WO1997007667A1 - Ribozymes targetting hiv and siv - Google Patents

Abstract

The present invention provides ribozymes that specifically target sequences in both HIV and SIV RNA. The ribozymes are useful in developing animal models of HIV infection.

Description

Ribozymes Targetting HIV and SIV

This invention was made with Government support under Grant Nos. U19-AI36612-01 and U01-AI30238-05 awarded by the National Institutes of Health. The Government has certain rights in this invention.

FIELD OF THE INVENTION The present invention is directed to methods of treating disease caused by retroviral infection. In particular, it provides ribozymes which specifically target sequences in the genome of human immunodeficiency virus (HIV) and simian immunodeficiency virus (SIV) . The ribozymes are particularly useful in developing animal models for HIV infection in humans. BACKGROUND OF THE INVENTION

The primate lentiviruses, including HIV type 1 (HIV-1) , and type 2 (HIV-2) and SIV are structurally and functionally similar. HIV-1 and HIV-2 are genetically related, antigenically cross reactive, and share a common cellular receptor (CD4) . See, Rosenburg and Fauci (1993) in Fundamental Immunology, Third Edi tion Paul (ed) Raven Press, Ltd., New York) and the references therein for an overview of HIV infection. Due to the pandemic spread of HIV-1 (and increasingly, HIV-2) , an intense world-wide effort to unravel the molecular mechanisms and life cycle of these viruses has been undertaken.

Ribozyme therapeutic agents are of increasing importance in the treatment and prevention of HIV infection. Ribozymes are particularly potent therapeutic agents because (i) as RNA molecules, they are not likely to induce host immunity that eliminates the transduced cells; (ii) although they resemble antisense molecules in their sequence specific recognition of target RNA, their ability to cleave the target RNA catalytically renders them more efficient than simple anti-sense molecules; and (iii) they can potentially cleave both afferent and efferent viral RNA, and therefore inhibit both preintegration and postintegration steps of the virus replication cycle.

T-cell lines and primary lymphocytes transduced with retroviral vectors expressing anti-HIV hairpin ribozymes have been shown to be resistant to exogenous infection with HIV-1 (Yu et al . , (1993) Proc . Natl . Acad. Sci . USA 90, 6340-6344) . Furthermore, macrophages derived from primary CD34⁺ hematopoietic stem/progenitor cells were also resistant to challenge with a macrophage tropic strain of HIV-1 (Yu et al . , (1995) Proc . Natl . Acad. Sci . USA . 92,699-703) .

To obtain regulatory approval and to study the therapeutic effects of ribozymes and other therapies, relevant animal models of HIV infection must be developed. As a result of this need, recent studies have focussed on SIV. SIV^,, and SIV_smm can cause disease in rhesus macaques, pig-tailed macaques, and cynomolgus monkeys (McClure et al. , (1989) Vet Immunol Immunopathol 21, 13-24) . Challenge with a molecular clone of SIV_mac239 results in persistent infection and, subsequently, AIDS in macaque monkeys (Kestler et al . , (1988) Nature 331, 619-22; and Kestler et al . , (1989) J Med Pri atol 18, 305-9) . Recently, a highly pathogenic strain of HIV-2 was found to induce rapid CD4-cell depletion in pig- tailed macaques. The close similarity in the natural course of infection and eventual evidence of disease to HIV-1 infection of humans, combined with the greater accessibility of the macaques (as opposed to chimpanzees, for example) , make the SIV model in macaques extremely useful (Ringler et al . , (1989) Am J Pathol 134, 373-83) .

Despite the many advantages of the macaque system, improved commercial models for studying the pathogenesis of disease are lacking in the art . This invention addresses these and other needs. SUMMARY OF THE INVENTION

The present invention provides ribozymes which specifically target an RNA sequence from HIV and SIV. The targeted sequence is typically encoded by a sequence in the 3' terminal region of HIV and SIV. A preferred sequence is encoded by ATTCAGTCGCTCTGCG, or substantially identical sequences, in both the SIV and HIV genomes. The ribozyme can be any type of ribozyme, but is typically a hairpin ribozyme which specifically targets RNA from HIV and from SIV. A preferred ribozyme is one expressed by p9456t or pMR94s and has a sequence as shown in SEQ. ID. No. 1. The ribozyme can be made synthetically, but is typically expressed by a nucleic acid encoding it. Thus, the invention also provides isolated nucleic acids comprising a sequence encoding the ribozymes of the invention. The nucleic acids will usually comprise an expression cassette containing a promoter sequence operably linked to the sequence encoding the ribozyme. Exemplary expression cassettes are those in p9456t or pMR94s. Promoters suitable for expression include the human tRNA^val promoter and the promoter sequence from the HIV-2_rø LTR.

Since the ribozymes are particularly useful in gene therapy, the nucleic acid is often a retroviral vector, suitable for transducing human or macaque cells. Two suitable vectors are p9456t and pMR94S. The invention further provides cells comprising the nucleotide sequence encoding the ribozyme of the invention. The cell can be, for example, a macaque cell or a human cell . The cell can be in an animal or in a cell culture. Thus, the invention also provides macaques comprising a sequence encoding ribozymes of the invention.

The macaques are useful as animal models to study methods for treating HIV infection in humans. Thus, the invention further provides methods of improving gene therapy for treatment of HIV infection. The methods comprise administering a ribozyme which specifically targets an RNA sequence from HIV and SIV to a macaque; and monitoring SIV replication in the macaque. The macaque may be infected with SIV before or after administration of the ribozyme. The methods may be used, for instance, to study the effects of using CD34⁺ cells transduced with a retroviral vector containing the ribozyme.

DEFINITIONS

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Singleton et aJZ. (1994) Dictionary of Microbiology and Molecular Biology, second edition, John Wiley and Sons (New York) provides one of skill with a general dictionary of many of the terms used in this invention. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described. For purposes of the present invention, the following terms are defined below.

A ribozyme "specifically targets" a nucleic acid (typically an RNA) when the ribozyme cleaves the nucleic acid between two particular nucleotides in the nucleic acid. Thus, a ribozyme "specifically targets an RNA" when the ribozyme cleaves that RNA between 2 particular nucleotides found in a target subsequence within the RNA. The particular nucleotides found at the ribozyme cleavage site are defined with reference to the overall nucleic acid sequence, i . e . , the target subsequence within which the cleavage site is found relative to the whole nucleic acid. Ordinarily, the ribozyme recognizes the cleavage site by hybridizing to the nucleic acids in the region of the cleavage site, i . e . , by forming a duplex nucleic acid with nucleic acids in the target subsequence of the cleavage site to align the ribozyme with the RNA substrate during the cleavage reaction.

An "RNA sequence from HIV and SIV" is an RNA sequence which is conserved between the viral nucleic acids, i . e . , a sequence which is the same, or highly similar between the two viral sequences when the sequences are aligned for maximum similarity. The RNA is part of the viral genome, or encoded by the viral genome. "Viral inhibition" refers to the ability of a ribozyme to inhibit the infection, growth, integration, or replication of a virus in a cell. Inhibition is typically measured by monitoring changes in a cell's viral load (i.e., the number of viruses and/or viral proteins present in the cell, cell culture, or organism) or by monitoring resistance by a call, cell culture, or organism to infection.

The term "identical" in the context of two nucleic acids refers to the residues in the two sequences which are the same when aligned for maximum correspondence.

Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman (1981) Adv. Appl . Math . 2 : 482; by the homology alignment algorithm of Needleman and Wunsch (1970) J. Mol . Biol . 48: 443; by the search for similarity method of Pearson and Lipman (1988) Proc . Natl . Acad . Sci . USA 85: 2444; by computerized implementations of these algorithms

(including, but not limited to CLUSTAL in the PC/Gene program by Intelligenetics, Mountain View, California, GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG) , 575 Science Dr., Madison, Wisconsin, USA) ; the CLUSTAL program is well described by Higgins and Sharp (1988) Gene, 73: 237-244 and Higgins and Sharp (1989) CABIOS 5: 151-153; Corpet, et al . (1988) Nucleic Acids Research 16, 10881-90; Huang, et al . (1992) Computer Applications in the Biosciences 8, 155-65, and Pearson, et aJZ . (1994) Methods in Molecular Biology 24, 307-31. Alignment is also often performed by inspection and manual adjustment of the sequences.

The terms "isolated" or "biologically pure" refer to material which is substantially or essentially free from components which normally accompany it as found in its native state. The isolated nucleic acids of this invention do not contain materials normally associated with their in si tu environment, in particular, nuclear, cytosolic or membrane associated proteins or nucleic acids other than those nucleic acids which are indicated. The term "labeled nucleic acid probe" refers to a nucleic acid probe that is bound, either covalently, through a linker, or through ionic, van der Waals or hydrogen "bonds" to a label such that the presence of the probe may be detected by detecting the presence of the label bound to the probe.

The term "label" refers to a composition detectable by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. For example, useful labels include ³²P, ³⁵S, fluorescent dyes, electron-dense reagents, enzymes (e.g., as commonly used in an ELISA) , biotin, dioxigenin, or haptens and proteins for which antisera or monoclonal antibodies are available.

The term "nucleic acid" refers to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited, encompasses known analogues of natural nucleotides that hybridize to nucleic acids in manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence includes the complementary sequence thereof.

The term "operably linked" refers to functional linkage between a nucleic acid expression control sequence (such as a promoter, or array of transcription factor binding sites) and a second nucleic acid sequence, wherein the expression control sequence directs transcription of the nucleic acid corresponding to the second sequence .

The term "recombinant" when used with reference to a cell indicates that the cell replicates or expresses a nucleic acid, or expresses a peptide or protein encoded by nucleic acid whose origin is exogenous to the cell . Recombinant cells can express genes that are not found within the native (non-recombinant) form of the cell. Recombinant cells can also express genes found in the native form of the cell wherein the genes are re¬ introduced into the cell by artificial means. A "recombinant expression cassette" or simply an "expression cassette" is a nucleic acid construct, generated recombinantly or synthetically, with nucleic acid elements which permit transcription of a particular nucleic acid in a cell . The recombinant expression cassette can be part of a plasmid, virus, or nucleic acid fragment. Typically, the recombinant expression cassette includes a nucleic acid to be transcribed, and a promoter. In some embodiments, the expression cassette also includes, e . g . , an origin of replication, and/or chromosome integration elements ( e . g . , an AAV ITR, or retroviral LTR) .

The term "subsequence" in the context of a particular nucleic acid sequence refers to a region of the nucleic acid equal to or smaller than the specified nucleic acid.

BRIEF DESCRIPTION OF THE DRAWINGS Figure IA is a schematic representation of the retroviral construct, p9456t. Figure IB shows target sequence alignment of various strains of HIV-2 and SIV. Conservation of the chosen consesus target sequence is 100% among all known SIVs, and there exist only a few exceptions for HIV-2.

Figure 2 shows expression of the ribozyme in CEM/174 cells transduced with the retroviral construct and selected for neomycin resistance. Lanes 1 and 2 show the specific expression of the 9456 ribozyme in the CEM/174 cells transduced with p9456t, in the presence and absence of reverse transcriptase; the size of the band was measured in the RT PCR step to be approximately 60 base pairs. Lanes 3 and 4 mimic lanes 1 and 2, but the ribozyme being expressed is 9860, a ribozyme with a slightly different target region in the SIV RNA which was included in the preliminary screening experiments. Lanes 5 and 6 depict 9456 ribozyme expression in pLNL-6 (the parent vector into which the ribozyme cassette has not been cloned) , again in the presence and absence of reverse transcriptase; this latter set was included as an additional negative control . Lanes 7 and 8 also mimic lanes 1 and 2, but the ribozyme being expressed is the U5 leader sequence rz that targets HIV-1 RNA.

Figure 3 shows proliferation of untransduced CEM/174 cells in comparison with cells stably transduced with retroviral vectors. The cells were counted via the Trypan blue exclusion method. Untransduced CEM/174 cells (D) , cells stably expressing pMJT (O) , and cells stably expressing p9456t (•) .

Figure 4 shows inhibition of expression of SIV p26 core antigen protein. Untransduced CEM/174 cells

(O) , cells stably expressing pMJT (O) , and cells stably expressing p9456t (■) were infected with an SIV_mac239 viral stock at an input moi of 0.02. Viral infectivity was monitored for 43 days, the duration of the experiment, via regular sampling of the culture supernatant for subsequent SIV antigen capture test (Coulter) . Figure 5A shows the effect of the stable expression of the 9456 ribozyme on proviral synthesis. Lane M represents the marker dye, which allowed estimation of the size of specific bands; lane 1: virus present in untransduced cells; lane 2: virus present in cells transduced with p9456t; lane 3: virus present in cells transduced with pMJT; lane 4: as in lane 1, virus present in untransduced cells.

Figure 5B shows quantification of differences between band intensities via the ratio of densities of PCR products in the cells described in Figure 5A.

Figure 6 shows the sequence and structure of the 9456 ribozyme.

DESCRIPTION OF THE PREFERRED EMBODIMENT

The present invention provides improved models for the study of HIV infection. In particular, the invention provides ribozymes that specifically target sequences in both HIV and SIV. In one class of preferred embodiments, the ribozymes target HIV-2 sequences.

Overlap of HIV-2 sequences with those of SIV isolates provides evidence indicating that HIV-2 infection of humans originated through introduction of these primate lentiviruses through environmental or occupational ( e . g. , hunting, or cooking) exposure (Gao, et al . (1992) Nature 358, 495-9) . Molecular analysis suggests that HIV-2 is more stable than HIV-1 in the human population, implying milder pathogenicity of the virus and introduction into the human population at a time earlier than HIV-1 (Clavel, et al . (1986) Nature, 324, 691-695; Gao, et al . (1992) Nature 358, 495-9; Νaucler, et al . (1991) Aids 5, 301-4; O'Brien, et al . (1991) Aids 5, 85-8; Castro, et al . (1990) Virology 178, 527-34; Kirchhoff, et al . (1990) Aids 4, 847-57; Kuhnel, et al . (1989) Proc . Na tl . Acad . Sci . U. S . A . 86, 2383- 2387; Kumar, et al . (1990) Journal of Virology 64, 890- 901; Zagury, et al . (1988) Proc. Natl . Acad. Sci . U. S.A . 85, 5941-5945; Franchini, et al . (1989) Proc . Natl . Acad . Sci . U. S.A . 86, 2433-2437) . Several HIV-2 isolates, including three molecular clones of HIV-2 (HIV-2_R0D, HIV-2_SBL._Isy, and HIV-

2_UC1) , have been reported to infect macaques (M. mulatta and M. nemestrina) or baboons (Franchini, et al . (1989) Proc . Natl . Acad. Sci . U. S.A . 86, 2433-2437; Barnett, et al . (1993) Journal of Virology 67, 1006-14; Boeri, et al .

(1992) Journal of Virology 66, 4546-50; Castro, et al .

(1991) Virology 184, 219-26; Franchini, et al . (1990)

Journal of Virology 64, 4462-7; Putkonen, et al . (1990) Aids 4, 783-9; Putkonen, et al . (1991) Nature 352, 436- 8) . As human pathogens capable of infection of small primates, HIV-2 molecular clones provide attractive models for studies of AIDS pathogenesis, and for drug and vaccine development against HIV-1 and HIV-2. One notable characteristic of most HIV-2 isolates, in contrast to HIV-1, is their ability to readily infect primary monocyte-macrophages even after extensive passage on T-cell lines (Franchini, et al . (1989) Proc . Natl . Acad. Sci . U. S.A. 86, 2433-2437; Barnett, et al . (1993) Journal of Virology 67, 1006-14; Boeri, et al . (1992) Journal of Virology 66, 4546-50; Castro, et al. (1991) Virology 184, 219-26; Franchini, et al . (1990) Journal of Virology 64, 4462-7; Putkonen, et al . (1990) Aids 4, 783-9; Putkonen, et al . (1991) Nature 352, 436-81; Hattori, et al . (1990) Proc . Natl . Acad. Sci . U. S. A . 87, 8080-4) . HIV-2, like SIV, encodes a vpx gene (Kappes, et al . (1991) Virology 184, 197-209; Marcon, et al . (1991) Journal of Virology 65, 3938-42) , but lacks the vpu gene found in HIV-1. A consequence of the absence of vpu is that the HIV-2 envelope is not expressed as a bicistronic message. Other differences between HIV-1 and HIV-2 include differential sensitivity to non-nucleoside reverse transcriptase inhibitors

(Bacolla, et al . (1993) Journal of Biological Chemistry 268, 16571-7) , the variability and importance of the V3 region of envelope in neutralization (Bjorling, et al . (1994) Journal of Immunology 152, 1952-9; Chiodi, et al . (1993) Chemical Immunology 56, 61-77), the involvement of different transcriptional factors and T-cell signaling pathways in activation of the viral LTR (Hannibal, et al .

(1993) Journal of Virology 67, 5035-40) , and the specificity of the Tat and Rev transactivating proteins

(Fenrick, et al . (1989) Journal of Virology 63, 5006-12;

Malim, et al . (1989) Proc . Natl . Acad. Sci . U. S.A . 86,

8222-6) .

SIV as a Model of HIV

Because the ribozymes of the invention specifically target sequences in both HIV (particularly HIV-2) and SIV, they are particularly useful in macaque models of HIV infection. Any information obtained through studies in the macaque model is directly applicable to HIV infection in humans, as the same ribozyme construct is utilized for HIV-2 infection, as well as SIV infection.

Studying SIV infection of rhesus macaques allows rapid optimization of therapeutic regimines and administration modes. For instance, the ribozymes of the invention are useful to evaluate preventive therapies, which is not possible in a human trial. This involves isolating primary cells from an uninfected rhesus macaque and stably transducing them with an expression cassette of the invention. Once these cells have been stimulated to proliferate, they are reimplanted into the animal for subsequent SIV infection and monitoring of viral replication. A second approach parallels human studies in that primary cells from an infected macaque are harvested for transduction. Upon stable expression of the ribozyme of the invention, the cells are infused back into the animal and the continued replication of the virus is measured. Specific issues that are addressed in the SIV_mac model for the adoptive transfer of T cells include information on the longevity and trafficking of these cells. The effect of different ex vivo culture and transduction conditions on in vivo properties and that of different vectors on selectable markers (such as CTL response to the neomycin resistance gene) can also be studied.

The SIV model offers additional advantages . For instance, it presents the opportunity to infect animals with a defined SIV genotype. The in vivo development of mutations or the effect of specifically designed mutations can be evaluated. It also allows the standardization of infection conditions, ( e . g. , the level of input virus) , thus minimizing the variability that is inevitable in human trials.

Although the efficacy of gene therapy using ribozymes has been established, one great challenge remains the stable introduction of the nucleic acid encoding the ribozyme into a significant fraction of the cells targeted by HIV. The clinical applicability of the therapy is broadened by transducing autologous hematopoietic stem cells and subsequently reinfusing them into the patient. These cells can continually produce CD4+ T cells, monocytes, and macrophages that are "intracellularly immunized" by the expression of the protective ribozyme in the cell . Recent studies have shown that human CD34+ cells can be isolated and stably transduced with ribozyme constructs without adverse effects on the differentiation and proliferation of the progenitor cells (Yu et al . , (1995) Proc. Natl . Acad. Sci . USA 92, 699-703) . However, recent efforts have indicated that long-term retroviral marking in patient bone marrow may be difficult (Dunbar et al . , (1995) Blood 85, 3048-57) . Another problem is the selective pressure possibly provided by transduction with a ribozyme-expressing vector. A viral mutation resulting in viral resistance will render the transduced population of cells ineffective in terms of protection against infection. 13

The macaque animal model offers the ability to test the generation of such resistance via the creation of an SIV mutant. For instance, one can render the virus resistant to cleavage by inducing a silent mutation, e . g. , deletion of the GUC sequence at the cleavage site, and then assess the fate of the transduced progenitor cells.

Experiments designed to optimize delivery of the ribozymes typically involve altering a single parameter at a time to determine the effect of each alteration. Thus, the methods typically involve administering the ribozyme to a first set of animals using one method or construct (the test animals) and administering the same ribozyme to a second set of animals using a second method or construct (the controls) . The level of SIV infection in the two sets of animals can be measured according to known methods and compared. Optimization of any number of parameters is achieved using these methods. For instance, the effect of different promoter sequences, gene therapy vectors, modes of administration, levels of vector, and the like are studied and optimized using these methods. Since the ribozyme used in the macaque model is identical to that used in humans, the information obtained is directly applicable to human clinical use. Accordingly, the model systems described herein are of significant commercial calue in the development fo therapeutic agents for the treatment of HIV-related illnesses.

Ribozymes A ribozyme is a catalytic RNA molecule that cleaves other RNA molecules having nucleic acid sequences that are complementary to particular targetting sequences in the ribozyme. General methods for the construction of ribozymes, including hairpin ribozymes, hammerhead ribozymes, RNAse P ribozymes (i.e., ribozymes derived from the naturally occurring RNAse P ribozyme from prokaryotes or eukaryotes) are known in the art. Castanotto et al (1994) Advances in Pharmacology 25: 289- 317 provides and overview of ribozymes in general, including group I ribozymes, hammerhead ribozymes, hairpin ribozymes, RNAse P, and axhead ribozymes. Ribozymes useful in this invention include those that cleave HIV and SIV viral transcripts. The production of ribozymes which specifically target HIV sequences are taught in the art (see, e . g. , Wong-Staal et al . , WO 94/26877, Yu et al . (1993) Proc . Natl . Acad. Sci . USA 90:6340-6344) and Dropulic et al . (1992) Journal of Virology 66(3) :1432-1441) .

Briefly, two types of ribozymes that are particularly useful in this invention include the hairpin ribozyme and the hammerhead ribozyme. The hammerhead ribozyme ( see, Rossie et al . (1991) Pharmac . Ther.

50:245-254; Forster and Symons (1987) Cell 48:211-220;

Haseloff and Gerlach (1988) Nature 328:596-600; Walbot and Bruening (1988) Nature 334:196; Haseloff and Gerlach

(1988) Nature 334:585; and Dropulic et al and Castanotto et al . , and the references cited therein, supra) and the hairpin ribozyme ( see, e . g. , Hampel et al . (1990) Nucl . Acids Res . 18:299-304; Hempel et al . , (1990) European Patent Publication No. 0 360 257; U.S. Patent No. 5,254,678, issued October 19, 1993; Wong-Staal et al . , PCT/US94/05700; Ojwang et al . (1993) Proc Natl Acad Sci USA 90:6340-6344; Yamada et al . (1994) Human Gene Therapy 1:39-45; Leavitt et al . (1995) Proc Natl Acad Sci USA 92:699-703; Leavitt et al . (1994) Human Gene Therapy 5:1151-1120; and Yamada et al . (1994) Virology 205:121-126) are catalytic molecules having antisense and endoribonucleotidase activity. Intracellular expression of hammerhead ribozymes and a hairpin ribozymes directed against HIV RNA has been shown to confer significant resistance to HIV infection. The typical sequence requirement for the hairpin ribozyme is an RNA sequence consisting of ]SπsrNG/CN*GUCNNNNNNNN (where N*G is the cleavage site, and where N is any of G, U, C, or A) . The sequence requirement at the cleavage site for the hammerhead ribozyme is any RNA sequence consisting of NUX (where N is any of G, U, C, or A and X represents C, U or A) . Accordingly, the same target within the hairpin leader sequence, GUC, is targetable by the hammerhead ribozyme. The additional nucleotides of the hammerhead ribozyme or hairpin ribozyme is determined by the common target flanking nucleotides and the consensus sequences. As noted above, the ribozymes of the invention specifically target sequence that are present in both HIV and SIV. A number of target sites within the HIV-2 and SIV genomes that follow the afore-mentioned algorithms for optimum cleavage can be targeted using the ribozymes of the invention. To identify such sites, the genomic sequences of various known HIV-2 and SIV strains can be compared according to standard techniques.

When using hairpin ribozymes, a preferred site is the 9456 region at the 3' end of the viral mRNA. A preferred target sequence is ATTCAGTCGCTCTGCG. Figure IB shows the alignment of this sequence in a number of SIV and HIV-2 strains. This particular target region is also preferred because of its high degree of conservation in strains of both the human and non-human primate immunodeficiency virus. HIV-2 ROD is one of a few sequenced strains of HIV-2 in which the sequence in this area does not show 100% conservation with that of the target. However, even HIV-2 ROD is expected to be cleaved by the ribozyme, since it has been determined that the nucleotide 5' of GUC is flexible.

The nucleotide sequence of a preferred hairpin ribozyme of the invention is shown in SEQ. ID. No. 1 and in Figure 6. The targetting sequence of the ribozyme is the subsequence (read from the 3' to 5' end) UAAGAAGACGAGACGC (SEQ. ID. No. 2) . Making Ribozymes of the invention

The ribozymes can be synthesized chemically according to known methods such as the solid phase phosphoramidite triester method described by Beaucage and Caruthers (1981), Tetrahedron Letts . , 22 (20) :1859-1862, e . g. , using an automated synthesizer, as described in Needham-VanDevanter et al . (1984) Nucleic Acids Res . , 12:6159-6168. Purification of the molecules, where necessary, is typically performed by either native acrylamide gel electrophoresis or by anion-exchange HPLC as described in Pearson and Regnier (1983) J. Chrom. 255:137-149. The sequence of the synthetic RNA molecules can be verified using the chemical degradation method of Maxam and Gilbert (1980) in Grossman and Moldave (eds.) Academic Press, New York, Methods in Enzymology 65:499-560.

After synthesis, the RNA molecule can be modified by ligation to a DNA molecule having the ability to stabilize the ribozyme and make it resistant to RNase. Alternatively, the ribozyme can be modified to the phosphothio analog for use in liposome delivery systems. This modification also renders the ribozyme resistant to endonuclease activity.

Alternatively, the ribozymes are prepared from a DNA molecule comprising an expression cassette that, upon transcription, yields a ribozyme of the invention. An expression cassette of the invention comprises a promoter sequence ( e . g. , a olymerase II promoter, a polymerase III promoter, and the like) operably linked to a sequence encoding the ribozyme.

The particular promoter used in the expression cassettes is not a critical feature of the invention. Ideally, expression of the construct should be sufficiently high to inhibit the growth, infection or replication of the virus against which protection is sought. Accordingly, strong promoters are generally preferred promoters for directing expression of the ribozymes. Preferred promoters include Pol III promoters such as the t-RNA promoters ( e . g. , the tRNA^al promoter; see, Wong-Staal et al . WO 94/26877) , the HIV-2^ LTR promoter (the sequence of this clone is available under Genbank Accession No. U22047) and strong constitutive promoters known to persons of skill, including cellular promoters which direct expression of the cytoskeletal machinery such as the β-actin promoter and the tubulin promoter. In addition to the constitutive promoters mentioned above, strong inducible promoters are also preferred. In particular, promoters which are expressed upon entry or replication of the virus in the cell are particularly preferred. For example, HIV LTR promoters are preferred promoters when the virus against which protection is sought is an HIV virus.

General cloning methodologies to produce nucleic acids which encode ribozymes of the invention are well known in the art. Examples of appropriate cloning and sequencing techniques, and instructions sufficient to direct persons of skill through many cloning exercises are found in Berger and Kimmel, Guide to Molecular Cloning Techniques, Methods in Enzymology volume 152 Academic Press, Inc., San Diego, CA (Berger) ; Sambrook et al . (1989) Molecular Cloning - A Laboratory Manual (2nd ed.) Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor Press, NY, (Sambrook) ; and Current Protocols in Molecular Biology, F.M. Ausubel et al . , eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc., (1994 Supplement) (Ausubel) . Product information from manufacturers of biological reagents and experimental equipment also provide information useful in known biological methods. Such manufacturers include the SIGMA chemical company (Saint Louis, MO) , R&D systems (Minneapolis, MN) , Pharmacia LKB Biotechnology (Piscataway, NJ) , CLONTECH Laboratories, Inc. (Palo Alto, CA) , Chem Genes Corp., Aldrich Chemical Company (Milwaukee, WI) , Glen Research, Inc., GIBCO BRL Life Technologies, Inc. (Gaithersberg, MD) , Fluka Chemica-Biochemika Analytika (Fluka Chemie AG, Buchs, Switzerland) , and Applied Biosystems (Foster City, CA) , as well as many other commercial sources known to one of skill.

The nucleic acid compositions of this invention, whether RNA, cDNA, genomic DNA, or a hybrid of the various combinations, are isolated from natural sources or synthesized in vi tro . The nucleic acids claimed are present in transformed or transfected whole cells, in transformed or transfected cell lysates, or in a partially purified or substantially pure form. In vi tro amplification techniques are suitable for amplifying provirus sequences for use as molecular probes or generating proviral nucleic acid fragments for subsequent subcloning. Examples of techniques sufficient to direct persons of skill through such in vi tro amplification methods, including the polymerase chain reaction (PCR) the ligase chain reaction (LCR) , Qβ- replicase amplification and other RNA polymerase mediated techniques ( e . g. , NASBA) are found in Berger, Sambrook, and Ausubel, as well as Mullis et al . , (1987) U.S. Patent No. 4,683,202; PCR Protocols A Guide to Methods and Applications (Innis et al . eds) Academic Press Inc. San Diego, CA (1990) (Innis) ; Arnheim & Levinson (October 1, 1990) C&EN 36-47; The Journal Of NIH Research (1991) 3, 81-94; (Kwoh et al . (1989) Proc . Natl . Acad. Sci . USA 86, 1173; Guatelli et al . (1990) Proc . Natl . Acad. Sci . USA

87, 1874; Lomell et al . (1989) J. Clin . Chem 35, 1826;

Landegren et al . , (1988) Science 241, 1077-1080; Van

Brunt (1990) Biotechnology 8, 291-294; Wu and Wallace,

(1989) Gene 4, 560; Barringer et al . (1990) Gene 89, 117, and Sooknanan and Malek (1995) Biotechnology 13: 563-564. Improved methods of cloning in vi tro amplified nucleic acids are described in Wallace et al. , U.S. Pat. No. 5,426,039.

Oligonucleotides for use as probes, e . g. , in in vitro amplification methods and for use as gene probes are typically synthesized chemically according to the solid phase phosphoramidite triester method described by

Beaucage and Caruthers (1981) , supra .

One of skill will recognize many ways of generating alterations in a given nucleic acid sequence. Such well-known methods include site-directed mutagenesis, PCR amplification using degenerate oligonucleotides, exposure of cells containing the nucleic acid to mutagenic agents or radiation, chemical synthesis of a desired oligonucleotide ( e . g. , in conjunction with ligation and/or cloning to generate large nucleic acids) and other well-known techniques. See, Giliman and Smith (1979) Gene 8:81-97; Roberts et al . (1987) Nature 328:731-734 and Sambrook, Innis, Ausbel, Berger, Needham VanDevanter and Mullis (all supra) .

One of skill can select a desired ribozyme or nucleic acid encoding a ribozyme of the invention based upon the sequences and strategies provided herein, and upon knowledge in the art regarding primate lentiviruses generally. The life-cycle, genomic organization, developmental regulation and associated molecular biology of lentiviruses such as HIV and SIV viruses have been the focus of over a decade of intense research. The specific effects of many mutations in the viral genome are known, and the interaction of many of the components of the viruses at a molecular level are known.

Measuring Viral Inhibition

The level of virus in a cell culture, cell or whole organism is measured by means known in the art.

Typically, the level of virus is measured in a western blot or other immunoassay such as an ELISA, or by performing quantitative PCR. In immunoassay formats, the level of virus is measured by monitoring the amount of a viral protein (or viral capsid) by quantifying binding of the protein to an immunogenic reagent such as an antibody. In quantitative PCR, the level of a viral nucleic acid is measured by monitoring PCR amplification products, and comparing the amount of amplified nucleic acid obtained, as compared to a amplification products obtained from amplification performed on a known reference nucleic acid. Making Antibodies

Methods of producing polyclonal and monoclonal antibodies are known to those of skill in the art, and many anti-viral antibodies are commercially available. See, e . g. , Coligan (1991) Current Protocols in Immunology Wiley/Greene, NY; and Harlow and Lane (1989) Antibodies : A Laboratory Manual Cold Spring Harbor Press, NY; Stites et al. (eds.) Basic and Clinical Immunology (4th ed.) Lange Medical Publications, Los Altos, CA, and references cited therein; Goding (1986) Monoclonal Antibodies : Principles and Practice (2d ed.) Academic Press, New York, NY; and Kohler and Milstein (1975) Nature 256: 495-497. Such techniques include antibody preparation by selection of antibodies from libraries of recombinant antibodies in phage or similar vectors. See, Huse et al . (1989) Science 246: 1275-1281; and Ward, et al. (1989) Nature 341: 544-546. Specific monoclonal and polyclonal antibodies and antisera will usually bind with a K_D of less than about .1 mM, more usually less than about 1 μM, preferably less than about .1 μM or better, and most typically and preferably, .01 μM or better.

Frequently, the polypeptides and their ^* corresponding antibodies will be labeled by joining, either covalently or non covalently, a substance which provides for a detectable signal. A wide variety of labels and conjugation techniques are known and are reported extensively in both the scientific and patent literature. Suitable labels include radionucleotides, enzymes, substrates, cofactors, inhibitors, fluorescent moieties, chemiluminescent moieties, magnetic particles, and the like. Patents teaching the use of such labels include U.S. Patent Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4, 366, 241.

In one preferred class of embodiments, the viral proteins detected when quantifying viral inhibition in the present invention are used for the detection of the virus (such as HIV) in human (or animal, e . g. , where the animal is a macaque and the virus is HIV-2 or SIV) patients. For instance, HIV polypeptides are used routinely in western blots for the detection of antibodies to HIV in a patient's blood, and the reciprocal experiment (for detecting HIV polypeptides in a patient's blood) is suitable for measuring HIV viral load in a patient's blood. Such tests are well known, and are presently a standard method by which HIV-1 and HIV-2 infections are detected in patient populations. A variety of immunoassay formats are known and available.

A particular protein can be quantified by a variety of immunoassay methods. For a review of immunological and immunoassay procedures in general, see

Stites and Terr (eds.) 1991 Basic and Clinical Immunology (7th ed.) . Moreover, the immunoassays of the present invention can be performed in any of several configurations, e . g. , those reviewed in Maggio (ed.) (1980) Enzyme Immunoassay CRC Press, Boca Raton, Florida; Tijan (1985) "Practice and Theory of Enzyme Immunoassays," Laboratory Techniques in Biochemistry and Molecular Biology, Elsevier Science Publishers B.V., Amsterdam; Harlow and Lane, supra; Chan (ed.) (1987) Immunoassay: A Practical Guide Academic Press, Orlando, FL; Price and Newman (eds.) (1991) Principles and Practice of Immunoassays Stockton Press, NY; and Ngo (ed.) (1988) Non isotopic Immunoassays Plenum Press, NY. Sample Collection and Processing

An HIV-2 transcript, antibody or polypeptide is preferably quantified in a biological sample, such as a cell, or a tissue sample derived from a patient. In a preferred embodiment, antisera to HIV polypeptides are quantified in serum (See, supra) . In another preferred embodiment, HIV nucleic acids are detected in an infected patient using gene probes derived from the nucleic acids of the invention. For instance, in one embodiment, HIV nucleic acids in a biological sample are amplified by an in vi tro amplification technique ( e . g. , PCR or LCR) and detected using labeled complementary nucleic acids.

Although the sample is typically taken from a human patient, the assays can be used to detect viral polypeptides in cells from eukaryotes in general, in particular primates such as humans, chimpanzees, gorillas, macaques, and baboons. In addition, rodents such as mice, rats, and guinea pigs can be used. The cells may be part of a whole organism, or in cell culture.

The sample is pretreated as necessary by dilution in an appropriate buffer solution, or concentrated, if desired. Many standard aqueous buffer solutions employing one of a variety of buffers, such as phosphate, Tris, or the like, at physiological pH are appropriate. Cell sorting techniques such as FACS are optionally used to isolate particular cells such as CD4⁺ cells in which the virus needs to be quantitated.

Quantification of Polypeptides, Nucleic Acids and Antibodies

HIV antibodies, polypeptides and nucleic acids of the invention are detected and quantified by any of a number of means well known to those of skill in the art . These include analytic biochemical methods such as spectrophotometry, radiography, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC) , thin layer chromatography (TLC) , hyperdiffusion chromatography, and the like, and various immunological methods such as fluid or gel precipitin reactions, immunodiffusion (single or double) , immunoelectrophoresis, radioimmunoassays (RIAs) , enzyme- linked immunosorbent assays (ELISAs) , immunofluorescent assays, and the like. The detection of nucleic acids proceeds by well known methods such as Southern analysis, northern analysis, gel electrophoresis, PCR, radiolabeling, scintillation counting, and affinity chromatography.

Reduction of Non Specific Binding

One of skill will appreciate that it is often desirable to reduce non specific binding in immunoassays or nucleic acid assays, and during analyte purification. Where the assay involves a viral antibody, or other capture agent immobilized on a solid substrate, it is desirable to minimize the amount of non specific binding to the substrate. Means of reducing such non specific binding are well known to those of skill in the art . Typically, this involves coating the substrate with a proteinaceous composition. In particular, protein compositions such as bovine serum albumin (BSA) , nonfat powdered milk, and gelatin are widely used.

Other Assay Formats

Western blot analysis can also be used to detect and quantify the presence of a polypeptide or antibody (including peptide, transcript, or enzymatic digestion product) in the sample. The technique generally comprises separating sample products by gel electrophoresis on the basis of molecular weight, transferring the separated proteins to a suitable solid support, (such as a nitrocellulose filter, a nylon filter, or derivatized nylon filter) , and incubating the sample with labeling antibodies that specifically bind to the analyte protein (antibody or HIV-2 polypeptide) . The labeling antibodies specifically bind to analyte on the solid support. These antibodies are directly labeled, or alternatively are subsequently detected using labeling agents such as antibodies ( e . g. , labeled sheep anti-mouse antibodies where the antibody to an analyte is a murine antibody) that specifically bind to the labeling antibody.

Other assay formats include liposome immunoassays (LIAs) , which use liposomes designed to bind specific molecules ( e . g. , antibodies) and release encapsulated reagents or markers. The released chemicals are then detected according to standard techniques (see, Monroe et al . , (1986) Amer. Clin . Prod. Rev. 5:34-41) .

Non-Therapeutic Uses of the Nucleic Acids of The Invention

The nucleic acids encoding ribozymes of the invention are useful as molecular probes, in addition to their utility as therapeutic agents as described below. A wide variety of formats and labels are available and appropriate for nucleic acid hybridization, including those reviewed in Tijssen (1993) Laboratory Techniques in biochemistry and molecular biology- -hybridization with nucleic acid probes parts I and II, Elsevier, New York and Choo (ed) (1994) Methods In Molecular Biology Volume 33 - In Si tu Hybridization Protocols Humana Press Inc., New Jersey (see also, other books in the Methods in Molecular Biology series) ; see especially, Chapter 21 of Choo ( id) "Detection of Virus Nucleic Acids by Radioactive and Nonisotopic in Si tu Hybridization" and the methods described infra for the detection of nucleic acids in general .

The nucleic acids and ribozymes can also be used to inhibit replication of HIV or SIV in cell cultures used to study these viruses. Thus, the ribozymes can be used prophylactically to prevent infection of researchers who handle the cell cultures. Therapeutic uses of Ribozymes of the Invention

Gene therapy provides a method for combating chronic infectious diseases such as AIDS, caused by HIV infection, as well as non-infectious diseases such as cancer. Yu et al . (1994) Gene Therapy 1:13-26 and the references therein provides a general guide to gene therapy strategies for HIV infection. See also, Sodoski et al . PCT/US91/04335. Wong-Staal et al . , WO/94/26877 describes HIV-based gene therapy vectors.

Common gene therapy vectors include those derived from murine retroviruses (including MoMLv) , avian rous sarcoma virus (RSV) , Hepatocyte viruses, HIV-1, HIV- 2 and AAV-based vectors. The majority of the approved gene transfer trials in the United States rely on replication-defective murine retroviral vectors harboring a therapeutic poiynucleotide sequence as part of the retroviral genome (Miller et al . Mol . Cell . Biol . 10:4239

(1990) ; Kolberg R J^". NIH Res . 4:43 (1992) ; Cornetta et al. Hum. Gene Ther. 2:215 (1991)) . As is known in the art, the major advantages of murine retroviral vectors for gene therapy are the high efficiency of gene transfer into certain types of replicating cells, the precise integration of the transferred genes into cellular DNA, and the lack of further spread of the sequences after gene transfer.

HIV based vectors and AAV based vectors are generally preferred because they do not require actively dividing cells (unlike murine retroviruses) . HIV vectors are most preferred, because they typically only infect CD4⁺ cells in vivo, i . e . , those cells which are infected by HIV viruses.

When using retroviral vectors, packaging cells are commonly used to prepare the virions used to transduce the target cells. In these cells, trans active genes rendered inactive in a gene therapy vector are "rescued" by trans complementation to provide a packaged vector. This form of transcomplementation is provided by co-infection of a packaging cell with a virus or vector which supplies functions missing from a particular gene therapy vector in trans. For instance, cells transduced with HIV or murine retroviral proviral sequences which lack the nucleic acid packaging site produce retroviral trans active components, but do not specifically incorporate the retroviral nucleic acids into the capsids produced, and therefore produce little or no live virus. If these transduced "packaging" cells are subsequently transduced with a vector nucleic acid which lacks coding sequences for retroviral trans active functions, but includes a packaging signal, the vector nucleic acid is packaged into an infective virion. A number of packaging cell lines useful for MoMLV-based vectors are known in the art, such as PA317 (ATCC CRL 9078) which expresses MoMLV core and envelope proteins see, Miller et al. J. Virol . 65:2220-2224 (1991) .

Carrol et al . (1994) Journal of virology 68 (9) :6047-6051 describe the construction of packaging cell lines for HIV viruses.

Functions of viral replication not supplied by trans-complementation which are necessary for replication of the vector are present in the vector. In HIV, this typically includes, e . g. , the TAR sequence, the sequences necessary for HIV packaging, the RRE sequence if the instability elements of the pl7 gene of gag is included, and sequences encoding the polypurine tract . HIV sequences that contain these functions include a portion of the 5' long terminal repeat (LTR) and sequences downstream of the 5' LTR responsible for efficient packaging, i.e., through the major splice donor site ("MSD") , and the polypurine tract upstream of the 3' LTR through the U3R section of the 3' LTR. The packaging site (psi site or site) is partially located adjacent to the 5' LTR, primarily between the MSD site and the gag- initiator codon (AUG) in the leader sequence. See, Garzino-Demo et al. (1995) Hum. Gene Ther. 6(2) : 177-184. For a general description of the structural elements of the HIV genome, see, Holmes et al . PCT/EP92/02787.

The present invention provides several features that allow one of skill to generate powerful retroviral gene therapy vectors against specific cellular targets, in vi tro and in vivo, e . g. , against CD4⁺ cells. CD4⁺ cells are infected by HIV viruses. HIV viruses also infect a few other cell-types in vi tro which exhibit little or no CD4 expression, such as peripheral blood dendritic cells, follicular dendritic cells, epidermal Langerhans cells, megakaryocytes, microglia, astrocytes, oligodendroglia, CD8⁺ cells, retinal cells, renal epithelial cells, cervical cells, rectal mucosa, trophoblastic cells, and cardiac myocytes ( see, Rosenburg and Fauci, supra) ; the infection of these cell types by

HIV in vivo, however, is rare. Lists of CD4⁺ and CD4^" cell types which are infectable by HIV have been compiled

(see, Rosenburg and Fauci 1 supra; Rosenburg and Fauci (1989) Adv Immunol 47:377-431; and Connor and Ho (1992) in AIDS: etiology, diagnosis, treatment , and prevention, third edition Hellman and Rosenburg (eds) Lippincott, Philadelphia) .

Nucleic acids encoding ribozymes of the invention are useful as components of gene therapy vectors. Retroviral vectors packaged into HIV envelopes primarily infect CD4⁺ cells, (i.e., by interaction between the HIV envelope glycoprotein and the CD4 "receptor") including non-dividing CD4⁺ cells such as macrophage. For instance, nucleic acids which encode ribozymes are encapsidated into HIV capsids in gene therapy vectors which include an HIV packaging site (e.g., the

site in HIV-1) , and typically also include the HIV LTR sequences. Thus, in one preferred embodiment, the ribozymes of the present invention are incorporated into HIV-based gene therapy vectors which deliver the ribozymes to CD4⁺ cells. This is accomplished by incorporating cis active nucleic acids ( e . g. , promoter sequences, packaging sequences, integration or cellular targeting sequences) into the vector, or by using trans active nucleic acids and polypeptides (capsid and envelope proteins and transcription factors) to replicate and package the gene therapy vector into an viral capsid (e.g., an HIV-1 or HIV-2 capsid and envelope), or both. See, e . g. , Poznansky et al . (1991) Journal or Virology 65(1) : 532-536 and Garzino Dem et al . ( supra) for a description of the ability of the region flanking the 5' HIV LTR. Ex Vivo Therapy

Ex vivo methods for inhibiting viral replication in a cell in an organism involve transducing the cell ex vivo with a vector of this invention, and introducing the cell into the organism. Cells are typically selected based upon the host range of the virus against which a ribozyme is directed. For instance, where the virus is an HIV virus, the cells selected for transfection are typically CD4⁺ cells such as CD4⁺ T cells, or CD4⁺ macrophage isolated or cultured from a patient. See, e . g. , Freshney et al . , (Cul ture of Animal Cells, a Manual of Basic Technique, third edi tion Wiley- Liss, New York (1994)) and the references cited therein for a discussion of how to isolate and culture cells from patients. Alternatively, the cells can be those stored in a cell bank (e.g., a blood bank) . In addition, in preferred embodiments, the vector is replicated and packaged into viral capsids such as HIV capsid/envelopes using the viral replication machinery. Typically, the necessary functions for encapsidation of the vector are supplied in trans by a parental virus which recognizes and packages nucleic acids which contain appropriate packaging sequences.

Thus, a patient infected with a virus such as HIV-l can be treated for the infection by transducing a population of their cells with a vector of the invention and introducing the transduced cells back into the patient as described herein. Thus, the present invention provides a method of protecting cells in vi tro, ex vivo or in vivo, and the cells are optionally already infected with the virus against which protection is sought. In Vivo Therapy

Gene therapy vectors containing nucleic acids of the invention can be administered directly to the organism for transduction of cells in vivo . Administration of gene therapy vectors comprising the ribozymes of the invention, and cells transduced with the gene therapy vectors is by any of the routes normally used for introducing a molecule into ultimate contact with blood or tissue cells. As described herein, preferred vectors utilize HIV viral particles or other retroviral particles, but other arrangements are also feasible, such as adeno-associated capsids, naked DNA or RNA forms of the gene therapy vectors. Gene therapy vectors of the present invention can be used to treat and prevent virally-mediated diseases such as AIDS in patients.

The vectors, or the ribozymes themselves, are administered in any suitable manner, preferably with pharmaceutically acceptable carriers. Suitable methods of administering such vectors and ribozymes in the context of the present invention to a patient are available, and, although more than one route can be used to administer a particular composition, a particular route can often provide a more immediate and more effective reaction than another route. Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions of the present invention.

Formulations suitable for oral administration can consist of (a) liquid solutions, such as an effective amount of the vector or ribozyme dissolved in diluents, such as water, saline or PEG 400; (b) capsules, sachets or tablets, each containing a predetermined amount of the active ingredient, as liquids, solids, granules or gelatin; (c) suspensions in an appropriate liquid; and (d) suitable emulsions. Tablet forms can include one or more of lactose, sucrose, mannitol, sorbitol, calcium phosphates, corn starch, potato starch, tragacanth, microcrystalline cellulose, acacia, gelatin, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, stearic acid, and other excipients, colorants, fillers, binders, diluents, buffering agents, moistening agents, preservatives, flavoring agents, dyes, disintegrating agents, and pharmaceutically compatible carriers. Lozenge forms can comprise the active ingredient in a flavor, usually sucrose and acacia or tragacanth, as well as pastilles comprising the active ingredient in an inert base, such as gelatin and glycerin or sucrose and acacia emulsions, gels, and the like containing, in addition to the active ingredient, carriers known in the art.

The vectors, alone or in combination with other suitable components, can be made into aerosol formulations to be administered via inhalation. Aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like.

Suitable formulations for rectal administration include, for example, suppositories, which consist of the vector with a suppository base. Suitable suppository bases include natural or synthetic triglycerides or paraffin hydrocarbons. In addition, it is also possible to use gelatin rectal capsules which consist of a combination of the vector with a base, including, for example, liquid triglyercides, polyethylene glycols, and paraffin hydrocarbons. Formulations suitable for parenteral administration, such as, for example, by intraarticular (in the joints), intravenous, intramuscular, intradermal, intraperitoneal, and subcutaneous routes, include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non¬ aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives. Parenteral administration is a preferred method of administration. The formulations of vector or ribozyme can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials, and in some embodiments, can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, water, for injections, immediately prior to use. For many vectors, this mode of administration will not be appropriate, because many virions are destroyed by lyophilization. Other vectors (e.g., vectors utilizing an AAV capsid, or naked nucleic acids) tolerate lyophilization well.

Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described. Cells transduced by the vector, e.g., as described above in the context of ex vivo therapy, can also be administered parenterally as described above, except that lyophilization is not generally appropriate, since cells are destroyed by lyophilization.

The dose administered to a patient, in the context of the present invention should be sufficient to effect a beneficial therapeutic response in the patient over time, or to inhibit infection by a pathogenic strain of HIV. The dose will be determined by the efficacy of the particular vector employed and the condition of the patient, as well as the body weight or surface area of the patient to be treated. The size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects that accompany the administration of a particular vector, vaccine, or transduced cell type in a particular patient . In determining the effective amount of the vector to be administered in the treatment or prophylaxis of virally- mediated diseases such as AIDS, the physician needs to •evaluate circulating plasma levels, vector toxicities, progression of the disease, and the production of anti- HIV antibodies. In general, the dose of a naked nucleic acid composition such as a DNA is from about 1 μg to 100 μg for a typical 70 kilogram patient, and doses of gene therapy vectors which include viral capsids such as AAV or HIV vectors are calculated to yield an equivalent amount of the desired ribozyme.

In the practice of this invention, compositions can be administered, for example, by intravenous infusion, orally, topically, intraperitoneally, intravesically or intrathecally. The preferred method of administration will often be oral, rectal or intravenous, but the vectors can be applied in a suitable vehicle for the local and topical treatment of virally-mediated conditions. The vectors of this invention can supplement treatment of virally-mediated conditions by any known conventional therapy, including cytotoxic agents, nucleotide analogues and biologic response modifiers.

For administration, ribozymes and transduced cells of the present invention can be administered at a rate determined by the LD-50 of the ribozymes, vector, or transduced cell type, and the side-effects of the inhibitor, vector or cell type at various concentrations, as applied to the mass and overall health of the patient. Administration can be accomplished via single or divided doses. EXAMPLES

The following example is provided by way of illustration only and not by way of limitation. Those of skill will readily recognize a variety of noncritical parameters which could be changed or modified to yield essentially similar results.

Example 1 This example describes the construction and use of ribozymes of the present invention.

MATERIALS AND METHODS Cloning

The retroviral vector pMJT, in which an internal human tRNA^val promoter drives a hairpin ribozyme targetting the HIV-1 5' leader sequence, was constructed as described previously (see, International Application wo 94/26877 and Yu et al . , Proc Natl Acad Sci U S A 90, 6340-4 (1993)) . Single-stranded oligonucleotides were used to amplify the expression cassette containing the ribozyme from this vector. One primer contained the specifically targetting ribozyme sequence of the present invention (5' GGGGATCCCGCAGAGCAGAAGAATACCAGAGAAACACAC 3' ) and one primer specifically hybridizes to a sequence upstream of the promoter/ribozyme cassette, in the LNL-6 parent vector backbone (5' CTGCTCCAAAGGGACCTCAAG 3') . A 170 bp fragment was amplified via polymerase chain reaction (94 °C 30 sec, 59 °C 30 sec, 72 °C 30 sec; 30 cycles) from pMJT. The PCR product was subsequently digested with BamHI and Mlul to yield a 57 bp fragment purified from a 3% low melting point agarose gel via freeze-thaw. pMJT was digested with the same enzymes, and the backbone fragment was isolated and treated with alkaline phosphatase. The two fragments were then ligated to generate the retroviral vector p9456t. See Figure IA. The amphotrophic packaging cell line PA317 was transfected with 20 μg p9456t via the calcium phosphate method (Yamada et al . , Gene Therapy 1 , 38-45 (1994)) . The culture supernatant, rich with retroviral particles, was harvested 48 to 56 hours later and filtered (0.45 um) . lxlO⁶ CEM/174 cells were resuspended in 5-10 mL of the supernatant supplemented with 10-20 μL 4 mg/mL polybrene and incubated 2-4 hours at 37 C. The cells were then washed once and resuspended in fresh R10 (RPMI supplemented with 10% FCS, 2% penicillin-streptomycin, 1% L-glutamine) . Selection for G418 resistance (at a concentration of 400-600 μg/mL) was begun 3-4 days later and continued over a period of approximately 4 weeks. Ribozyme expression in stable cell lines The expression of the ribozyme was detected via a 2-step process combining RT PCR with Southern blotting (Yamada et al . , (1994)) . Total RNA was isolated from the stably transduced cell lines using RNAstat60 (manufactured by Tel-Test "B", Inc.) . 1 ug of this isolate then served as template for a 60-minute reverse transcription reaction including an oligonucleotide primer that binds specifically at the 3' end of the ribozyme (5' TACCAGGTAATATACCAC 3') . This reaction was followed by PCR (94 °C 30 sec, 59 °C 30 sec, 72 °C 30 sec; 30 cycles) , now including a primer to bind the 5' end of the ribozyme. The PCR product was then loaded onto a 3% low melting point agarose gel for electrophoresis and subsequent Southern blot analysis with ³²P-random-labeled 9456 probe for detection. SIV infection

5xl0⁴ untransduced CEM/174 cells were infected with 1 μL 1:10 dilution of the pathogenic molecular clone pMA239 (SIV_mac239) for determination of infectious titre (TCID₅₀) by performing limiting dilutions as described by Kodama et al . , J Virol 63, 4709-14 (1989) and Naidu et al . , J Virol 62,4691-6 (1988)) . Upon visualization of cytopathic effects, the culture supernatant was harvested and filtered (0.45 μm) for subsequent infection. 3-5xl0⁵ CEM/174 cells stably expressing p9456t were challenged with virus supernatant at an input m.o.i. of 0.02. Untransduced CEM/174 cells and cells stably expressing pMJT were subjected to similar challenge conditions as controls . The culture supernatants were sampled every 2 to 3 days beginning 3 days post-infection for p26 antigen capture ELISA. The infected cells were maintained at a concentration of approximately 1x106 cells/mL via splitting upon regular intervals. Viral DNA burden

1x10^s CEM/174 cells stably expressing p9456t were infected with 1 μL DNAse-treated infectious virus stock in triplicate and harvested (8 min centrifugation at 1500 rpm and transfer of pellet to -80 C) at 24, 48, and 72 hours post-infection. This pellet was thawed out and resuspended in 50 μL each lysis buffer (40 mM KCI, 50 mM Tris-HCI (pH 8.3) , 3 mM MgCl₂, 0.45% NP-40, 200 μg/mL Proteinase K) for a 60-minute incubation at 56 °C as described by Reddy et al . , J Virol 69,3549-53 (1995)) . The Proteinase K was inactivated via 10 min boiling, and the lysate was subsequently subjected to PCR (94 °C 45 sec, 55 °C 45 sec, 72 °C 30 sec; 30 cycles) with the primer pair 5' EHO (AGTCTCATAGCCAACATTGA) and 3' EHO (CAAAGCCAATTGGTGTTATC) . 2 μL of this PCR product were subjected to a new round of 5 cycles (same conditions) PCR and loaded onto a 3% agarose gel for detection.

RESULTS

Target sequence conservation

To identify the target sequences, the genomic sequences of various known HIV-2 and SIV strains were compared in the ribozyme target region for exact conservation. Selection of conserved sites and preliminary results of enzyme activity in transient transfection studies led to the 9456 region at the 3' end of the viral mRNA. The Figure IB shows the alignment of this region in HIV and SIV strains. This target region is particularly useful because of its high degree of conservation in strains of both the human and non-human primate immunodeficiency virus. HIV-2 ROD is one of a few sequenced strains of HIV-2 in which the sequence in this area does not show 100% conservation with that of the target. However, even HIV-2 ROD should be cleaved by the ribozyme, since it has been determined that the nucleotide 5' of GUC is flexible.

Ribozyme expression in stable cell lines

The ribozyme gene was cloned into a retroviral vector, immediately adjacent to a polymerase III promoter, the human tRNA^val promoter, and upstream of the neomycin resistance gene. The resultant construct was transfected into an amphotrophic packaging cell line, which yielded retroviral particles for the subsequent transduction of the CEM/174 cells. The expression of the ribozyme by the G418-selected CEM/174 cells was checked by reverse transcription, followed by PCR, using a specific primer pair. Figure 2 shows the Southern blot depicting the amplified 60 bp product corresponding to the ribozyme being expressed in the stably transduced cells (lanes 1, 3, and 7) . To ensure that the DNA amplified originated from reverse-transcribed RNA, control reactions were performed excluding reverse transcriptase. Lanes 2, 4, and 6 show the results -- no detectable band. Lane 5 corresponds to RT PCR carried out on cells stably transduced with the parental vector, pLNL-6, which contains no ribozyme. Again, no band is visible, as expected.

Proliferation kinetics of transduced and control cells

One important issue was whether stable expression of the ribozyme in the transduced CEM/174 cells would induce cellular toxicity, possibly due to chance recognition of a cellular mRNA sequence. To examine this, 5xl0⁴ untransduced cells, as well as equal numbers of cells transduced with p9456 and pMJT were each resuspended in 10 mL fresh RIO and then counted every 2-3 days over a period of 8 days. pMJT is the retroviral vector construct into which a hairpin ribozyme targeting the HIV-1 U5 leader sequence was cloned into the same expression cassette. Figure 3 shows comparable growth rates among the three cell lines. The stably transduced cells also remained morphologically indistinguishable from the untransduced cells (data not shown) . Resistance to SIV challenge

The CEM/174 cells stably expressing the 9456 ribozyme showed 100% protection against infection with a pathogenic molecular clone of SIV_mac239 for up to 43 days. The experiment was terminated at this point. Figure 4 shows that despite an input virus m.o.i. of 0.02, further SIV replication was effectively inhibited in p9456t, as measured in terms of the levels of p26 viral core antigen. In contrast, untransduced cells and cells stably expressing pMJT both allowed substantial levels of virus replication upon infection; they offered no protection. A peak level of virus (80 ng/mL) was reached by day 15, and the cells died off completely just five days later, as is depicted by the end of the curve. Reduction of viral DNA burden A 120-base region of viral env-derived sequence was selected for PCR amplification from genomic DNA harvested from stably transduced CEM/174 cells infected with SIV_mac239 at an input m.o.i. of 0.1. Figure 5A shows that at 48 hours post-infection, there is a marked difference in the intensity of the 120 bp band between the untransduced cells (lanes 1 and 4) , those cells stably expressing the MJT ribozyme (lane 3) , and those stably transduced with p9456t (lane 2) . Figure 5B shows quantification of differences between band intensities via the ratio of densities of PCR products in the cells described in Figure 5A. In conclusion, the presence of the 9456 ribozyme resulted in a significant decrease in proviral DNA. This dramatic reduction is due to the ability of the 9456 ribozyme to cleave incoming viral RNA. Stable transduction of the hybrid B-/T/cell line, CEM/174, with the ribozyme construct described above resulted in G418-resistant cells that did not differ from untransduced cells in terms of growth or viability. Upon establishment of stable expression of the ribozyme gene, the selected cells were challenged with a pathogenic molecular clone of SIV_mac239. Similar results were also obtained using a construct in which expression of the ribozyme was driven by an HIV-2_KR LTR promoter. This construct is referred to as pMR94s (see, Figure IA) .

Regular monitoring of viral core antigen production showed that p26 was virtually undetectable up to 43 days post-challenge. These results show that the ribozyme conferred long-term resistance to SIV infection. This protection was most likely provided via the ribozyme's specific cleavage of the SIV RNA in both early and late phases of the viral replication cycle, as made evident by the dramatic reduction in proviral DNA burden measured in those cells stably expressing the ribozyme 48 hours after they were infected with an artificially high moi of input virus.

The above examples are provided to illustrate the invention but not to limit its scope. Other variants of the invention will be readily apparent to one of ordinary skill in the art and are encompassed by the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference for all purposes.

Claims

WHAT IS CLAIMED IS:

1. A ribozyme which specifically targets an RNA sequence from HIV and SIV.

2. The ribozyme of claim 1, which specifically targets an RNA sequence encoded by a sequence in the 3' terminal region of HIV and SIV.

3. The ribozyme of claim 1, which specifically targets a sequence encoded by

ATTCAGTCGCTCTGCG.

4. The ribozyme of claim 1, which has a sequence as shown in SEQ. ID. No. 1.

5. The ribozyme of claim 1, which is a hairpin ribozyme.

6. An isolated nucleic acid comprising a sequence encoding a ribozyme which specifically targets an RNA sequence from HIV and SIV.

7. The nucleic acid of claim 6, further comprising an expression cassette containing a promoter sequence operably linked to the sequence encoding the ribozyme.

8. The nucleic acid of claim 7, wherein the ribozyme specifically targets a sequence encoded by ATTCAGTCGCTCTGCG.

9. The nucleic acid of claim 7, wherein the ribozyme has a sequence as shown in SEQ. ID. No. 1.

10. The nucleic acid of claim 7, wherein the ribozyme is a hairpin ribozyme.

11. The nucleic acid of claim 7, wherein the promoter sequence is a human tRNA^val promoter.

12. The nucleic acid of claim 7, wherein the promoter sequence is from HIV-2_KR LTR.

13. The nucleic acid of claim 7, which is a retroviral vector.

14. The nucleic acid of claim 13, wherein the retroviral vector is p9456t.

15. The nucleic acid of claim 13, wherein the retroviral vector is pMR94S.

16. A cell comprising a sequence encoding a ribozyme which specifically targets an RNA sequence from HIV and SIV.

17. The cell of claim 16, wherein the cell is a macaque cell.

18. The cell of claim 16, wherein the cell is a human cell.

19. The cell of claim 16, wherein the cell is in a cell culture.

20. The cell of claim 16, wherein the ribozyme specifically targets an RNA sequence encoded by a sequence in the 3' terminal region of HIV and SIV.

21. The cell of claim 16, wherein the ribozyme specifically targets a sequence encoded by ATTCAGTCGCTCTGCG.

22. The cell of claim 16, wherein the ribozyme has a sequence as shown in SEQ. ID. No. 1.

23. A macaque comprising a sequence encoding a ribozyme which specifically targets an RNA sequence from HIV and SIV.

24. The macaque of claim 23, wherein the ribozyme specifically targets a sequence encoded by ATTCAGTCGCTCTGCG.

25. The macaque of claim 23, wherein the ribozyme has a sequence as shown in SEQ. ID. No. 1.

26. A method of improving gene therapy for treatment of HIV infection, the method comprising: administering a ribozyme which specifically targets an RNA sequence from HIV and SIV to a macaque; and monitoring SIV replication in the macaque.

27. The method of claim 26, wherein the ribozyme is administered to the macaque using CD34⁺ cells transduced with a retroviral vector containing the ribozyme.

28. The method of claim 27, wherein the retroviral vector is selected from the group consisting of pMR94s and p9456t.

29. The method of claim 27, further comprising the step of infecting the macaque with SIV after the step of administering the ribozyme.