WO1997011195A1

WO1997011195A1 - Detection of francisella tularensis using oligonucleotide probes

Info

Publication number: WO1997011195A1
Application number: PCT/GB1996/002262
Authority: WO
Inventors: Mark John Fulop; Dario Lyall Leslie; Richard William Titball
Original assignee: The Secretary Of State For Defence
Priority date: 1995-09-22
Filing date: 1996-09-13
Publication date: 1997-03-27
Also published as: GB9519373D0

Abstract

A method for the detection of Francisella tularensis in clinical samples based on a nested polymerase chain reaction (PCR) for the FopA gene using primers selected from the nucleotide sequences FNA8L (sequence GAGGAGTCTCAATGTACTAAGGTTTGCCC), FNB2L (sequence CACCATTATCCTGGATATTACCAGTGTCAT), FNA7L (sequence CTTGAGTCTTATGTTTCGGCATGTGAATAG) and FNB1L (sequence CCAACTAATTGGTTGTACTGTACAGCGAAG).

Description

DETECTION OF FRANCISELLA TULARENSIS USING OLIGONUCLEOTIDE PROBES

Francisella tularensis is the causative agent of tularemia in man and animals. The species is divided into two subspecies: Francisella tularensis subspecies tularensis (type A) and Francisella tularensis subspecies palaearctica (type B). Type A strains (which are confined to Nearctic regions) cause a more serious disease with higher mortality than that caused by type B strains (which are of Holarctic distribution). The agent is extremely infectious with as few as ten organisms capable of causing disease in humans (See Bell J. 1983. Tularemia. In: Stoenner H. Kaplan W, Torten M, editors. Handbook series in zoonoses. Section A bacterial, rickettsial. and mycotic diseases. New York: Academic press, 161-193.

Current methods of diagnosis are unsatisfactory. The symptoms of tularemia are not pathognomic and the disease is often diagnosed as atypical pneumonia. Blood culture is slow (48 - 72) hours, prone to false negatives, and represents a considerable safety hazard to laboratory workers (Weaver RE, Hollis DG, Bottone EJ, 1985. Gram-negative fermentative bacteria and Francisella tularensis. In: Lennette EH. Balows A, Hausler WJ, Shodomy HJ. editors. Manual of clinical microbiology. 4th ed. Washington D.C. American society for microbiology, 309-329). Measurement ofthe increase in circulating antibody titre in convalescent serum provides important epidemilogical data, but is of little value in the management ofthe disease. Rapid diagnosis is particularly important for tularemia to select the appropriate antibiotic therapy. The organism is naturally resistant to penicillin, and treatment with antibiotics that cannot penetrate cells, such as gentamicin. fail to eliminate the bacteria and relapses of the disease occur (Enderlin G, Morales L, Jacobs RF, Cross JT, 1994. Streptomycin and alternative agents for the treatment of tularemia: review ofthe literature. Clin Infect Dis 19:42-47).

Because Francisella tularensis is highly infectious by the aerosol route and causes severe disease it is recognised as an important biological warfare agent (Spencer RC, Wilcox MH, 1993. Agents of biological warfare. Rev Med Microbiol 4. 138-143.). Therefore there is a military requirement to rapidly identify the organism. ~>

The gene encoding the protein that elicits the dominant antibody response, FopA, has been cloned into Escherichia coli and the nucleotide sequence determined (Leslie DL, Cox J, Lee M. Titball RW. 1993. Analysis of a cloned Francisella tularensis outer membrane protein gene and expression in attenuated Salmonella typhimurium. FEMS MicrobiolLetts 111:33 - 335.). Antibodies to the FopA are always present in human convalescent serum (Bevanger L, Maeland JA, Naess AI, 1989. Competitive enzyme immunoassay for antibodies to a 43,000-molecular-weight Francisella tularensis outer membrane protein for the diagnosis of tularemia. J Clin Microbiol 27:922-926.) and therefore it is well developed in the Francisella genera.

According to this invention a method for the detection ofthe bacterium Francisella tularensis comprises the steps of hybridizing one or more sequence of nucleic acids associated with the bacterium, detecting hybridization products and relating the detection of hybridization products to the presence ofthe bacterium, and is characterised in that the nucleic acid sequence or sequences hybridized is located in the FopA outer membrane protein gene and in that hybridization of one or more sequence of nucleic acids is carried out using one or more primers having a sequence selected from any consecutive 10 or more bases from one or more ofthe nucleotide sequences:

GAGGAGTCTCAATGTACTAAGGTTTGCCC FNA8L

CACCATTATCCTGGATATTACCAGTGTCAT FNB2L

CTTGAGTCTTATGTTTCGGCATGTGAATAG FNA7L

CCAACTAATTGGTTGTACTGTACAGCGAAG FNB 1 L

A preferred embodiment further includes the step of amplifying one or more sequence of nucleic acids associated with the bacterium. In a further preferred embodiment the amplification of one or more sequence is achieved by a polymerase chain reaction.

In a further preferred embodiment the amplification of one or more sequence is achieved by a nested polymerase chain reaction.

The invention will now be described, by way of illustration, with reference to non-limiting examples and the following figures in which figure 1 shows the sensitivity ofthe technique in detecting purified Francisella tularensis DNA in the presence of murine blood and figure 2 shows the sensitivity ofthe technique in detecting purified Francisella tularensis DNA in infected murine blood. Further embodiments will occur to those skilled in the art in light of these.

Bacterial Stains and Culture. Francisella tularensis was grown on blood cysteine glucose agar and modified cysteine partial hydrolysate broth (MCPH). Francisella tularensis used for animal challenge was washed three times in phosphate buffered saline (PBS), re¬ suspended in MCPH broth supplemented with 10% glycerol, and stored in 0.5ml volumes at -70°C.

Preparation of amplifiable DNA from clinical samples.

Method 1 : Spleens were homogenised in 10ml PBS in a Stomacher Lab-Blender Model 80 (Seward Medical, London) for 2 min, the homogenate diluted 1/10, and Gene Releaser added 1 :1. lOμl were subjected to the manufacturers recommended thermal cycle before a standard PCR was completed.

Method 2 (Based on Boom R, Sol CJ, Salimans MM, Jansen CL. Wertheim van Dillen PM, van der Noordaa J, 1990. Rapid and simple method for purification of nucleic acids. J Clin Microbiol 25:495-503.): Organs were homogenised in 2ml L6 buffer (8M guaninidium thyiocyanate. in 0.1M tris-HCl, pH 6.4 containing 44mM EDTA and 2.6% (v/v) Triton X- 100). 100 μl of homogenate were added to a reaction vessel containing 900 μl L6 buffer and 40 μl acidified silica diatoms (Jansen Chimica). The silica diatoms were washed twice with L2 buffer (8M guaninidium thiocyanate, in 0.1 M tris-HCl, pH6.4), twice with ethanol, and once with acetone. The pellets were dried at 56°C. lOOμl distilled water added, and the DNA was eluted from the silica at 56°C for 5 minutes. The reaction vessels were centrifuged and the DNA removed and stored at -70°C. To determine the relative sensitivity ofthe two methods spleen and blood were spiked with various numbers of Francisella tularensis before processing and subjected to PCR.

Challenge. Mice were challenged with a 5 x 10^""1 CFU oi Francisella tularensis Live Vaccine Strain suspended in PBS intraperitoneally. At 24 hour intervals mice were anaesthetized by halothane and blood removed by cardiac puncture. Mice were immediately killed by cervical dislocation and spleens removed. 50μl of blood were plated on to blood cysteine glucose agar.

PCR. PCR was performed using a Perkin-Elmer PE9600 thermocycler. The thermal cycle was 95°C for 15 seconds, 55°C for 15 seconds and 72°C for 30 seconds. A final elongation of 72°C for 10 minutes was followed by storage at 4°C until analysis. For each reaction 20μl of a reaction mixture (1.5μM0 primers, 300μM each dNTP. 4.125mM MgCl₂ and 0.75 U Boehringer Mannheim Taq polymerase in 1.5X Boehringer Mannheim reaction buffer) were added to 1 Oμl DNA sample. For some experiments cosolvents DMSO, foramide or glycerol were added to the PCR master mix (see Rolfs A. Schuller I, Finckh U, Weber-Rolfs I. 1992. Substances affecting PCR: Inhibition or enhancement. In: Anonymous PCR: Clinical diagnostics and research. Berlin: Springer-Verlag, 51-60.). For the first PCR, the following primer pairs were used FNA8L (sequence GAGGAGTCTCAATGTACTAAGGTTTGCCC) and FNB2L (sequence CACCATTATCCTGGATATTACCAGTGTCAT). The inner (nested pair) primers were FNA7L (sequence

CTTGAGTCTTATGTTTCGGCATGTGAATAG)andFNB1Lsequence CCAACTAATTGGTTGTACTGTACAGCGAAG). Detection of PCR Products. PCR products were detected by UV induced fluorescence following electrophoresis through 2% aggarose abd staining by ethidium bromide (see Sambrook J, Fritsch EF, Maniatis T, Molecular cloning, A Laboratory Manual, 1989. 2nd ed. Cold Spring Harbour, NN. Cold Spring Harbour Laboratory Press.).

Specificity of Primers. All primer pairs were tested against a panel of bacterial DΝA comprising :-

Clostridium perfringens type A strain ΝCTC 8237, type B strain ΝCTC 8533, type C strain

ΝCTC 10719. type D strain ΝCTC 8346; Clostridium botulinim undesignated type E strain, undesignated type F strain;

Bacillus subtilis NCTC 10412;

Bacillus cereus strain ΝCTC 9939;

Bacillus anthracis strain Ames;

Vibrio cholera strain ΝCTC 8029, strain ΝCTC 10782;

E. coli Kll strain JM101, strain 08: K87: K88ad:H19;

Psuedomonas aeruginosa strain 606;

Psuedomonas mallei strain ΝCTC 10230;

Psuedomonas psuedomallei strain 4845;

Yersinia pestis strain EV76;

Francisella tularensis strain Schu 4;

Francisella novicida strain ATCC 15482 and murine DΝA.

Specificity of PCR assays. Attempts were made to amplify the FopA targeted sequences from Ing samples of DΝA isolated from Francisella tularensis LVS and HΝ63 and the strains in the bacterial DNA test panel listed in Materials and methods. PCR products ofthe appropriate size were detected from the Francisella derived DNA but not from any ofthe DNA isolated from the control bacteria. No detectable PCR product resulted from murine DNA. Optimization of PCR. The PCR was optimized for a maximum product yield by altering the magnesium ion concentration and the annealing temperature in reactions using purified Francisella tularensis as template. The optimal annealing temperature was 55°C (range tested 45°C to 65°C) and the optimal magnesium ion final concentration was 4.25mM (range tested 1.5mM to 5.5mM).

Sensitivity of PCR Using Pure Culture. Using limiting dilution of viable Francisella tularensis LVS the respective sensitivities of standard and nested PCR were determined. It was found that standard PCR could detect approximately 500 CFU per reaction (equivalent to 5 x IO⁴ CFU/ml) whereas nested PCR detected 1 CFU per reaction (equivalent to 100 CFU/ml).

Sensitivity of PCR from Clinical Samples. Blood and spleen homogenate were spiked with various numbers oϊ Francisella tularensis and processed using both methods 1 and 2 described above. Method 1 required a 10 fold dilution to eliminate PCR inhibition. This resulted in a detection limit of 3 x 10³ CFU per reaction (equivalent to a total bacterial count in the spleen of 3 x IO⁶ CFU). Published data indicates that the total bacterial count in tularemic spleens is frequently lower than 3 x 10⁶ CFU (see Sjostedt A, Sandstrom G, Tarnvik A, 1992. Humoral and cell-mediated immunity in mice to a 17-kilodalton lipoprotein oϊ Francisella tularensis expressed by Salmonella typhimurium. Infect and Immun 60:2855-2862.) and so an altemative method was sought.

Method 2 had a detection limit of 5 x IO² CFU per reaction (equivalent to 5 x IO⁴ CFU spleen total bacterial count). Attempts to improve the detection limit by using cosolvents (glycerol, DMSO and foramide: see Rolfs A, Schuller I, Finckh U. Weber-Rolfs I, 1992. Substances affecting PCR: Inhibition or enhancement. In: Anonymous PCR: Clinical diagnostics and research. Berlin: Springer-Verlag, 51-60) were not successful. Referring to figure 1 Francisella tularensis in ten fold dilutions were added to murine blood and the DNA extracted according to method 2. The DNA was amplified using either standard PCR (lanes A-C) or nested PCR (lanes E-G). Lanes D and H are the respective negative controls. The results showed that detection was further enhanced by using a nested PCR (1 CFU/reaction - equivalent to 1 x IO² CFU/ml). Detection oi Francisella tularensis from Infected Tissues. Nine mice were infected with Francisella tularensis LVS. At 24 hour intervals three mice were killed, their spleens removed and blood samples taken. The infection dose was selected to cause death after 3-4 days. Using method 2 followed by a standard PCR. Francisella tularensis DNA could be detected in five spleens and three blood samples at the height of tularemic infection.

However, using nested PCR, Francisella tularensis could be detected in all three spleens samples and in eight (out of nine) blood samples. The absence of bacteria in the one PCR negative sample was confirmed by blood culturing. Referring to figure 2. lanes B-D relate to 24 hour samples lanes E-G relate to 48 hour samples and lanes H-J relate to 72 hours. Lanes A and K are negative controls. The lowest positive blood culture was 1 CFU/μl. Thus the development of a nested PCR based test has significantly increased the sensitivity previously reported (see Long GW, Oprandy JJ, Narayanan RB, Fortier AH, Porter KR, Nacy CA, 1993. Detection oϊ Francisella tularensis in blood by polymerase chain reaction. J Clin Microbiol 31: 152-154.

Further reductions in the time taken to complete diagnosis are envisaged as PCR technology develops. For example, thermocyclers that can use capillary tubes can significantly reduce the time for this process. Also capillary electrophoresis reduces the time taken to analyse PCR products.

Claims

Claims.

1. A method for the detection ofthe bacterium Francisella tularensis comprising the steps of hybridizing one or more sequence of nucleic acids associated with the bacterium, detecting hybridization products and relating the detection of hybridization products to the presence ofthe bacterium, characterised in that the nucleic acid sequence or sequences hybridized is located in the FopA outer membrane protein gene and in that hybridization of one or more sequence of nucleic acids is carried out using one or more primers having a sequence selected from any consecutive 10 or more bases from one or more ofthe nucleotide sequences:

GAGGAGTCTCAATGTACTAAGGTTTGCCC FNA8L

CACCATTATCCTGGATATTACCAGTGTCAT FNB2L

CTTGAGTCTTATGTTTCGGCATGTGAATAG FNA7L

CCAACTAATTGGTTGTACTGTACAGCGAAG FNB1L

2. The method of claim 1 and further including the step of amplifying one or more sequence of nucleic acids associated with the bacterium.

3. The method of claim 2 where the amplification of one or more sequence is achieved by a polymerase chain reaction.

4. The method of claim 3 where the amplification of one or more sequence is achieved by a nested polymerase chain reaction.

5. An oligonucleotide hybridization probe, transcription primer or specific sequence amplification primer comprising a sequence selected from any 10 or more consecutive bases selected from any ofthe nucleotide sequences:

GAGGAGTCTCAATGTACTAAGGTTTGCCC FNA8L

CACCATTATCCTGGATATTACCAGTGTCAT FNB2L

CTTGAGTCTTATGTTTCGGCATGTGAATAG FNA7L

CCAACTAATTGGTTGTACTGTACAGCGAAG FNB1L