WO1997035996A1 - Packaging cell line based on human 293 cells - Google Patents

Abstract

The invention features a cell line harboring a first expression construct encoding functional Friend Murine Leukemia Virus gag/pol. In a preferred embodiment the cell line harbors a second expression construct encoding a functional viral envelope protein. In more preferred embodiments the viral envelope protein is a retroviral envelope protein; the viral envelope protein is a non-retroviral envelope protein; the cells of the cell line are stably transfected with the second expression construct; the cells of the cell line are transiently transfected with the second expression construct; and the cells of the cell line are stably transfected with the first expression construct and said second expression construct.

Description

PACKAGING CELL LINE BASED ON HUMAN 293 CELLS

Background of the Invention

The field of the invention is packaging cell lines for the production of replication-deficient retrovirus and the use of these cell lines in somatic cell therapy.

Retrovirus are virus in which genomic RNA is enclosed in a viral particle that is enveloped by a lipid bilayer. During viral replication the retroviral RNA is reverse transcribed into DNA (provirus) by viral reverse transcriptase. The DNA can then integrate into cellular genomic DNA.

Because retroviral vectors can mediate the efficient transfer of genes into the genome of a wide variety of cell types, retroviral vectors have long been considered a promising tool for gene therapy. For safety reasons it is important to use a defective retrovirus which cannot replicate outside of the targeted cell or beyond the patient to whom it is administered. A replication deficient retrovirus is created by eliminating all or part of one or more of the retroviral structural genes gag, pol and env. Unlike a normal retrovirus, which will produce infectious virion upon its introduction into a cell, a replication-deficient retrovirus will not produce infectious virion unless the cell provides the missing viral structural proteins. A cell line which provides the required structural proteins is referred to as a packaging cell line.

The use of replication deficient retrovirus does not completely eliminate the risks associated with the use of retrovirus. This is because retroviral DNA can recombine with helper genes present in the packaging cell line or with retroviral elements that are endogenous to the cellular genome, leading to the production of replication competent retrovirus. Packaging cell lines employing helper genes with reduced homology to the retroviral vector with which they are used have been developed in an effort to reduce the potential for recombination. To further reduce the opportunity for recombination, packaging cell lines in which the gag/pol and env genes are separately integrated into the packaging cell genome have been developed. Miller (Human Gene Therapy 1 :5, 1990) provides a leview of retrovnus cell packaging lines

Danos et al (Pioc Nail Acad . S t USA 85.6460, 1988, WO 90/02806) descnbe packaging cell lines based on NIH 3T3 cells These cell lines harbor mutant 5 vai lants of the Moloney mui ine leukemia virus gag/pol and env genes which weie introduced by sequential tiansfection Both the gag/pol and env genes employed by Danos et al lack functional psi packaging sequences

Markowitz et al ( Virology 167 400, 1988) descnbe a packaging cell line in which the gag/pol and env genes are on separate plasmids The gag/pol gene used in this 10 cell line was derived from Moloney muπne leukemia virus, and the env gene used was derived from the amphotropic 4070A env. Both genes were intioduced into NIH 3T3 cells Maikowitz et al (J Vnol 62 1 120, 1988) describes similar ecotiopic packaging cell lines

Jolly et al. (WO 92/05266) describes packaging cell lines expressing the 15 4070A envelope.

Imler et al. (WO 94/28142) describe replication deficient adenoviral vectors. Finer et al (WO 94/29438) describe packaging cell lines based on 293 cells transiently transfected with retroviral helper sequences

There is a need for new, stable packaging cell lines that permit the production 0 of high titers of retrovirus vectors in large-scale cultuies There is also a need for safer packaging cell lines

Summary of the Invention The invention features a cell line harboring a first expression construct encoding functional Friend Murine Leukemia Virus gag/pol. In a preferred embodiment * the cell line harbors a second expression construct encoding a functional viral envelope piotein An expression construct encoding a functional gag/pol is an expression construct which can express gag and pol that is capable of fulfilling the functional role of these piotems in the viral life cycle (e.g , is capable of acting with env and an appiopπate

. i retroviral vector to produce virion). Likewise an expression construct encoding a functional envelope is an expression construct which encodes an envelope protein which can fulfill the functional role of the envelope protein in the retroviral life cycle (e.g., is capable of acting with gag and pol and an appropriate retroviral vector to produce virion). A cell line is a clonal cell population generally of immortalized cells.

In moie preferred embodiments the viral envelope protein is a rclroviral envelope protein; the viral envelope protein is a non-retroviral envelope protein; the cells of the cell line are stably transfected with the second expression construct; the cells of the cell line are transiently transfected with the second expression construct; and the cells of the cell line are stably transfected with the first expression construct said second expression construct.

In an even more preferred embodiment the first expression construct is integrated into the genome of the cells of the ceil line at a first location and the second expression construct is inserted into the genome of the cells of the cell line a second location distinct from the first location.

In other preferred embodiments the cells of the cell line are transiently transfected with said first expression construct; the cells of he cell line are stably transfected with said first expression construct; and the Friend Murine Leukemia Virus is strain FB29. In still other preferred embodiments the envelope is an amphotropic envelope; and the envelope is an ecotropic envelope.

In another embodiment the invention features a ceil line produced by transfecting human 293 cells with the first expression construct to obtain a gag/pol expressing cell line and then transfecting the gag/pol expressing cell line with the second expression construct. In a more preferred embodiment the cells are stably transfected with the first and second expression constructs.

In another embodiment the invention features a cell line produced by iransfectmg human 293 cells with the second expression construct to obtain an envelope

- J expiessing cell line and then transfecting said envelope expressing cell line with the first expicssion consttuct In a more pieferied embodiment the cells are stably transfected with the first and second expression constructs.

In other prefeπed embodiments the fust and second expression constructs do not include a functional retroviral LTR

The cell lines are preferably based on the human cell line 293 In one embodiment the packaging cell line expresses the gag/pol genes of Fnend Murine Leukemia Virus (FmuLV) stiain FB29 and the 4070A env gene In another preferred embodiment the cell line harboring the first and second expression constructs further haibois a letrovual vector, the cell line being capable of producing virion

In another aspect the invention features virion produced by a cell line cell line hai boring a first expression construct encoding functional Friend Murine Leukemia Virus gag/pol, a second expression construct encoding a functional viral envelope protein

In yet another aspect, the invention features a method for producing virion comprising The method includes: (a) stably transfecting a cell line harboring the first and second expression constructs with a selected replication-incompetent retroviral vector which comprises a packaging sequence to create a producer cell line; and (b) culturing the pioducei cell line under conditions causing production of virion

In prefeπed embodiments of the method the packaging sequence is not the Fnend Murine Leukemia Virus FB29 psi sequence and the packaging sequence is a retiotransposon virus-like 30 S RNA psi sequence

A retroviral vector is a retroviral nucleic acid deleted for some or all of the sequences encoding viral proteins (gag, pol, and env) and aie therefor replication deficient Retroviral vectors generally include one or more heterologous (non-retroviral) genes Retroviral vectors are often used to transfer the heterologous gene(s) to cells which the virus infects, e.g , for somatic cell therapy. Retroviral vectors generally include (oi letain) sequences necessary for packaging and integration They also include sequences lequired for expiession of the heteiologous genes In many cases the expression and packaging sequences are not all derived from the same retrovirus. Expression sequences fiom non-viral sources are commonly used.

A cell which expresses the viral proteins required to complement a replication deficient retrovirus is referred to as a packaging cell. Packaging cells generally do not include the cis-acting retroviral sequences which actually dnect dimeπzation and encapsulation. A packaging cell which harbors a retroviral vector and can produce virion containing retroviral genetic material, including any inserted heterologous (non-retroviral) sequences, is referred to as a producer cell line. Packaging cell line have uses beyond somatic cell therapy as well. The packaging cell lines of the invention have a number of advantages. The stability of the cell lines is one important advantage. For example, the clone designated 293-E 17 is able to stably produce high virus titers even in the absence of any selection for eithei expression of structural genes or for the retrovirus vector produced by these cells Titers are stable for at least 10 cell passages and decrease only by a factor of 5 after 25 cell passages.

As described briefly below, and in greater detail in the examples, the sequential transfection of first the gag/pol expression vector and then the env expression vector assures that these vectors integrate at separate sites within the host cell genome. Recombination events which might otherwise occur between plasmids when they are co- transfected are thus excluded. The vectors can also be integrated in the opposite order. The fact that gag/pol genes employed in the packaging cell lines of the invention are derived from Friend Murine Leukemia virus FB29 and not from Moloney Murine Leukemia virus has several advantages. Optimizations may have occurred which, taken together, assure high vims titers, a higher physical stability of the virus particles or gieater halve- ves of the particles The strength of the promoters, the nature of the structural proteins, the kinetics of assembly of gag/pol encoded proteins into nucleocapsids, and the efficiency of maturation and release of virus particles from the infected cell, which requiies interaction of nucleocapsids with the envelop proteins present in the cellular membrane, can all contribute to the higher titer, gieater physical stability and longer half-life of the viral particles produced by the packaging cell lines of the invention. Moreover, the physical properties of virus particles based on FMuLV may facilitate vectoi purification and vector concentration processes indispensable for the pioduction of huge quantities of retiovirus vector particles foi gene therapy purposes cithei iv; vivo oi ex vivo.

Additional advantages can arise from the sequence differences between FMuLV and MoMuLV. Currently used retiovirus vectors contain a large psi packaging legion which extends into the gag coding region (e.g., up to the Narl site at position 1035 of MoMuLV). This psi region thus ovei laps with the entiie gag sequence encoding matrix piotein present in packaging cells. Although the retroviral vectors can be mutated (i.e , the gag ATG codon can be changed to a stop codon), there is at least a 365 bp overlap (between the original ATG and the Nad-fragment) which can permit unwanted lecombination. Such an event, of course, would not give rise to replication competent viruses However, it would create a product which could be subject of further recombination events and could be co-encapsulated into virus particles. The lower homology of only 83.6% (68 mutations in 416 bp) between FMuLV and MoMuLV in this icgion could help reduce the frequency of lecombination. All homology can be abolished by replacing the MoMuLV packaging sequence with a VL30 packaging sequence (see WO/9601324).

Brief Description of the Drawings Fig. 1 is a schematic drawing of the construction of the pTG5332 vector containing a FB29 FmuLV gag/pol gene. Fig. 1 A is a schematic drawing of the construction of the pTG5331 vector from FB29 FmuLV gag/pol gene and p poly III. Fig I B is a schematic drawing of the construction of the pTG5323 vector from FmuLV gag/pol gene and p poly III and M 13TG30. Fig IC is a schematic drawing of the const! uction of the pTG5332 vector from pTG5331 and pTG5323 vectors.

Fig. 2 is a schematic drawing of the -.truction of the pTG5349 vectoi

6 -

RECTIFIED SHEET (RULE 91) ISA/EP capable of expressing a FB29 FMuLV gag/pol gene. Fig. 2A is a schematic drawing of the construction of the pTG5324 vector from p DELTAE, pBCMGNeo and p poly III vectors. Fig. 2B is a schematic drawing of the construction of the pTG5354 vector from pY3, pTG6529 and p poly III vectors. Fig. 2C is a schematic drawing of the construction of the pTG5349 vector from pTG5345, pTG5332 and pTG5334 vectors.

Fig. 3 is a schematic drawing of the construction of the pTG5387 vector capable of expressing the amphotropic env gene of 4070A. Fig. 3A is a schematic drawing of the construction of the pTG5347 vector from pBCMGNeo, p DELTAE and p poly III. Fig 3B is a schematic drawing of the construction of the pTG5383 vector from pPAM3 and pBSK+ vectors. Fig. 3C is a schematic drawing of the construction of the pTG5387 vector from pTG5347 and pTG5383.

Fig. 4 is a schematic drawing of the construction of the pTG5366 vector capable of expressing the FB29 FMuLV ecotropic env gene.

Fig. 5 is a schematic drawing of several retroviral vectors. Fig. 6 is a flow chart of the construction of a stable amphotropic packaging cell line based on 293 cells.

400 clones tested for reverse transcriptase (RT) activity.

28 clones with highest RT activity were transfected with amphotropic envelop pTG5387 and retrovirus construct ρTG5391 (FB29 LTR - LacZ - SV40-Puro). - Transient titers and titers of mycophenolic acid/puromycin selected pools were determined.

After selection, only few clones continuously produced high virus titers and grew well.

30 subclones were tested for RTase activity. - The subclones were transfected with pTG5391 and pTG5387 to test for productivity.

Transient virus titers and titers of puromycin selected pools were determined.

All clones were tested for productivity by transient and stable transfection

RECTIFIED SHEET (RULE 91) ISA/EP with pTG5391.

Subclones of 275- 12 produce only in transient assays higher titers than subclones of 231-6.

Subclones of 231-6 grow better and produce higher titers after puromycin selection.

The best 40 clones were retested by transient transfection with pTG539 l and titration.

The best eight clones, 2.9, 2.6, 21.24, 28.10, 4.8, 17.6, 17. 16, and 18.4 were renamed A, B, C, D, E, F, G, H, respectively. - 133 subclones were tested for productivity by transient and stable transfection of pTG5391.

Most subclones of A, B, D, F, G, H grow slowy, contain giant cells and produce low titers. They do not support the subcloning procedure by limited dilution. - Almost all subclones of C and E produce high titers and grow well.

Clones EI7 and C18 grow the best and start off the fastet after thawing. Clones E are very sensitive towards puromycin ( I μg) but grow fast to confluency.

Clones E support best the subcloning procedure after transfection of retrovirus constructs.

Stable transfection of pTG539 l into E 17 and E20 results in titers of 5x 10 E6.

Selected subclones E17-5391 and E20-5391 produce up to 5x l0E7 cfu/ml. Stable transfection of pTG9325 into E I 7 results in a titer of 4x 10 E6. (Individual clones of PA317-9325 cells produce only 1 x 10 E6).

Selected stable subclones E l 7-9325 and E20-9325 are being titered. Serial passages and titrations with subclones E 17-5391 and PA3 17-5391 arc being performed to test for long-term stability.

- 8

RECTIFIED SHEET (RULE 91) Fig. 7 is a photograph of the results of an experiment peiformed to assess the transduction ability of virus produced by a packaging cell line of the invention

Fig 8 is a schematic diawing of a retiovira! vector which can be used in conjunction with the packaging cells of the invention to create a producer cell line Descnption of the Piefened Embodiments

Descnbed below aie retrovual packaging cell lines useful foi the pioduction of high titei retiovirus vectots The packaging cells of the invention are based on human cells oi othei cells have veiy few oi no endogenous retioviial sequences (e g , human 293 cells) Using human cells as packaging cells decreases the risk of producing lephcation competent retroviruses by eliminating endogenous muπne retroviruses The use of human packaging cells also avoids the problem of serum mactivation of virus vectoi pai tides Human 293 cells (Graham et al , J Gen Virol 36 59, 1977) have been shown to be useful foi high titer retrovirus expression These cells contain the Adenovitus 5 E l A and EIB legion, the gene products of which transactivate transcription of tiansfected genes. This meets the requirements for high level production of viral stiuctural proteins and RNA

In addition to producing virion for use in somatic cell therapy, producer cells can be directly injected into a patient Direct injection has been shown to be more efficient than injection of virion (Tamiya et al , Gene Therapy 2 531, 1995)

In one embodiment, the packaging cells of the invention also harbor the Adenovirus E l region (Graham et al , J Gen Vaol 36 59, 1977) and thus encode pioteins which transcriptional activators for a large number of eukaryotic promoters These cells can support high level expression of retroviral structural genes that are under the control of a non-retroviral promoter

The retroviral structural genes expressed by the packaging cell lines of the invention are divided between two expression plasmids This reduces the risk of lecombination between these stiuctural genes and any retiovπus vectoi amplified in these cell lines Moieovei, the letioviral stiuctuial gene encoding plasmids lack known icti oviial legulatory sequences

The packaging cell lines described below have a nu bei ot usetul features which aie more readily undeistood by leference to the mannci in which they were

Fust, the vectoi s used to express retioviial structuial pioteins preferably employ non-retioviral contiol elements In one embodiment, the invention featuies gag/pol and env expression constiucts employing a cytomegalovuus piomotcr, labbit beta globin intt on 2 intron and poly A sequences, a mouse mitochondrial 12S DNA sequence (usetul for introducing seveial copies of the expression plasmid into actively transcribed genome legions), and a selection expiession cassette which includes the SV40 promoter, the SV40 poly A sequence, and a gene conteiπng diug resistance This last feature pei mits duect selection of cell clones which, after tiansfection, have stably integrated the plasmids into their genome This avoids the need to co-transfect a plasmid carrying a selective marker along with the expression vector

In some embodiments, 18bp of retroviral sequence upstream of the gag/pol ATG and 7 bp of retrovnal sequence upstream of the env ATG remain. In some cases it may be desirable to remove all retroviral sequences Finer et al. (WO 94/29438) describe an approach which permits removal of all retroviral sequences upstream of the gag/pol and env coding sequences

The cell lines of the invention are prepared using a two step transfection in which the expression constiuct encoding gag/pol and the expression construct encoding env aie separately transfected This two step process reduces the opportunity for unwanted lecombination events One can, of couise, transfect with either vector first In the example described below, the packaging cell lines were produced by f irst tiansfecting 293 cells with a vector which encodes the FMuLV FB29 gag/pol genes Positive selection with hygiomycin B pcπmtted identification of transfected clones Stably ttanstecied cells were then transtected with a vectoi expressing an amphotropic an gene When this cell line was then transfected with a letioviral vector, virion having a bioad host range can be produced Virion produced by this packaging cell line are able to efficiently tiansduce human, canine, feline and mouse cells These vual paiticles may also be used to infect all cell types which aie infectable by the amphotiopic 4070A vnus Altematively, the stable gag/pol expiessmg cell line can be tiansfected with a vectoi capable of expiessmg the ecotiopic FMuLV FB29 em gene When these cells aie transtected with a letioviral vector, ecotropic vuion can be produced

The stiain FB29 was isolated by cloning viral circulai DNA from cells infected with Friend Murine leukemia virus FMuLV 1-5 (Sitbon, et al , Cell 47S51 , 1986, Mathieu-Mahul et al , Virology 1 19 59, 1982, Perry man et al., Nucleic Acids Res ,

19 6950, 1991 ). The clone FB29 proved to be highly virulent in mice (Sitbon, et al., Cell 47 851 , 1986; Portιs et aI., y Virol. 65: 1877, 1991 )

The gag/pol genes of the FB29 FMuLV are encoded by overlapping reading fiames which cover nucleotides 619-2235 and 2221 -5835 of the retroviral genome (according to the nucleotide sequence disclosed in GeneBank/EMBL under accession number Z 1 1 128) and are generated from the viral mRNA by ribosomal frameshifting The FB29 env protein which is of ecotropic type is transcribed from a post- tianscnptionally modified spliced vual mRNA The 5' coding region of the env gene overlaps with the 3' end of the pol gene (position 5775-5835) Perryman et al. (Nucleic Acids Res. 19:6950, 1991 ) report the complete nucleotide sequence of Friend murine leukemia virus, strain FB29 Plasmid const! uction

To minimize the risk of generating recombinant, replication competent vu uses, the gag/pol genes and the env gene are expressed from two different vectors In the example below, the viral structural genes, gag/pol and env, are expressed under contiol of the Cytomegalovirus immediate early promoter and enhancer (Boshart et al , Cell 4 \ 521 , 1985) To increase long mRNA half-life and high translation efficiency, the vectors used to express retioviral structural genes in the example descnbed below contain

I I - the intron and 2 poly A fragment of the rabbit beta 1 -globin gene. The vectors also contain a 1.1 kb fragment of mouse mitochondrial 12 S rDNA from pDelta. This sequence includes elements which cause the formation of head-to-tail multimeric structures when they integrate into mammalian host chromosomes (Lutfalla et al.. Somatic Cell and Molecular Genetics, 1 1 :223, 1985). Both vectors include a selectable marker for identification of stably transfected cells. The vector expressing gag/pol includes a hygromycin B resistance gene located between SV40 early promoter and the SV40 polyA region. The vector expressing env includes a mycophenolic acid resistance gene located between SV40 early promoter and the SV40 polyA region. It should be understood that various of these elements can be replaced by functionally similar elements. Thus, the Cytomegalovirus promoter could be replaced by another strong promoter capable of directing high level constitutive or inducible expression in the chosen cell line. Suitable vectors include, but are not limited to, the BKG promoter, the MT promoter, and the TK promoter. Similarly, the selectable markers can be replace by other selectable markers.

Isolation of DNA, digestion with restriction enzymes, purification, PCR amplification and other manipulations of DNA fragments used in cloning procedures were performed using methods well known to those in the art of molecular biology, (see, e.g., Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY, USA, 1982). Plasmids were grown on E. coli DH5 alpha (Woodcock et al., Nucleic Acid Res. 17:3469, 1989). Site-directed mutagenesis were performed using the Amersham oligonucleotide-directed in vitro mutagenesis system (Version 2. 1 , code RPN 1523) essentially as described in the manufacturer's protocol. The single-stranded M 13 DNA which served as template were purified after phage amplification on NM522 cell (Woodcock, Nucleic Acids Res. 17:3469, 1988; Gough et al., J. Mol. Biol., 166: 1 , 1983) using standard procedures.

Cloning of FB29 FMuLV gag/pol genes: fpTG 5332)

This example describes the cloning, from FB29 genomic DNA. of two

- n fragments which togethei include the entire gag/pol gene, the modification of these two fiagments by site-directed mutagenesis to introduce new restriction sites, and the leconstitution of the gag/pol coding region to generate vector pTG5332 These piocedures aie illustrated schematically in Fig. I 5 Fust, the KpnI-EcoRI fragment (nucleotides 480-3297) of FB29 was subcloned into the KpnI-EcoRI sites of pPolylll-I (Lathe et al.. Gene 57" 193, 1 87) lesulting in plasmid pTG5303. Using the Accl restriction sites in the polylinkei and in the gag gene (nucleotide 1337), a 881 bp Accl fragment of pTG 5303 was subcloned into the Accl site of M 13 mpI30, resulting in MI3TG 5306 which was subsequently mutagenized 10 to mtioduce a new EcoRI site upstream of gag initiator ATG using OTG54 I 9

(ACAAATACAGGAATTCAGTCAAACAG) (SEQ ID NO.- 1 ) The 886bp Accl f i agment of the resulting vector M 13TG 5325, which contains the 5' end of the gag gene coding region with the new EcoRI site, was then reintroduced into the Accl sites of pTG 5303 from which the 881 bp Accl fragment had been removed, resulting in pTG 5331.

1 Second, the HindlH-AccI fragment of FB29 genome (nucleotides 5508-6352) was cloned into the Hmdlll-Accl sites of M13TG130. Site-directed mutagenesis was pei formed on the resulting vector M l 3TG 5305 with OTG 5334 (GGCCCCTTTGGTCGACAGGAAGAG) (SEQ ID NO.: 2) to create a new Sail lestπction site 1 I bp behind the TAG stop codon of the pol reading frame (nucleotide

20 5855). giving M 13TG5307. This change also serves to minimize sequence homology between gag/pol and env expression vectors which could allow homologous lecombination

The EcoRI- Hindlll fragment of FB29 genome DNA (nucleotides 3297-5508) was introduced into the EcoRI-Hind III sites of pPoly III-I, resulting in pTG5304 The

25 795 bp Hind Ill-Sail fragment from M 13TG 5307 carrying the 3' end of the pol gene with the new Sail site was cloned into pTG 5304 linearized with Hindlll-Sall. resulting in pTG 5323 The entire gag/pol coding region was reassembled by cloning the 2254 bp EcoRI f i agment of pTG 5331 into the EcoRI site of pTG 5323. lesulting in pTG5332.

- u Construction FB29_FMuLV gag/pol expression vector tpTG 5349) The construction of expression vector pTG 5349 is depicted in Fig. 2. The Cytomegalovirus immediate early promotor and enhancer region together with the rabbit beta- 1 globin intron-2 polyA region were isolated from pBCMG Neo (Karasuyama et al., J. Exp. Med. 169: 13, 1989; Karasuyama et al., Eur. J. Immunol. 18:97, 1988) by digestion with Xbal, filling in with Klenow fragment of E. coli DNA polymerase I ("Klenow"), and digestion with Bglll. This fragment contains the CMV immediate early promotor and enhancer region from position - 671 to +73, and the rabbit beta- 1 globin intron-2 polyA fragment from position 903-2063 (GENEBANK accession K03256 and M l 2603). The original EcoRI site at position 1542 in the beta- 1 globin gene had been changed by introduction of a Xhol linker generating a unique Xhol restriction site into which genes of interest can be cloned. This fragment was inserted into pPoly III-I linearized with Xhol, filled in with Klenow, and then digested with Bglll. The resulting plasmid is pTG 5343. A 1.1 kb EcoRI fragment from pTG 5324, filled in with Klenow and containing the mouse mitochondrial 12S rDNA from pDelta ( Lutfalla et al., Somatic Ceil and Molecular Genetics, 1 1 :223, 1985) was then transferred into pTG 5343 linearized with Nael. The resulting plasmid pTG 5345 was then linearized with Xhol and ligated with the Xhol fragment from pTG 5332 which contains the gag/pol genes from FB29 FMuLV. The resulting plasmid pTG 5348 contains the viral structural genes under control of the CMV promotor but lacks an eukaryote selective marker.

A suitable selectable marker was prepared as follows. First, an SV40 expression cassette was generated from pTG 6529 which is a p polylll-I plasmid having incorporated a cassette expressing the puromycin resistant gene (JHIC) under the control of SV40 early promoter and SV40 poly A sequence. After digestion with Hindlll and partial digestion with Xhol to remove the pac gene, the ends were filled with Klenow and the vector was religated. The resulting plasmid pTG5353 contains a unique Hindlll site between the SV40 promotor and poly A regions. The Escherichia coli Hygromycin B phosphotransfera.se gene from plasmid pY3 ( Blochlinge et al., Mol. Cell. Biol., 4:2929. 1984 ; Gntz et al., Gene 25: 179, 1983) was released as a KpnI-SacI fragment and cloned into pPoly III-I linearized with Kpnl and Sad, resulting in plasmid pTG 5352. To generate pTG5354, the Smal-Hindlll fragment of pTG 5352 containing the hygromycin phosphotransferase gene was filled with Klenow and the cloned into pTG5353 linearized with Hindlll and filled with Klenow. The Xhol fragment of pTG 5354 containing SV40 promotor, hygromycin phosphotransferase gene and SV40 polyA was then cloned into pTG 5348 linearized with NotI after filling in the ends with Klenow. The resulting plasmid is pTG 5349, the expression vector for FB29 FMuLV gag/pol genes.

Construction of the amphotropic env gene expression vector (pTG5387) The construction of vector pTG5387 expressing the env gene is illustrated schematically in Fig. 3.

Plasmid pPAM3 (Miller et al., Mol. Cell Biol., 6:2895-2902, 1986) contains a Sall-Clal fragment which includes the env gene from amphotropic 4070A virus. The sequence downstream of the Clal site, which includes the C-terminal 32 amino acids of the env gene, is from ecotropic MoMuLV. The amphotropic env gene from pPAM 3 (Miller et al., Mol. Cell Biol., 6:2895-2902, 1986) was modified by introducing a new Sail restriction site 10 bp upstream of the ATG start codon. For this purpose, the Xbal-BamHI fragment from pPAM3 comprising the 5' region of the amphotropic env gene was cloned into the Xbal-BamHI sites of pBluescript SK^* (Stratagene, La Jolla, CA, USA), resulting m pTG 5369. Single stranded plasmid (phagemid) DNA of pTG 5369 was recovered from E. coli XL 1 Blue cells infected with helper phage R408 (Stratagene, La Jolla, CA, USA), essentially as described in the manufacturer's protocol. Mutagenesis of single stranded DNA with oligonucleotide OTG 6057 (CCATGTCCGTCGACAGGATGGTCC) (SEQ ID NO.: 3) was performed to introduce a new Sail site. The resulting plasmid pTG 5380 was linearized with BamHI, and the BamHI fragment from pPAM3 comprising the 3' end of the amphotropic env gene was introduced, resulting in pTG 5383. The entire env gene was released by digestion with Sail and cloned into the Xhol site of expression vector pTG 5347. Plasmid pTG 5347 was constructed by introducing the Sall-Clal

l -> - fragment from pDelta (see above) from into the Narl site of pTG 5343 (see above) aftei filling in the end with E colt DNA polymerase I The fragment fiom pDelta includes the mouse mitochondrial 12s DNA and the XGPRT gene, confeiπng icsistance to micionephronic acid, under contiol of the SV40 piomotot and the SV40 poly A region The sequence of the FB29 FMuLV gag/pol gene and the amphotiopic 4070A env differ significantly The amphotropic env and FB29 gag/pol contain 64 bp that are 90 7% homologous

Cloning and constiuction of FB29 FMuLV ecottopic env gene expiession vectoi fpTG5366) The construction of pTG5366 is illustrated schematically in Fig 4

The ecotiopic FMuLV FB29 env gene (Sitbon, et al , Cell 47 851 -859) was amplified by polymerase chain reaction (PCR) with oligonucleotides OTG 5703 (GAGGATCCATGCATCGGAATCGACATG) (SEQ ID NO 4) and OTG 5708 (TAGGATCCATGCATTATTTATTGTGGCTCG) (SEQ ID NO 5) using standard piotocols Briefly, 100 ng of template DNA was amplified in a 100 μl reaction using 100 pmol of pπmers. By using OTG 5703 and OTG 5708, new Nsil sites were introduced at genome positions 5759 and 7809, respectively. The PCR product was cut with Nsil and cloned into the PstI site of pPolylll-I, resulting in pTG 5364 Subsequently, the Ball fragment of the env gene in pTG 5364 was replaced by the identical fragment isolated from pFB29 (position 5991 -7533) to exclude all possibilities of having introduced mutations during the PCR amplification process. The env gene of the resulting plasmid pTG5365 was cut out with Xhol and Sail and cloned into pTG5347 The resulting expression vector pTG 5366 contains the entire FMuLV FB29 env gene The sequence overlap between FB29 gag/pol and FB29 env expression vectors can be only 95 bp (position 5762-5857). Generation of Cell Lines

General technology

The 293 cells (Graham et al , J Gen Vu al J6. 59. 1977) (CRL 1573, Lot No FI 0I50), NIH 3T3 cells (CRL 1685), Mus dunni cells (CRL 2017), canine MDCK cells (CCL 34), feline PG4 cells (CRL 2032), A549 cells (CCL 185), and HeLa cells (CCL 2) were obtained from ATCC (Bethesda, MD). Cells were grown in Dulbecco's modified Eagle's medium containing 10% (vol/vol) fetal calf serum, 3 g/ml glucose, 1 % non- essential amino acids and 200μg/ml gentamycin. Selection of transfected or infected cells was performed with Hygromycin B (Boehringer Mannheim) at 350 μg/ml. Selection with mycophenolic acid was performed in medium supplemented with 15 μg/ml Hypoxanthine (Sigma), 15 μg/ml Thymidine (Sigma), 250 μg/ml Xanthine (Sigma) and 25 μg/ml Mycophenolic acid (Serva). Puromycin was used at 1 μg/ml. Plasmid DNA transfection into eukaryotic cells was performed using the calcium phosphate precipitation method of Graham et al. (Virology 52,456, 1973). Reverse transcriptase activity in cell culture supernatants was determined as described by Goff et al. (J. Virol., 38:239, 1981 ). β-galactosidase activity in cells fixed with formaldehyde/glutaraldehyde was determined as described by Sanes et al. (EMBO J., 5:3 133, 1986). Radioactive, ³²P labeled DNA probes were generated using the

Amersham multiprime DNA labeling system (RPN 1600Y), essentially as described in the manufacturer's protocol.

To determine retrovirus titers produced from individual cell clones expressing either only the FB29 FMuLV gag/pol genes or FB29 FMuLV gag/pol plus amphotropic env genes, transient transfections were performed in 6 well plates with 40-50% confluent cells, using the retrovirus vectors illustrated in Fig. 5. Vector pTG5363 represents a retrovirus vector carrying the puromycin resistance marker under control of an internal SV40 promotor and the human CD4 cell surface antigen gene under control of the LTR (LTR-ΨFB29-hCD4-SV40prom-pac-LTR). Vector pTG5391 carries the E. coli β- galactosidase (LacZ) gene under control of the LTR and the puromycin resistance marker under control of an internal SV40 promotor (LTR-ΨVL30-LacZ-SV40prom-pac-LTR). Vector pTG4371 comprises the LacZ gene with a nuclear localization sequence (nls) directed by the retroviral LTR (LTR-ΨMLV-nlsLacZ-LTR). Finally, vector pTG9325 expresses the neomycin-resistant gene (Neo) under the control of the LTR (LTR-ΨVL30 - Neo-LTR).

The virus particles produced in culture supernatant were then titred on NIH 3T3 cells (ATCC: CRL 1685) using standard methods. Briefly, 5x lθ' cells in 6 well plates were incubated for I h in presence of 15 μg/ml polybrene with 400 μl of serial dilutions ( 10 " to l 0^"'i) of supernatants from transfected producer cells culture supernatants. After l h, 3 ml of medium was added. Selection for puromycin resistant cells was performed by replacing the medium 24 h after the infection with 2 ml of DMEM containing 1 μg/ml of puromycin. The medium was changed every two days. Colonies of puromycin resistant, transduced cells were counted after 10-14 days. Staining for β- galactosidase activity was performed 48 h after the infection by standard methods.

Transient retrovirus expression system

Five micrograms of each of the plasmids pTG 5349 (FB29 gag/pol) and pTG 5366 (FB29 env) were transfected together with 15 μg of either vector pTG 5363 (LTR - CD4-S V40prom-pac-LTR) or vector pTG 4371 (LTR-nlslacZ-LTR) into 293 in 10 cm dishes containing 10 ml DMEM. After 16 h, the medium was changed. Eight hours later the medium was replaced by 4 ml of DMEM. After 24h, the medium was recovered, filtered through 0.45μm filters and frozen at -80°C. The virus particles produced in this transient assay were titered on NIH 3T3 cells as described above. The results presented in Table I show that titers obtained from transiently transfected 293 cells are up to 4-fold higher than titers obtained with stable ecotropic GP+E-86 cell lines (Markowitz et al., J. Virol. 62: 1 120- 1 124, 1988)

- 11 TABLE I pTG 4371 pTG 5363

(lacZ) (Puromycin)

GP E 86 19 xlO³ 5.5 xlO³ 293 25 xl0³ 22 xlO³

Production of stable gag/pol expressing cell lines

Described below is the construction and use of cells stably expressing FB29 gag/pol genes. 293 cells were transfected with pTG 5349 (FB 29 FMuLV gag/pol) using the calcium phosphate precipitation method. Twenty micrograms of DNA were allowed to form precipitates in a volume of 500 μl calcium phosphate solution and then added to 10 cm culture dishes containing 10 ml of DMEM culture medium and the target cells at a density of 40-50%. After 16 h the medium was changed. Forty-eight hours after transfection the cells of each dish were split into 5 new 10 cm dishes and selective medium containing 350 μg/ml of Hygromycin B was added. The medium was changed every 4 days. After 3 weeks, clones were recovered and cultivated in 24 well plates. When clones became confluent, 24 h-supernatants were recovered from the wells, filtered through 0.45μm filters, and pol expression was determined by reverse-transcriptase activity (RT). Cell clones with high RT activity were subsequently expanded in 6 well plates, trypsinized and frozen in 10 % DMSO (Sigma), 20% FCS at -80°C.

Table II shows the reverse transcriptase activity of the 293 TG5349 cell clones which, in subsequent experiments, gave the best results. The RT activity in the best clones is 4-fold higher than in the GP + E-86 cell line, an ecotropic NIH 3T3 based cell line containing the MoMuLV gag/pol genes under control of the MoMuLV LTR (Markowitz et al.,/. Virol. 62:1120-1124, 1988).

The 27 clones 293-TG5349 with the highest reverse transcriptase activity were thawed, grown up and tested for transient virus production in two independent

- 19 -

SU8STITUTE SHEET experiments. These 27 clones were transfected with 1.5 μg pTG 5366 (FB29 env gene) and 3 μg pTG 5363 (LTR-hCD4-SV40prom-pac-LTR) in 2 ml DMEM. Titration for puromycin resistant transduced NIH 3T3 cells was performed as described above. As controls, GP + EnvAml2 cells were transiently transfected with pTG5363. In these experiments, 293-TG5349 cell clone 231 gave 12.5 times higher titers than GP + EnvAml2 cells.

TABLE II

RT ^' activity P uromycin resistant colonies

(cpm x 10³) Exp.l Exp.2 mean Titre (xlO⁴)

293-TG5349- 59 27 25 0 6.3

293-TG5349- 82 21 16 0 4.0

293-TG5349- 98 22 4 1 1.3

293-TG5349- 118 16 11 8 4.3

293-TG5349- 122 15 10 11 5.3

293-TG5349- 231 22 80 10 22.5

293-TG5349- 244 16 1 1 0.5

293-TG5349- 275 20 90 50 35.0

293-TG5349- 280 12 36 20 14.0

293-TG5349- 295 12 1 1 0.5

293-TG5349- 298 17 24 18 8.0

293-TG5349- 357 16 1 1 0.5

293-TG5349- 388 15 37 18 13.8

GP + E- 86 7 n.d. n.d.

GP + EnvAml2 n.d. 4 7 2.8

The clones 231, 275 and 280, which gave the highest titers in both experiments, were finally subcloned by limited dilution in 96 well plates using a cell suspension containing 0.3 cells per 200 μl per well. Subclones were retested for reverse transcriptase activity. Those with highest RT activity were 23 I -6 and 275- 12.

Production of stable gag/pol and env cell lines Clones 293 TG5349 231 -6 and 275- 12 were transfected in 10 cm dishes with

20 μg pTG 5387 (4070A amphotropic env). After transfection and splitting of each dish into 5 new 10 cm dishes, the cells were selected for XGPRT with 25 μg/ml mycophenolic acid. Medium was changed every 4 days and resistant colonies were picked into 24 well plates after 4 weeks. After the cultures had grown to confluency, the clones (approximately 250) were split into two wells of a six well plate. The cells from one well were subsequently trypsinized and frozen in DMEM 10%DMSO, 20%FCS, the cells in the duplicate well were transfected with 2 μg of the retroviral vector pTG 5391 (LTR- LacZ-SV40prom-pac-LTR) and tested for transient virus production 48 h after the transfection by determining the β-galactosidase titers on infected NIH 3T3 cells. Additionally, after recovery of the medium, the transfected clones were selected for stable virus vector production in medium containing 1 μg/ml puromycin and the puromycin resistant pools were retitered.

Of the 250 clones screened by this procedure, approximately 1 in 5 clones produced a titer of greater than 10^s. Eight clones producing titers between 5x l 0⁶ and 1 x I0⁷ were finally chosen for subsequent cloning by limited dilution (parental clones A, B, C. D, E, F, G and H). Of these eight clones, two grew very well and generated fast growing subclones. 20 subclones for each parental clones A to H were tested for transient and stable virus vector production after transfection with pTG 5391 as before. The best 6 subclones were additionally tested with another vector construct, pTG 9325 (LTR-Neo- LTR). The stable titers obtained from puromycin or neomycin-selected pools of cells are civen in table III. TABLE III

pTG 5391 pTG 9325 (lacZ) (Neomycin)

PA317 0.9 xlO⁶ 1.0 xlO⁶

293 TG5349 + TG5387 clone E2 1.8 xlO⁶ 1.5 xl0^G clone E17 4.5 xlO⁶ 3.5 xlO⁶ clone E20 3.5 xlO⁶ 0.3 xlO⁶ clone B4 2.0 xlO⁶ 0.5 xlO⁶ clone B18 1.0 xlO⁶ 0.4 xlO⁶ clone C26 1.0 xlO⁶ 0.4 xlO⁶

TABLE IV

pTG 5391 (lacZ)

PA317 subclone 4 0.5 xlO⁷

293 TG5349 + TG5387 subclone E2 -6 2.8 xlO⁷ subclone E2-12 4.0 xlO⁷ subclone El 7-3 1.8 xlO⁷ subclone E17-5 1.7 xlO⁷ subclone El 7- 12 1.8 xlO⁷ subclone E20-2 2.3 xlO⁷ subclone E20-4 3.3 xlO⁷ subclone E20-7 1.8 xlO⁷ subclone E20-14 1.8 xlO⁷

9? pTG5391 producei cells were subcloned by limited dilution Individual subclones were isolated and the titers weie compared to the highest producei subclone that could be isolated from PA317 cells The results (Table IV) show that individual pioducei subclones geneiated fiom the 293 based gag/pol env cell line produce titers which largely exceed 10⁷ cfu/ml

Transduction capabilities of viius pioduced on the 293 the packaging cells To determine the transduction efficiency of vectors produced by a cell line of the piesent invention to currently used systems, we infected mouse NIH 3T3 cells, Mus dunni tail fibroblasts (which, unlike NIH 3T3 cells, are not infectable by ecotropic vu uses), human lung caicinoma cells A549, human HeLa cells, canine MDCK cells and feline PG4 cells with supernatants of producer clones 293 El 7-3 and PA3 I 7-4, and with the supernatant from a producer clone of GP+EnvAm l 2 cells cotransfected with vector pTG 4371 and a plasmid encoding the puromycin resistance maiker Producer cell clones weie seeded in 175 cm² cell culture flasks. When cultures were 80% confluent, the medium was removed, replaced by 8 ml of fresh medium, and 24 h later supernatants weie lecovered, and filtered through 045μm filters The supernatants were supplemented with 15 μg/ml of poiybrene and 0.5 ml was subsequently used to infect the different target cells which were 50-60% confluency in 6 well plates 1 h later, 3 ml of medium was added, and after 24 h the medium was changed After 48 h the cells were stained for β- galactosidase activity As can be seen in Fig. 7, vectors from 293 packaging cells ttansduce the different cells 5- 10 times more efficiently than vectors produced on PA3 17 oi GP+EπvAml2 cells. This, in pait may be due to the higher titers produced on 293 based packaging cells. However, as was described by Morgan, et al. (J. Virol 69:6994- 7000. 1995) and Forestell et al. (Gene Therapy 2:723-730, 1995), there is no direct linear correlation between the multiplicity of infection and the transduction efficiency or between the end-point-titer determined on NIH 3T3 cells and the transduction efficiency of cells different from NIH 3T3 cells Additional, specific factors from 293 cells may thus add to the significant increase in transduction efficiency observed with the cells of the present invention.

Stability of he 293 packaging cell lines E l 7-3 and PA 17-4 Producer clones E l 7-3 and PA317-4 were passaged every 4 days at a ratio of 1 : 10 in medium without any selective antibiotics. Every 5 passages, cells were frozen. Subsequently, the cells with different passage numbers were thawed in parallel. The supernatants obtained from these cells were titered on NIH 3T3 for β-galactosidase activity. Titers of 293 producer were shown to be stable for at least 10 passages whereas titers from PA3 17 producer cells dropped by a factor of 2. Industrial Applications The procedures described above can be used to produce virion which display on their surface envelope glycoproteins from any of a wide variety of retroviruses including polytropic, xenotropic, or ecotropic virus. For example, suitable retroviral envelope proteins include those derived from Feline Leukemia virus, Gibbon ape Leukemia virus (Eglitis et al., Gene Therapy 2:486, 1995; Miller et al., J. Virol. 65:2220, 1991 ), or other retroviral leukemia virus. Gibbon ape leukemia virus envelope is a particularly desirable envelope protein because it recognizes many human cell types, in particular, bone marrow cells. Envelope proteins which mediate the infection or progenitor cells are particularly useful for somatic cell therapy.

In general, envelope proteins from any enveloped virus may be used, whether the virus is a DNA virus, a negative strand RNA virus or a positive strand RNA virus. Thus, useful envelope proteins include, but are not limited to. those of: Vesicular Somatitus Virus (VSV) G protein, hepatitis B glycoprotein, influenza virus HA glycoprotein.

The procedures described above can be used to create packaging cell lines for the production of pseudotyped virus in which the genome of a first virus is associated with the envelope protein of a second virus. Such virus can be used to infect cells recognized by the envelope protein of the second virus. In some circumstances it is preferable to use hybrid envelope proteins produced by combining domains from two or more different env

- 24

SUBSTITUTE SHEf I _{(ftULE 26)} genes such that the cytoplasmic domain of the envelope is derived from a virus that is compatible with the remainder of the viral components and the extracellular portion of the envelope is derived from a virus which can infect the target cells. The preferred location for recombination is within the membrane spanning region of the envelope protein. Jolly et al. (WO 92/05266) describes methods for producing hybrid envelope proteins.

The methods described above can also be used to prepare virus having other genetically modified envelope proteins.

Cell lines other than human 293 cells can be used to prepare packaging cell lines. Preferred cell lines are those which are relatively or completely free of endogenous retroviral sequences.

Under some circumstances it may be desirable to produce retrovirus by transient transfection of a packaging cell line rather than by the production of a stably transfected producer cell line. This approach is particularly useful for producing high tiers of retroviral vectors which express gene that are difficult to propagate at high tier in stable producer cell lines. Pear et al. (Proc. Natl. Acad. Sci. USA 90:8392, 1993) describes the use of transient transfection to produce retrovirus.

Packaging cell lines can be used to generate producer cell lines which can be used to produce virions for the transfection of target cells. Target cells can be transduced by co-cultivation with producer cells or by incubation with viral particles or viral supernatant obtained by the culturing of producer cells. Target cells are generally exposed to virions in the presence of polycation (Cornetta et al., J. Virol Meth. 23: 187, 1989). Repeated transduction can be used to increase the percentage of target cell transduced. The use of vectors which include selectable markers followed by positive selection can also increase the percentage of target cells transduced. Rosenberg et al. (New Engl. J. Med. 323, 1990) describes a useful gene therapy protocol employing a retroviral vector. In order to be useful for gene therapy, a producer cell line must not generate replication competent virus. A number of methods for determining whether a retroviral supernatant is free of replication competent retrovirus are known to those skilled in the art. In one approach producer cell supernatant is used to transduce a susceptible target cells which are then tested by PCR for the presence of helper virus DNA (Morgan et al.. Human Gene Ther. 1 : 135, 1990; Anderson et al., Human Gene Therapy 4:31 I , 1993). This approach is capable of detecting one cell containing helper virus against a background of 100,000 helper virus-free transduced cells. Like all other therapeutic agents, retroviral supernatant should be tested for the presence of potential pathogens and toxins using the standard FDA required general safety tests. Transduced cell are generally suspended in normal saline for administration to a patient by subcutaneous injection. Anderson et al. (U.S. 5,399,346) describes a number of useful techniques for the preparation of transduced cells for administration to patients.

What is claimed is:

- 26 -

SUBSTI fUTE SHEET (RULE 26)

Claims

1 A cell line harboring a first expression constiuct encoding functional Friend Murine Leukemia Virus gag/pol

2 The cell line of claim I wherein said cell line harboi s a second expression consttuct encoding a functional vual envelope protein

5 3 The cell line of claim 2 wheicin said viral envelope piotein is a letioviral envelope protein

4 The cell line of claim 2 wheiem said vual envelope protein is a non- ictioviral envelope protein

5. The cell line of claim 1 wherein the cells of said cell line are transiently 0 tiansf ected with said first expression construct.

6 The cell line of claim 2 wherein the cells of said cell line are transiently transfected with said second expression construct

7 The cell line of claim 1 wheiein the cells of said cell line are stably tiansfected with said first expression construct.

s 8 The cell line of claim 2 wherein the cells of said cell line are stably transfected with said second expiession construct.

9 The cell line of claim 2 wherein the cells of said cell line are stably transfected with said first expression construct and said second expression construct

10 The cell line of claim 9 wheiein said first expression construct is integrated into the genome of the cells of said cell line at a first location and said second expression construct is inserted into the genome of the cells of said cell line a second location distinct from said first location.

I I . The packaging cell line of claim I wherem said Friend Murine Leukemia

Virus is strain FB29.

13. The cell line of claim 2 wherein said envelope is an amphotropic envelope.

14. The cell line of claim 2 wherein said envelope is an ecotropic envelope.

15. The cell line of claim 2, said cell line being produced by transfecting human 293 cells with said first expression construct to obtain a gag/pol expressing cell line and then transfecting said gag/pol expressing cell line with said second expression construct.

16. The cell line of claim 2, said cell line being produced by transfecting human 293 cells with said second expression construct to obtain an envelope expressing cell line and then transfecting said envelope expressing cell line with said first expression construct.

17. The cell line of claim 15 wherein the cells of said cell line are stably transfected with said first and said second expression construct

18 The cell line of claim 16 wherein the cells of said cell line are stably transfected with said first and said second expression construct

19. The cell line of claim 2 wherein said first and second expression constructs do not include a functional retroviral LTR.

20. The cell line of claim 2 said cell line further harboring a retroviral vector, said cell line being capable of producing virion.

21 . Virion produced by the cell line of claim 20.

22. A method for producing virion comprising:

(a) stably transfecting the cell line of claim 2 with a selected replication- incompetent retroviral vector which comprises a packaging sequence to create a producer cell line; and (b) culturing said producer ceil line under conditions causing production of virion.

23. The method of claim 22 wherein said packaging sequence is not the Friend Murine Leukemia Virus FB29 psi sequence.

24. The method of claim 23 wherein said packaging sequence is a retrotransposon virus-like 30 S RNA psi sequence.