WO1997023626A1

WO1997023626A1 - Helicobacter pylori oxidoreductase enzymes and their uses

Info

Publication number: WO1997023626A1
Application number: PCT/GB1996/003119
Authority: WO
Inventors: Peter Andrew Chalk; Christopher Leeson Clayton; David Jacob Kelly; Nicola Jane Hughes
Original assignee: Glaxo Group Limited
Priority date: 1995-12-22
Filing date: 1996-12-17
Publication date: 1997-07-03
Also published as: GB9526407D0; AU1185497A

Abstract

Oxidoreductase enzymes have been identified in H. pylori and can be used to screen for agents effective against H. pylori mediated diseases or disorders.

Description

HELICOBACTER PYLORI OXIDOREDUCTASE ENZYMES AND THEIR USES

The present invention relates to H. pylori .

H. pylori is a micro-organism which has been associated with gastritis and may be involved in ulcers . There has been some success in treating H. pylori related disorders with a combination of anti-secretory agents and antibiotics which are effective against H. pylori .

However, there is a need to identify new agents which are effective against H. pylori . Since there is always the possibility of H. pylori strains developing which are resistant to known therapies.

According to the present invention there is provided a substance:

(i) which is a protein or a subunit thereof having one or more of the amino acid^"sequences shown in Figure 1 or Figure 2 (corresponding to one or more of the four open reading frames indicated therein) ;

(ii) which has one or more amino acid substitutions, deletions or insertions relative to the protein or subunit thereof described in (i) above;

or

(iii) which is a fragment of a substance as defined in (i) or (ii) above.

(The term "subunit" when used herein refers to a part of a protein which can associate with other subunits to give a complete protein. Thus, four subunits may associate to give a tetrameric protein. Individual subunits have their own N-termini and C-termini and generally associate together by non-covalent interactions. Occasionally however covalent bonds (e.g. disulphide bridges) may be present between different subunits of the same protein.

The amino acid sequences shown in Figure 1 and 2 are believed to be sequences of subunits of enzymes having oxidoreductase activity.

These enzymes are believed to be a 2-oxoglutarate: acceptor oxidoreductase (e.g. a 2-oxoglutarate:ferredoxin oxidoreductase) and a pyruvate:flavodoxin oxidoreductase respectively.

They are believed to be important or essential to H. pylori and are not expressed by humans. The substances of the present invention can therefore be used to screen for agents which are active against H. pylori but which are not substantially deleterious to humans.

The present invention is important in identifying substances for use in screening for agents which can be used to treat H. pylori mediated diseases or disorders.

Agents identified using the substances of the present invention may be provided in pharmaceutical compositions which may include a carrier. They may be provided in unit dosage form. Such agents and pharmaceutical compositions are within the scope of the present invention.

In order to prepare such pharmaceutical compositions the agents will normally be provided in substantially pure form. They can then combined with a carrier under sterile conditions.

Preferred substances of the present invention have substantial amino acid sequence identity with one or more of the amino acid sequences shown in Figure 1 or Figure 2.

Desirably there is at least 50% sequence identity, desirably at least 75% sequence identity and more desirably at least 90 or at least 95% sequence identity with one or more of said sequences (determined over the length of the amino acid- sequences shown in Figure 1 or Figure 2) . In some cases the sequence identity may be 99% or above.

The substances of the present invention may be provided in substantially pure form. They may therefore be provided in a form which is free of from one or more proteins which normally occur in __. pylori .

Gene cloning techniques may be used to provide the substances of the present invention in substantially pure form. These techniques are disclosed, for example, in J. Sambrook et al Molecular Cloning 2nd Edition, Cold Spring Harbor Laboratory Press (1989) .

The substances of the present invention can be used to develop vaccines to H. pylori since these substances are believed to include one or more epitopes which are found in H. pylori but are not found in humans. Such substances are therefore useful in targeting H. pylori by providing antigens (including one or more such epitopes) which are not expressed by humans. Preferred vaccines include antigens which are highly specific (and therefore are not expressed by humans or by micro-organisms which are native to the human gastro-intestinal tract) .

A further use of the substances of the present invention is in raising or selecting antibodies. The present invention therefore includes antibodies which bind to one ore more substances of the present invention. Preferred antibodies bind specifically to substances of the present invention. The antibodies may be monoclonal or polyclonal.

Polyclonal antibodies can be raised by stimulating their production in a suitable animal host (e.g. a mouse, rat, guinea pig, rabbit, sheep, goat or monkey) when the substance of the present invention is injected into the animal. If necessary an adjuvant may be administered together with the substance of the present invention. They can then be purified (e.g. by virtue of their binding to a substance of the present invention) .

Monoclonal antibodies can be produced from hybridomas. These can be formed by fusing myeloma cells and spleen cells which produce the desired antibody in order to form an immortal cell line. This is the well known Kohler & Milstein technique (Nature 256 52-55 (1975)) .

Techniques for producing monoclonal and polyclonal antibodies which bind to a particular protein are now well developed in the art. They are discussed in standard immunology textbooks, for example in Roitt et al

{ Immunology, Churchill Livingston, 2nd Edition (1989)) . In addition to whole antibodies, the present invention covers variants thereof which are capable of binding to an epitope present or a substance of the present invention.

The variants may be antibody fragments or synthetic constructs. Examples of antibody fragments and synthetic constructs are given by Dougall et al in TiJ tec 12 372- 379 (September 1994) .

Antibody fragments include Fab and Fv fragments.

Fv fragments can be modified to produce a synthetic construct known as a single chain Fv (scFv) molecule. This includes a peptide linker covalently joining V_H and V_L regions which contribute to the stability of the molecule.

Other synthetic constructs include CDR peptides. These are synthetic peptides comprising antigen binding determinants. Peptide mimetics may also be used. These molecules are usually conformationally restricted organic rings which mimic the structure of a CDR loop and which include antigen-interactive side chains.

Synthetic constructs include chimaeric molecules. Thus, for example, humanised antibodies or derivatives thereof are within the scope of the present invention. An example of a humanised antibody is an antibody having human framework regions, but a rodent or other non-human hypervariable regions. Synthetic constructs also include molecules comprising a covalently linked moiety which provides the molecule with some desirable property in addition to antigen binding. For example the moiety may be a label (e.g. a fluorescent or radioactive label) or a pharmaceutically active agent.

The antibodies or variants thereof of the present invention have a wide variety of uses. They can be used in purification and/or identification of the substances of the present invention. They can be provided in the form of a kit for screening for the substances of the present invention.

These antibodies or variants thereof may be used to provide a patient with passive immunity to a H. pylori mediated disease or disorder.

The present invention also includes within its scope nucleic acids encoding the substances of the present invention, complementary nucleic acids thereto, or nucleic acids hybridising to any of the aforesaid nucleic acids. Preferably these nucleic acid molecules are provided in isolated form or in recombinant form (i.e. combined with one or more heterologous sequences) .

The nucleic acid molecules of the present invention include fragments of any of the nucleic acids discussed above.

The nucleic acid molecules of the present invention may be used as probes for H. pylori . They may also be used as primers. Probes or primers will generally be at least ten, and preferably at least twenty or at least thirty nucleotides long. Preferred probes and primers have a high degree of specificity for H. pylori .

Nucleic acids of the present invention may be used in appropriate expression systems to express the substances of the present invention. Thus they may be expressed from vectors which are present in host cells.

Nucleic acids within the scope of the present invention may also be used as probes for H. pylori (which preferably show a high degree of specificity to H. pylori and which can be incorporated into diagnostic kits) or as primers - e.g. as PCR primers.

A further use of nucleic acid molecules of the present invention is in anti-sense therapy to block or to reduce the expression of one or more of the substances of the present invention in H. -pylori . Since these substances are believed to be important or essential to H. pylori , blocking or reducing their expression can provide an effective way of treating H. pylori mediated diseases or disorders .

The present invention therefore includes pharmaceutical compositions comprising such molecules. These compositions may include a pharmaceutically acceptable carrier. They may be provided in unit dosage form.

Nucleic acid molecules which hybridise to nucleic acids encoding substances of the present invention, or to complementary nucleic acids thereto, preferably do so under stringent hybridisation conditions.

One example of stringent hybridisation conditions which is sometimes used is where attempted hybridisation is carried out at a temperature of from about 35°C to about 65°C using a salt solution which is about 0.9 molar. However, the skilled person will be able to vary such conditions as appropriate in order to take into account variables such as probe length, base composition, type of ions present, etc.

Most preferred nucleic acid molecules of the present invention hybridise to one or more of the four coding nucleic acid sequences shown in Figure 1 or Figure 2 under stringent conditions (or to one or more of the complementary nucleic acid molecules thereto) .

The present invention will now be described by way of example only with reference to the accompanying drawings, wherein:

FIGURE 1 shows the nucleotide sequence which includes four ORFs within a single operon. It also shows the amino acid sequencing encoded by the individual ORFs (which are believed to be sequences of subunits of a 2-oxoglutarate :acceptor oxidoreductase) .

FIGURE la shows the molecular masses of the subunits referred to above in respect of Figure 1 (determined from the amino acid sequences and also determined by SDS PAGE) . It also indicates sequence similarities with known proteins which were found.

FIGURE 2 shows a different nucleotide sequence from that shown in Figure 1, which also includes four ORFs with a single operon. Also shown are the amino acid sequences encoded by the individual ORFs (which are believed to be sequences of subunits of pyruvate : flavodoxin oxidoreductase) . FIGURE 2a shows the molecular masses of the subunits referred to above in respect of Figure 2 (determined from the amino acid sequences and also determined by SDS PAGE) . It also indicates sequence similarities with known proteins which were found.

EXAMPLES

A) IDENTIFICATION OF AN ENZYME AS A PYRUVATE:FERREDOXIN OXIDOREDUCTASE OR A 2-OXOGLUTARATE :ACCEPTOR OXIDOREDUCTASE

A sequence from a H. pylori gene library is set out below:

ATCAAAGAAGCTAAAGCCCTTGTGCGAGAAACCTTCTTTAAGCACTTTTTCTAAT TTTTGAGGGTCTAAAACGCTCTCTCTAGCCACAAAGCTCGCCCCTGCAGCGGTGG TTAAAGCGCATGGGTCAAATTGGTTATCAATATTCCCCCATTGAGCCGTAACCGT CCACATGCCATTAGGGTGGTGGGCGAAGTTTGGGAGTTGTCAAACCATAAATGAA ATTATTCACTAAAATAAAATTCAAATCAATGTTTCTTCTCGATCGATCGATGGTG TGATTGCCTCCAATAGCAAAGCCATCGCCATCACCAGAAACCACGACTACATGCT TACTAGGTTAGCATTTATCCTGCTGCATACGCTACAGCCTACCATCG

This sequence was found to have a significant degree of sequence identity with DNA encoding Halobacteri rn salinarum (formerly H. halobium) pyruvate:ferredoxin oxidoreductase.

Oligonucleotide primers were designed to the ends of this sequence, and used in PCR to amplify a 700bp PFOR probe.

This was then used to detect clones from H. pylori cosmid libraries. This strategy enabled the DNA sequence shown in Figure 1 to be determined.

Figure 1 shows a sequence having four open reading frames which are within a single operon. These open reading frames (ORFs) encode moieties having theoretical approximate molecular masses 12.6 kDa, 41.3 kDa, 30.6 kDa and 20.5 kDa respectively. [The numbering used to identify the open reading frames is based upon the first nucleotide show in Figure 1 being numbered "1" and the following nucleotides being numbered consecutively. This numbering system also applies to the nucleotide sequence shown in Figure 2, which will be discussed later.]

These open reading frames are shown schematically in Figure la, together with the theoretical molecular masses of the moieties encoded by the ORFs, the molecular masses as determined by SDS PAGE, and also indications of proteins having significant sequence identity with the moieties encoded by the ORFs. It can be seen that two of the ORFs (ORF2 and ORF3) encode moieties having significant sequence identity with H. Halobium pyruvate oxidoreductase subunits.

The ORFs illustrated in Figure la are believed to encode four different subunits. A drug resistance cartridge was used to inactivate the coding sequence coding for the largest subunit by insertional inactivation. It was discovered that this inactivation was lethal for H. pylori since no viable transformants showing drug resistance were found. These experiments support the conclusion that the enzyme made up of the relevant subunits is essential for H. pylori . This enzyme could have been either pyruvate:ferredoxin oxidoreductase or an alternative enzyme: a 2-oxoglutarate :acceptor oxidoreductase. In fact it was identified as a 2- oxoglutarate:acceptor oxidoreductase (see Example C) .

B) PYRUVATE:FLAVODOXIN OXIDOREDUCTASE

Another oxidoreductase enzyme was also identified: pyruvate:flavodoxin oxidoreductase (emphasis added). This enzyme was identified as described below:

Pyruvate oxidoreductase activity had been observed in a cell free extract of H. pylori . A protein which had this activity was purified to a sufficient degree to enable N- terminal sequencing to be done.

An N-terminal sequence was then used to design probes to probe H. pylori DNA libraries. This enabled longer stretches of DNA to be identified by hybridisation. Eventually a large DNA sequence was identified by DNA walking techniques.

This sequence is shown in Figure 2. It shows four open reading frames.

These open reading frames (ORFs) encode four moieties of molecular mass 24 kDa, 14 kDa, 47 kDa and 36 kDa respectively as determined by SDS PAGE. The approximate theoretical molecular masses of these moieties were 19.1 kDa, 14.5 kDa, 45.4 kDa and 36.5 kDa respectively (as determined from the sequence data) . These open reading frames are shown schematically in Figure 2a, together with the molecular mass data discussed above and (where appropriate) indications of proteins having significant sequence identity with moieties encoded by the ORFs shown.

In particular it can be seen that two of these moieties (encoded by 0RF3 and ORF4) have degrees of sequence identity with the pyruvate:flavodoxin oxidoreductase of Klebsiella pneumoniae {nifj gene) which were considered to be significant. As was done for the previously described oxidoreductase enzyme (see Example A) , insertional inactivation of the pyruvate: flavodoxin oxidoreductase enzyme was achieved using a drug resistance cartridge to insert into a coding sequence coding for the largest subunit of the enzyme. No viable transformants having drug resistance were found and it was concluded that the pyruvate:flavodoxin oxidoreductase enzyme is also essential for H. pylori .

C) DEMONSTRATION INDICATING THAT THE ENZYME INDICATED IN EXAMPLES A) AND B) AS POSSIBLY BEING A PYRUVATE:

FERREDOXIN OXIDOREDUCTASE IS IN FACT

2-OXOGLUTARATE:ACCEPTOR OXIDOREDUCTASE

A 2-oxoglutarate:acceptor oxidoreductase activity (OOR) was detected in cell extracts of H. pylori . A final preparation containing four major polypeptides was obtained and each of these was N-terminally sequenced. The following results were obtained:

Approximate

Subunit molecular mass N-terminal

(determined by sequence

SDS PAGE)

OorA 46,000 MREIISDGNE

OorB 33,000 AFNYDEYLRV

OorC 21,000 MEAQLRFTGV

OorD 10,000 XKMSAPDGVA

The N-terminal sequences were found to be identical to the N-termini of the predicted translation products of the four-gene operon previously thought to encode a pyruvate -. ferredoxin oxidoreductase in the cases of OorA, OorB and OorC and to be very similar in the case of OorD. It is now concluded that these genes in fact encode a 2-oxoglutarate:acceptor oxidoreductase (which is likely to be 2-oxoglutarate:ferredoxin oxidoreductase). A 2-oxoglutarate:acceptor oxidoreductase enzyme within the scope of the present invention may therefore have one or more sub-units with the N-terminal sequences shown in the table above (although of course different N-terminal sequences can be present, provided that the resultant enzyme still has 2-oxoglutarate:acceptor ferredoxin activity) .

D) ENZYME ASSAYS

Spectrophotometric enzyme assays were routinely performed using a Pye Unicam SP1800 UV spectrophotometer connected to a Servoscribe chart recorder. More detailed spectral analyses were carried out on a Perkin-Elmer Lambda 15 UV- Vis spectrophotometer. All NaH¹⁴C0₃ incorporation assays were counted for 5 min on a LKB1219 Rackbeta liquid scintillation counter.

(i ) Pyruva te : f lavodoxin oxidoreductase (referred to here as PFOR)

PFOR catalyses the reversible decarboxylation of pyruvate to acetyl-CoA in the presence of CoA and the low potential electron acceptor, flavodoxin. In the assays described below the artificial electron acceptor methyl viologen has been used.

(a) Rapid screening method

For rapid identification of PFOR containing purification fractions under essentially aerobic conditions, the following assay was carried out at room temperature in microtitre plates. Each microtitre well contained the following:

enzyme fraction 50-100 μl 500 mM Na-pyruvate 8 μl

10 mM CoA 8 μl

100 mM methyl viologen 8 μl

Active fractions rapidly turned blue, before the reduced methyl viologen was eventually reoxidised by atmospheric oxygen.

(b) Quantitative determination

For the quantitative measurement of rates of methyl viologen reduction, a modified assay of that described by Blarney and Adams (1993) was employed. The standard 2 ml assay contained the following:

CoA 0.1 mM methyl viologen 1 mM

Na-pyruvate 5 mM

MgCl₂ 1 mM

Tris-HCl, pH 8.0 50 mM

The reaction was carried out 3 ml glass cuvettes, adapted to hold the enzyme sample in a separate chamber. The entire unit was bubbled for 1 min with oxygen-free nitrogen, before being inverted to mix the assay buffer and the enzyme sample. The reduction of methyl viologen was followed at 600 nm at 30°C. Results were expressed as units mg^"1 protein, where one unit of activity equals the reduction of 1 μmol methyl viologen min^"1.

The pH optimum for PFOR activity was measured by performing the standard assay in 50 mM Mes/Tris buffer, adjusted to pH values between 5.0 and 10.0. The temperature optimum of the enzyme was measured by pre- equilibrating the enzyme assay buffer at the required temperature for 10 min.

(ii ) Oxoglutarate : acceptor oxidoreductase (referred to here as OOR)

This enzyme carries out the oxidative decarboxylation of 2-oxoglutarate to succinyl-CoA in the presence of CoA and a low potential electron acceptor. In this case, the artificial electron acceptor, methyl viologen, has been used.

(a) Rapid screening technique

The rapid screening technique, used for detecting active purification fractions, was based on a similar method to that described for detection of PFOR activity (Example D(i)) . Each microtitre well contained the following;

Enzyme fraction 100-200 μl

1 M 2-oxoglutarate 2 μl

1 M Methyl viologen 1 μl 100 mM CoA 1 μl

As this enzyme activity was relatively low in comparison to PFOR, and also appeared to be rather more intolerant of oxygen, the assay mixture was coated with a layer of mineral oil after the addition of enzyme. This aided in the exclusion of oxygen from the enzyme and stabilised the methyl viologen colour change. (b) Quantitative method

The quantitative assay for 00R was carried out employing an identical method to that described for PFOR (Example Dl) , replacing 5 mM pyruvate with 5 mM 2-oxoglutarate.

E) PURIFICATION TECHNIQUES

(i ) Purifi ca tion of H. wlori PFOR

For large scale PFOR purification, 14 g (wet weight) of

H. pylori NCTC 11637 cells previously harvested and stored at -70°C, were resuspended in 10 ml of Buffer A

(50 mM Tris-HCl, pH 7.4, 1 mM MgCl₂, 1 mM DTT, 10% glycerol) . Cells were broken by sonication (5 cycles of 30 s on, 60 s off, at 12 Amps) . All buffers used during purification were flushed with N₂ and then filtered and degassed. Cell membranes were removed by centrifugation at 4°C for 1 h at 100,000 x g, and the supernatant loaded onto a Mono Q 10/10 column (Pharmacia) previously equilibrated in Buffer A. A flow rate of 4 ml min^"1 was used throughout this procedure. The column was washed with 2 column volumes of Buffer A and PFOR activity eluted with a 0 to 300 mM gradient of NaCl in Buffer A. An aliquot of each fraction was then assayed for PFOR. Pooled peak fractions were diluted with an equal volume of buffer A and loaded onto a 1% 12.7 cm Green A dye affinity column (Amicon) previously equilibrated with buffer A. The column was eluted at a flow rate of 2 ml min^"1 with a linear gradient from 0 M to 1 M NaCl over 9 column volumes. Ammonium sulphate was added to the pooled active fractions to a concentration of 1.5 M, filtered through a 0.2 μM membrane, and loaded onto a Phenyl Superose 5/5 column (Pharmacia) equilibrated in Buffer B (Buffer A containing 1.5 M ammonium sulphate). The column was developed with a decreasing linear ammonium sulphate gradient from 1.5 M to 0 M at a flow rate of 0.5 ml min^"1. Active fractions were concentrated on a Centriprep 10 filter (Amicon) to 0.2 ml, and loaded onto a Superose 12 column (Pharmacia) equilibrated in Buffer A. The column was developed using Buffer A at a low rate of 0.5 ml min^"1. Active fractions were examined by SDS-PAGE.

(ii ) Partial purification of H. pylori OOR

For the small scale purification of H. pylori 2 - oxoglutarate:acceptor oxidoreductase 3.0 g of NCTC 11637 was resuspended in 5 ml 10 mM Tris-HCl, pH 8.0, 1 mM DTT. All buffers were flushed with N₂, filtered and then degassed prior to use. The cells were sonicated (3 cycles of 15 s at 20 A) and ultracentrifuged for 30 min at 100,000 x g at 4°C. The supernatant was then loaded onto a MONO Q Hr5/5 ion exchange column (Pharmacia) pre- equilibrated in 50 mM Tris-HCl, pH 8.0, 1 mM DTT (Buffer A) . The column was washed with Buffer A supplemented with 50 mM Kci for 10 column volumes. The activity was eluted by an increasing linear gradient of KCI from 50 mM to 250 mM over 15 column volumes. The flow rate throughout this step was set at 2 ml min^"1. Fractions containing activity were pooled (approximately 4 ml) and the sample brought up to 1.5 M ammonium sulphate. Any precipitate formed during this step was removed by centrifugation at 14,000 x g for 2 min. The sample was then loaded onto a Phenyl Superose HR5/5 column (Pharmacia) , equilibrated with 1.5 M ammonium sulphate in Buffer A and any unbound protein removed by washing for 5 column volumes. The column was developed using a decreasing linear gradient of ammonium sulphate from 1.5 M to 0.75 M over 30 column volumes. 0.5 ml fractions were collected and assayed for OOR activity.

Claims

1. A substance:

(i) which is a protein or a subunit thereof having one or more of the amino acid sequences shown in Figure 1 or Figure 2;

or

(iii) which is a fragment of a substance as defined in (i) or (ii) above.

2. A substance according to claim 1 which is a protein which has four subunits, which subunits have substantial amino acid sequence identity with the four amino acid sequences shown in Figure 1.

3. A substance according to claim 1 which is a protein which has four subunits, which subunits have substantial amino acid sequence identity with the four amino acid sequences shown in Figure 2.

4. The use of a substance according to any preceding claim to screen for substances active against H. pylori .

5. The use of a substance according to any of claims 1 to 4 to identify an epitope useful in a vaccine against

H . pyi ori .

6. The use of a substance according to any of claims 1 to 3 to raise or select antibodies against H. pylori

7. A method of treating an H. pylori-mediated disease or disorder comprising providing a patient with a pharmaceutically effective amount of an agent which has been identified by screening with a substance according to any of claims 1 to 3.

8. A method of immunising a patient against H. pylori comprising providing a patient with a pharmaceutically effective amount of a vaccine comprising an antigen, which antigen includes an epitope which has been identified by screening with a substance according to any of claims 1 to 3.

9. A method of treating an H. pylori mediated disease or disorder comprising administering to a patient a pharmaceutically acceptable inhibitor which is an inhibitor of 2-oxoglutarate:acceptor oxidoreductase, or of pyruvate:flavodoxin oxidoreductase.

10. A nucleic acid molecule:

a) coding for a substance according to any of claims 1 to 3;

b) which is a complementary nucleic acid molecule to a nucleic acid molecule as defined in a) above;

c) which is or a nucleic acid molecule which hybridises to a nucleic acid molecule as defined in a) or b) above;

or d) which is a fragment of a nucleic acid molecule as described in a), b) or c) above.

11. A vector comprising a nucleic acid molecule according to claim 10.

12. A host cell comprising a vector according to claim 11.

13. The use of a vector according to claim 11 or of a host cell according to claim 12 to express a substance according to any of claims 1 to 3.

1 . A diagnostic kit for diagnosing the presence of H. pylori , comprising a nucleic acid molecule according to claim 10 and optionally including instructions for use.

15. The use of a nucleic acid molecule accordmg to claim 10 as a probe for H. pylori .

16. The use of a nucleic acid molecule according to claim 10 as a primer.

17. A method of treating H. pylori mediated diseases or disorders comprising providing to a patient a molecule according to claim 10 in sufficient quantity to block or reduce the expression of a substance according to any of claims 1 to 3.

18. An antibody or a variant thereof which binds to a substance of the present invention.

19. The use of an antibody or a variant thereof according to claim 18 for diagnosing the presence of H. pyl ori .

20. A method of treating an H. pylori mediated disease or disorder comprising providing a patient with a pharmaceutically effective amount of an antibody or a variant thereof according to claim 18.

21. A substance, use, method or nucleic acid molecule substantially as hereinbefore described, with reference to the accompanying example.