pharmaceutical Co., Ltd. Piperidine derivative, method for preparation thereof, and a pharmaceutical composition comprising the same
JPH03204885A (en) * 1989-12-28 1991-09-06 Meiji Seika Kaisha Ltd New cephalosporin based compound
US5057524A (en) * 1990-02-08 1991-10-15 A. H. Robins Company Incorporated 4-[diaryl)hydroxymethyl]-1-piperidinealkylcarboxylic acids, salts and esters useful in the treatment of allergic disorders
US5063235A (en) * 1990-04-30 1991-11-05 A. H. Robins Company, Inc. 4-[(diaryl)hydromethyl]-1-piperidinealkanols and esters and carbamates thereof useful in the treatment of allergic disorders
JPH0517443A (en) * 1991-07-11 1993-01-26 Hokuriku Seiyaku Co Ltd Piperidine derivative

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH03264562A (en) * 1989-05-22 1991-11-25 Hokuriku Seiyaku Co Ltd Piperidine derivative
EP0918767A4 (en) * 1996-05-31 2000-04-26 Allelix Neuroscience Inc Pharmaceutical for treating of neurological and neuropsychiatric disorders

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0349340A2 (en) * 1988-07-01 1990-01-03 Meiji Seika Kabushiki Kaisha Novel cephem compound, method for producing the same and anti-bacterial agent
EP0399414A1 (en) * 1989-05-22 1990-11-28 Hokuriku Pharmaceutical Co., Ltd. Piperidine derivative, method for preparation thereof, and a pharmaceutical composition comprising the same
JPH03204885A (en) * 1989-12-28 1991-09-06 Meiji Seika Kaisha Ltd New cephalosporin based compound
US5057524A (en) * 1990-02-08 1991-10-15 A. H. Robins Company Incorporated 4-[diaryl)hydroxymethyl]-1-piperidinealkylcarboxylic acids, salts and esters useful in the treatment of allergic disorders
US5063235A (en) * 1990-04-30 1991-11-05 A. H. Robins Company, Inc. 4-[(diaryl)hydromethyl]-1-piperidinealkanols and esters and carbamates thereof useful in the treatment of allergic disorders
JPH0517443A (en) * 1991-07-11 1993-01-26 Hokuriku Seiyaku Co Ltd Piperidine derivative

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
CHEMICAL AND PHARMACEUTICAL BULLETIN, December 1990, Vol. 38, No. 12, SAKAGAMI et al., "Synthetic Cephalosporins. VII. Synthesis and Antibacterial Activity of 7-[(Z)-2-(2-Aminothiazol-4-yl)-2-(3-hydroxy -4-pyridon-1-yl)-3-carboxypropoxyimino)acet amido]-3-(1,2,3-thiadiazol-5-yl)-thiomethyl -3-cepham-4-carboxylic Acid and Its Related *
JOURNAL OF CHROMATOGRAPHY B: BIOMEDICAL APPLICATIONS, 05 August 1994, Vol. 658, No. 1, TAKAHARA et al., "Analysis of Urinary and Biliary Metabolites of (+)-4-[4-(4-methylphenyl)phenylmethoxy-1-pi peridinyl]butyric Acid in Rats by Liquid Chromatography-Frit-Fast Atom Bombardment Mass Spectrometry", pages 154-160. *
JOURNAL OF THE AMERICAN CHEMICAL SOCIETY, 09 June 1976, Vol. 98, No. 12, BEAK et al., "Dipole Stabilized Carbanions: N-Methyl Carboxamides", pages 3621-3627. *
See also references of EP0918767A4 *
THE JOURNAL OF ANTIBIOTICS, November 1990, Vol. 43, No. 11, IWAMATSU et al., "A New Antipseudomonal Cephalosporin CP6162 and Its Congeners", pages 1450-1463. *

Cited By (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999045011A1 (en) * 1998-03-06 1999-09-10 Janssen Pharmaceutica N.V. Glycine transport inhibitors
US6410592B1 (en) 1998-07-31 2002-06-25 Akzo Nobel N.V. Aminomethylcarboxylic acid derivatives
WO2000007978A1 (en) * 1998-07-31 2000-02-17 Akzo Nobel N.V. Aminomethylcarboxylic acid derivatives
US6720336B2 (en) 1998-09-09 2004-04-13 Pfizer, Inc. 4,4-biarylpiperidine derivatives
US6638940B1 (en) 1999-09-03 2003-10-28 Syngenta Crop Protection, Inc. Tetrahydropyridines as pesticides
JP2003508519A (en) * 1999-09-03 2003-03-04 シンジェンタ パーティシペーションズ アクチェンゲゼルシャフト Tetrahydropyridine as a pesticide
AU767535B2 (en) * 1999-09-03 2003-11-13 Syngenta Participations Ag Tetrahydropyridines as pesticides
WO2001017964A1 (en) * 1999-09-03 2001-03-15 Syngenta Participations Ag Tetrahydropyridines as pesticides
JP4763195B2 (en) * 1999-09-03 2011-08-31 シンジェンタ パーティシペーションズ アクチェンゲゼルシャフト Tetrahydropyridine as a pesticide
US7507824B2 (en) 1999-11-17 2009-03-24 N.V. Organon Spiro(2H-1benzopyran-2,4′-piperidine) derivates as glycine transport inhibitors
US7049343B2 (en) 2000-09-08 2006-05-23 Merck & Co., Inc. Substituted hydrazine derivatives
WO2002022581A1 (en) * 2000-09-14 2002-03-21 Gliatech, Inc. Nitrogen-containing compounds and their use as glycine transport inhibitors
US6946474B2 (en) 2000-09-14 2005-09-20 Merck & Co., Inc. Nitrogen-containing compounds and their use as glycine transport inhibitors
WO2002064135A1 (en) * 2001-02-09 2002-08-22 Telik, Inc. Heterocyclic inhibitors of glycine transporter 2
US6894054B2 (en) 2001-02-09 2005-05-17 Telik, Inc. Heterocyclic inhibitors of glycine transporter 2
US7358066B2 (en) 2001-07-24 2008-04-15 Serono Genetics Institute S.A. Variants and exons of the GlyT1 transporter
WO2003016274A3 (en) * 2001-08-21 2003-10-16 Sepracor Inc 2-substituted piperidines that are ligands for monoamine receptors and transporters
WO2005100301A1 (en) * 2004-03-31 2005-10-27 Eli Lilly And Company 2-aryloxyethyl glycine derivatives and their use as glycine transport inhibitors
US7538114B2 (en) 2006-06-28 2009-05-26 Amgen Inc. Glycine transporter-1 inhibitors
US8183244B2 (en) 2006-06-28 2012-05-22 Amgen Inc. Glycine transporter-1 inhibitors
US8735383B2 (en) 2006-06-28 2014-05-27 Amgen Inc. Glycine transporter-1 inhibitors
US9663476B2 (en) 2006-06-28 2017-05-30 Amgen Inc. Glycine transporter-1 inhibitors
US8258306B2 (en) 2007-12-12 2012-09-04 Amgen Inc. Glycine transporter-1 inhibitors
US20110082166A1 (en) * 2008-03-05 2011-04-07 Neurosearch A/S Novel 4-benzhydryl-tetrahydro-pyridine derivatives and their use as monoamine neurotransmitter re-uptake inhibitors
WO2019196898A1 (en) * 2018-04-12 2019-10-17 中国科学院大连化学物理研究所 2-(2,2-diarylethyl)-cyclic amine derivative or salt, synthesis thereof, and application and composition thereof
CN110372571A (en) * 2018-04-12 2019-10-25 中国科学院大连化学物理研究所 A kind of 2- (2,2- diaryl ethyl)-Cycloamine derivative or salt and synthesis and application and composition
US11274079B2 (en) 2018-04-12 2022-03-15 Dalian Institute Of Chemical Physics, Chinese Academy Of Sciences 2-(2,2-diarylethyl)-cyclic amine derivative or salt, synthesis method, application and composition thereof
CN110372571B (en) * 2018-04-12 2022-11-15 中国科学院大连化学物理研究所 2- (2, 2-diarylethyl) -cyclic amine derivative or salt, synthesis and application thereof, and composition

Also Published As

Publication number Publication date
EP0918767A1 (en) 1999-06-02
EP0918767A4 (en) 2000-04-26
AU737095B2 (en) 2001-08-09
CA2255727A1 (en) 1997-12-04
JP2009149663A (en) 2009-07-09
AU3151097A (en) 1998-01-05
JP4403212B2 (en) 2010-01-27
JP2001500107A (en) 2001-01-09

Similar Documents

Publication Publication Date Title
CA2254833C (en) Pharmaceutical for treatment of neurological and neuropsychiatric disorders
US6191165B1 (en) Pharmaceutical for treatment of neurological and neuropsychiatric disorders
AU737095B2 (en) Pharmaceutical for treating of neurological and neuropsychiatric disorders
JP2005519048A (en) GlyT1 transporter inhibitors and their use in the treatment of neurological and neuropsychiatric disorders
WO2004113280A1 (en) Glyt1 transporter inhibitors and uses thereof in treatment of neurological and neuropsychiatric disorders
US6001854A (en) Pharmaceutical for treating of neurological and neuropsychiatric disorders
JP2022065012A (en) Novel substituted benzimidazole derivatives as d-amino acid oxidase (daao) inhibitors
WO2004002483A1 (en) Substituted 3- and 4- aminomethylpiperidines for use as beta-secretase in the treatment of alzheimer’s disease
EA000380B1 (en) 4-aminotetrahydrobenzisoxazole or isothiazole compounds, use thereof and pharmaceutical composition on their base
EP1440075A1 (en) Novel 3beta-amino azabicyclooctane heteroaromatic amide derivatives, preparation method and therapeutic uses thereof
JP2011510022A (en) N- and O-substituted 4- [2- (diphenylmethoxy) -ethyl] -1-[(phenyl) methyl] piperidine analogs and methods of treating CNS disorders using the same
NZ233002A (en) 3-(aminoalkyl)benzothiopyran derivatives and pharmaceutical compositions
EP0557305B1 (en) (2-thienyl) alkylamine derivatives having neuroprotective properties
MXPA03001311A (en) Prodrugs to nmda receptor ligands.
RU2465273C2 (en) HETEROCYCLIC LOW-MOLECULAR sAPP-MIMETICS, PHARMACEUTICAL COMPOSITION, METHODS FOR PREPARING AND USING
AU2001285894A1 (en) Prodrugs to NMDA receptor ligands
KR20010033998A (en) 1,4-diazacycloheptane derivatives for the treatment of neurological disorders
MXPA00006078A (en) 1,4-diazacycloheptane derivatives
JPH1149718A (en) New cyclopentanone derivative and its use

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BB BG BR BY CA CH CN CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG UZ VN AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref document number: 2255727

Country of ref document: CA

Ref country code: CA

Ref document number: 2255727

Kind code of ref document: A

Format of ref document f/p: F

ENP Entry into the national phase

Ref country code: JP

Ref document number: 1997 543001

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1997926837

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1997926837

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1997926837

Country of ref document: EP