WO1997032605A1 - Acides nucleiques de cytomegalovirus codant pour des proteines ayant une liaison mhc de classe i normale ou modifiee et utilises dans le traitement de certaines maladies - Google Patents

Acides nucleiques de cytomegalovirus codant pour des proteines ayant une liaison mhc de classe i normale ou modifiee et utilises dans le traitement de certaines maladies Download PDF

Info

Publication number
WO1997032605A1
WO1997032605A1 PCT/US1997/003606 US9703606W WO9732605A1 WO 1997032605 A1 WO1997032605 A1 WO 1997032605A1 US 9703606 W US9703606 W US 9703606W WO 9732605 A1 WO9732605 A1 WO 9732605A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
nucleic acid
class
binding domain
mhc
Prior art date
Application number
PCT/US1997/003606
Other languages
English (en)
Inventor
Hidde L. Ploegh
Emmanuel J. H. J. Wiertz
Original Assignee
Massachusetts Institute Of Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Massachusetts Institute Of Technology filed Critical Massachusetts Institute Of Technology
Publication of WO1997032605A1 publication Critical patent/WO1997032605A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16111—Cytomegalovirus, e.g. human herpesvirus 5
    • C12N2710/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • the present invention relates to recombinant human cytomegalovirus nucleic acids having various binding domains for different targets, and methods for using such constructs for treating diseases.
  • T lymphocytes have antigen-binding molecules on their cell surface called T-cell receptors that react with antigens on the surface of other cells. These T cells recognize other cells that display foreign antigens on their surfaces and kill the cells.
  • T cell can target a virus- infected cell that displays fragments of a viral glycoprotein on its surface that is bound to a cellular protein called class I MHC (major histocompatibility complex).
  • class I MHC major histocompatibility complex
  • the peptide that becomes part of the complex of foreign peptide and class I MHC molecule is derived from a protein that is first degraded and then released so as to become tightly bound to the MHC molecule.
  • Class I MHC binds peptides from intracellular proteins, e.g., peptides from viral proteins made in a virus-infected cell.
  • the T cells functioning in this way, thus are a principal immunologic defense mechanism against viruses.
  • proteasome and transporter in antigen processing (TAP) genes are involved in the cytosolic proteolysis of the viral proteins and the delivery of the resulting peptides to the endoplasmic reticulum (ER), the exocytotic pathway, where they can associate with newly synthesized chains of class I MHC molecules.
  • Certain viruses have evolved mechanisms which can manipulate the expression of the class I MHC gene products, so as to down-regulate such products, either by transcriptional or post-transcriptional mechanisms. It has been reported that in adenovirus infected cells, viral proteins are produced which retain the newly synthesized class I MHC molecules in the ER and thus prevent the MHC molecules from reaching the cell surface. It has also been reported that Herpes simplex viruses 1 and 2 produce a protein that blocks class I MHC cell surface expression by inactivating the TAP peptide transporter. This inactivation prevents access of the ⁇ ytosolic peptides to the ER, and thus prevents stable assembly of class I MHC molecules and their expression at the cell surface.
  • a recombinant human cytomegalovirus nucleic acid encoding a US11 protein or a US2 protein which lacks a functional first binding domain for class I MHC and which has a second binding domain for a target
  • the target can be a viral protein, e.g., HIV GP20, an oncogenic element, e.g., a mutant form of Neu, an integrin, a selectin, a ligand, a receptor, a cytokine, a hormone, an antibody, an antigen, an enzyme, an enzyme substrate or a harmful agent.
  • Another aspect of the invention is a substantially pure protein encoded by the recombinant nucleic acid described above.
  • Another aspect of the invention is a recombinant vector comprising the recombinant nucleic acid described above.
  • Another aspect of the invention is a recombinant HCMV mutant comprising a genome which lacks a first nucleic acid sequence encoding a functional first binding domain for class I MHC, and which has a second nucleic acid sequence encoding a second binding domain for a target.
  • the first nucleic acid sequence is gene USll, gene US2, or portions thereof.
  • Another aspect of the invention is a method for degrading a first protein.
  • a mammal having cells which have a cytosol is provided.
  • a recombinant nucleic acid encoding a second protein, US11 or US2, which lacks a functional binding domain for class I MHC and which has a second binding domain for a target on the first protein is provided.
  • the recombinant nucleic acid is administered to the mammal under conditions which allow the second protein to interact with the first protein such that the first protein is degraded in the cytosol.
  • Mammal is meant to include human and non-human mammals.
  • a mammal having a disease e.g., a viral infection, a bacterial infection, a malignancy, an autoimmune disease, or a transplant graft rejection
  • a recombinant nucleic acid encoding an HCMV US11 or US2 protein which lacks a functional first binding domain for class I MHC and which has a second binding domain for a target, e.g., HIV GP120 or class II MHC, is provided.
  • the recombinant nucleic acid is administered, e.g., in a virus vector or in a non-infectious form, to the mammal in a therapeutically effective amount such that treatment of the disease occurs.
  • Another aspect of the invention is a vaccine composition for treating a disease comprising a therapeutically effective amount of a recombinant nucleic acid encoding HCMV US11 or US2 which lacks a functional first binding domain for class I MHC and which has a second binding domain for a target, and a pharmaceutically acceptable carrier.
  • the vaccine has an adjuvant and/or other therapeutic agents.
  • a pharmaceutical composition for treating a disease comprising a therapeutically effective amount of a recombinant nucleic acid encoding HCMV US11 or US2 which lacks a functional first binding domain for class I MHC and which has a second binding domain for a target, and a pharmaceutically acceptable carrier.
  • Another aspect of the invention is a method for degrading class I MHC so as to treat an autoimmune disease.
  • a mammal having an autoimmune disease e.g., ankylosing spondylitis
  • the mammal has cells capable of synthesizing class I MHC.
  • a recombinant nucleic acid encoding HCMV US11 protein, US2 protein, or functional portions thereof, is provided.
  • a therapeutically effective amount of the recombinant nucleic acid is administered to the mammal so as to degrade class I MHC such that treatment of the autoimmune disease occurs.
  • Another aspect of the invention is a vaccine composition for treating an autoimmune disease comprising a therapeutically effective amount of a recombinant nucleic acid encoding HCMV USll protein, US2 protein, or functional portions thereof, and a pharmaceutically acceptable carrier.
  • the vaccine also has an adjuvant and/or other therapeutic agents.
  • Another aspect of the invention is a pharmaceutical composition for treating an autoimmune disease comprising a therapeutically effective amount of a recombinant nucleic acid encoding HCMV USll protein, US2 protein, or functional portions thereof, and a pharmaceutically acceptable carrier.
  • Another aspect of the invention is a method for degrading class I MHC so as to treat tissue graft rejection.
  • a mammal having a tissue graft is provided.
  • a recombinant nucleic acid encoding HCMV USll protein, US2 protein, or functional portions thereof, is provided.
  • a therapeutically effective amount of the recombinant nucleic acid is administered to the mammal so as to degrade class I MHC such that treatment of the tissue graft rejection occurs.
  • Another aspect of the invention is a method for degrading a first protein.
  • a mammal having cells, the cells having a cytosol is provided.
  • a recombinant nucleic acid encoding a second protein, USll, US2 or functional portions thereof, which has a binding domain that is capable of interacting with the first protein is provided.
  • the recombinant nucleic acid is administered to the mammal under conditions which allow the second protein to interact with the first protein such that the first protein is degraded in the cytosol.
  • FIG. 1 depicts an influenza hemagglutinin tag with flanking sequences and restriction sites.
  • This invention provides a recombinant human cytomegalovirus nucleic acid encoding a USll protein or a US2 protein which lacks a functional first binding domain for class I MHC and which has a second binding domain for a target.
  • USll and US2 are human cytomegalovirus (HCMV) genes. Chee et al., Curr. Top. Microbiol. Immunol. 154: 125-169 (1990); EMBL Gene Bank Database Accession No. X17403. USll encodes an endoplasmic reticulum (ER) resident type-I transmembrane glycoprotein.
  • ER endoplasmic reticulum
  • a USll or US2 protein is meant to include a protein with greater than about 60%, 70%, 80%, 90%, 95%, 98%, or 99% homology with the native USll or US2 protein, respectively.
  • USll and US2 proteins each target newly synthesized class I MHC (major histocompatibility complex) heavy chains in the ER and redirect them to the cytosol.
  • the class I MHC heavy chains are attacked by N- glycanase which removes the single N-linked glycan and converts the asparagine residues to which the glycan was attached to an aspartic acid.
  • N-glycanase This change is diagnostic of N-glycanase activity, which is localized to the cytosol.
  • the now cytosolic class I MHC molecule is destroyed by rapid proteolysis involving the cytosolic proteasome complex.
  • the USll and US2 proteins each result in down-regulating expression of class I MHC genes. See Examples 1-5.
  • first binding domain for class I MHC is meant the region on the USll or US2 protein which normally interacts with the class I MHC molecule. Interact is meant to include, e.g., bind, complex or associate.
  • first binding domain By lacking a functional first binding domain means that the normal USll or US2 binding domain is altered so that it cannot properly interact with the class I MHC molecule. Such an alteration can result from, e.g., any type of mutation, e.g., a deletion, substitution, duplication, inversion, rearrangement or point mutation.
  • the first binding domain, or a functional portion thereof is deleted.
  • second binding domain is meant a binding domain which is different from the first binding domain.
  • the second binding domain results from altering the first binding domain, e.g., completely replacing the first binding domain with a second binding domain, or partially replacing the first binding domain so as to result in a second binding domain, or fusing the first binding domain or a portion thereof to a different amino acid sequence so as to result in a second binding domain, or deleting a portion of the first binding domain so as to result in a second binding domain, or altering in any other way the first binding domain so as to result in a second binding domain.
  • the second binding domain is in addition to an unaltered or altered first binding domain.
  • the second binding domain has a binding specificity for a different target than the first binding domain.
  • Target is meant to include, e.g., a viral protein, e.g., HIV GP120, an oncogenic element, e.g., a mutant form of Neu, an integrin, a selectin, a ligand, a receptor, a cytokine, a hormone, an antibody, an antigen, an enzyme, an enzyme substrate, and a harmful agent.
  • harmful agent is meant a molecule that harms the cell.
  • the target is class II MHC.
  • the second binding domain can be, e.g., an amino acid sequence capable of heterodimer formation.
  • Second binding domains include, e.g., subunits of an adhesion glycoprotein or a functional portion thereof.
  • functional portion means a portion of the molecule that is able to bind to its target.
  • second binding domains are a specific surface protein, e.g., CD8 or CD4 or functional portions thereof.
  • functional portion means a portion of the molecule that is able to bind to its target.
  • the second binding domain is CD4 or a functional portion thereof, that is capable of interacting with HIV GP120.
  • the second binding domain is a region of the Neu oncogene responsible for homodimer formation.
  • the invention also includes a substantially pure protein encoded by the recombinant nucleic acid described above.
  • the invention also includes a recombinant vector comprising the recombinant nucleic acid described above.
  • recombinant vector is meant a vector having a nucleic acid sequence which is not normally present in the vector.
  • the invention also includes a recombinant HCMV mutant comprising a genome which lacks a first nucleic acid sequence encoding a functional first binding domain for class I MHC, and which has a second nucleic acid sequence encoding a second binding domain for a target.
  • the first nucleic acid sequence is gene USll, gene US2, or portions thereof.
  • the invention also includes a method for degrading a first protein.
  • a mammal having cells which have a cytosol is provided.
  • a recombinant nucleic acid encoding a second protein, USll or US2, which lacks a functional binding domain for class I MHC and which has a second binding domain for a target on the first protein is provided.
  • the recombinant nucleic acid is administered to the mammal under conditions which allow the second protein to interact with the first protein such that the first protein is degraded in the cytosol.
  • Mammal is meant to include human and non-human mammals.
  • the invention also includes a method for treating a disease.
  • a mammal having a disease is provided.
  • a recombinant nucleic acid encoding an HCMV USll or US2 protein which lacks a functional first binding domain for class I MHC and which has a second binding domain for a target is provided.
  • the recombinant nucleic acid is administered to the mammal in a therapeutically effective amount such that treatment of the disease occurs.
  • Disease is meant to include, e.g., a viral infection, a bacterial infection, a malignancy, an autoimmune disease, or a transplant graft rejection.
  • Treating is meant to include, e.g., preventing, treating, reducing the symptoms of, or curing the disease, in certain embodiments, the method is used to treat HIV infection: the second binding domain is CD4 or a functional portion thereof, and the target is HIV GP120.
  • the second binding domain's target is class II MHC
  • this method can thus be used to treat, e.g., an autoimmune disease, e.g., multiple sclerosis (HLA-DR2 linked disease), insulin dependent diabetes mellitus (HLADQw2, HLA- DQw8), rheumatoid arthritis (HLA-DR4), or juvenile rheumatoid arthritis (HLA-DP2, HLA-DR5/DR8), or it can be used, e.g., to treat graft rejection accompanying transplants, e.g., before or after transplantation.
  • HLA-DR2 linked disease multiple sclerosis
  • HLA-DR4 insulin dependent diabetes mellitus
  • HLA-DR4 rheumatoid arthritis
  • HLA-DP2, HLA-DR5/DR8 juvenile rheumatoid arthritis
  • Autoimmunity is a phenomenon in which the host's immune response is turned against its own constituent parts, resulting in pathology.
  • Many human autoimmune diseases are associated with certain alleles of class II MHC products. This association occurs because the structures recognized by T cells, the cells that cause autoimmunity, are complexes comprised of class II MHC molecules and peptides.
  • the polymorphism of class II MHC genes in the human population ensures that genetically distinct individuals will display different MHC products, with unique binding specificities for peptide. Given the involvement of T cells in causing autoimmunity, it follows that certain class II MHC products will predispose for certain types of autoimmunity, while other allelic forms of class II molecules could be protective.
  • autoimmune diseases show strong associations with particular alleles at the HLA-DR and -DQ loci.
  • alleviation of autoimmune symptoms can be brought about by eliminating the offending class II-peptide complexes from the surface of the antigen presenting cells in afflicted tissues or organs by redirecting the specificity of USll or US2, through engineering of its binding domain.
  • therapeutically effective amount is meant that amount which is capable of at least partially preventing or reversing the symptoms of the disease.
  • a therapeutically effective amount can be determined on an individual basis and will be based, at least in part, on consideration of the species of mammal, the mammal's size, the recombinant nucleic acid used, the type of delivery system used and the time of administration relative to the progression of the disease.
  • a therapeutically effective amount can be determined by one of ordinary skill in the art employing such factors and using no more than routine experimentation.
  • the recombinant nucleic acid can be administered to said mammal by any method which allows the recombinant nucleic acid to reach the appropriate cells. These methods include, e.g., injection, infusion, deposition, implantation, oral ingestion or topical administration. Preferably, administration is by injection. injections can be, e.g., intramuscular, intravenous, intradermal, subcutaneous or intraperitoneal.
  • the recombinant nucleic acid can be delivered, e.g., as part of a viral vector, e.g., avipox viruses, such as canary pox or fowl pox, recombinant vacciniavirus, replication-deficient adenovirus strains or poliovirus, or as a non-infectious form, e.g., naked DNA or liposome encapsulated DNA.
  • the virus will be administered by intramuscular injection in a dose range of about 10 s to about 10 10 infectious particles per injection, more preferably in a dose range of about IO 5 to abut 10 ⁇ infectious particles per injection.
  • Single or multiple doses can be administered over a given time period, depending upon the disease, as can be determined by one skilled in the art without undue experimentation.
  • the invention also includes a vaccine composition for treating a disease comprising a therapeutically effective amount of a recombinant nucleic acid encoding HCMV USll or US2 which lacks a functional first binding domain for class I MHC and which has a second binding domain for a target, and a pharmaceutically acceptable carrier.
  • the vaccine also has an adjuvant.
  • the vaccine also has other therapeutic agents.
  • the invention also includes a pharmaceutical composition for treating a disease comprising a therapeutically effective amount of a recombinant nucleic acid encoding HCMV USll or US2 which lacks a functional first binding domain for class I MHC and which has a second binding domain for a target, and a pharmaceutically acceptable carrier.
  • the invention also includes a method for degrading class I MHC so as to treat an autoimmune disease.
  • a mammal having an autoimmune disease is provided.
  • the mammal has cells capable of synthesizing class I MHC.
  • a recombinant nucleic acid encoding HCMV USll protein, US2 protein, or functional portions thereof, is provided.
  • a therapeutically effective amount of recombinant nucleic acid is administered to the mammal so as to degrade class I MHC such that treatment of the autoimmune disease occurs.
  • Any autoimmune disease that is associated with class I MHC can be treated by this method, e.g., ankylosing spondylityis (HLA-B27 linked disease).
  • the invention also includes a pharmaceutical composition for treating an autoimmune disease comprising a therapeutically effective amount of a recombinant nucleic acid encoding HCMV USll protein, US2 protein, or functional portions thereof, and a pharmaceutically acceptable carrier.
  • the invention also includes a method for degrading class I MHC so as to treat tissue graft rejection. A mammal having a tissue graft is provided. A recombinant nucleic acid encoding HCMV USll protein, US2 protein, or functional portions thereof, is provided.
  • a therapeutically effective amount of the recombinant nucleic acid is administered to the mammal so as to degrade class I MHC such that treatment of the tissue graft rejection occurs.
  • Tissue graft rejection can occur e.g., as a result of tissue or organ transplants.
  • administration is accomplished by introducing the recombinant nucleic acid into the graft itself. Administration can be before or after transplantation.
  • administration is by liposome encapsulated nucleic acid.
  • the invention also includes vaccine compositions and pharmaceutical compositions for treating tissue graft rejections.
  • the invention also includes a method for degrading a first protein.
  • a mammal having cells, the cells having a cytosol is provided.
  • a recombinant nucleic acid encoding a second protein, USll, US2 or functional portions thereof, which has a binding domain that is capable of interacting with the first protein is provided.
  • the recombinant nucleic acid is administered to the mammal under conditions which allow the second protein to interact with the first protein such that the first protein is degraded in the cytosol.
  • This invention is also meant to include similar constructs and methods for the other human cytomegalovirus Unique Short genes, USl and US3-10, as those described above for US2 and USll.
  • Example 2 The Class I Breakdown Intermediate in USll Cells is Resistant to Endoglvcosidase H
  • LnL Leucyl-leucyl-norleucinal
  • ID NO:l derived from the cytoplasmic COOH terminus of human class I molecules still recognized the breakdown intermediate, indicating its COOH terminus was largely, if not entirely, intact.
  • Other modifications of the class I heavy chain were considered, pulse-chase experiments in conjunction with digestion using the enzyme endoglycosidase H (endo H) were performed. Endo H cleaves high mannose-type oligosaccharides as commonly found on ER-resident N-linked glycoproteins.
  • Class I complexes were recovered using the W6/32 antibody from control cells exposed to LLnL or BFA.
  • SDS-polyacrylamide gel electrophoresis failed to distinguish between class I heavy chains deglycosylated using endo H and class I heavy chains isolated from tunicamycin (TM)- treated cells; these differ by the presence of a single GlcNAc residue.
  • TM tunicamycin
  • the possibility of an N-glycanase-type reaction was considered, in which the N-glycosidic bond is hydrolyzed, and the Asn sidechain is converted to an Asp residue (reviewed by Tarentino and Plummer, Meth. Enzymol. 230: 44-57 (1994)). Such conversion should result in a change in isoelectric point of the class I heavy chains.
  • Example 4 The Proteasome Inhibitors Carboxybenzyl-Leucyl-
  • Peptide aldehydes such as LLnL have been widely used as inhibitors of proteases (Sherwood et al., Proc. Natl. Acad. Sci., USA 90: 3353-3357 (1993); Rock et al., Cell 78: 761-771 (1994)).
  • the precise target of inhibition is often difficult to assess, and the rank order of inhibitory potency on purified proteases derived from different sources, such as lysosomal or proteasomal, has been used as a criterion for identification of their intracellular targets (Rock et al.. Cell 78: 761-771 (1994)).
  • LLnL has been described as a calpain I inhibitor
  • the compound carboxybenzyl-leucyl»- leucyl-leucinal (Cbz-LLL) was described as a very potent inhibitor of proteasomes (Rock et al.. Cell 78: 761-771 (1994)).
  • This compound was synthesized using solution chemistry and was found to produce a class I breakdown intermediate indistinguishable from that produced in the presence of LLnL.
  • the antibiotic lactacystin (Fenteany et al..
  • Example 5 Sub ⁇ ellular Fractionation Shows Dislocation of the Class I Heavy Chain from the Microsomal Fraction to the Cytosol
  • the 1000 g pellet contained substantial amounts of class I heavy chains, ⁇ 2 m, calnexin, and transferrin receptor (TfR) .
  • This pellet may contain unbroken cells, and larger cellular debris that may also trap soluble proteins. Therefore, the distribution of the proteins of interest over the 10,000 and 100,000 g pellets and the 100,000 g supernatant were considered to be the more significant parameters.
  • both intact heavy chains and some of the breakdown intermediates were present.
  • an epitope tag influenza HA tag
  • PCR-based standard oligonucleotide directed mutagenesis By introducing an epitope tag (influenza HA tag) in different segments of the USll gene product, to be accomplished using PCR-based standard oligonucleotide directed mutagenesis. the entire USll sequence is scanned, and mutants are identified that carry the epitope tag, but have lost the ability to engage in dislocation.
  • an epitope tagged version of USll is prepared, where the epitope tag (flue HA) is carried at the extreme C-terminus. This arrangement allows production of a series of progressive truncations from the N-terminus inward. Each of these truncation variants is examined for the ability to mediate dislocation of class I molecules.
  • the combination of epitope tag scanning, and truncation analysis identifies the region of USll responsible for interaction with class I molecules. This identification is further narrowed down by site directed mutagenesis. The procedures
  • the epitope tag used is influenza hemagglutinin tag, with amino acid sequence as shown in Figure 1. This sequence is flanked by a number of restriction sites (see Figure 1) that allow facile insertion into a suitable cloning vector. Primers complementary and in frame with the tag, and extended at the 5' end with a sequence complementary to the 3' end of the USll coding sequence are used to allow amplification by PCR of a sequence that translates into a tagged USll open reading frame, where the tag is at the COOH-terminus of USll. This primer has the sequence 5' CCATCCCTATGCGTAGTCTGGTACGTCGTATGGGTAGGCCATTCCGGG CCCCCACTGGTCCGAAAA 3' (Seq.
  • the amplified product are sequences with the desired deletion, to be identified by sequence analysis. These deleted constructs encode a product that contains the cleavable USll signal sequence, but with progressive deletions from the NH2 terminus, and having the HA tag at the COOH terminus. Upon transfection of these deletion mutants, their expression is verified in a metabolic labeling experiment in which the USll mutant product is identified by immunoprecipitation with the anti-HA epitope tag antibody, the effects of the mutant USll products on dislocation of class I molecules are assessed as follows:
  • the effects of the mutant USll products on dislocation of class I molecules is assessed by metabolic labeling of cells transfected with the mutant USll products, followed by the immunoprecipitation of the target molecules, e.g., the MHC class I molecules. Separation of the immunoprecipitates on SDS- polyacrylamide gel or isoelectric focusing gel and visualization by fluoragraphy allows quantitation of the USll-induced degradation of the MHC molecules. Alternatively, steady state levels of the target molecules are determined by immunoblotting of the immunoprecipitated and SDS-PAGE-separate target molecules.
  • the fate of the target molecules is followed in time by pulse-chase analysis: after very short (45-60 seconds) metabolic labeling of the cells transfected with the mutant USll molecules, the cells are chased in the presence of excess non- radioactive amino acids.
  • the half-life of the target molecules in the presence of the USll mutants is established.
  • protease inhibitors such as Carboxybenzyl-Leucyl-Leucyl-Leucinal (Cbz-L3) or lactacystin, both known to inhibit proteasomal degradation, allows the identification of breakdown intermediates.
  • a polyclonal antiserum recognizing multiple epitopes occurring throughout the target molecule are used to detect such breakdown intermediates.
  • Dislocation of the target molecules to the cytosol by the mutant USll molecules is monitored by subcellular fractionation of metabolically labeled transfectants, followed by immunoprecipitation of the target molecules from the subcellular fractions obtained. Again, inclusion of protease inhibitors allows monitoring of both the intact target molecules and degradation intermediates.
  • ADDRESSEE Nutter, McClennen & Fish, LLP
  • STREET One International Place

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention décrit un acide nucléique de cytomégalovirus humain recombinant (HMVC) codant pour une protéine US11 ou US2 à laquelle il manque un premier domaine de liaison fonctionnelle dans un MHC (complexe d'histocompatibilité majeure) de classe I et qui possède un deuxième domaine de liaison pour une autre cible. Les vaccins et procédés permettant de traiter certaines maladies au moyen de telles constructions sont aussi décrits. En outre, le procédé décrit les vaccins et procédés de dégradation du MHC de classe I pour le traitement de certaines maladies auto-immunes lors des rejets de greffe de tissu au moyen de constructions d'acide nucléique recombinant codant pour une protéine US11 ou US2 du HMCV, ou d'autres parties fonctionnelles de celles-ci.
PCT/US1997/003606 1996-03-08 1997-03-06 Acides nucleiques de cytomegalovirus codant pour des proteines ayant une liaison mhc de classe i normale ou modifiee et utilises dans le traitement de certaines maladies WO1997032605A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US1302396P 1996-03-08 1996-03-08
US60/013,023 1996-03-08

Publications (1)

Publication Number Publication Date
WO1997032605A1 true WO1997032605A1 (fr) 1997-09-12

Family

ID=21757916

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1997/003606 WO1997032605A1 (fr) 1996-03-08 1997-03-06 Acides nucleiques de cytomegalovirus codant pour des proteines ayant une liaison mhc de classe i normale ou modifiee et utilises dans le traitement de certaines maladies

Country Status (1)

Country Link
WO (1) WO1997032605A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000046361A1 (fr) * 1999-02-02 2000-08-10 Oregon Health Sciences University Inhibition du chemin de presentation de l'antigene du complexe majeur d'histocompatibilite de classe ii et presentation aux cellules cd4+
WO2007129093A3 (fr) * 2006-05-09 2008-01-03 Univ Birmingham Thérapie à base de peptides

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996004384A1 (fr) * 1994-07-29 1996-02-15 American Cyanamid Company Identification d'un gene de cytomegalovirus humain implique dans la regulation vers le bas de l'expression des chaines lourdes de classe i du complexe majeur d'histocompatibilite

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996004384A1 (fr) * 1994-07-29 1996-02-15 American Cyanamid Company Identification d'un gene de cytomegalovirus humain implique dans la regulation vers le bas de l'expression des chaines lourdes de classe i du complexe majeur d'histocompatibilite
WO1996004383A1 (fr) * 1994-07-29 1996-02-15 American Cyanamid Company Identification d'une region du gene du cytomegalovirus humain (hcmv), jouant un role dans la retroregulation de l'expression des chaines lourdes des mhc de classe i

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CELL, 20 May 1994, Vol. 77, YORK et al., "A Cytosolic Herpes Simplex Virus Protein Inhibits Antigen Presentation to CD8+ T Lymphocytes", pages 525-535. *
J. EXP. MED., 20 January 1997, Vol. 185, No. 2, MacHOLD et al., "The HCMV Gene Products US11 and US2 Differ in Their Ability to Attack Allelic Forms of Murine Major Histocompatibility Complex (MHC) Class I Heavy Chains", pages 363-366. *
PROC. NATL. ACAD. SCI. U.S.A., October 1996, Vol. 93, JONES et al., "Human Cytomegalovirus US3 Impairs Transport and Maturation of Major Histocompatibility Complex Class I Heavy Chains", pages 11327-11333. *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000046361A1 (fr) * 1999-02-02 2000-08-10 Oregon Health Sciences University Inhibition du chemin de presentation de l'antigene du complexe majeur d'histocompatibilite de classe ii et presentation aux cellules cd4+
WO2007129093A3 (fr) * 2006-05-09 2008-01-03 Univ Birmingham Thérapie à base de peptides
EP2436394A1 (fr) * 2006-05-09 2012-04-04 The University of Birmingham Thérapie par peptides
US8715680B2 (en) 2006-05-09 2014-05-06 The University Of Birmingham HLA peptide therapy

Similar Documents

Publication Publication Date Title
Demotz et al. Delineation of several DR-restricted tetanus toxin T cell epitopes.
EP1432441B1 (fr) Utilisation de hmgb1 pour l'activation de cellules dendritiques
EP0671926B1 (fr) Peptides immunomodulateurs
JP4391232B2 (ja) Ｗｔ１特異的免疫療法のための組成物および方法
US5550214A (en) Isolated antigenic oncogene peptide fragments and uses
US6696061B1 (en) Immunomodulatory peptides
AU2002341266A1 (en) Use of HMGB1 for the activation of dendritic cells
CN1537164A (zh) 治疗和诊断Her-2/neu相关恶性肿瘤的组合物和方法
WO1994004171A9 (fr) Peptides immunomodulateurs
EP0914333A1 (fr) Derives de peptides
AU668927B2 (en) Peptides stimulating cytotoxic lymphocytes response to HIV-I GP 160
EP0286447A2 (fr) Méthode et composés pour le traitement prophylactique des maladies autoimmunes
WO1997032605A1 (fr) Acides nucleiques de cytomegalovirus codant pour des proteines ayant une liaison mhc de classe i normale ou modifiee et utilises dans le traitement de certaines maladies
WO1997011966A1 (fr) Polypeptides et leur utilisation dans le traitement et la prophylaxie d'une maladie auto-immune
EP0648836B1 (fr) Transactivateur du complexe majeur d'histomcompatibilité de la classe II et ses utilisations
WO1998023644A1 (fr) Derives de peptides
Persson et al. Adenoviral early glycoprotein E3-19K and its association with transplantation antigens
KR20040018459A (ko) 폴리펩티드 면역원성의 감소방법
EP1066315B1 (fr) Utilisation d'inhibiteurs d'asparaginyl endopeptidase de mammifere pour la modulation du systeme immunitaire
WO1992011289A1 (fr) Formation d'antigene
EP0946589A1 (fr) Inhibiteurs peptides se liant a des proteines cmh de classe ii
EP0674526A1 (fr) Vaccination a l'aide d'un peptide de molecules de classe ii du complexe majeur d'histocompatibilite (mhc) pour le au traitement de maladies autoimmunes
Buschman et al. Genetic Resistance to Coronavirus Infection: A Review
US20210046153A1 (en) Oca-b peptide conjugates and methods of treatment
Braciale et al. T-lymphocyte recognition of a membrane glycoprotein

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): CA JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 97531970

Format of ref document f/p: F

NENP Non-entry into the national phase

Ref country code: CA

122 Ep: pct application non-entry in european phase