WO1997032998A2 - Materials and methods relating to the identification of a polymorphism associated with disease susceptibility - Google Patents

Abstract

The inventors have found a highly significant association between homozygotes (designated tt) for the less common allele t of the Taq1 VDR polymorphism and susceptibility to autoimmune infectious diseases such as tuberculosis, hepatitis B, leprosy, HIV-1. There is provided a method for the determination of an individual's susceptibility level to autoimmune disease or infectious disease which comprises obtaining a sample of tissue from the individual; obtaining from the tissue sample a test sample comprising nuclear material from cells of the tissue sample; establishing the individuals vitamin D receptor (VDR) genotype, namely establishing whether or not the individual is: homozygous or heterozygous for a less common allele of the gene for the vitamin D receptor (VDR) and wherein said less common allele of the VDR gene comprises the polymorphisms B and A in intron 8 of the VDR gene and the polymorphism t in exon 9 of the VDR gene; or homozygous for a more common allele of the VDR gene and wherein said more common allele of the VDR gene comprises the polymorphisms b and a in intron 8 of the VDR gene and the polymorphism T in exon 9 of the VDR gene and wherein the genotype in relation to the VDR is specifically associated with susceptibility level to one or more autoimmune or infectious diseases.

Description

Materials and Methods Relating to the Identification of a Polymorphism Associated with Disease Susceptibility

The present invention concerns materials and methods deriving from the identification of a polymorphism associated with disease susceptibility. In particular the present invention provides materials and methods relating to diagnostic methods and treatments

(therapeutic and prophylactic) of diseases, typically autoimmune and infectious diseases such as tuberculosis, leprosy, HIV-1 and hepatitis B. In particular the diagnostic methods relate to predicting or determining an individuals susceptibility to a disease as above. Thus the invention provides methods for the differentiation of individuals who are more, or less, likely to be

susceptible to infection with tuberculosis, tuberculoid leprosy, lepromatous leprosy and HIV-1. The invention also provides methods for the differentiation of

individuals who are more, or less, likely to eradicate infection with HBV. The invention also concerns methods of predicting potentially successful treatment regimes for autoimmune and infectious diseases eg diseases as abo^ and to therapeutic and prophylactic materials and methods based thereon. More specifically, the present invention relates to materials and methods relating to the detection of certain genetic polymorphisms linked to susceptibility in relation to autoimmune and infectious diseases eg tuberculosis, leprosy, hepatitis B, HIV-1. Tuberculosis is caused by Mycobacterium tuberculosis infection. There is epidemiological evidence that host genetic factors play a major role in determining

susceptibility to tuberculosis. However, with the exception of an HLA-DR2 association observed in some studies, the genes involved have, until recently, been unknown.

Evidence indicates a role for genetic factors in

influencing the clinical outcome of Mycobacterium tuberculosis infection. Epidemiological studies have identified racial differences in susceptibility to mycobacterial diseases that cannot wholly be attributed to social and environmental effects^30-34. In vitro studies have suggested qualitative and quantitative differences between blacks and whites in HLA Class II antigen

expression and bacteriostatic effects of macrophages in response to M. tuberculosis infection^35,36. Moreover, different twin studies have demonstrated greater

concordance for tuberculous disease in monozygous

(identical) as compared to dizygous (fraternal) twins^37,38.

The genetic component that influences the host response and therefore the outcome of tubercle infection may result from the interaction of multiple genes in the human genome.

HBV infection is a major global public health problem. The infection is endemic in many resource-poor countries and it has been estimated that 80% of West African adults have been infected with HBV (Ryder R.W. et al., 1984

Lancet 2, pages 449-452). The majority of individuals develop immunity and clear the infection. These

individuals have 'antibodies to HBV core antigen, but no HBV surface antigen detectable in their body. Thus they are said to be HBVcAb positive and HBVsAg negative.

However around 15% of West Africans fail to clear the infection. They have HBV surface antigen ie they are

HBVsAg positive. HBVsAg positive people are predisposed to cirrhosis and hepatoma. HBV-associated hepatocellular carcinoma is a major cause of death in many African countries. HBV infection is also becoming an increasing problem in the industrially developed world, particularly among intravenous drug users and homosexual men.

The ability to clear HBV infection is partly related to host genetic factors. Associations have been described between HBV clearance and HLA types (Thursz, M.R. et al., 1995 N. Engl. J. Med., 332 pages 1065-1069 and Almarri, A., et al., 1994 Lancet, 2 pages 1194-1195). The inventors for the present application have now made the surprising discovery that clearance of HBV is associated with non- HLA genetic polymorphisms. In particular they have found that HBV is associated with a variant allele of the vitamin D receptor (VDR) gene . The results and

applications of their investigations are set out below. Leprosy is a disease caused by Mycobacterium leprae and may result in disfiguring lesions over the entire body. Leprosy provides a clinical polarity in which immune response to the pathogen is characterised by a spectrum moving from adequate cell-mediated immunity in the tuberculoid form of the disease to the more chronic lepromatous type in which there is an absence of cellular immune responses. Tuberculoid leprosy patients can mount a cell-mediated response limiting the spread of bacilli and have well-organised granulomas. Lepromatous leprosy patients on the other end of the spectrum, have bacilliladen macrophages with high antibody titres but weak cell-mediated immunity. Since M. leprae is an

intracellular pathogen and antibody related immunity is not of much value, macrophage activity is important in its immunopathology.

Human immunodeficiency virus (HIV) - associated infection and disease constitutes a major global health problem. The incidence and prevalence of HIV infection and AIDS continues to increase world-wide and measures to control this infectious disease are urgently needed.

Considerable evidence indicates that people vary in their susceptibility to HIV infection and in their rates of progression to AIDS. In studies of resistance to

infection, cohorts of prostitutes have been studied to identify individuals who do not seroconvert despite repeated exposure. Recently, evidence has been presented that the CD4+ lymphocytes of some such resistant

individuals are difficult to infect in vitro and a gene associated with this phenotype has recently been

identified: the chemokine receptor, CCR5.

Vitamin D is primarily concerned with the absorption and deposition of calcium and phosphate. The active

metabolite of vitamin D is a steroid-like hormone 1,25- dihydroxycholecalciferol (1,25(OH)₂D₃) which is well known as a regulator of bone and calcium homeostasis, via the VDR to which 1,25(OH)₂D₃ binds. 1,25(OH)₂D₃ has been found to exert important effects on the immune system including the enhancement of cell-mediated immunity (Hernandez- Frontera,E., et al., 1993 Infect. Immun., 61 pages 116-

121.), the stimulation of human monocytes (Rook, G.A.W., et al., 1987 Immunology 62 pages 229-234) and the

inhibition of lymphocyte proliferation (Manolagas, S . C . et al., 1989 Proc. Soc. Exp. Biol. Med. 191 pages 238-245.

It has recently been shown that variants of the VDR gene exert clinically significant effects on bone density

(Morrison N.A., et al., 1994 Nature 367 pages 284-287). Morrison et al. have identified several restriction fragment length polymorphisms (RFLPs) in the 3' region of the VDR gene (Morrison N.A., et al., 1992 PNAS, USA 89 pages 6665-6669). The enzymes BsmI, Apal and TaqI

identify RFLPs where the presence of the enzyme cutting site is designated b, a or t. The cleavage sites for BsmI and Apal are in intron 8 of the VDR gene. The cleavage site for Taql is in exon 9 of the VDR gene.

Homozygosity for the presence of a less common allele of the VDR gene having B, A and t, correlates with reduced bone mineral density and increased risk of osteoporotic fractures. The RFLP polymorphisms B, A and t are in close linkage disequilibrium, so it is only necessary to type one polymorphism to identify the two common

haplotypes BAt and baT. Thus, for example, an individual shown to possess the less common t allele will be likely also to possess the B and A alleles. In an extensive twin study Morrison N.A., et al. 1994 supra., determined that up to 75% of the genetic component of variation in bone mineral density was determined by the VDR gene.

These results have been confirmed by other studies (eg Fleet, U.J.C., et al., 1995 J. Bone Miner. Res., 10 pages 985-990). Preliminary in vi tro work has suggested that the BAt haplotype is associated with increased VDR mRNA

expression (Morrison N.A., et al., 1994 supra). It may therefore lead to increased binding of 1,25(OH)₂D₃ to the VDR in immunocompetent cells.

The interaction between vitamin D and the immune system is complex. The findings of in vitro studies may not be directly translatable into in vivo responses. Immunocompetent cells are capable of producing 1,25(OH)₂D₃ and therefore it could act as a paracrine hormone

regulating localised inflammation. In pulmonary TB the hormone can sometimes be produced in such large

quantities, that it causes systemic hypercalcaemia.

1,25(OH)₂D₃ appears to stimulate immune responses in some situations and inhibits them in others.

1,25(OH)₂D₃ has been shown to have beneficial effects in several animal models of autoimmune disease. 1,25(OH)₂D₃ prevents insulitis and the development of clinical

diabetes in non obese diabetic mice, a model for human type I diabetes^24,25. In MRL/I mice, which spontaneously develop a systemic lupus erythematosus-like syndrome, 1,25(OH)₂D₃ therapy completely prevents dermatological lesions and reduces proteinuria²⁶. Murine autoimmune encephalomyelitis, a disease produced by the T cell response to a specific antigenic challenge, can also be prevented by 1,2 (OH)₂D₃ ²⁷. Vitamin D and the VDR may therefore play an important role in susceptibility to multifactorial autoimmune diseases, in both animal models and humans.

In relation to tuberculosis, 1,25(OH)₂D₃ increases tumour necrosis factor (TNF) production by human monocytes

stimulated in vitro by lipopolysaccharide or virulent

Mycobacterium tuberculosis⁴ and enhances the ability of interferon gamma-activated monocytes to control proliferation of Mycobacterium tuberculosis³ . Guinea pigs fed vitamin D-deficient diets have impaired dermal tuberculin reactivity although it remains unclear as to whether there is an effect on susceptibility to primary TB infection⁷. In contrast, vitamin D has an inhibitory effect on in vitro lymphocyte proliferation,

immunoglobulin production and cytokine synthesis^8,9.

Whether these effects on lymphocytes occur in vivo is debatable as hypovitaminosis D causes increased risk of infection.

Epidemiological data has been presented suggesting that vitamin D deficiency contributes to the development of TB². Some untreated TB patients have been found to have low serum levels of 25(OH)D3¹⁰. Prior to the availability of specific chemotherapy against TB, patients with lupus vulgaris, a cutaneous form of the disease, were treated with vitamin D with apparently successful results¹². A recent study among the Asian community in Britain showed that lactovegetarians had an eight-fold increased risk of developing TB compared with those who ate meat or fish daily¹³. However this striking result could be attributed to several dietary factors including vitamin D

deficiency.

Although vitamin D has been known to be effective in the treatment of tuberculosis, it is not practical simply to give blanket treatment either to all sufferers or, more particularly, as a prophylactic to whole populations in areas where the disease is prevalent. Some method of targeting those individuals most likely to benefit would be desirable.

There is evidence from twin studies that genetic factors are important in susceptibility to TB^14,15 and the genetic component to susceptibility has been found to be greater for death from infectious diseases generally, than for ischaemic heart disease or cancer¹⁶. In addition, there is the racial variation in susceptibility to TB which is at least in part due to genetic factors¹⁷. Therefore, if vitamin D has an important role in TB susceptibility, it may exert its effects through a combination of genetic and environmental influences.

The effects of vitamin D on lymphocytes are regulated via the vitamin D receptor (VDR). Cells from a patient with vitamin D-resistant rickets, a condition where the abnormal VDR receptor cannot bind 1,25(OH)₂D₃, do not respond to stimulation by the hormone¹⁸. The VDR is present in human monocytes and in activated but not resting T and B lymphocytes¹. In relation to HIV, experimental data suggests that treatment of mononuclear cells with 1,25(OH)₂D₃ may affect HIV infection of, and replication in these cells, with most investigators finding evidence of increased infection and HIV replication.

The surprising results disclosed herein provide evidence that:

(1) homozygotes for the VDR genotype designated tt, are significantly protected against TB;

(2) VDR gene polymorphisms influence the outcome of HBV infection and in particular there is a trend of increasing ability to eradicate HBV infection across the VDR genotypes TT, Tt and tt;

(3) homozygosity for the VDR genotype designated tt

predisposes to tuberculoid leprosy and that

homozygosity for the other T allele predisposes to lepromatous leprosy.

(4) VDR gene polymorphisms are significantly associated with susceptibility to HIV-1 infection; particularly that homozygotes for the VDR genotype designated tt, are at significantly higher risk of HIV-1 infection than heterozygotes; there is a trend of increasing risk of HIV-1 infection across the VDR genotypes Tt, TT and tt.

The present invention provides the use of materials and methods both for establishing the presence or absence of particular variants of VDR gene polymorphisms

specifically associated with autoimmune disease or infectious disease, as a way of determining

susceptibility thereto and for planning therapeutic and/or prophylactic treatment. In various embodiments, the invention relates to such materials and methods for determining susceptibility to tuberculosis, HBV, HIV-1 and forms of leprosy and for planning prophylactic and therapeutic treatment therefor. The invention also provides compositions and methods for the prophylactic and therapeutic treatment of autoimmune disease or infectious disease eg tuberculosis, HBV, HIV-1 and forms of leprosy. Further, the invention provides a method for determining the susceptibility of an individual to an autoimmune disease or an infectious disease, eg tuberculosis, HBV, HIV-1 and forms of leprosy by establishing the presence or absence of VDR gene variants associated with increased expression of VDR.

The determination of an individual's VDR

genotype/haplotype ie the determination of whether or not an individual has the less common allele t of the TaqI VDR polymorphism and/or the determination of whether or not an individual has the more common allele T of the Taql VDR polymorphism and whether the alleles exist in one or two copies, may be carried out in accordance with a variety of methodologies known and available to those skilled in the art. Some methodologies are mentioned below in broad outline for guidance only. The provision of these methodologies should not be construed as

limiting the invention. The inventors have found a highly significant association between homozygotes (designated tt)for the less common allele t of the TaqI VDR polymorphism and protection against tuberculosis. Thus in accordance with the present invention there is a method of determining or diagnosing the susceptibility of an individual to

tuberculosis which comprises determining the presence or absence of homozygosity for a mutation in the VDR gene which gives rise to the less common allele t. Because of the linkage disequilibrium observed, detection of

homozygosity for the B or the A allele will be indicative of homozygosity for the t allele and vice versa.

The presence or absence of a mutation/gene variant may be detected by determining the hybridisation to a DNA sample derived from the individual, of one or more

oligonucleotides, or nucleic acid molecules comprising such oligonucleotides, specific for the mutation/variant. Thus eg hybridisation with an oligonucleotide probe specific for the less common allele t would indicate the individual as having the less common allele t. However the individual could be homozygous tt or heterozygous Tt. One can establish whether an individual is tt or Tt by use of an oligonucleotide probe specific for the more common allele T. Hybridisation by a probe for T would establish that the individual is heterozygous Tt. No hybridisation would establish that the individual is tt homozygous. A similar analysis could be made in order to determine the less common alleles B and A which are linked with t.

Use may be made of oligonucleotide probes specific for T, t, B, b, A and a as appropriate in the methods of

analysis.

The inventors have also found a highly significant association between homozygotes for the less common allele t of the TaqI VDR polymorphism and ability to clear an HBV infection. If an individual is homozygous for the variant allele t of the VDR gene ie the

individual has the genotype tt, they are more likely to eradicate an HBV infection than an individual homozygous for the normal allele of the VDR gene (i.e. the

individual has the genotype TT) or heterozygous for the variant allele of the VDR gene (i.e. the individual has the genotype Tt). Thus, the method provides a way of identifying individuals (i.e. individuals of the TT genotype and to a lesser extent, of the Tt genotype) who are at greater risk of suffering conditions associated with HBV infection such as cirrhosis and hepatoma and treating these individuals accordingly. Thus in relation to HBV, the discovery allows the

provision cf means (materials and methods) relating to the determination of whether or not an individual is likely to clear HBV infection, by establishing the presence or absence of markers associated with particular variants of VDR gene polymorphisms or by establishing the presence or absence of particular variants of the VDR gene themselves. Thus, the invention allows one to identify a group of individuals who are less likely to clear HBV infection and will therefore be predisposed to eg cirrhosis and hepatoma. The markers eg genetic markers described herein have application in the diagnosing of an individual's status with regard to HBV and for planning prophylactic and therapeutic treatment of HBV infection accordingly.

Compositions and methods for the prophylactic and

therapeutic treatment of HBV infection are also

disclosed.

The present invention provides a method for establishing whether or not an individual is likely to clear an HBV infection which method comprises identifying the

individual's VDR genotype/haplotype.

A method for establishing whether or not an individual is more or less likely to clear an HBV infection, may

comprise determining whether or not the individual has the less common allele of the TaqI VDR polymorphism designated t. Homozygotes for the variant allele (ie genotype tt) are more likely to clear an HBV infection than homozygotes for the normal allele (ie genotype TT). Heterozygotes (ie genotype Tt) are also more likely to clear an HBV infection than homozygotes for the normal allele (ie genotype TT). Individuals homozygous for a said variant allele may be identified by establishing the absence of the non-variant allele T for the VDR gene.

The determining of whether or not an individual is homozygous for a said variant allele t may be done by contacting under suitably stringent hybridisation

conditions a nucleic acid sample derived from the

individual with one or more oligonucleotides or nucleic acid molecules comprising such oligonucleotides, specific for the non-variant allele T for the VDR gene. Hereafter oligonucleotides or nucleic acid molecules comprising such oligonucleotides, specific for a non- variant allele T for a VDR gene are called "non-variant allele probe(s) or non-variant allele primers" according to the context.

The absence of binding of one or more non-variant allele probes to the nucleic acid sample would show that the individual is homozygous for a variant allele of a VDR gene. This is because any binding of one or more non- variant allele probes would indicate that the individual has said non-variant allele and is therefore homozygous for said non-variant allele or heterozygous. An

individual homozygous for a variant allele of a VDR gene is likely to be better able to clear an infection with HBV, than individuals homozygous for said non-variant allele and to a lesser extent, than individuals who are heterozygous.

Alternatively or in addition to the above, the

determining of whether or not an individual is homozygous for a said variant allele may be done by contacting under suitably stringent hybridisation conditions a nucleic acid sample derived from the individual with one or more oligonucleotides or nucleic acid molecules comprising such oligonucleotides, specific for the variant allele for the VDR gene. Hereafter oligonucleotides or nucleic acid molecules comprising such oligonucleotides, specific for a variant allele for a VDR gene are called "variant allele probe(s) or non-variant allele primers" according to the context. The absence of binding of one or more variant allele probes to the DNA sample would show that the individual is without said variant allele and therefore homozygous for the non-variant allele of a VDR gene (if the

individual had been either homozygous for the variant allele of a VDR gene or heterozygous, there would have been binding of said one or more variant allele probes). An individual homozygous for the non-variant allele of a VDR gene is likely to be less able to clear an HBV infection than individuals homozygous for the variant allele.

The presence of binding of one or more variant allele probes to the nucleic acid sample would show that the individual has said variant allele and is therefore either homozygous for the variant allele of a VDR gene or heterozygous. In which case, one may want to distinguish between homozygotes for the variant allele and

heterozygotes, as although a single t provides some protective effect in relation to HBV, tt homozygotes are likely to be the best able to clear an HBV infection.

This may be done by also contacting under suitably stringent hybridisation conditions a nucleic acid sample derived from the individual with one or more non-variant allele probes. The absence of binding of said one or more non-variant allele probes to the nucleic acid sample would show that the individual is without said non- variant allele and therefore homozygous for the variant allele of a VDR gene. In contrast the binding of one or more non-variant allele probes to the nucleic acid sample would show that the individual has a said non-variant allele and is therefore heterozygous. For ease of processing, the nucleic acid sample derived from the individual may be divided into two portions. One portion may be tested for hybridisation under suitably stringent conditions to one or more non-variant allele probes. The other portion may be tested for hybridisation under suitably stringent conditions to one or more variant allele probes. Or alternatively a single nucleic acid sample may in one step be contacted under suitably stringent hybridisation conditions with one or more non- variant allele probes and in another step contacted under suitably stringent hybridisation conditions with one or more variant allele probes, each of the two steps being followed by a washing step to remove any non-hybridised probes and a detection step to establish the

hybridisation of the probes to the nucleic acid sample. If the variant allele and non-variant allele probes are labelled differently to one another such that they can be differentiated from each other they may be simultaneously contacted under suitably stringent hybridisation

conditions with the nucleic acid sample.

The nucleic acid sample may be derived from a nucleic acid isolate from any tissue of the individual eg from blood or from cells taken from the buccal cavity by a mouthwash or swab procedure. A genomic or cDNA library may be produced from a nucleic acid isolate for

subsequent hybridisation. Hybridisation may be carried out as indicated elsewhere herein.

In relation to HIV-1, the discovery that VDR gene polymorphisms are significantly associated with

susceptibility to HIV-1 infection allows the provision of means (materials and methods) relating to the

determination of whether or not an individual is likely to be susceptible to HIV-1 infection, by establishing the presence or absence of markers associated with particular variants of VDR gene polymorphisms or by establishing the presence or absence of particular variants of the VDR gene themselves. Thus, the invention allows one to identify a group of individuals who are more, or less likely to be susceptible to HIV-1 infection. The markers eg genetic markers described herein have application in the diagnosing of an individual's status with regard to HIV and for planning prophylactic and therapeutic

treatment of HIV infection accordingly.

The inventors for the present application have found a highly significant association between homozygotes for the less common allele of the TaqI VDR polymorphism associated previously with high receptor mRNA levels

(designated tt), homozygotes for the more common allele of the TaqI VDR polymorphism (designated TT), and risk of HIV-1 infection. If an individual is homozygous for either the variant allele of the VDR gene ie the

individual has the genotype tt, or the more common allele of the VDR gene, ie the individual has the genotype TT, they have more risk of HIV-1 infection than a

heterozygous individual (i.e. the individual has the genotype Tt). Homozygotes for the less common allele (tt) are at highest risk of HIV-1 infection. Thus, the method provides a way of identifying individuals (i.e. individuals of the TT and tt genotypes) who are at greater risk of HIV-1 infection and progression of AIDS and treating these individuals accordingly.

Thus the method of the present invention for establishing whether or not an individual is more, or less,

susceptible to HIV-1 infection, comprises determining whether the individual has the genotype TT, tt or Tt. Thus one may determine whether or not the individual has the more common allele of the Taq1 VDR polymorphism designated T. The presence of T indicates either the genotype TT or Tt. These should then be distinguished between, as individuals with the TT genotype are at high risk of HIV-1 infection, whilst individuals with the Tt genotype are at low risk of HIV-1 infection. One may distinguish between TT and Tt by establishing either the absence or presence of the variant allele (t) for the VDR gene.

Samples of nuclear material such as DNA for the

diagnostic methods described herein, may be isolated from blood or tissue of the individual e.g. from cells taken from the Buccal cavity by a mouthwash or swab procedure. A genomic or cDNA library may be produced from the DNA isolate for subsequent hybridisation or, more practically, the relevant portion of the VDR gene (the 3' end) may be amplified directly from the DNA sample for probing by oligonucleotide hybridisation.

Hybridization may involve probing nucleic acid and identifying positive hybridization under suitably

stringent conditions (in accordance with known

techniques) and/or the use of oligonucleotides as primers in a method of nucleic acid amplification, such as PCR.

For probing, preferred conditions are those which are stringent enough for there to be a simple pattern with a small number of hybridizations identified as positive which can be investigated further. Desirably, the

stringency is sufficient to accurately differentiate individuals possessing a variant allele from those who do not. It is well known in the art to increase stringency of hybridization gradually until only a few positive clones remain.

As an alternative or prior to probing, though still employing nucleic acid hybridisation, oligonucleotides designed to amplify DNA sequences may be used in PCR reactions or other methods involving amplification of nucleic acid, using routine procedures. See for instance "PCR protocols; A Guide to Methods and Applications", Eds. Innis et al, 1990, Academic Press, New York. Amplification may be followed by probing as discussed herein. Alternatively amplification may be followed by use of a restriction endonuclease such as TaqI which recognises the less common allele t. If the allele t is present the amplification product will be cut and this can be confirmed by other separation techniques such as those based on size.

Alternatively the amplification primer may be specific for the single base change associated with the less common allele t such that the amplification reaction will only proceed if the t allele is present. The product may be detected in accordance with standard methods. The determination of an individual's VDR genotype may be carried out by use of a restriction endonuclease such as TaqI as discussed, in the absence of carrying out an amplification reaction. On the basis of nucleic acid or amino acid sequence information, variant allele probes/primers and non- variant allele probes/primers for use in

detection/amplification methods may be designed, taking into account the degeneracy of the genetic code, and, where appropriate, codon usage.

Preferably an oligonucleotide probe or primer in

accordance with this invention has about 10 or fewer codons ie is about 30 or fewer nucleotides in length.

Assessment of whether or not a PCR product corresponds to a certain allelic form of a gene may be conducted in various ways. A PCR band may contain a mix of products. Individual products may be cloned and screened or

screened directly. Assessment of whether a PCR band contains a gene variant may be carried out in a number of ways familiar to the skilled man. The PCR product may be treated in a way that enables one to display the

polymorphism on a denaturing polyacrylamide DNA

sequencing gel, with specific bands that are linked to the gene variants being selected. Probes/primers used in the methods of the present

invention or included in kits according to the present invention may be directed to DNA or mRNA complementary thereto. The probes maybe either cDNA probes, RNA probes or oligonucleotides. The probes may be suitably labelled in accordance with standard procedures to aid detection of hybridization. Commonly the labels maybe radio-, fluoro- or enzyme-labels.

Hybridization may be carried out in accordance with well known methodologies. The use of high stringency

conditions will serve to minimise non-specific binding and the occurrence of false positives.

Where the nucleic acid sample derived from the individual is to be amplified by use of PCR or other related

amplification methods using routine procedures the method will comprise adding to the sample suitable

oligonucleotide primers and other standard ingredients for carrying out a PCR, applying standard hybridisation, elongation and denaturation or strand separation

conditions to amplify any polynucleotide sequence

positioned between the two primers and looking for the presence or absence of an amplification product or products by adding at least one oligonucleotide probe specific for the mutation/gene variant of a VDR

polymorphism to determine the presence or absence of said variant. Said variant is preferably a mutation at codon 352 of the VDR gene. Alternatively, the step of looking for the presence or absence of an amplification product or products of interest may comprise digestion of the amplified DNA with one or more restriction enzymes selected from BsmI, Apal and TaqI and, optionally, the construction of a restriction map. Note that because of the linkage disequilibrium observed homozygosity for the t allele may be detected by determining homozygosity for the B or A alleles in which case the methods herein are applied to said alleles.

Oligonucleotide primer pairs used in the methods of the present invention may be designed from any parts of the VDR gene on either side of the polymorphism or which themselves span the polymorphism. The length of the primers should be such that they efficiently hybridize with good specificity. Typically the primers may be upwards of about 14 nucleotides. Generally, the primers may be 18-20 nucleotides.

It is not necessary to have 100% correspondence between the primers and their target region. The primers may comprise one or more non-complementary bases. All that is necessary is that the primer and target sufficiently correspond for specific hybridization to allow the desired amplification reaction to proceed.

In another aspect, the present invention provides

primers, variant allele probes and non-variant allele probes and their use in the methods as aforementioned for establishing whether or not an individual is more or less likely to clear an HBV infection, more or less

susceptible to tuberculosis or different forms

(tuberculoid and lepromatous) of leprosy and HIV-1.

In another aspect, the present invention provides a kit for carrying out methods as above. Preferably the kit comprises at least one primer, variant allele probe and/or non-variant allele probe for carrying out a method as aforementioned. The kit may also include other reagents necessary for carrying out a diagnostic test.

In another aspect, the present invention provides the use of a variant-specific oligonucleotide probe in the determination of eg whether an individual is more or less likely to clear an HBV infection whether an individual is more or less susceptible to tuberculosis, forms of leprosy or HIV-1 by determining the presence or absence of a mutation in the VDR gene indicative of a VDR gene variant associated with increased likelihood of being able to clear an HBV infection, increased susceptibility to tuberculosis, leprosy or HIV-1, or with increased VDR expression, such use being eg in determining the

hybridisation of said oligonucleotide to a DNA sample derived from an individual.

In relation to infectious and autoimmune diseases eg tuberculosis etc., prior to the present invention, practitioners would not have been able to identify patients most likely to benefit from vitamin D treatment or from the other presently proposed treatments. The present invention therefore permits the possibility of stream-lining treatment by targeting those most likely to benefit.

In the light of the present invention, practitioners will be able to target suitable treatment to those who will benefit most from it by conducting a test for the subject vitamin D receptor gene polymorphisms indicative of susceptibility. Prior to the present invention, no such test could have been applied because the skilled man would not have known the indicators to test for.

A further aspect of the present invention provides a method for the prophylactic or therapeutic treatment of infectious diseases or autoimmune diseases such as HBV, tuberculosis or leprosy, which comprises administration of vitamin D itself or the administration of a substance which causes the same in vivo effects as vitamin D. Thus one may administer a biologically active ligand for the vitamin D receptor, a vitamin D precursor, analogue or homologue, or an active metabolite of vitamin D. The present invention also provides for the use of such substances in the manufa-cture of a medicament for the prophylactic or therapeutic treatment of infectious diseases or autoimmune diseases such as HBV, tuberculosis or leprosy. The present invention also provides

pharmaceutical formulations combined with instructions for administration to an individual to treat an

infectious diseases or autoimmune diseases such as HBV, tuberculosis or leprosy or to protect against the

establishment of HBV, tuberculosis or leprosy which pharmaceutical comprises a substance as stated above which is able to substantially mimic one or more of the in vivo activities of vitamin D or 1,25(OH)₂D₃.

Alternatively one may use as treatment agents which interfere with the in vivo processing of vitamin D eg which enhance its metabolism to its active metabolite 1,25(OH)₂D₃ or which inhibit breakdown of 1,25(OH)₂D₃. Such inhibitors may for example include agents such as substrate analogues or antibodies able to bind

specifically to an enzyme involved in the breakdown of 1,25(OH)₂D₃ to reduce or block its activity.

The present invention also provides a composition comprising a vitamin D analogue or an agent able to modulate the metabolism of vitamin D or a signalling pathway activated by vitamin D, 1,25(OH)₂D₃ or VDR for prophylactic or therapeutic treatments of infectious diseases or autoimmune diseases such as HBV, leprosy or tuberculosis.

Further, the invention provides a method of making a medicament for treating infectious diseases or autoimmune diseases such as HBV, tuberculosis and leprosy, the method comprising use of a vitamin D analogue or an agent able to modulate the metabolism of vitamin D or a

signalling pathway activated by vitamin D, 1,25(OH)₂D₃ or VDR, by admixing the analogue or agent with

pharmaceutically acceptable components to produce a pharmaceutical composition suitable for administration. Such an analogue or agent may be administered as a combined preparation with another treatment for

simultaneous or sequential administration. In relation to the prophylactic/therapeutic treatment of HIV one may utilise inhibitors of vitamin D-regulated pathways or analogues of vitamin D or an active moiety of vitamin D₃ to potentially alter susceptibility to HIV infection.

Thus the present invention provides HIV treatment methods as suggested, compositions containing the above indicated treatment agents. Administration methods and routes and pharmaceutical formulations may be generally as

previously described herein.

Antibodies which are specific for a target of interest may be obtained using techniques which are standard in the art. Methods of producing antibodies include

immunising a mammal (eg mouse, rat, rabbit, horse, goat, sheep or monkey) with the protein or a fragment thereof, or a cell or virus which expresses the protein or

fragment. Immunisation with DNA encoding a target polypeptide is also possible. Antibodies may be obtained from immunised animals using any of a variety of

techniques known in the art, and screened, preferably using binding of antibody to antigen of interest. For instance, Western blotting techniques or

immunoprecipitation may be used (Armitage et al, 1992, Nature 357: 80-82).

As an alternative or supplement to immunising a mammal with a peptide, an antibody specific for a protein may be obtained from a recombinantly produced library of

expressed immunoglobulin variable domains, eg using lambda bacteriophage or filamentous bacteriophage which display functional immunoglobulin binding domains on their surfaces; for instance see WO92/01047. The library may be naive, that it is constructed from sequence obtained from an organism which has not been immunised with the target, or may be constructed using sequences obtained from an organism which has been exposed to the antigen of interest (or a fragment thereof) eg an enzyme in the 1,25(OH)₂D₃ metabolic pathway.

If antibodies are to be used in treatment, it may be desirable to "humanise" non-human (eg murine) antibodies to provide antibodies having the antigen binding

properties of the non-human antibody, while minimising the immunogenic response of the antibodies, eg when they are used in human therapy. Humanised antibodies may comprise framework regions derived from human

immunoglobulins (acceptor antibody) in which residues from one or more complementarity determining regions (CDR's) are replaced by residues from CDR's of a non- human species (donor antibody) such as mouse, rat or rabbit antibody having the desired properties, eg

specificity, affinity or capacity.

It is possible to take monoclonal antibodies and use the techniques of recombinant DNA technology to produce other antibodies or chimeric molecules which retain the

specificity of the original antibody. Non-antibody specific binding molecules specific for the desired target can be produced by such methods, which may then find use in medicaments according to the present

invention.

As antibodies can be modified in a number of ways, the term "antibody" should be construed as covering any specific binding substance having a binding domain with the required specificity. Thus, this term covers

antibody fragments, derivatives, functional equivalents and homologues of antibodies, including any polypeptide comprising an immunoglobulin binding domain, whether natural or synthetic. Chimaeric molecules comprising an immunoglobulin binding domain, or equivalent, fused to another polypeptide are therefore included. Cloning and expression of chimaeric antibodies are described in EP-A- 0120694 and EP-A-0125023.

In accordance with the present invention, compositions provided may be administered to individuals.

Administration is preferably in a "therapeutically

effective amount", this being sufficient to show benefit to a patient. Such benefit may be at least amelioration of at least one symptom. The actual amount administered, and rate and time-course of administration, will depend on the nature and severity of the HBV infection.

Prescription of treatment, eg decisions on dosage etc, is within the responsibility of general practitioners and other medical doctors.

A composition may be administered alone or in combination with other treatments, either simultaneously or

sequentially dependent upon the condition to be treated. Pharmaceutical compositions according to the present invention, and for use in accordance with the present invention, may comprise, in addition to active

ingredient, a pharmaceutically acceptable excipient, carrier, buffer, stabiliser or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material will depend on the route of

administration, which may be oral, or by injection, e.g. cutaneous, subcutaneous or intravenous.

Pharmaceutical compositions for oral administration may be in tablet, capsule, powder or liquid form. A tablet may comprise a solid carrier such as gelatin or an

adjuvant. Liquid pharmaceutical compositions generally comprise a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oil. Physiological saline solution, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included.

For intravenous, cutaneous or subcutaneous injection, the active ingredient will be in the form of a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability. Those of

relevant skill in the art are well able to prepare suitable solutions using, for example, isotonic vehicles such as Sodium Chloride Injection, Ringer's Injection,

Lactated Ringer's Injection. Preservatives, stabilisers, buffers, antioxidants and/or other additives may be included, as required. Further, the invention provides a method of making a medicament for treating infectious diseases or autoimmune diseases such as HBV, tuberculosis and leprosy the method comprising mixing one or more of vitamin D, a vitamin D precursor or homologue, or an active metabolite of vitamin D with pharmaceutically acceptable components to produce a pharmaceutical composition suitable for

administration.

In relation to HIV, the invention provides a method for making a medicament for treating an infectious disease or autoimmune disease with a susceptibility pattern in relation to VDR genotype similar to that seen for HIV-1 which comprises mixing the agents stated above for the prophylactic/therapeutic treatment of HIV, with

pharmaceutically acceptable components to produce a pharmaceutical composition suitable for administration. A fragment comprising the VDR variation responsible for the variant allele may be amplified by PCR. Suitably a 340bp fragment is amplified using the primers

CAGAGCATGGACAGGGAGCAAG and

GGTGGCGGCAGCGGATGTACGT.

The specific oligonucleotide probe for detecting the allele T may comprise the sequence GCG CTG ATT GAG GCC ATC. The specific oligonucleotide probe for detecting the allele t may comprise the sequence GCG CTG TCG AGG CCA TC. Specific oligonucleotide probes may be rendered detectable by labelling with digoxigenin. In which case the probes may be detected by using an anti-digoxigenin antibody chemiluminescence system. The results disclosed herein also provide evidence that the VDR genotype is predictive of likely leprotic status. This discovery allows the provision of means (materials and ..methods) relating to the determination of an

individuals likely leprotic status on infection with Mycobacterium leprae, by establishing the presence or absence or markers associated with particular variants of VDR gene polymorphisms or by establishing the presence or absence of particular variants of the VDR gene themselves. Thus one can identify individuals more likely to have lepromatous leprosy and individuals more likely to have tuberculoid leprosy. Thus the markers described herein have application in the diagnosing of an individual's status with regard to infection by

Mycobacterium leprae and for planning prophylactic, therapeutic and nursing treatment of infection

accordingly. Basically the materials and methods as disclosed and referred to above particularly in relation to

tuberculosis and HBV can be also applied in relation to the prediction of an individual's likely leprotic status. Embodiments of the present invention are described in further detail below, by way of example only.

EXPERIMENTAL

Described below is the experimental work leading to the making of the present invention.

HBV INFECTION

Materials and Methods

Study Design

Two different groups of people were identified for this study. The first group consisted of children under 10 years with a variety of illnesses. They were recruited from the Medical Research Council and Royal Victoria Hospitals in the Gambia. The second group comprised adult healthy male blood donors. Subjects were typed

serologically for IgM HBVcAb and HBVsAg using an enzyme- linked immnuosorbent assay (Boehringer-Mannheim).

Methods

Blood samples (10ml venous blood collected into

potassium/EDTA tubes) were taken from the patients and blood donors recruited into the study. Except for the primer and probe details the methods employed are routine and well-known to those skilled in the art. 50 - 100 ng of genomic DNA isolated from the blood samples (using Nucleon kits from Scotlab) was amplified by PCR. The amplified product was denatured with sodium hydroxide and transferred onto positively charged nylon filters. The DNA was fixed onto the filters using UV light before the filters were used in specific

oligonucleotide hybridisation reactions using a

digoxigenin-based (Boehringer Mannheim) detection

protocol. The primers, amplification conditions and detection oligonucleotides used are as given below.

PCR

A 340bp fragment of the VDR gene containing the TaqI RFLP was amplified using the following primers: 5' - CAG AGC ATG GAC AGG GAG CAA G - 3'

5' - GGT GGC GGC AGC GGA TGT ACG T - 3'

(Sequences obtained from Spector, T.D., et al, 1995 BMJ 310 pages 1357 to 1360; and Baker, A.R., et al. 1988 PNAS USA 85 pages 3294-3298)

The PCR program was: 95 C for 10.0 minutes, then 35 cycles of 95 C x 1.0 min, 60 C x 1.5 min, 72 C x 2.0 min, finally 72 C x 10.0 min.

The Taq1 (t) RFLP occurs at codon 352 due to a silent T to C base change.

Detection of PCR Product with Oligonucleotide Probes

The following digoxigenin-labelled sequence specific oligonucleotides were used to detect the amplification product. The probe 5'- GCG CTG ATT GAG GCC ATC - 3' detects the allele T and the probe 5'- GCG CTG TCG AGG CCA TC - 3' detects the allele t.

Signal was detected using an anti-digoxigenin antibody chemiluminescence system (Boehringer-Mannheim).

Statistical analyses were carried out using SPSS

Results The results are shown in Table 1.

"Cleared" are individuals who are HBVcAb+ and HBVsAg- "Carriers" are individuals who are HBVsAg+.

As can be seen from the above table 1 among the children who had been infected with HBV (ie those who were HBVcAb positive) there was a trend of increasing ability to eradicate the infection (ie to become HBVsAg negative) across the VDR genotypes TT, Tt and tt. This trend was also observed among the adults infected by HBV. VDR genotype was not associated with whether or not a subject had experienced a previous HBV infection which is

believed to be related to environmental exposure alone

(data not shown). Overall the odds ratio for persistence of HBV between the two homozygous genotypes TT and tt was 2.49 (95% Cl 1.25-5.04, p=0.005).

Determining Whether or Not an Individual is Likely to Clear an HBV Infection

DNA isolated from e.g. blood samples or cell samples taken by a simple mouthwash procedure is amplified as described above using the VDR PCR primers. The amplified DNA is then probed with the VDR polymorphism

oligonucleotide probes. Individuals proving not to be homozygous for the less common allele of the codon 352 polymorphism (TT or Tt individuals) can be considered to be at increased risk of HBV infection, and the health care professionals involved can consider whether to begin prophylactic treatment.

TUBERCULOID LEPROSY

Materials and Methods

Study Design

Both cases and controls were collected for Calcutta, India. Only those leprosy patients affected by the two polar types, presenting at the School of Tropical

Medicine, were selected for this study. Diagnosis of leprosy was carried out by clinical leprologists looking for four cardinal signs of the disease; structure and distribution of skin lesions, anaesthetic spots,

condition of peripheral nerves and acid-fast bacilli in slit-skin smear examination. Lepromatous leprosy

required the presence of diffused and numerous skin lesions with numerous globi of acid-fast bacilli in the slit-skin smears taken from at least three parts of the body including one from a lesion site. Tuberculoid lesions were more well defined and had a dry surface. A symmetrical distribution of lesions and no detectable acid-fast bacilli in the skin smears were other

characteristic features of tuberculoid patients.

Borderline leprosy patients were not bled for this study. The control samples were collected from professional blood donors visiting the Swasti Blood Clinic.

A total of 397 samples have been analysed for the TaqI restriction fragment length polymorphism (RFLP) in the coding region of the VDR gene, of which 124 were

lepromatous, 107 were tuberculoid and 166 were controls. Both patient and control groups consisted of Hindus,

Muslims and Christians. The Hindu group was subdivided into four castes: Brahmins, Vaidyas, Kaisthas and

Shudras. Patients and controls were well matched for ethnic group.

Methods

Blood samples (5 to 10ml venous blood collected into potassium/EDTA tubes) were taken from the individuals involved in the study. 50-100ng of genomic DNA isolated from the blood samples using a simple salting out method (Miller, S., et al., 1988 Nucl. Acids Res. 16 page 1215) was amplified by PCR.

The PCR amplification and oligonucleotide hybridisations were carried out as described above in relation to HBV.

Statistical analyses were carried out using SPSS/PC+ and Epilnfo Ver.5.

Results

In total, 397 DNA samples were typed for the TaqI vitamin D receptor polymorphism, of which 166 were controls, 107 tuberculoid and 124 lepromatous patients (Table 2).

A chi square analysis between groups showed the

tuberculoid group with significantly more number of 'tt' homozygotes compared to both controls (P=.004; 0R=1.41, 95% CI 0.97-2.04) and lepromatous patients (P=.016;

OR=1.77, 95% CI 1.18-2.66). Ethnic heterogeneity was taken into account by carrying out a logistic regression analysis with caste as an independent variable. Vitamin D receptor remained an independent predictor of leprotic status (P=.002) even after including caste in the

regression model. Also, chi square analysis for VDR alleles in each caste group showed the same trend of 'tt' homozygotes being the highest in the tuberculoid

patients. Homozygote 'TT' was found to be higher in the lepromatous group (52.4%) compared to tuberculoid

patients (37.4%) and controls (39.8%). Controls had the maximum number of heterozygotes in comparison to

tuberculoid and lepromatous patients (52.4%, 41.4% and 37.1%, respectively). These results indicate that homozygosity for the variant allele defined by the TaqI polymorphism (the 't' allele), predisposes to tuberculoid leprosy and that homozygosity for the other 'T' allele predisposes to lepromatous leprosy. On one end of the leprosy spectrum, the

tuberculoid patients had high numbers of tt homozygotes while on the other end, the lepromatous patients had the highest frequency of TT homozygotes compared to the other two groups.

Determining An Individual's Likely Leprotic Status

DNA isolated from eg blood samples or cell samples taken by a simple mouthwash procedure is amplified as described above using the VDR PCR primers. The amplified DNA is then probed with the VDR polymorphism oligonucleotide probes. Individuals proving to be homozygous for the less common allele of the codon 352 polymorphism (tt individuals) can be considered to be more prone to tuberculoid leprosy. In contrast individuals proving to be homozygous for the common allele of the codon 352 polymorphism (TT individuals) can be considered to be more prone to lepromatous leprosy.

Determination of possible treatment regimes

DNA isolated from e.g. blood samples or mouthwash cell samples taken from HBV patients is amplified and probed as described above. Individuals proving to be homozygous for either allele of the codon 352 polymorphism may then be candidates for treatment with an analogue of vitamin D, an agent able to modulate the metabolism of vitamin D or an agent able to modulate a signalling pathway

activated by 1,25(OH)₂D₃ or VDR. Treatment with such agents should aid the mounting of an immune response limiting the spread of bacilli. Such agents include enzymes which interfere in the

processing of vitamin D, eg which enhance its metabolism to 1,25(OH)₂D₃ or inhibit breakdown of 1,25(OH)₂D₃. Such inhibitors may for example include agents such as substrate analogues or antibodies able to bind

specifically to an enzyme involved in the breakdown of 1,25(OH)₂D₃ to reduce or block its activity. Suitable agents may be combined. Preferably these agents will be administered in the form of a pharmaceutical composition in combination with a pharmaceutically acceptable carrier or diluent. Similar treatment may also be given in prophylaxis. TUBERCULOSIS

Materials and Methods

Study Design TB cases were identified from specific TB and leprosy clinics in The Gambia. All cases were adults with pulmonary tuberculosis who had acid fast bacilli on sputum microscopy. Blood samples were not collected from patients known to be infected by the human

immunodeficiency virus (HIV) and all patients who gave their consent were screened for HIV antibodies. Controls were random blood donors who attended the Gambian blood transfusion service and were from the same geographical area and racial groups as the TB cases.

Methods

As set out above for HBV infection. Results

213 TB cases and 258 controls from The Gambia were typed for the codon 352 polymorphism and the results are shown in table 3.

Figures in brackets indicate percentages. The chi square value shown apply to the population analysis, performed using a 2x3 table, calculated with 2 degrees of freedom, using SPSS. Comparing tt with TT/Tt combined using a 2x2 analysis gives a chi square value with 1 degree of

freedom of 10.60, p=0.0011.

Significantly fewer TB cases were found to be homozygous for the genotype tt, known to be associated with lower bone mineral density (BMD), compared to controls (chi square=10.6, p=0.001). Six cases were later identified as being HIV positive but excluding them from the

analysis made no substantial difference to the results. Relative risk of TB among tt homozygotes compared to the other genotypes TT and Tt was 0.311 (95% confidence interval = 0.145-0.667). There was a weak correlation between ethnic group and TB (p=0.046) but no correlation between ethnic group and frequency of the codon 352 alleles (data not shown). Logistic regression analysis using TB as the dependent variable and including ethnic group and mannose binding protein and TNF polymorphisms (which we have found to be associated with TB) as independent variables found that VDR genotype was a significant independent predictor of TB status.

Discussion

The above results indicate that, among Africans from The Gambia, homozygotes for the VDR genotype associated with low BMD, designated tt, are significantly protected against TB.

Determining Susceptibility to Tuberculosis

DNA isolated from e.g. blood samples or cell samples taken by a simple mouthwash procedure is amplified as described above using the VDR PCR primers. The amplified DNA is then probed with the VDR polymorphism

oligonucleotide probes. Individuals proving not to be homozygous for the less common allele of the codon 352 polymorphism (TT or Tt individuals) can be considered to be at increased risk of developing tuberculosis, and the health care professionals involved can consider whether to begin prophylactic treatment. Determination of Possible Treatment Regimes

DNA isolated from e.g. blood samples or mouthwash cell samples taken from tuberculosis patients is amplified and probed as described above. Individuals proving not to be homozygous for the less common allele of the codon 352 polymorphism may then be candidates for treatment with an analogue of vitamin D, an agent able to modulate the metabolism of vitamin D or an agent able to modulate a signalling pathway activated by 1,25(OH)₂D₃ or VDR.

Modulating agents are as stated above in relation to treatment regimes for leprosy. HIV-1

Materials and Methods

Study Design

HIV-1 seropositive individuals were recruited as part of annual serosurveys of 15 neighbouring villages at the Kyamulibwa and Masaka districts of southwestern Uganda (population 9,000 individuals). HIV-1 prevalence in this area is 8.2% amongst adults over 13 years, HIV- 2 is absent and the epidemiological characteristics of HIV transmission in this setting have been reported. The subjects were predominantly Ugandan Baganda (75%) with small numbers of other ethnic groups. Initially each case was individually matched to two controls for age, sex and ethnic group; 258 HIV infected adults were

recruited and compared to 647 HIV uninfected and matched individuals. However not all of these matched controls were recruitable and further controls were recruited to a ration of 2.5 cases to each control. The primary

analysis is thus a comparison of the genotype frequencies between HIV seropositive and control groups with the possibility of a matched subgroup analysis of 258 HIV positive individuals and 464 matched controls.

121 of the 257 HIV seropositive individuals were female reflecting the almost even sex distribution of HIV infection in this population. The study design aimed to compare the frequencies of the candidate gene in

individuals considered susceptible to infection as defined by HIV seropositivity, with the general

population of villagers. Thus, HIV-negative individuals were not required to have been exposed to HIV infection and were not recruited as an HIV-resistant group.

Although there is previous evidence that MHC genes and the CCR-5 gene may affect risk of HIV-1 infection, the inventor's aim was to identify other non-MHC genes affecting susceptibility to HIV in rural Ugandans.

Methods

Blood samples (10ml venous blood collected into

potassium/EDTA tubes) were taken from the patients and blood donors recruited into the study. Except for the primer and probe details the methods employed are routine and well-known to those skilled in the art.

DNA analysis was performed in Oxford, UK by investigators blind to the HIV status of the subjects. The analysis was carried out as described above in the 'methods' section for HBV.

Statistical analysis was performed in Entebbe in a stepwise manner, initially comparing the overall genotype frequencies using a 3x2x² test and then, if a significant overall difference between cases and controls was

detected (P <0.05), individual's genotypes were compared using 2 x 2 x² analysis. Possible confounding effects of age, sex and ethnic group were investigated using Mantel- Haenszel stratification and conditional logistic

regression analysis. A subsequent subgroup analysis assesses the VDR genotype associations separately in males and females. Results

Table 4. VDR genotype and HIV-1 serostatus amongst 905 rural Ugandans VDR genotypes are significantly different between HIV positive individuals and controls (x² =11.69, P =0.003). Those with the tt genotype were more frequent in the HIV cases (odds ratio 1.69 [95% confidence intervals 1.10-2.58], P =0.01) whereas Tt

heterozygotes were less frequent (odds ratio = 0.63 [0.45-0 87], p =0.004). Comparison of Tt heterozygotes to those of the TT genotype showed an odds ratio for HIV infection of 0.68 [0.48-0.96], indicating a reduction in risk of 32% (1 - odds ratio x 100) for heterozygotes compared to the commonest TT genotype. Allowance for any potential confounding influence of age, sex and ethnic group, on 257 cases and a subgroup of 464 matched controls, either by Mantel- Haenszel stratification or by conditional logistic regression made negligible difference to the measured crude odds ratios.

Table 5. Subgroup analysis by sex of VDR genotype and HIV infection. Amongst females VDR genotype distribution was significantly different between HIV-l infected individuals and controls [x² =12.09,

P =0.002). Females with the tt genotype were more frequent in the HIV cases (odds ratio 2.08 [95% confidence intervals 1.18-3.65], P =0.006) whereas Tt heterozygotes were less frequent (odds ratio = 0.48 [0.30-0.77], p =0.001). However, amongst males VDR genotype distribution was not different between HIV-l infected individualx and controls (x² =1.94, P =0.38).

The less common t allele was found a frequency of 0.30 amongst the non-infected control group in this Ugandan population. The primary analysis compared the overall distribution of genotypes between the cases and controls using a 3x2 chi-squared analysis. This showed that VDR genotype was a significant determinant of HIV status

(chi-squared = 11.69, P =0.003)), an association that was not explained by potential confounders assessed by

logistic regression analysis (see Table 4 legend).

Homozygotes for the t allele were at increased risk of infection (odds ratio 1.69 [95% confidence intervals 1.10-2.58], P =0.01) whereas Tt heterozygotes were at reduced risk (odds ratio =0.63 [0.45-0.87], P =0.004). Subsequent subgroup analysis showed that the influence of VDR genotype was more marked in females than males (Table 5) and that the associations, though highly significant in females, were not statistically significant in males.

250 Ugandans were analysed for the presence of the 32bp deletion common in Europeans using PCR amplification and oligonucleotide hybridisation. No Ugandan was found to have this deletion providing evidence that this allele is rare or absent in sub-Saharan Africa. Sequence analysis of nucleotides from the N-terminus to the sixth

transmembrane domain of CCR5 in 10 Ugandans revealed no new sequence variants (not shown) indicating that a common novel resistance allele is unlikely to be present in this population.

These Ugandan data provide evidence that sequence

variation at the 3' end of the VDR gene is of functional relevance and may exert an important immunomodulatory effect on the course of infectious diseases. These human genetic data together with previous in vitro studies of the influence if 1,25 D3 on HIV infection and replication suggest possible mechanisms for this association. The greater resistance of Tt heterozygotes than TT or tt homozygotes suggests the involvement of two different mechanisms, one enhancing relative susceptibility of tt homozygotes, the other of TT homozygotes. Evidence that the t allele is associated with increased VDR expression suggests that an increased receptor expression in antigen presenting cells found in the genital tract might

increase the likelihood of a successful HIV infection of cells of the tt genotype, just as increased 1,25 D3 levels appear to increase monocyte infectability and HIV replication in vi tro . Conversely, if enhanced expression of RANTES is induced by 1,25 D3 in vi tro, individuals with the TT genotype might produce less of this chemokine that impairs infection with macrophage-tropic HIV strains and thereby be more susceptible than heterozygotes.

The VDR association is stronger in females than males and could be confined to females. Females are at higher risk of heterosexuals transmission per act than males and are probably exposed to a higher dose of virus. If the VDR association relates to genetically-determined differences in infectabilities of mononuclear cells in the genital tract, anatomic and histological differences in the respective mucosal routes of infection may contribute to this apparent sex difference.

Follow-up surveillance of this cohort is taking place to determine whether there is an influence of VDR genotype on the rate of disease progression in HIV infection. The increased replication of HIV in 1,25 D3-treated

mononuclear cells suggests that the tt genotype, found here to be associated with increased risk of HIV

infection, could also be associated with rapid disease progression. It will also be important to determine whether a VDR association with infection is found for other common modes of HIV transmission, and whether there is inter-population heterogeneity in this association, as described for the VDR association with osteoporosis. The complex regulation of 1,25 D3 levels and the known influences if environmental factors such as calcium intake and sunlight exposure raise the possibility of important gene-environment interactions for this HIV association. Moreover, if the protection of

heterozygotes involves two different mechanisms each enhancing susceptibility of homozygotes, different genotypic associations may be seen in different

environments.

Several types of evidence have suggested that individuals may differ in their susceptibility to HIV infection and disease. Most studies of candidate genes have focused in the major histocompatibility complex and have studied populations in developed countries where heterosexual transmission is uncommon. There is little evidence of HLA effects on HIV infection, but in populations of

European origin homozygotes, but probably not

heterozygotes, for a prevalent CCR-5 variant are

protected from HIV infection. The protective effect if heterozygosity at the vitamin D receptor in Uganda in much less marked, 32% (see Table 4 legend), but because this genotype is so much more frequent (0.37) than CCR-5 homozygosity is in Europeans (0.01) an estimate of the number of infections prevented by the presence of this VDR genotype in the population (0.37 x 0.32 = 0.12), the preventive fraction, is much greater than for the CCR-5 genotype in Europe (0.01).

Determinincr An Individual's Susceptibility to Infection with HIV-1

DNA isolated from eg blood samples or cell samples taken by a simple mouthwash procedure is amplified as described above using the VDR PCR primers. The amplified DNA is then probed with the VDR polymorphism oligonucleotide probes. Individuals proving to be homozygous for the less common allele of the codon 352 polymorphism (tt) and the more common allele of the codon 352 polymorphism (TT) can be considered to be more prone to infection with HIV- 1. In contrast individuals proving to be heterozygous

(Tt) can be considered to be less prone to infection with HIV-1. References

1) Prowedini DM, Tsoukas CD, Deftos LJ & Manolagas SC. Science 1983;221:1181-3.

2) Davies PDO. ruJbercZ e 1985;66:301-6.

3) Rook GAW, Steele J, Froher L et al. Immunology

1986;57:159-163.

4) Rook GAW, Taverne J, Leveton C & Steele J.

J . Immunology 1987;62:229-34.

5) Morrison NA, Qi JC, Tokita A et al. Nature 1994;367:284-7.

6) Spector TD, Keen RW, Arden ΝK et al. BMJ

1995;310:1357-60.

7) Hernandez-Frontera E & McMurray DΝ. Infect Immun 1993;61:2116-21.

8) Manolagas SC , Hustmeyer FG & Yu X. Proc Soc Exp

Biol Med 1989;191:238-45.

9) Lemire JM, Adams JS, Sakai R & Jordan SC. J Clin Inves t 1984;74:657-61.

10) Davies PDO, Brown RC & Woodhead JS. Thorax 1985;40:187-90.

11) Grange JM, Davies PO, Brown RC, Woodhead JS & Kardjito T. Tubercle 1985;66:187-91.

12) Dowling GB & Prosser-Thomas EW. Lancet

1946;i:919-22. 13) Strachan DP, Powell KJ, Thaker A, Millard FJC & Maxwell JP. Thorax 1995;50:175-80.

14) Comstock GW. Amer Rev Resp Dis 1978;117:621-4.

15) Kallmann FJ & Reisner D. Amer Rev Tuberc

1942;47:549-74. 16) Sorensen TIA, Nielsen GG, Andersen PK & Teasdale TW. N Engl J Med 1988;318:727-32.

17) Stead WW, Senner JW, Reddick WT & Lofgren JP. N Engl J Med 1990;322:422-7.

18) Reichel H, Koeffler HP, Tobler A & Norman AW.

Proc Na tl Acad Sci USA 1987;84:3385-9.

19) Morrison NA, Yeoman R, Kelly PJ & Eisman JA.

Proc Na tl Acad Sci USA 1992;89:6665-9.

20) Fleet JC, Harris SS, Wood RJ & Dawson-Hughes B. J Bone Miner Res 1995;10:985-90.

21) Ferrari S, Rizzoli R, Chevalley T, Slosman D, Eisman JA & Bonjour JP. Lance t 1995;345:423-4.

22) Baker AR, McDonnell DP & Hughes M. Proc Natl Acad Sci USA 1988;85:3294-8.

24) Cadranel J, Hance AJ, Milleron B, Paillard F,

Akoun GM & Garabedian M. Amer Rev Resp Dis 1988; 138:984-

9.

25) Mathieu C, Laureys J, Sokis H, Vandeputt M, Waer

M & Bouillon R. Diabetes 1992;41:1491-5.

26) Mathieu C, Waer M, Laureys J, Rutaerts O &

Bouillon R. Diabetologia 1994;37:552-8.

27) Lemire JM, Ince A & Takashima M. Autoimmuni ty 1992:12:143-8.

28) Lemire JM & Archer DC. J Clin Invest

1991;87:1103-7. 29) Stavros et al. Proc . Soc . Exp . Biol . Med .

1989;191:238-245.

30) A. G. Motulsky Human Genetics. Raven Press, Inc., New York (1979).

31) R. M. Goodman & A.G. Motulsky Genetic Diseases among Ashkenazi Jews, p301 Raven Press, Inc., New York.

32) E. Skamene Curr. Top . Microbiol . Immunol . 124: 49-66 (1986).

33) W. Stead et al New Eng. J of Med. 332, No.7: 422-427 (1990).

34) W. Stead Ann. of Intern Med. 116, No. 11: 937- 941 (1992).

35) A. J. Crowle & N. Elkins Infect . Immun . 58, No. 3 632-688 (1990).

36) M. McPeek et al . Clin . Exp. Immunol . 87: 163-

168 (1992).

37) G. W. Comstock Am Rev. Respir. Disease 117 :

621-624 (1978).

38) F. J. Kallmann & D. Reisner Am . Rev. Tuberc. 47: 549-574 (1942).

39) C. M. Steel et al . Lancet i: 1185-1188 (1988).

Claims

1. A method for the determination of an individual's susceptibility level to autoimmune disease or infectious disease which comprises

obtaining a sample of tissue from the individual;

obtaining from the tissue sample a test sample comprising nuclear material from cells of the tissue sample;

establishing the individuals vitamin D receptor (VDR) genotype, namely establishing whether or not the individual is:

homozygous or heterozygous for a less common allele of the gene for the vitamin D receptor (VDR) and wherein said less common allele of the VDR gene comprises the polymorphisms B and A in intron 8 of the VDR gene and the polymorphism t in exon 9 of the VDR gene; or

homozygous for a more common allele of the VDR gene and wherein said more common allele of the VDR gene comprises the polymorphisms b and a in intron 8 of the VDR gene and the polymorphism T in exon 9 of the VDR gene

and wherein the genotype in relation to the VDR is specifically associated with susceptibility level to one or more autoimmune or infectious diseases.

2. A method for the determination of an individual's susceptibility level to autoimmune disease or infectious disease which comprises following obtaining a sample of tissue from the individual and obtaining from the tissue sample a test sample comprising nuclear material from cells of the tissue sample, the step of establishing whether or not the individual is: homozygous or

heterozygous for a less common allele of the gene for the vitamin D receptor (VDR) and wherein said less common allele of the VDR gene comprises the polymorphisms B and A in intron 8 of the VDR gene and the polymorphism t in exon 9 of the VDR gene; or homozygous for a more common allele of the VDR gene and wherein said more common allele of the VDR gene comprises the polymorphisms b and a in intron 8 of the VDR gene and the polymorphism T in exon 9 of the VDR gene and wherein the genotype in relation to the VDR is specifically associated with susceptibility level to one or more autoimmune or

infectious diseases.

3. A method according to claim 1 or claim 2 wherein:

polymorphism t comprises a cleavage site for the Taql restriction enzyme, said cleavage site being the TaqI polymorphism' the TaqI polymorphism existing in an alternative polymorphic form 'T' which is without a cleavage site for TaqI;

the polymorphism B exists in an alternative polymorphic form 'b' , b having a cleavage site for the enzyme BsmI and B not having a cleavage site for BsmI; the polymorphism A exists in an alternative polymorphic form 'a', a having a cleavage site for the enzyme Apal and A not having a cleavage site for Apal.

4. A method according to any one of claims 1 to 3 wherein establishing the individual's genotype in

relation to the VDR gene comprises contacting a VDR gene nucleic acid sequence having a 3' region of the VDR gene with one or more the restriction enzymes of BsmI and Apal and TaqI.

5. A method according to claim 4 wherein the VDR gene nucleic acid sequence comprises part or all of intron 8 and/or part or all of exon 9.

6. A method according to claim 5 wherein the VDR gene nucleic acid sequence comprises a part of intron 8 which in one polymorphic form comprises a cleavage site for BsmI and/or Apal.

7. A method according to claim 5 wherein the VDR gene nucleic acid sequence comprises a part of exon 9 which in one polymorphic form comprises a cleavage site for TaqI.

8. A method according to any one of claims 1 to 7 wherein establishing the individual's genotype in

relation to the VDR gene comprises hybridising a VDR gene nucleic acid sequence having a 3' region of the VDR gene with one or more primers and carrying out an

amplification reaction to amplify a part or all of said 3' region of the VDR gene.

9. A method according to claim 8 wherein the 3' region of the VDR gene comprises part or all of intron 8 and/or part or all of exon 9.

10. A method according to claim 9 wherein the 3' region of the VDR gene comprises a part of exon 9 which in one polymorphic form comprises a cleavage site for Taq1.

11. A method according to any one of claims 8 to 10 which comprises hybridising a said VDR gene nucleic acid sequence with a pair of primers.

12. A method according to claim 11 when a said pair of primers comprises the primers

5'- CAGAGCATGGACAGGGAGCAAG -3'

5 ' - GGTGGCGGCAGCGGATGTACGT -3'.

13. A method according to any one of claims 1 to 12 wherein establishing the individual's genotype in

relation to the VDR gene comprises contacting a VDR gene nucleic acid sequence having a 3' region of the VDR gene with one or more oligonucleotide hybridisation probes specific for one or more of the polymorphisms A, a, B, b, T and t as set forth in claim 3.

14. A method according to claim 13 which employs an oligonucleotide hybridisation probe specific for the polymorphism T and which comprises the sequence

5'- CGCTGATTGAGGCCATC -3'.

15. A method according to claim 13 which employs an oligonucleotide hybridisation probe specific for the polymorphism t and which comprises the sequence

5'- CGCTGATCGAGGCCATC -3'.

16. A method according to any one of claims 13 to 15 wherein a said oligonucleotide hybridisation probe is labelled.

17. A method according to any one of claims 13 to 15 which employs more than one oligonucleotide hybridisation probe.

18. A method according to claim 17 wherein the

oligonucleotide hybridisation probes are labelled

differently to one another.

19. A method according to any one of claims 8 to 10 wherein a primer is specific for one or more of the polymorphisms A, a, B, b, T or t as set forth in claim 3 and the absence of an amplification product indicates that the individual is homozygous for the allele for the VDR gene which comprises the polymorphism for which the primer is specific.

20. A method according to any one of claims 1 to 19 which comprises the step of sequencing a 3' region of the VDR gene.

21. A method according to any one of claims 1 to 20 wherein the disease is tuberculosis.

22. A method according to any one of claims 1 to 20 wherein the disease is HBV related.

23. A method according to any one of claims 1 to 20 wherein the disease is leprosy.

24. A method according to any one of claims 1 to 20 wherein the disease is HIV-1.

25. Use of a vitamin D analogue in the manufacture of a medicament for the treatment of an autoimmune disease or infectious disease which is associated with VDR genotype.

26. Use of an agent able to modulate the metabolism of vitamin D or able to modulate a signalling pathway activated by vitamin D, 1,25(OH)₂ D₃ or VDR, in the manufacture of a medicament for the treatment of an autoimmune disease or infectious disease which is associated with VDR genotype.

27. Use according to claim 25 or claim 26 wherein the disease is selected tuberculosis, HBV, leprosy or HIV-1.

28. A treatment for an autoimmune disease or infectious disease which is associated with VDR genotype which comprises administering to a patient an analogue of vitamin D, an agent able to modulate the metabolism of vitamin D, or an agent able to modulate a signalling pathway activated by 1,25(OH)₂ D₃ or VDR.

29. A treatment according to claim 28 wherein the infectious disease is selected from tuberculosis, HBV, leprosy or HIV-1.

30. A therapeutic composition for the treatment of an autoimmune disease or an infectious disease which is associated with VDR genotype, which composition comprises an analogue of vitamin D, an agent able to modulate the metabolism of vitamin D, or an agent able to modulate a signalling pathway activated by 1,25(OH)₂ D₃ or VDR.