WO1997032978A1 - Production of human hemoglobin in transgenic animals - Google Patents

Abstract

The invention features non-human transgenic animals, such as mice, which produce human hemoglobin, but fail to produce hemoglobin endogenous to the animal. The invention also features methods for producing human hemoglobin in these mice, as well as the human hemoglobin produced by these methods.

Description

PPOΠTTΠTTON OF HTTMΆN HFMOGT.OBIN IN TRANSGENIC ANIMALS Background of the Invention This invention relates to the production of human hemoglobin in non-human transgenic mammals, such as mice.

Hemoglobin, the oxygen carrying component of blood, is a tetramer of two α-globin subunits and two β- globin subunits. Each subunit contains a heme moiety, composed of a porphyrin ring and an iron atom, which binds oxygen. Specific alterations in hemoglobin gene sequences cause hematological disorders, such as thalassemias and sickle-cell anemia. Thalassemias arise when the synthesis of an or a β-globin subunit is absent or severely reduced. For example, in β- thalassemia, the ratio of β-globin subunits to α-globin subunits is less than 1. While the causes of thalassemias are heterogeneous, involving different mutations in the structural or regulatory sequences of the affected gene, sickle-cell anemia is caused by a single nucleic acid substitution in the β-globin gene, which results in a Glu -> Val substitution at position 6.

Summary of the Invention We have shown that human hemoglobin can be produced in transgenic mice, which do not produce murine hemoglobin.

Accordingly, in one aspect, the invention features a transgenic non-human mammal which produces erythrocytes that produce at least one chain of human hemoglobin, but which fail to produce at least one hemoglobin chain O 97/32978 PC17US97/03896

- 2 - endogenous to the non-human mammal . A non-human transgenic mammal of the invention may be used, e . g. , for producing human hemoglobin for use as a human blood substitute, or for an animal model system for a hemoglobinopathy. These animal model systems may be used for testing potential therapeutic drugs, as well as for testing gene therapy methods.

The erythrocytes of a non-human transgenic mammal of the invention may produce, e . g. , a human α-globin chain, a human β-globin chain, two human α-globin chains, two human β-globin chains, one human α-globin chain and one human β-globin chain, or two human α-globin chains and two human β-globin chains. The erythrocytes may also fail to produce an α-globin chain endogenous to the non- human mammal, a β-globin chain endogenous to the non- human mammal, or any α-globin or β-globin chains endogenous to the non-human mammal. In addition, the erythrocytes may produce two human α-globin chains and two human β-globin chains, but fail to produce any α- globin or β-globin chains endogenous to the non-human mammal. As is described below, the human hemoglobin made by the erythrocyte may be, e . g. , human HbA hemoglobin (α2/β2) , human β-sickle hemoglobin, human β Kansas Porto Alegre hemoglobin, or a human thalassemia hemoglobin. The non-human transgenic mammals of the invention may be generated by crossing transgenic animals obtained by gene knock-out by homologous recombination in embryonic stem cells, transgenic animals obtained by gene replacement by homologous recombination in embryonic stem cells, and transgenic animals obtained by microinjection of fertilized eggs.

In another aspect, the invention features a method for producing human hemoglobin. In this method, human hemoglobin ( e . g. , human HbA hemoglobin, human sickle- hemoglobin, human Kansas Porto Alegre hemoglobin, or human thalassemia hemoglobin) is expressed in the erythrocytes of a transgenic non-human mammal of the invention, as is described above. Hemoglobin is purified from hemolysates of the non-human transgenic mammals of the invention using standard methods in the art.

In a further aspect, the invention features human hemoglobin produced by the non-human transgenic mammals described above. For example, the invention includes, but is not limited to, human HbA hemoglobin, human hemoglobin containing a β-sickle mutation, human hemoglobin containing a β-Kansas Porto Alegre mutation, and human hemoglobin containing a thalassemia mutation (e.g., a β°-thalassemia mutation) . The human hemoglobin may be stored in any appropriate buffer, such as phosphate-buffered saline.

The term "human hemoglobin" , as used herein, means a molecule whose amino acid sequence at least in part corresponds to the amino acid sequence of a naturally- occurring human hemoglobin molecule, whether mutated or wild-type.

The term "anti-sickling" , as used herein, means capable of interfering with the aggregation of hemoglobin into 14-stranded hemoglobin molecules characteristic of Hb S hemoglobin and resulting in sickle cell anemia (as described herein) . Preferably, the anti-sickling molecules of the invention have approximately the same anti-sickling properties as fetal Hb (i.e., α₂γ₂) hemoglobin (e.g., as measured by in vi tro solubility assays, e.g., the assay of Benesch et al . , J. Biol. Chem. 254:8169, 1979) .

The term "Hb S hemoglobin" or "human β-sickling hemoglobin" as used herein means that hemoglobin which aggregates into 14-stranded fibers at high intracellular concentrations and low partial pressure; such Hb S hemoglobin has an A to T transversion in the 6th codon of the human β-globin gene. "HbA" represents adult human hemoglobin, which consists of two α-globin chains and two β-globin chains (α2/β2) ; "HbS" represents sickle hemoglobin, which consists of α2/β^s2; and "HbF" represents fetal hemoglobin, which consists of α2/γ2.

"Transgenic, " as used herein, is used to describe a non-human mammal that has a foreign (or partly foreign) gene incorporated into its genome (both in its germ cells and somatic cells) . The foreign (or partly foreign) gene may have been introduced into the genome of the non-human mammal (or an ancestor of the non-human mammal) by homologous recombination (knock-out or replacement) in an embryonic stem cell or by microinjection of a fertilized egg. Although transgenic mice are described throughout the application, other non-human transgenic mammals, including, without limitation, rodents ( e . g . , hamsters, guinea pigs, rabbits, and rats) , pigs, cattle, sheep, and goats and are also included in the invention. An advantage of the invention is that it facilitates production of human hemoglobins in the absence of hemoglobins from another species, such as the hemoglobin that the non-human transgenic mammal would naturally produce, but for the genetic modifications accomplished by the methods described below (i.e., endogenous hemoglobin) . Thus, purification of the human hemoglobin from the non-human transgenic mammals of the invention is not complicated by fractionation of the human hemoglobin from the mammal's endogenous hemoglobin.

An additional advantage of the invention is that hemoglobins produced in a non-human mammal of the invention are not likely to be contaminated with human pathogens, such as hepatitis virus or human retroviruses, such as HIV. Production of human hemoglobin offers the additional advantage of providing a red blood substitute which can be used to transfuse patients having any blood type, thus obviating the persistent problems created by limited availability of transfusable blood for rare or relatively unusual blood types.

Other features and advantages of the invention will be apparent from the detailed description, the drawings, and the claims.

Brief Description of the Drawings Fig. 1 is a schematic representation of the mating scheme for production of HbA replacement mice.

Fig. 2 is a schematic representation of the mating scheme for production of transgenic HbF-->HbA mice O 97/32978 PC17US97/03896

- 6 -

(doubly homozygous for mouse α-globin and β-globin deletions) .

Fig. 3 is a schematic representation of a strategy for making a β knock-out/human β replacement mouse. LoxP sites (*) may be included on either side of the neo gene in order to facilitate its post-antibiotic selection removal. The human β-globin gene can be a wild-type human β-globin, or contain a mutation, such as the β- Kansas Porto Alegre mutation, a thalassemia mutation, or a sickle cell mutation.

Fig. 4 is a photograph of transgenic mouse hemolysates fractionated by isoelectric focusing.

De a.i 1ed Description We have generated mice which produce human, but not murine, hemoglobin. These mice can be used for producing human blood substitutes, as well as for animal model systems of hemoglobinopathies, such as thalassemias and sickle cell anemia. The mice of the invention can be generated using combinations of genetic methods. Two examples of such combinations are described below.

Human Hemoglobin Replacement Mice (hα/hα, hβ/hβ) One method for making a mouse which produces human, but not murine, hemoglobin is illustrated in Fig. 1. Briefly, a mouse in which the endogenous α-globin genes (αl and α2) on one chromosome have been knocked out and replaced with a human α-globin gene (or genes) by homologous recombination in embryonic stem cells (an "α- replacement heterozygote" or "hα/mα, mβ/mβ") is crossed with a mouse in which the endogenous β-globin genes (β^m*^D and β ⁿ) on one chromosome have been knocked out and replaced with a human β-globin gene (or genes) (a "β- replacement heterozygote" or "mα/mα, hβ/mβ") . Progeny of this cross, which are heterozygous for human α and β- globin genes (a "double-replacement heterozygote" or "hα/mα, hβ/mβ"), are crossed with each other to generate a human hemoglobin replacement mouse ("double-replacement homozygote" or "hα/hα, hβ/hβ") . This method is described in further detail below. A. Production of single replacement heterozygotes (hα/mα, mβ/mβ and mα/mα, hβ/mβ)

Gene replacement using homologous recombination in embryonic stem cells for production of replacement heterozygotes is carried out using standard genetic methods (see, e.g., Ausubel et al. , eds. Current Protocols in Molecular Biology, Wiley & Sons, New York, 1989, Units 9.15-9.17) . In these methods, a replacement vector is constructed in which the replacement gene, together with a selectable marker, such as an antibiotic resistance gene, are flanked by sequences homologous to sequences which flank the target gene to be replaced. Fig. 2 illustrates a replacement vector which can be used to replace murine β-globin genes with human β-globin genes. (See Ciavatta et al . , Proc . Natl . Acad. Sci. USA 92:9259-9263, 1995, for further details.) The replacement vector is transfected by, e . g. , electroporation' into appropriate mouse embryonic stem cells, such as D3 (Ciavatta et al . , supra) , RI (Nagy et al . , Proc. Natl. Acad. Sci. USA 90:8424-8428, 1993) , or RW4 (Genome Systems, St. Louis) cells, and clones in which the replacement and selectable marker genes have replaced the target gene are selected by culturing the cells in selection medium. For example, when the neomycin resistance gene is used as the selectable marker, selection medium containing G418 can be used. Confirmation of homologous recombination may be carried out by Southern blot analysis of genomic DNA prepared from selected clones.

The selectable marker gene, e . g. , an antibiotic resistance gene, such as a neomycin resistance gene, may be incorporated into the vector so that it can be removed after selection. For example, in constructing the replacement vector, the selectable marker gene can be flanked by loxP sites. Selected clones can then be transiently transfected with a gene encoding the ere enzyme, which catalyzes a loxP site-dependent recombination, so that the DNA sequences between the two loxP sites, i.e., the sequences corresponding to the selectable marker gene, are efficiently excised from the chromosome (Gu et al . , Cell 73:1155-1164, 1993) . An additional method for ensuring removal of a selectable marker is the tag and exchange method (Stacey et al . , Molecular and Cellular Biology 14 (2) :1009-1016, 1994) . In this method, the targeted gene in the embryonic stem cells is replaced with the hypoxanthine phosphoribosyltransferase (HPRT) gene, using standard gene replacement by homologous recombination in embryonic stem cells. Clones in which the HPRT gene has replaced the target gene are selected by culture in medium containing hypoxanthine aminopterin-thymidine (HAT) . In a subsequent round of homologous recombination, the HPRT gene is replaced with the replacement gene ( e. g. , a human α or β-globin gene) . Cells are then cultured in 6- thioguanine to select for clones which lack HPRT, and thus which have undergone site-specific recombination to replace the HPRT gene with the replacement gene.

Using standard methods, embryonic stem cells, which have been confirmed to have undergone the correct knock-out and replacement, are injected into blastocysts, such as C57BL/6 blastocysts, which are implanted into pseudo-pregnant female mice, to generate chimeric mice. Male chimeric mice are bred with female mice, such as C57BL/6 female mice, to generate single replacement heterozygotes, which can be identified using, e . g. , Southern blot analysis. B. Production of a double- replacement heterozygote (hα/mα, hβ/mβ)

In order to produce a double-replacement heterozygote (hα/mα, hβ/mβ) , an α-replacement heterozygote (hα/mα, mβ/mβ) is crossed with a β- replacement heterozygote (mα/mα, hβ/mβ) . Double- replacement heterozygotes produced by this cross can be identified using, e . g. , Southern blot analysis.

C. Production of a double-replacement homozygote (hα/hα, hβ/hβ) A double-replacement homozygote (hα/hα, hβ/hβ) can be made by crossing two double-replacement heterozygotes ( e . g. , hα/mα, hβ/mβ) . Double-replacement homozygotes, which express human, but not murine, α and β-globin genes, may be identified using standard methods, such as Southern blot analysis.

II. Human Hemoglobin Producing Mice (HbA mα⁰/mα^:, mβ°/mβ°) Made By Crossing Knock-Out Mice With Transgenic Micre Made By Microinjection

A second method for making a mouse which produces human, but not murine, hemoglobin is illustrated in Fig. 3. A mouse in which the endogenous α-globin genes on one chromosome have been knocked out, but not replaced, by homologous recombination in embryonic stem cells (an "α- knock-out heterozygote" or "raα'/mα, mβ/mβ"; see, e . g. , Paszty et al . , Nature Genetics 11:33-39, 1995) is crossed with a mouse which was produced by microinjection of a fertilized egg with human α and β-globin genes (HbA, mα/mα, mβ/mβ; Behringer et al . , Science 245:971-973, 1989) . Similarly, a mouse in which the endogenous β- globin genes (β""⁰ and β""ⁿ) on one chromosome have been knocked out, but not replaced, (a "β-knock-out heterozygote" or "mα/mα, mβ°/mβ"; see, e . g. , Ciavatta et al . , supra) is crossed with a mouse which was produced by microinjection of a fertilized egg with human α and β- globin genes (HbA, mα/mα, mβ/mβ; Behringer et al . , supra) . Progeny from this cross, which are heterozygous for murine α and β-globin genes ("double knock-out heterozygotes" or "α°/mα, β°/mβ") , are crossed with each other to generate a mouse which produces human hemoglobin, but not murine hemoglobin (HbA α°/α°, β°/β°) •

Using this method, we have generated such a mouse. Hemolysates from the mouse were fractionated by isoelectric focusing. As shown in Fig. 4, the mouse generated by these experiments produces human hemoglobin, but not murine hemoglobin.

Examples I and II described above illustrate generation of mice which produce HbA, which consists of two human α-globin subunits and two human β-globin subunits. As is described below, other genes, such as genes containing human α or β-globin mutations, such as a β-sickling mutation, the β-Kansas Porta Alegre mutation, and thalassemia mutations may be used in this method. The genes may be used to replace mouse genes in homologous recombination replacement methods or may be injected into fertilized mouse eggs. Mice which may be used for production of a human blood substitute include, but are not limited to, those which produce human hemoglobin HbA (hα2/hβ2) or human hemoglobin containing the Kansas Porto Alegre mutation (hα2/hβ^KPA2) , but not murine hemoglobin. Mice which may be used for animal model systems include, but are not limited to, mice which produce human hemoglobin HbA (hα2/hβ2) , human hemoglobin containing the β^s mutation (hα2/hβ^s2) , human hemoglobin containing an anti-sickling mutation, or human hemoglobin containing a thalassemia mutation, but not murine hemoglobin.

Ill . β-Sickling Hemoglobins

We have generated transgenic mice that make sickle hemoglobin (HbS^j-α₂β^s ₂) by DNA microinjection of fertilized eggs. However, these animals have their wild-type α- and β-globin genes; they produce normal functioning mouse hemoglobin. As a result, these mice exhibit sickle-cell trait (heterozygous for the sickle β-globin gene) because their normal hemoglobin effectively dilutes the amount of HbS, inhibiting the formation of extended HbS polymers. With the development of gene targeting and embryonic stem (ES) cell technology, mice can be generated with specific genes deleted. Figure 1 of Caviatta et al . ( supra) shows the targeting scheme used to create an embryonic stem cell heterozygous for the deletion of the murine adult β- globin genes, β^ma: and β^mιn. A correctly targeted embryonic stem cell clone was injected into blastocysts to produce chimeric mice that subsequently transmitted the deletion allele, giving rise to heterozygous β-knockout mice. Heterozygous β-knockout mice and mice heterozygous for a deletion of the adult α-globin genes (α-knockout mice; Paszty et al . , supra) were mated to a HbS transgenic mouse (see, e . g. , Ryan et al . , Science 247:566-568, 1990) to make an animal producing human sickle hemoglobin, but not murine hemoglobin.

Mice have been born that are heterozygous for the β-globin deletion and contain the HbS transgene . The construct injected into fertilized eggs to make HbS transgenic mice links the human α- and β^s-globin genes directly to the human β-globin Locus Control Region (LCR) . This design bypasses the normal temporal regulation observed in globin gene expression because the β-globin gene promoter is not competing with other globin gene promoters (in the absence of e or y) for interaction with the LCR. As a result the β^B-globin gene is expressed early, and HbS is present using embryonic and fetal development. Apparently, HbS or β^s-globin is detrimental early in mouse development . To circumvent this problem we have produced HbS mice with a construct that also contains the human γ-globin gene (see, e . g. , Behringer et al . , Genes and Development 4:380-389, 1990) . These animals make human fetal hemoglobin (HbF - α₂γ₂) early in development and then to switch to HbS around day 15 of embryonic development, the time at which expression of the mouse adult β-globin genes normally begins.

An additional approach for creating a mouse model for sickle cell disease that produces only HbS as an adult again exploits the power of gene targeting in ES cells. In this way, the targeting vector is designed to simultaneously delete the mouse's adult α- or β-globin genes and replace them with the human α- or β^s-globin genes, respectively. The β^s-globin gene was introduced into the mouse β-globin locus by the scheme shown in Fig. 2. A correctly targeted ES cell clone was used to generate two chimeric males by the non-injection aggregation chimera technique. Progeny from a cross between these chimeric males and wild-type females has demonstrated that the embryonic stem cell has contributed to the germline of both chimeras. Additionally, eight β^s chimeric mice have been produced by the blastocyst injection technique. We have shown that the transgene has been successfully passed through the germline.

IV. Targeted Deletion of the Mouse β"^aι and β¹"" Globin G&n&a in embryonic stem cells. β°-thalassemia is an inherited disorder characterized by the absence of β-globin polypeptides derived from the affected allele. The molecular basis for this deficiency is a mutation of the adult β-globin structural gene or the cis regulatory elements that control β-globin expression. We have shown that produced a mouse in which both adult β-like globin genes, β""° and β""ⁿ, are deleted. Heterozygous animals derived form the targeted cells are severely anemic with dramatically reduced hemoglobin levels, abnormal red cell morphology, splenomegaly, and markedly increased reticulocyte counts. Homozygotes die in utero; however, heterozygous mice are fertile and transmit the deleted allele to progeny. The anemic phenotype is completely rescued in progeny derived form mating β°-thalassemic animals with transgenic mice expressing high levels of human hemoglobin A. The β°- thalassemic mice can be used to test genetic therapies for β°-thalassemia and can be bred with transgenic mice expressing high levels of human hemoglobin HbS to produce a mouse model of sickle cell disease. Methods for carrying out these experiments are described below. O 97/32978 PCΪYUS97/03896

- 15 -

Additional details are described by Ciavatta et al . ( supra) .

Targeting Vector Construction. Homologous sequences flanking β^ma:ι- and β^mιn-globin genes were isolated from a 129 Sv/Ev strain mouse genomic library by using a 2.5-kb PstI probe containing β^ma:l-globin gene sequences. The targeting vector was constructed by inserting a 1.7- kb Hindlll fragment and a 7.0-kb BamHI fragment into the HindiII and BamHI sites of the plasmid pNTK (Mortensen et al . , Mol. Cell Biol. 12:2391-2395; Ausubel et al . , Current Protocols in Molecular Biology, 1993) .

ES Cell Transfection and Characterization of Homologous Recombinant. The targeting vector was linearized with Sail and introduced into the D3 line of ES cells as described (Doetschman et al . , J. Embryol .

Exp. Morphol 87:27-45, 1985) . Briefly, 2 x 10⁷ cells in 1 ml of Dulbecco's modified Eagle's medium with 15% (vol/vol) fetal calf serum (HyClone) were electroporated with 25 μg of linearized vector DNA in a 0.4-cm cuvette at 400 V and 250 μF with a Bio-Rad Gene Pulsar. Twenty- four hours after electroporation, cells were selected (Mansour et al . , Nature 366:348-352, 1988) in G418 (300 g/ml) and 2.5 μM gancyclovir (Syntex, Palo Alto, CA) for 2 weeks. Forty colonies were picked and expanded, and DNA was isolated for Southern blot analysis. The

5' probe was a 1.45-kb Sau3A-HindIII fragment and the 3' probe was a 1.12-kb BamHI-Pst I fragment.

Characterization of Chimeras and Agouti Offspring. The probes used for Southern blot analysis of chimeras and agouti offspring were a 1.03-kb Hindlll fragment from positions -340 to +690 of β^ma:ι . This probe cross- hybridizes with β^mιn, β^ε, and β¹ sequences form the BamHI site in the second exon to the end of this exon. Cellulose acetate gel electrophoresis was performed as described (Behringer et al . , Science 455:971-973, 1989) . Primer-extension analysis was performed as described (Behringer et al . , Genes Dev. 4:380-389, 1990) . Primer- extension reaction mixtures contained 4 μg of RNA from 10-day yolk sac or 50 ng of RNA from adult blood. Bands were quantitated on a Molecular Dynamics PhosphorImager using IMAGEQUANT software.

V. α-Globin Knock-Out Mice

Using gene targeting in mice, Paszty et al . ,

( supra) deleted a 16 kb region encompassing both α-globin genes. A mouse generated using the method of Paszty et al . can be used in carrying out crosses described above .

The method and constructs described by Paszty et al . may also be used to produce additional α-knock-out mice, as well as to replace mouse α-globin genes with the human α- globin genes (Lauer et al . , Cell 20:119-130, 1980) , using the methods described above.

J, Cross-Linked Hemoglobins

It has been found that hemoglobin tetramers rapidly dissociate into αβ dimers when red cells are lysed and the concentration of hemoglobin is decreased by dilution. To prevent tetramers from dissociating, the present invention identifies several sites for introducing internal, disulfide crosslinks into human hemoglobin. These crosslinks stabilize α₂β₂ tetramers and, therefore, prolong the half-life of cell-free hemoglobin. The crystal structure of both deoxy- and oxy-hemoglobin have been accurately determined and the important sites of subunit interaction are known. The atomic distances were examined between various amino acids in areas of subunit interaction and several sites were identified in which cysteine substitutions for the normal amino acids in α and β polypeptides result in the formation of disulfide bridges between these chains. Those sites which would allow bond angles that favor disulfide linkage were chosen for mutagenesis.

Stabilization of human hemoglobin tetramers requires disulfide crosslinks between the two αβ dimers. Crosslinks could be between the αl and β2 subunits, the αl and α2 subunits, or the βl and β2 subunits. Computer- assisted modeling and energy minimization were utilized to identify the sites in which cysteine substitutions for the normal amino acids would lead to the most stable disulfide bridges. The most stable tetramer disulfide bridges thus determined include from:

1) αl 92 to β2 40

2) βl 1 to β2 146

3) α2 130 to a cysteine added to the carboxy terminus of the αl chain, designated αl 142.

Of the above disulfide bridges, a preferred one is αl 92 to β2 40 or α2 92 to βl 40 crosslink because a disulfide in this position would not hinder the rotations of αβ dimers with respect to each other during the cooperative binding of oxygen. Xntermolecular Disu]JLides for. Polymerization of

In addition to stabilizing the tetramer, disulfide bridges can also be used to link tetramers together to form polymers, such as octomers and the like. Tetramers stabilized by chemical crosslinking have a half-life of only 4 hours in vivo. Although the tetramers have a molecular weight of 64,000, they are filtered by the kidneys and can cause renal damage. Linkage of 2 tetramers produces a molecule of about 128,000 daltons. It has been demonstrated that octomers and higher molecular weight polymers produced by chemical crosslinking have a half-life of 40-48 hours in vivo and these molecules are not filtered by the kidneys. (Gould et al. (1990) , Ann. Surg. 211:394-398) .

Another important advantage of polymerization of the hemoglobin relates to the osmotic property of the polymer. The highest concentration of a crosslinked tetramer that would be iso-osmotic is 7 g/dl . However, this concentration does not provide sufficient oxygen carrying capacity (Gould et al . (1990) , Ann. Surg. 211:394-398) . An octomeric polymer would be iso-osmotic at 14 g/dl which is the physiologic hemoglobin concentration. Hence, the crystal structures of deoxy- and oxy-hemoglobin were examined to determine the best position for a disulfide bride between 2 tetramers. It was found that changing the αl aspartic acid 75 to cysteine would produce a molecule capable of forming intermolecular crosslinks. Once an octomer is formed, steric hindrances inhibit further polymerization. AUi≤xnative Self-.Limiting Polymerization Str egy

As an alternative to the polymerization strategy described above, a naturally-occurring mutation which also results in polymerization was examined. This mutation is known as Hemoglobin Porto Alegre and involves a change from serine to cysteine at position 9 of the beta chain (Tonda et al., 1963, Amer. J. Human Genetics 15 265-279; Bonaventura and Riggs, 1967, Science 158: 800-802) . Hemoglobin (Hb) Porto Alegre polymerizes in a self-limiting fashion to form octamers composed of two hemoglobin tetramers or dodecomers composed of three tetramers (Bonaventura and Riggs, s_upxa; Tonda, 1971, An. Acad. brasil . Cienc 43: 651-669) . Although this hemoglobin does not polymerize in vivo, it forms stable polymers in vitro after exposure to gentle oxidizing conditions. After polymerization in vitro, polymers of Hb Porto Alegre are stable in reducing conditions similar to serum (Tonda et al., 1985, An. Acad. brasil. Cienc. 57: 497-506) . Therefore, it was postulated that genetically modified polymers would be ideally suited to function as a blood substitute. One undesirable characteristic of Hb Porto Alegre, however, is its increased oxygen affinity. In order to overcome this limitation, a second, oxygen affinity decreasing mutation can be made, as described below. Approximation of Normal Oxygen Affinity in Hemoglobin Porto Alegre

The oxygen affinity of human hemoglobin is regulated by the molecule 2, 3-diphosphoglycerate (DPG) . Outside of red blood cells, DPG diffuses away from hemoglobin, resulting in a large increase in the hemoglobin's oxygen affinity. The present invention provides for a unique solution to the loss of DPG regulation. This is accomplished by modification of the human hemoglobin so that its oxygen affinity will approximate that of bovine hemoglobin.

Bovine hemoglobin has a naturally low oxygen affinity which is not dependent upon DPG. Peru v. and Imai (1980, J. Mol. Biol. 136: 183-191) characterized the amino acid change responsible for the decreased oxygen affinity of bovine hemoglobin. The change occurs at the amino terminus of the beta chain and involves the replacement of a hydrophilic residue at position NA2 with a hydrophobic residue. The present invention involves the removal of the first two amino acids at the N- terminus of the beta chain and their replacement by the hydrophobic amino acid methionine. The resulting β- globin polypeptide is composed of 145 amino acids instead of 146 and mimicks the bovine β-globin chain at the amino terminal end.

As mentioned above, the invention also provides for a second mutation, designed to counteract the increase in oxygen affinity of Hb Porto Alegre. One such mutation, which occurs naturally, is known as Hb Kansas. O 97/32978 PC17US97/03896

- 2 1 -

In Hb Kansas the beta 102 asparagine is changed to threonine (Bonaventura and Riggs, 1968, J. Biol. Chem. 243: 980-991) . This mutation stabilizes the T or Tense conformation of hemoglobin which is the structure normally found in venous blood after oxygen has been delivered to the tissues. The oxygen affinity of Hb Kansas is 2 fold lower than normal HbA. Therefore, it was postulated that Hb Kansas may decrease the abnormally high affinity associated with Hb Porto Alegre. Hence, combinations of Hb Porto Alegre and Hb Kansas as well as Hb Porto Alegre and the bovine mutations were constructed. The present invention provides for these unique combinations of mutant hemoglobins and for their use as blood substitutes. Other Genetic Modification of Human Hemoglobins Synthesized in Transgenic Animals

As described above, the present invention provides for the genetic modifications of human hemoglobin, but is not limited to these specific examples. Computer- assisted modeling and energy minimization were employed to identify the sites in which cysteine substitutions for the normal amino acids would lead to the most stable disulfide bridges. Of course, following this strategy any number of new designs of these hemoglobin molecules can be generated. The basic strategy for identifying sites for cysteine substitution is as follows. The molecular coordinates of hemoglobin obtained from the Brookhaven Data Bank were loaded into an Evans and Sutherland PS300 Computer Graphics System. Cysteine substitutions were made at a variety of positions. Bond angles between pairs of cysteine residues on αl and β2 chains were adjusted such that β carbon atoms were separated by less than 3.5 angstroms and disulfide bonds were formed between these residues. The disulfide linked tetramer was then subjected to energy minimization as described by Powell (1977, Mathematical Programing 12, 241-254) on a silicon graphics IRIS-4D. Briefly, energy minimization was conducted using the Powell-method conjugate gradient minimizer provided in the software system X-PLOR version 2.1 (Brunger, 1990, X-PLOR: A System for Crystallography and NMR, Yale University, New Haven) . Twenty-five hundred cycles of minimization were conducted using both the oxy- and deoxyhemoglobin molecular coordinates. This established a baseline minimal total energy to which hemoglobins with engineered disulfides could be compared. The engineered hemoglobin with a disulfide bond from αl 92 to β2 40 displayed energy minima which were similar to those of the native human hemoglobin in both the deoxy- and oxygenated conformations. This bridge was subsequently selected as the first disulfide for tetramer stabilization to be engineered by site-directed mutagenesis. Specific cysteine codons were then introduced into α- and β- globin genes by site specific mutagenesis. Furthermore, experimental data obtained from transgenic animals may suggest additional modifications to be incorporated into the design. Thus, the present invention provides for any mutant hemoglobin synthesized in transgenic animals for use as a blood substitute including a combination of naturally occurring mutants with those specifically designed by computer modeling and site-directed mutagenesis and the like. Mutagenesis of Human α- and β-globin Genes

Mutations were introduced into the normal human α- and β-globin genes by site-directed mutagenesis. A 3.8 kb Bglll-EcoRI fragment containing the human α-globin gene and a 4.1 kb Hpal-Xbal fragment containing the human β-globin gene were cloned into the pSELECT plasmid (Lewis and Tho paon, (1990, Nucl . Acids Res. 18: 3439-3443) by standard procedures (Maniatis et al . , 1989, Molecular Cloning; A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) . Oligonucleotide mutagenesis was performed as described by Lewis and Thompson, 1990, Nucl. Acids Res. 18: 3439-3443. In this procedure an oligonucleotide which corrects a mutation in the ampicillin resistance gene in the pSELECT plasmid is used simultaneously with one or more oligonucleotides designed to create mutations in the globin gene insert. Briefly, E. coli (JM109) containing the pSELECT plasmid with globin gene inserts were infected with helper phage (M13K07) . After growing the culture overnight (about 12- 16 hours) , phage obtained from the supernatant were extracted with phenol :chloroform and single-stranded DNA was isolated by standard methodology. Oligonucleotides containing each of the mutations were annealed to single- stranded DNA together with the wild type ampicillin oligonucleotide and these primers were extended with Klenow for about 90 min. at 37°C. Double-stranded DNA was transformed into E. coli (BMH 71-18 mutS) and the culture was grown overnight in L broth containing 75 μg/ml ampicillin. DNA obtained from rapid lysis preparations of these cultures were transfected into E. coli (JM109) and colonies were selected on ampicillin plates (75 μg/ml) . Double-stranded DNA obtained from rapid lysis preparations of these colonies was sequenced (Sanger et al . , 1977, Proc. Natl. Acad. Sci. USA 74: 5463-5467) with oligonucleotides located upstream of the mutagenic oligonucleotides. Mutants were clearly identified by comparison to wild type sequence. The oligonucleotides used to generate the mutations include those listed below. Underlined bases indicate the bases which differ from the wild type. I . Tetramer intramolecular crosslink

A. α92 arginine to cysteine CGG to TGC

5 'GCGCACAAGCTTTGCGTGGACCCGGTC3 *

B. β40 arginine to cysteine AGG to TGT

5 'CCTTGGACCCAGTGTTTCTTTGAGTCC3 '

O 97/32978 PC17US97/03896

-25 -

II. Polymerization intermolecular crosslinks

A. α75 aspartic acid to cysteine (α octamer) GAC to TGC

5 'CGCACGTGGACIGCATGCCCAACGC3 ' B. β9 serine to cysteine (Porto Alegre)

TCT to TGI 5 'CCTGAGGAGAAGTGTGCCGTTACTGCC3 ^•

III. Mutations to lower oxygen affinity

A. βl02 asparagine to threonine (Hb Kansas) AAC to ACC

5 'GTGGATCCTGAGACCTTCAGGGTGAGT3 '

B. Bovine mutation (βΔl-2) in which the first and second codons, GTG (valine) and CAC

(histidine) , are deleted 5 'CAAACAGACACCAIGCTGACTCCTGAG3 '

The wild type DNA sequence is ATG GTG CAC CTG ACT and the mutated sequence is ATG CTG ACT. The wild type amino acid sequence is Met-Val- His-Leu-etc. The methionine is cleaved from the amino terminal end by an aminopeptidase and the final protein is composed of 146 amino acids. The amino acid sequence of the mutant is Met-Leu-etc. The methionine is not removed from the amino terminal end because the aminopeptidase does not cleave the Met-

Leu peptide bond. The final protein is thus composed of 145 amino acids.

The α75 and α92 mutations were introduced simultaneously into the α-globin gene with two separate oligonucleotides. The β40 and Bovine (βΔl-2) mutations were introduced into the β-globin gene in a single mutagenesis with 2 different β-globin oligonucleotides. Similarly, the β40 and Kansas mutations were also introduced in the β-globin gene in a single mutagenesis with 2 different β-globin oligonucleotides. The Porto Alegre (β9) and Hb Kansas (βl02) mutations were also introduced into the β-globin gene in a single mutagenesis with 2 different β-globin oligonucleotides. The Porto Alegre and bovine (βΔl-2) mutations were created with a single 48 base oligonucleotide. Construction of Cosmid Clones

Mutant α- and β-globin genes were excised from pSELECT plasmids and subcloned into "right arm" plasmids containing a Cos site. Specifically, a 1.2 kb Ncol-Xbal fragment from the α-globin pSELECT plasmids and a 1.4 kb Clal-BamHI fragment from the β-globin pSELECT plasmids were inserted into right arm plasmids in place of the corresponding α- and β-globin gene wild type fragments. The α-globin right arm plasmids were digested with Clal and Mlul and 4.8 kb fragments containing mutated α-globin genes which were linked to Cos sites were purified from agarose gels. The β-globin right arm plasmids were digested with Clal and Hindlll and 6.5 kb fragments containing mutated β-globin genes which were linked to Cos sites were purified from agarose gels. Cosmids containing these fragments were constructed in four way ligations (Ryan et al . , 1989, Genes. Dev. 3: 314-323) . The left arms were 9.0 kb Mlul-Sall fragments obtained from the cosmid vector pCVOOl (T.au and Kan, 1983, Proc. Natl. Acad. Sci. U.S.A. 80: 5225-5229) . This fragment O 97/32978 PC17US97/03896

- 27 - contained a Cos site, an ampicillin resistance gene, a ColEl origin and the SVneo gene. The two internal fragments were a 10.7 kb Sall-Kpnl fragment containing DNase I super-hypersensitive (HS) sites V, IV and III and a 10.9 kb KpnI-Clal fragment containing HS II and I. The four fragments were ligated together in a 2:1:1:2 molar ratio of vector arms to inserts and packaged (Packagene; Promega) . E. coli ED8767 was infected with the packaged cosmids and plated onto ampicillin plates. Large scale cultures of ampicillin resistant colonies were grown and cosmids were prepared by standard procedures. Production of Transgenic Animals

Cosmid DNA was prepared by standard procedures. HS I-V α and HS I-V β cosmids containing the mutations described above were injected directly into fertilized mouse eggs or the constructs were digested with Sail and insert DNA was separated from plasmid DNA by agarose gel electrophoresis before injection. The eggs were injected and transferred to pseudopregnant foster mothers (Brins er et al . , 1985, Proc. Natl. Acad. Sci. USA 82: 4438-4442) and transgenic progeny were identified by Southern blot hybridization of tail DNA. Similarly, large animal eggs can be injected with the same constructs and transferred to foster mothers as described by Pur-.ciel et al . (1989, Science 244: 1281-1288) .

Typically, human α- and β-globin genes were cloned into expression vectors designed to direct high levels of α- and β-globin synthesis in erythroid cells of transgenic animals. These constructs were coinjected into fertilized mouse eggs and expression was analyzed in transgenic animals that developed. All of the mice that contained intact copies of the transgenes expressed correctly initiated human α- and β-globin mRNA specifically in erythroid tissue. Isolectric focusing of hemolysates demonstrated that a complete human hemoglobin was formed in adult erythrocytes and oxygen equilibrium curves of human hemoglobin purified from these mice demonstrated that the molecule was fully functional. The animals are healthy and faithfully transmit the human genes to progeny. These animals have been bred for over 20 generations and the progeny continue to synthesize equal amounts of human and mouse hemoglobins .

It is pointed out that similar methodology can be used to produce functional (capable of efficiently delivering oxygen to tissues) human hemoglobin in large animals, such as pigs, sheep, goats, cows and the like. Analysis of Blood from Transgenic Animals

Blood collected from transgenic animals is washed with saline and hemolysates prepared as described by Ryan e±__al., 1990, Science 245: 971-973. Hemoglobin is analyzed on isoelectric focusing (IEF) gels (Ryan et al . , 1990, supra) . Human hemoglobin bands are excised from IEF gels and analyzed on urea cellulose acetate strips to demonstrate that the human hemoglobin band is composed of human α- and β-globin polypeptides. It is noted that if human hemoglobin is difficult to separate from endogenous hemoglobins, mutations that increase or decrease the isoelectric point (pi) of human hemoglobin can be introduced into the α- and β-globin genes. Increases in pi are accomplished by introducing basic (positively charged) amino acids into the protein and decreases are accomplished by introducing acidic (negatively charged) amino acids. These charged amino acids are introduced at positions which do not disturb the structure or function of the protein. Oxygen equilibrium curves of purified hemoglobin are then determined as described by Ryan_e_t al. (1990, supra) .

Formation of Disulfide Crosslinks

Disulfide crosslinks in proteins are not easily formed inside erythrocytes because high concentrations of glutathione prevent oxidation (Tondo et al . , 1985 aupra) . Both intramolecular and intermolecular disulfide crosslinks are formed after human hemoglobin is purified by isoelectric focusing as described above. Large scale purifications are accomplished by chromatofocusing (G ri, 1990, Methods. Enzymol., 182: 380-392) which also separates proteins according to their isoelectric focusing points. Purified human hemoglobin is then incubated for several days at 4°C in slightly alkaline conditions (0.1 M Tris-HCL pH 8.0; Matsumura et al . , 1989, Proc. Natl. Acad. Sci. USA 86: 6562-6566) to gently oxidize the protein without oxidizing heme groups. Crosslinked hemoglobins are dialysed into phosphate buffered saline at pH 7.5 by tangential flow ultrafiltration (Shiloash et al . , 1988, Adv. Biotechnol . Processes 8: 97-125) against membranes which retain polymers greater than 100,000 MW. These purified proteins are then analyzed on reducing and non-reducing polyacrylamide gels. Also, the oxygen equilibrium curves of these samples are obtained. Finally, the hemoglobins are tested for oxygen carrying capacity in animals following standard procedures well known in the art .

It is noted that since the transgenically produced human hemoglobin of the present invention is isolated in substantially pure form free of any cellular or subcellular component, it is non-immunogenic; hence, useful as a blood-substitute without the need for blood typing which becomes necessary if the whole blood or red blood cells (RBCs) are to be used. In addition, being of animal origin, the transgenic hemoglobin of the present invention would also be free of such viruses as HIV. A composition in accordance with the present invention comprises a biologically functional amount (i.e., capable of effective oxygen exchange with the tissues) or a blood substituting amount of the substantially pure transgenic human hemoglobin and a pharmaceutically acceptable vehicle such as physiological saline; non-toxic, sterile buffered medium; human plasma and the like.

The availability of the substantially pure, cell- free, non-immunogenic, biologically functional, non- toxic, polymeric, transgenic human hemoglobin of the present invention now provides a method for supplementing the oxygen exchange capacity of the red blood cells

(RBCs) by substituting the RBCs or the naturally occurring (wild type) whole blood with the purified transgenic hemoglobin of the present invention. The recombinant hemoglobin of the present invention is particularly suitable, at least as a temporary substitute, for providing oxygen to tissues during critical times, such as during emergency surgery or until whole blood transfusions can be given, or for entirely obviating the need for whole blood transfusions. Of course, it can also be employed for organ perfusion and the like.

Production of Transgenic Kansas/Porto Alegre Hemoglobin

Kansas and Porto Alegre mutations were introduced into the beta chain of human hemoglobin and expression constructs were produced as described above. These expression constructs were introduced into mice also as described above to produce transgenic animals expressing this mutant hemoglobin. Each chain of the human and mouse hemoglobins is expressed and is stable in vivo. Standard hemoglobin isolation from the animals followed by anion exchange high performance liquid chromatography under denaturing conditions was carried out. The HPLC chromatogram demonstrates that 34% of the total β-globin content of the animals is human Kansas/Porto Alegre β- globin, and 41% of the total α-globin is human α-globin. Figure 7 depicts an oxygen affinity curve (generated by standard techniques) from the blood of the Kansas/Porto Alegre mice (i.e., 40% human/60% mouse hemoglobin) . The total hemoglobin in Kansas/Porto Alegre transgenic mice exhibits a P₅₀ of 23.5 mm Hg. This value may be compared to normal mouse hemoglobin (13 mm Hg) , Porto Alegre hemoglobin (6 mm Hg) , Kansas hemoglobin (36 mm Hg) , and normal human hemoglobin (10 mm Hg) under similar conditions (0.1 M phosphate, pH 7.0; 20°C) . Under physiological conditions, the presence of 2,3- diphosphoglycerate (DPG) in intact red blood cells raises the P_s0 of normal human hemoglobin to 25. The cell-free homoglobin used for a blood substitute will function in the low DPG environment of the serum. Therefore, the P_so of genetically modified hemoglobin should be in the range of 25-35. Both the P₅₀ of the transgenic Kansas/Porto Alegre hemoglobin and the fact that viable transgenic offspring are produced indicates that this mutant hemoglobin properly binds oxygen and delivers it to tissues, and thus is functional in vivo.

VII . Anti-Sickling Hemoglobins

The molecular basis for sickle cell disease is an A to T transversion in the 6th codon of the human β- globin gene. This simple transversion changes a polar glutamic acid residue to a non-polar valine (Ingram et al . , Nature 178:792, 1956; Ingram et al . , Nature 180:326, 1957) in the β-globin polypeptide and, thus, drastically decreases the solubility of this hemoglobin (termed Hb S) .

Anti-Sickling β-globin Genes Designed to Inhibit Hb S Polymerization

Recombinant hemoglobins of the invention which contain anti-sickling mutations can be used to inhibit Hb S polymerization, and thus facilitate therapies for sickle cell anemia. In particular, the glutamic acid to valine change at the 6th position of the β^s polypeptide creates a non-polar surface that readily interacts with a O 97/32978 PCΪYUS97/03896

- 33 - natural hydrophobic pocket in the β chain of a second tetramer. This natural pocket is formed primarily by a phenylalanine (phe) at position 85 and a leucine (leu) at position 88. This interaction leads to the formation of the complex 14-stranded fibers described above (Bunn et al . , Hemoglobin: Molecular, Genetic, and Clinical AspecJ:_s, 1986, W.B. Saunders, Philadelphia) .

The structure of the fiber that forms in sickle erythrocytes was derived from X-ray diffraction studies of Hb S crystals (Edelstein, J. Mol . Biol. 150:557, 1981) . Hb S tetramers are composed of two α-globin subunits (α₂) and two β^ε-globin subunits (β^s ₂) , and form characteristic double stranded fibers. Interactions along the long axis of the fiber are termed axial contacts, while interactions along the sides of tetramers are lateral contacts (Bunn et al . , Hemoglobin: Molecular, Genetic, and Clinical Aspects. (W.B. Saunders, Philadelphia, 1986) ) . The β6 valine plays a critical role in the lateral contact by interacting with the hydrophobic residues β85 phenylalanine and β88 leucine. Accordingly, to interfere with detrimental Hb S polymerization, this interaction and, thus, hydrophobic pocket formation should be disrupted. Because Hb A (α₂β₂) has these same hydrophobic residues and is readily incorporated into sickle fibers, it cannot be used for this purpose. Moreover, although disruption of this pocket represents the best approach for inhibiting Hb S polymerization, certain strategies have detrimental side effects. For example, although amino acid substitutions at β85 phe and β88 leu would interfere with pocket formation, these amino acids are also important for correct positioning of the heme moiety, and cannot be mutated without severely altering oxygen affinity (Dickerson et al . , Hemoglobin: Structure, Function,, Evolution, and,P thology■ (Benj min/Cummings, Menlo Park,

CA, 1983) ) .

A better approach for inhibiting Hb S polymerization is the use of a β87 threonine (thr) to glutamine (gin) substitution that disrupts the hydrophobic pocket, without inhibiting β-globin function (Perutz et al . , Nature 219:902-909, 1968; Computer graphics generated using an Evans and Sutherland PS300 system running the package FRODO (Jones, Meth. Enz. 115:157, 1985)) . The long side chain of glutamine prevents the β6 Val from interacting with the hydrophobic pocket. Human y- and δ-globin polypeptides both have such a glutamine at position 87, and both Hb F (α₂γ₂) and Hb A2 (α₂δ₂) have potent anti-sickling activity (Nagel et al., Proc. Natl. Acad. Sci., USA 76 (2) :670-672, 1979) . Another naturally occurring human hemoglobin, designated Hb D Ibadan, also has anti-sickling activity (Watson- Williams et al . , Nature 205:1273, 1965) . This hemoglobin has a lysine at position 87 and its long side chain also projects across the hydrophobic pocket and inhibits interactions with the β6 Val.

Preferably, to produce a recombinant anti-sickling hemoglobin, the mutations described above (which interfere with a major lateral contact) are combined with a second mutation which interferes with an axial contact . One such axial contact-disrupting mutation is as follows. The side chains of the amino acids lysine-17 (lys) , asparagine-19 (asn) , and glutamic acid-22 (glu) project to form a surface which stabilizes the axial contact with another sickle hemoglobin tetramer (Dickerson et al . , H≤JiQ lQbi ; Structure, Function, Evolution, and

Pathology. (Benjamin/Cummings, Menlo Park, CA, 1983) ) . Although mutations at residues 17 or 19 are detrimental, amino acid 22 can be mutated from glutamic acid to alanine (ala) without an alteration in hemoglobin function (Bowman et al . , Biochemical and Biophysical

Research Communications 26 (4) :466-470, 1967; Bunn et al . ,

Hemoglobin: Molecular, Genetic:, and C nical Aspects.

(W.B. Saunders, Philadelphia, 1986)) . The negative charge of the glutamic acid side chain at this position plays a key role in stabilizing the axial contact because it interacts with the positively charged imidazole group of a histidine at position 20 in the α chain of the neighboring tetramer. The shorter nonpolar alanine side chain fails to stabilize this interaction, thus disrupting the axial contacts between sickle hemoglobin tetramers. Hb AS2 contains a glutamine at position 87 together with an alanine at position 22. Hb AS1 has the same β22 alanine and asparagine at β80 is replaced by lysine. This β80 lysine significantly inhibits sickling when present as a single site mutation in Hb A (Nagel et al., Nature 283:832, 1980) . The following 27-mer oligos were used for mutagenesis at the indicated amino acids in β-globin: β22, GTGAACGTGGATGCCGTTGGTGGTGAG (SEQ ID NO: 1) ; β80, GCTCACCTGGACAAGCTCAAGGGCACC (SEQ ID NO: 2) ; β87, GGCACCTTTGCCCAGCTGAGTGAGCTG (SEQ ID NO: 3) . Another anti-sickling mutation in the human β- globin gene useful in the invention is the Hb G Szuhu mutation, a β80 asn to lys mutation which has significant anti-sickling activity (Nagel et al . , Proc. Natl. Acad. Sci. USA 76 (2) :670-672, 1979) , but which does not impair hemoglobin function (Kaufman et al . , Human Heredity 25:60-68, 1975) . This mutation is preferably combined with the β22 glu to ala mutation described above. Alternatively, an α-globin mutation may be utilized to inhibit Hb S polymerization. One example of such an α-globin mutation is provided by the hemoglobin designated Hb Montgomery (Brimhall et al . , Biochim. Biophys. Acta. 379 (1) :28-32, 1975) , which contains an α48 leucine to arginine mutation. The 54 year old patient from which this mutation was isolated was homozygous for β^s, but had no history of painful sickle cell crises, jaundice, leg ulcers, or stroke, and was only mildly anemic (Prchal et al . , Am. J. Med. 86 (2) :232-236, 1989) . Anti-sickling hemoglobin AS3 combines the mutations at β22 and β87, which are present in anti- sickling hemoglobin AS2, with an additional mutation which lowers the oxygen affinity of the recombinant hemoglobin. The goal is to produce an anti-sickling hemoglobin which delivers oxygen to tissues prior to sickle hemoglobin (Hb S) . We have termed this concept "preferential deoxygenation. " If the anti-sickling hemoglobin delivers oxygen preferentially, Hb S will remain oxygenated and, therefore, will not polymerize. The mutation which was selected to lower the oxygen affinity of the anti-sickling hemoglobin is a change from asparagine to lysine at position 108 of the β-globin chain. This is the mutation which is present in the naturally-occurring Hb Presbyterian (Moo-Penn et al . , FEBS Letters 92:53-56, 1978) . Hb AS3 has the following three mutations: (1) β22 glutamic acid to alanine, (2) β87 threonine to glutamine, and (3) βl08 asparagine to lysine.

Two additional anti-sickling hemoglobins, AS4 and AS5, have been made which combine the mutations present in Hb AS2 at β22 and β87, with additional mutations which cause the β-globin subunit to become more negatively charged. In red blood cells, surface charge is a key determinant of the ability of α-globin and β-globin monomers to associate with each other to form dimers (Bunn, Blood 69:1-6, 1987) . The alpha subunit is somewhat positively-charged, while the beta subunit is somewhat negatively-charged. By increasing the negative charge on the β-globin subunit, it is possible to increase its affinity for the α-globin subunit. Introduction of an additional negative charge in the anti-sickling hemoglobin will provide β^AS polypeptides with a competitive advantage for interacting with α- globin polypeptides. Consequently, α₂β^AS ₂ tetramers will form more efficiently than α₂β^s ₂ tetramers. Anti-sickling hemoglobins Hbs AS4 and AS5 combine the mutations present in AS2 with a mutation which increases the negative charge on the β-globin subunit. One mutation which increases the negative charge on the β-globin subunit but which does not affect the normal functioning of the hemoglobin molecule is a change from lysine to glutamic acid at position 95. This mutation occurs naturally and is known as Hb N-Baltimore. The resulting change in charge is -2, since a positively- charged lysine is replaced by a negatively-charged glutamic acid. This change in charge also allows Hb AS4 and Hb S to be distinguished by isoelectric focusing. Hb AS4 has the following three mutations: (1) β22 glutamic acid to alanine, (2) β87 threonine to glutamine, and (3) β95 lysine to glutamic acid. An additional mutation which occurs naturally and which is known to increase the ability of the β-globin subunit to compete for the α-globin subunit is known as Hb J-Baltimore. This mutation consists of a change from glycine to aspartic acid at position 16 of the β-globin subunit. While this mutation adds only one additional negative charge to the β-globin chain (compared to the two negative charges added by the N-Baltimore mutation described above) , the location of the negative charge is significant. In fact, Hb J-Baltimore competes even more effectively than Hb N-Baltimore for the α-globin subunit. Hb AS5 has the following three mutations: (1) βl6 glycine to aspartic acid, (2) β22 glutamic acid to alanine, and (3) β87 threonine to glutamine.

The invention includes anti-sickling hemoglobins that contain any combinations of the individual mutations described above. For example, the βl08, β95, and βl6 mutations may occur either alone, in combination with the β22 mutation, or in combination with the β22 mutation and either the β80 or either of the above-described β87 mutations. Mutagenesis of Human α- and β-globin Genes

Mutations may be introduced into the normal human α- and β-globin genes by site-directed mutagenesis. For example, a 3.8 kb Bglll-EcoRI fragment containing the human α-globin gene or a 4.1 kb Hpal-Xbal fragment containing the human β-globin gene may be cloned into the pSELECT plasmid (Lewis et al . , Nucl. Acids. Res. 18:3439- 3443, 1990; pSELECT is available from the American Type Culture Collection, Rockville, Maryland, ATCC# 68196) using standard methods (see e.g., Maniatis et al . , 1989, Molecular Cloning; A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) . Oligonucleotide mutagenesis is performed, e.g., as described by Lewis et al . (Nucl. Acids. Res. 18:3439- 3443, 1990) . In this procedure, an oligonucleotide which corrects a mutation in the ampicillin resistance gene in the pSELECT plasmid is used simultaneously with one or more oligonucleotides designed to create mutations in the globin gene insert. Briefly, E. coli (JM109; ATCC# 53323) containing the pSELECT plasmid with globin gene inserts are infected with helper phage (M13K07) . After growing the culture overnight (about 12-16 hours) , phage obtained from the supernatant are extracted with phenol :chloroform, and single-stranded DNA is isolated by standard methods. Oliαonucleotides containing each of the mutations are annealed to single-stranded DNA together with the wild- type ampicillin oligonucleotide, and these primers are extended with Klenow for about 90 minutes at 37°C. Double-stranded DNA is transformed into E. coli (BMH 71- 18 mutS) , and the culture is grown overnight in L- broth containing 75 μg/ml ampicillin. DNA obtained from rapid lysis preparations of these cultures is transfected into E. coli (JM109) , and colonies are selected on ampicillin plates (75 μg/ml) . Double-stranded DNA obtained from rapid lysis preparations of these colonies is sequenced (Sanger et al . , Proc. Natl. Acad. Sci. USA 74:5463-5467, 1977) using oligonucleotide primers located upstream of the mutagenic oligonucleotides. Mutants are clearly identified by comparison to wild-type sequence.

Construction of Cosmid Clones

Constructs used for microinjection are as described by Behringer et al . (Science 245:971, 1989) , except that the gene for sickle hemoglobin is replaced with genes encoding anti-sickling hemoglobins. Mutations are introduced into the human β-globin gene by site- specific mutagenesis, as described above, and the mutant sequences are inserted downstream of a 22 kb DNA fragment containing the DNAse hypersensitive sites 1-5 (5¹ HS 1-5) of the β-globin LCR (Lewis et al . , Nucleic Acids Res. 18:3439, 1990) , as described in further detail below.

In order to construct cosmid clones containing mutant α- and β-globin genes, the mutant genes are excised from pSELECT plasmids and subcloned into "right arm" plasmids containing a Cos site. Specifically, a 1.2 kb Ncol-Xbal fragment from the α-globin pSELECT plasmids and a 1.4 kb Clal-BamHI fragment from the β-globin pSELECT plasmids are inserted into right arm plasmids in place of the corresponding α- and β-globin gene wild-type fragments. The α-globin right arm plasmids are digested with Clal and Mlul, and 4.8 kb fragments containing mutant α-globin genes which are linked to Cos sites are purified by agarose gel electrophoresis. The β-globin right arm plasmids are digested with Clal and Hindlll, and 6.5 kb fragments containing mutant β-globin genes which are linked to Cos sites are purified similarly. Cosmids containing these fragments are constructed in four way ligations (Ryan et al . , Genes Dev. 3:314-323, 1989) . The left arms are 9.0 kb Mlul-Sall fragments obtained from the cosmid vector pCVOOl (Lau et al . , Proc. Natl. Acad. Sci. U.S.A. 80:5225-5229, 1983) . This fragment contains a Cos site, an ampicillin resistance gene, a ColEl origin and the SVneo gene. The two internal fragments are a 10.7 kb Sall-Kpnl fragment containing DNase I super-hypersensitive (HS) sites V, IV and III, and a 10.9 kb KpnI-Clal fragment containing HS II and I . The four fragments are ligated together in a 2:1:1:2 molar ratio of vector arms to inserts and packaged (Packagene; Promega, Madison, WI) . E. coli ED8767 is infected with the packaged cosmids and is plated onto ampicillin plates. Large scale cultures of ampicillin resistant colonies are grown, and cosmids are prepared by standard procedures.

Other Embodiments

In addition to targeting and replacing (or knocking out) one gene at a time, both alleles of a gene or multiple genes may be targeted at once, as is known to one skilled in the art (see, e . g. , Ausubel et al . , supra) . In addition, one skilled the art may modulate gene dosage by inserting single or multiple copies of genes in the gene replacement methods described above.

From the above description, one skilled in the art can easily ascertain the essential characteristics of the invention and, without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. All publications cited herein are fully incorporated by reference in their entirety. Other embodiments of the invention are in the claims set forth below.

What is claimed is:

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: The UAB Research Foundation

(ii) TITLE OF INVENTION: PRODUCTION OF HUMAN HEMOGLOBIN IN TRANSGENIC ANIMALS

(iii) NUMBER OF SEQUENCES: 11

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Clark & Elbing LLP

(B) STREET: 585 Commercial Street

(C) CITY: Boston

(D) STATE: MA

(E) COUNTRY: USA

(F) ZIP: 02109-1024

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE:PatentIn Release#l .0,Version #1.30

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: PCT/US97/

(B) FILING DATE: 06-MAR-1997

(C) CLASSIFICATION:

(vi) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: US 08/611,542

(B) FILING DATE: 06-MAR-1996

(C) CLASSIFICATION:

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Elbing Karen Lech; Clark, Paul '

(B) REGISTRATION NUMBER: 35,238; 30,162

(C) REFERENCE/DOCKET NUMBER: 04005/013WO1

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 617/723-6777

(B) TELEFAX: 617/542-8962 ( C ) TELEX :

(2) INFORMATION FOR SEQ ID NO: 1 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 27 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1 :

GCGCACAAGC TTTGCGTGGA CCCGGTC 27

(2) INFORMATION FOR SEQ ID NO:2 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 27 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2 :

CCTTGGACCC AGTGTTTCTT TGAGTCC 27

(2) INFORMATION FOR SEQ ID NO:3 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3 : CGCACGTGGA CTGCATGCCC AACGC 25

(2) INFORMATION FOR SEQ ID NO:4 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 27 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4

CCTGAGGAGA AGTGTGCCGT TACTGCC 27

(2) INFORMATION FOR SEQ ID NO: 5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 27 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5

GTGGATCCTG AGACCTTCAG GGTGAGT 27

(2) INFORMATION FOR SEQ ID NO:6 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 27 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6 : CAAACAGACA CCATGCTGAC TCCTGAG 27

(2) INFORMATION FOR SEQ ID NO: 7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7

ATGGTGCACC TGACT 15

(2) INFORMATION FOR SEQ ID NO: 8 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 4 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: not relevant

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8 :

Met Val His Leu

1

(2) INFORMATION FOR SEQ ID NO:9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 27 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: GTGAACGTGG ATGCCGTTGG TGGTGAG 27

(2) INFORMATION FOR SEQ ID NO: 10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 27 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10

GCTCACCTGG ACAAGCTCAA GGGCACC 27

(2) INFORMATION FOR SEQ ID NO: 11:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 27 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11:

GGCACCTTTG CCCAGCTGAG TGAGCTG 27

Claims

1. A transgenic non-human mammal for use in producing human hemoglobin for use as a human blood substitute, said transgenic non-human mammal comprising erythrocytes which produce at least one chain of said human hemoglobin, but which fail to produce at least one hemoglobin chain endogenous to said non-human mammal .

2. The transgenic non-human mammal of claim 1, wherein said erythrocyte produces a human α-globin chain.

3. The transgenic non-human mammal of claim 1, wherein said erythrocyte produces a human β-globin chain.

4. The transgenic non-human mammal of claim 2 , wherein said erythrocyte produces two human α-globin chains.

5. The transgenic non-human mammal of claim 3, wherein said erythrocyte produces two human β-globin chains.

6. The transgenic non-human mammal of claim 1, wherein said erythrocyte produces one human α-globin chain and one human β-globin chain.

7. The transgenic non-human mammal of claim 1, wherein said erythrocyte produces two human α-globin chains and two human β-globin chains.

8. The transgenic non-human mammal of claim 1, wherein said erythrocyte fails to produce an α-globin chain endogenous to said non-human mammal .

9. The transgenic non-human mammal of claim 1, wherein said erythrocyte fails to produce a β-globin chain endogenous to said non-human mammal.

10. The transgenic non-human mammal of claim 1, wherein said erythrocyte fails to produce any α-globin or β-globin chains endogenous to said non-human mammal.

11. The transgenic non-human mammal of claim 1, wherein said erythrocyte produces two human α-globin chains and two human β-globin chains, but fails to produce any α-globin or β-globin chains endogenous to said non-human mammal.

12. The transgenic non-human mammal of claim 1, wherein said transgenic non-human mammal is a mouse.

13. The transgenic non-human mammal of claim 1, wherein said human hemoglobin is hemoglobin A.

14. The transgenic non-human mammal of claim 1, wherein said human hemoglobin is hemoglobin Kansas-Porta

Alegre.

15. A method of producing human hemoglobin, said method comprising expressing said human hemoglobin in the erythrocytes of the transgenic non-human mammal of claim 1.

16. Human hemoglobin produced by the method of claim 15.