DESCRTPTION
C-CAM EXPRESSION CONSTRUCTS
AND THFJR APPLICATION TN CANCER THERAPY
BACKGROUND OF THE INVENTION
Field of the Invention
10
The present invention relates generally to the field of tumor biology. In particular, the invention relates to a nucleic acid encoding a cell adhesion molecule (CAM) and its use in inhibiting tumor growth. In one aspect, the invention relates to expression constructs encoding C-CAM 1 and their use in inhibiting prostate and 15 breast cancer.
2. Description ofthe Related Art
Cancers are one ofthe leading causes of disease, being responsible for 526,000 20 deaths in the United States each year (Boring et al, 1993). The leading cancer among U.S. men is prostate carcinoma, a disease of epithelial origin. Almost 50% of patients diagnosed with prostate cancer have already developed metastatic lesions at initial clinical presentation, and an additional 20% of patients who initially have local disease will eventually develop metastasis. The standard regimen for metastatic 25 prostate cancer treatment is by androgen ablation. Despite the initial responsiveness to this treatment, tumor cells inevitably relapse to an androgen-independent (AI) state. The mortality associated with this cancer is mostly due to recurrent AI disease for t which effective therapeutic regimens are lacking.
Breast cancer is a major cause of morbidity and mortality in women in the United States, causing about 20% of all cancer deaths in women each year. This disease will develop in about six to seven percent of women in the United States each year, approximately of which half can be cured. Breast cancer is more likely in women who are older, have fibrocystic disease ofthe breast, have a history of breast cancer in their family, or have had cancer ofthe endometrium, ovary, or colon. There are several different types of tumors that form in the breast, each with unique characteristics. Most cancers ofthe breast are detected by the patients themselves, and the average size ofthe lesion is 2.5 cm. About half of these lesions have already metastasized to the lymph nodes. Early detection by self examination and mammography followed by biopsy to confirm breast cancer is currently the most effective regimen for diagnosis. The complexity of this malignancy thus offers a significant challenge to conventional cancer therapy strategies. Current treatment protocols include combinations of surgical removal ofthe cancerous tissue, chemotherapy, radiotherapy, and hormone ablation therapy.
With advances in molecular genetics and biology, it has become evident that altered expression of normal genes leads to initiation of cancer cells. The conventional therapy for malignancy, such as chemotherapy and radiation, has focused on mass cell killing without specific targeting, often resulting in damaging side effects. The new direction in cancer therapy is to deliver a normal gene to replace or correct the mutated gene, thereby altering the malignant phenotype of transformed cells. Several expression constructs have been developed in order to deliver a gene into somatic cells with high efficiency.
Cells can be regulated in a positive (stimulatory) or negative (suppressive) manner. Loss of negative regulation of cell growth is often found in malignant cells which exhibit loss of cell proliferation control. Accumulating molecular genetic evidence has revealed that loss of negative regulators or increase in positive regulators in normal cells will produce such cellular growth abnormalities. Most negative regulators (Marx, 1993; Grunicke and Maly, 1993), referred to as tumor suppressors,
have been found to be involved either in direct control ofthe cell cycle (e.g., Rb, p53, WT-1) or in the signaling pathway leading to cell growth and differentiation (e.g., NF- > 1). In addition, recent data suggest that genes related to the maintenance of cell architecture and polarity also may function as tumor suppressors (Marx, 1993; Fearon 5 et al. , 1990; Trofatter et al. , 1993).
Cell adhesion molecules, or CAM's are known to be involved in a complex network of molecular interactions that regulate organ development and cell differentiation (Edelman, 1985). Recent data indicate that aberrant expression of CAM's maybe involved in the tumorigenesis of several neoplasms; for example, 10 decreased expression of E-cadherin, which is predominantly expressed in epithelial cells, is associated with the progression of several kinds of neoplasms (Edelman and Crossin. 1991; Frixen et al., 1991; Bussemakers et al., 1992; Matsura et al., 1992; Umbas et al., 1992). Also, Giancotti and Ruoslahti (1990) demonstrated that increasing expression of α5βj integrin by gene transfer can reduce tumorigenicity of 15 Chinese hamster ovary cells in vivo.
C-CAM is expressed in virtually all epithelial cells (Odin and Obrink, 1987). C-CAM, with an apparent molecular weight of 105 kD, was originally isolated from the plasma membrane ofthe rat hepatocyte by its reaction with specific antibodies that neutralize cell aggregation (Obrink, 1991). Recent studies indicate that, structurally, 20 C-CAM belongs to the immunoglobulin (Ig) superfamily and its sequence is highly homologous to carcinoembryonic antigen (CEA) (Lin and Guidotti, 1989). Using a baculovirus expression system, Cheung et al. (1993 a) demonstrated that the first Ig domain of C-CAM is critical for cell adhesive activity.
During liver development, expression of both C-CAM isoforms correlates 25 with differentiation of hepatocytes; the regulation of C-CAM expression is mainly transcriptional (Cheung et al., 1993b; Thompson et al., 1993). Hixson and McEntire (1989) reported an apparent decrease in C-CAM on the cell surface of rat I hepatocellular carcinoma lines. In addition, Rosenberg et al. (1993) and Neumaier et al. (1993) demonstrated that mouse and human biliary glycoprotein, a C-CAM
homologue, is down-regulated in colon tumors. Little is known, however, about the role of C-CAM in cancer progression.
3. Summary of he Invention
The present invention addresses the need for improved therapy for prostate cancer, breast cancer and other CAM-associated diseases by providing an expression construct containing a nucleic acid encoding a C-CAM. It also is an object ofthe present invention to provide methods for the use of such compositions and, in particular, use in the treatment of cancer. In another embodiment, the present invention encompasses methods for transforming cells using a C-CAM nucleic acid in an expression construct.
The present invention also encompasses expression constructs that comprises a promoter functional in eukaryotic cells and a nucleic acid encoding a C-CAM, the nucleic acid being under transcriptional control ofthe promoter.
In a preferred embodiment, the expression constructs further comprise a polyadenylation signal. In another embodiment, the constructs further comprise a selectable marker. In a further embodiment, the expression construct is an adenovirus. In a preferred embodiment, the expression construct is an adenovirus that lacks at least a portion of the El region.
In certain embodiments, the nucleic acid is a cDNA. In other embodiments the nucleic acid is a genomic DNA. In an exemplary embodiment the nucleic acid is positioned in a sense orientation with respect to said promoter. In another embodiment the nucleic acid is positioned in an antisense orientation. The present invention also includes pharmaceutical compositions comprising an expression construct with a promoter functional in eukaryotic cells and a nucleic acid encoding a C-CAM, along with a pharmaceutically acceptable buffer, solvent or diluent. In certain embodiments, the expression construct and pharmaceutically acceptable buffer, solvent or diluent are supplied in a kit.
The invention also provides a method for restoring C-CAM function in a cell that lacks C-CAM function. This method comprises contacting such a cell with an expression construct as described above, wherein the nucleic acid is positioned in a sense orientation. In an exemplary embodiment ofthe invention, the cell is a transformed cell and the said contacting reverses the transformed phenotype. In a further embodiment, the cell is a prostate rumor cell or a breast tumor cell and, in still a further embodiment, the expression construct is an adenovirus.
The present invention further comprises a method for inhibiting C-CAM function in a cell. This method comprises contacting such a cell with an expression construct as described above, wherein the nucleic acid is positioned in an antisense orientation. In a further embodiment, the expression construct is an adenovirus.
Another embodiment ofthe invention is a method of treating a mammal with cancer. This method comprises administering to an animal a pharmaceutical composition comprising an expression construct having a promoter functional in eukaryotic cells and a nucleic acid encoding a C-CAM, positioned in a sense orientation, in a pharmaceutically acceptable buffer, solvent or diluent. In a particular embodiment ofthe invention, the mammal is a human. In another embodiment, administering is via intravenous injection. In a further embodiment, the cancer is prostate, breast or bladder cancer. In further embodiments the present invention encompasses methods for detecting cancer cells in a sample by detecting a C-CAM or a nucleic acid encoding a C-CAM.
4. Brief Description of the Drawings
FIG. 1. Linear structure of C-CAM. From the deduced amino acid sequence a linear structure composed of several distinct domains can be predicted. The protein contains two hydrophobic domains, one putative signal sequence in the N-terminal end (indicated by a dashed line) and one transmembrane domain (indicated by a cross-
hatched rectangle) near the C-terminal end. Four immunoglobulin-like domains can be predicted: the most N-terminal one is a V-like domain, the other three are C-2 domains. The C-2 domains, but not the V-like domain, have cysteine residues that could be involved in intradomain disulfide linkages. A consensus sequence for cAMP-dependent phosphorylation (indicated by a "P" in a circle) is found close to the C-terminal end. The protein contains 16 sites for N-linked glycosylation (indicated by a black dot connected to a line). The location ofthe glycosylation sites suggests that the major N-terminal portion of C-CAM is exposed on the extracellular side, and that the C-terminal end is located on the cytoplasmic side ofthe plasma membrane.
FIG. 2A. Staining profile of transfected PC-3 cells. PC-3 cells (1 x IO4) transfected with C-CAM1 cDNA were stained with Ab669 and FITC-conjugated secondary antibodies and subjected to FACS analysis. The dual-parameter histograms show relative cell size (x-axis), as measured by forward light scatter and log of C- CAMl expression levels (y-axis), as measured by the intensity of green fluorescence emitted by FITC-stained cells. Positive staining was defined as staining intensity greater than 10 FITC units, 10 FITC units being the background level for cells stained with preimmune serum.
FIG. 2B. Staining profile of enriched C-CAM 1 -positive cell population (cell recovery and cell purity were 93-98% after sorting). PC-3 cells (1 x 10 ) transfected with C-CAM 1 cDNA were stained with Ab669 and FITC-conjugated secondary antibodies and subjected to FACS analysis. The dual-parameter histograms show relative cell size (x-axis), as measured by forward light scatter and log of C-CAM 1 expression levels (y-axis), as measured by the intensity of green fluorescence emitted by FITC-stained cells. Positive staining was defined as staining intensity greater than 10 FITC units, 10 FITC units being the background level for cells stained with preimmune serum.
FIG. 3. Adhesion of C-CAM1 Transfected PC-3 Cells. Single-cell suspensions of PC-3 cells, PC-RSN cells, and C-CAM 1 transfected clones were prepared by trypsin digestion of cells from tissue culture plates. One million cells were incubated at room temperature with constant mixing. At the indicated times, the number of single cells was counted with a hemacytometer as described in Materials and Methods, Example II. Legend: PC-3 (open triangles), PC-RSN (closed circles), PC-LI (open circles), PC-L2 (closed triangles), PC-L6 (closed square), PC-L9 (open square).
FIG. 4A. In vitro growth rate of C-CAM 1 -transfected PC-3 clones as determined by crystal violet staining. Five thousand cells were plated on a 24-well plate in the presence of T medium containing 1% FBS. The medium was changed every 4 days, and the number of cells was determined every 48 hr by the crystal violet assay. Legend: PC-3 (closed circles), PC-RSN (open triangles), PC-LI (open circles), PC-L2 (closed triangles), PC-L6 (closed square), PC-L9 (open square).
FIG. 4B. In vitro growth rate of C-C AMI -transfected PC-3 clones as determined by [ Hjthymidine incorporation. Five thousand cells were plated as in FIG. 4A. Fresh medium containing OJ mCi of [ Hjthymidine was added and, after 2 hr, the cells were harvested and the amount of [3H]thymidine incorporated into the cells was determined. Columns = mean; bars = SD.
FIG. 5A. Study 1 - Change in Tumor Volume of C-CAM 1 -Transfected PC-3 Cells In vivo. Each animal was injected subcutaneously at six sites. The volume of each tumor was recorded weekly when tumors became palpable. Legend: PC-3 (closed circles), PC-RSN (open triangles), PC-LI (open circles), PC-L2 (closed triangles).
FIG. 5B. Study 2 - Change in Tumor Volume of C-CAMl -Transfected PC-3 Cells In vivo. Each animal was injected subcutaneously at six sites. The volume of each tumor was recorded weekly when tumors became palpable. Legend: PC-RSN (open triangles), PC-L6 (closed square), PC-L9 (open square).
FIG. 6. C-CAMl recombinant adenovirus construction. A full-length C- CAM1 cDNA (2.1 kB) was first cloned into the EcoRI site ofthe pBSK vector with two possible orientations (sense and antisense). Subsequently, either strand of C- CAM1 insert was directional cloned into the H DIII (5') and Not I (3') sites of p AdΕ 1 CMV/p A under the control of a CMV promoter, p JM 17 vector contains both viral genome and pBR322 sequences indicated by triangle. Plaques appeared between day 8 and day 10. Each clone of adenovirus was subjected to structural analysis, mu = map unit.
FIG. 7. Determination ofthe genome structure of C-CAMl adenovirus by
PCR. The AdCAM genome of 36 kB is divided into 100 map units (1 mu = 0.36 kB). The C-CAM expression cassette replaced the El region (1.3-9.2 mu) ofthe Ad5 genome. To confirm the structure of AdCAM, three different sets of primers were used. Primer set A is designed to amplify a 300-bp transcript from the C-terminus of C-CAMl cDNA. Primer set B, including the forward primer from the first intron downstream of human CMV major IE gene promoter and reverse primer from SV40 early polyadenylation signal, is designed to amplify 2.1 -kb ofthe cDNA insert. Primer set C, with two primers localized at 11 and 13.4 mu, is designed to amplify the
Ad5 genome-specific sequences (~0.86-kb PCR product). mu = map unit.
FIG. 8A. Efficiency of infection by adenovirus in PC-3 cells as determined by flow cvtometry. Cells were infected with PBS as a control for 1 day. At the indicated times, the percentage of infected cells was determined using immunofluorescence staining by fluorescent-activated cell scanning analysis. The dual-parameter
histogram represents relative cell size (x-axis) measured from forward light scatters (FSC) and log of C-CAMl expression levels (y-axis) measured from the green fluorescence intensity emitted by FITC-stained cells. Positive staining was defmed as staining intensity greater than 20 FITC units, which was the background level from control cells as well as the levels from AdCAMlOl -infected cells stained with antibodies. Fraction of C-CAM-positive cells = 2%.
FIG. 8B. Efficiency of infection by adenovirus in PC-3 cells as determined by flow cytometry. Cells were infected with AdCAMlOl (1,000:1 virions:cell) for 1 day. Fractions of C-CAM-positive cells = 1%.
FIG. 8C. Efficiency of infection by adenovirus in PC-3 cells as determined by flow cytometry. Cells were infected with AdCAM902 (100:1 virions:cell) for 1 day. Fractions of C-CAM-positive cells = 48%.
FIG. 8D. Efficiency of infection by adenovirus in PC-3 cells as determined by flow cytometry. Cells were infected with AdCAM902 1,000:1 virionsxell) for 1 day. Fractions of C-CAM-positive cells = 93%.
FIG. 8E. Efficiency of infection by adenovirus in PC-3 cells as determined by flow cytometry. Cells were infected with PBS as a control for 2 days. Fractions of C- CAM-positive cells = 4%.
FIG. 8F. Efficiency of infection by adenovirus in PC-3 cells as determined by flow cytometry. Cells were infected with AdCAMlOl (1,000:1 virionsxell) for 2 days. Fractions of C-CAM-positive cells = 6%.
FIG. 8G. Efficiency of infection by adenovirus in PC-3 cells as determined by flow cytometry. Cells were infected with AdCAM902 (100:1 virions: cell) for 2 days. Fractions of C-CAM-positive cells = 62%.
FIG. 8H. Efficiency of infection by adenovirus in PC-3 cells as determined by flow cytometry. Cells were infected with AdCAM902 1,000:1 virionsxell) for 2 days. Fractions of C-CAM-positive cells = 92%.
FIG. 81. Efficiency of infection by adenovirus in PC-3 cells as determined by flow cytometry. Cells were infected with PBS as a control for 4 days. Fractions of C- CAM-positive cells = 2%.
FIG. 8J. Efficiency of infection by adenovirus in PC-3 cells as determined by flow cytometry. Cells were infected with AdCAMlOl (1,000:1 virionsxell) for 4 days. Fractions of C-CAM-positive cells = 2%.
FIG. 8K. Efficiency of infection by adenovirus in PC-3 cells as determined by flow cytometry. Cells were infected with AdCAM902 (100:1 virionsxell) for 4 days. Fractions of C-CAM-positive cells = 77%.
FIG. 8L. Efficiency of infection by adenovirus in PC-3 cells as determined by flow cytometry. Cells were infected with AdCAM902 1,000:1 virionsxell) for 4 days. Fractions of C-CAM-positive cells = 95%.
FIG. 9. The tumor-suppressing effect of C-CAMl adenovirus on PC-3 tumors. Fourteen tumors were treated in each group. A single dose of 50 ml of either control (PBS + 10% glycerol) or viral solution (5xl0n AdCAMlOl or AdCAM902 virions/ml in PBS + 10% glycerol) was injected subcutaneously above the tumor mass 20 days after inoculation with PC-3 cells. Tumor volume was recorded every week
and tabulated as mean± standard deviation (indicated by error bars). Arrow indicates viral injection. Legend: control (closed triangles), AdCAMlOl (open circles), AdCAM902 (closed circles).
FIG. IOA. Control - Determination ofthe treatment schedule of C-CAMl adenovirus for PC-3 tumors. Five tumors (each indicated by a different symbol) were treated in each group. Control: a dose of 50 ml of PBS + 10% glycerol was injected once a week for three consecutive weeks when tumor volume was larger than 40 mm . Tumor volume was recorded every week. Arrow indicates viral injection.
FIG. 10B. AdCAMlOl - Determination ofthe treatment schedule of C-CAMl adenovirus for PC-3 tumors. Five tumors (each indicated by a different symbol) were treated in each group. 5x1011 AdCAMlOl virions/ml in PBS + 10% glycerol was injected once a week for three consecutive weeks when tumor volume was larger than 40 mm . Tumor volume was recorded every week. Arrow indicates viral injection.
FIG. IOC. AdCAM902 - Determination ofthe treatment schedule of C-CAMl adenovirus for PC-3 tumors. Five tumors (each indicated by a different symbol) were treated in each group. A dose of 5xlOπ AdCAM902 virions/ml in PBS + 10% glycerol was injected once a week for three consecutive weeks when tumor volume wwaass llaarrggeerr tthhaan 40 mm . Tumor volume was recorded every week. Arrow indicates viral injection
FIG. 11. Structure of wild type and mutant C-CAM proteins. The Ig domains are labeled Dl to D4. sig, signal sequence; L, linker domain; TM, transmembrane domain; cyto, cytoplasmic domain.
FIG. 12A. Controls - Effects of C-CAMl and its mutants on the tumorigenicity of MDA-MB-468 cells in vivo. MDA-MB-468 cells were uninfected,
infected with AdCAM 1 -AS, or infected with AdCAM 1. Twenty-four hours after infection, the cells were injected subcutaneously into nude mice at 10 cells per site. Each column represents one tumor site. The tumor sizes were recorded at four weeks.
FIG. 12B. Mutants - Effects of C-CAMl and its mutants on the tumorigenicity of MDA-MB-468 cells in vivo. MDA-MB-468 cells were infected with AdCAMl-ΔDl, AdCAMl-H458 or AdCAMl-G454. Twenty-four hours after infection, the cells were injected subcutaneously into nude mice at 10 cells per site. Each column represents one tumor site. The tumor sizes were recorded at four weeks.
FIG. 13. Aggregation of MDA-MB-468 cells expressing C-CAMl mutants. MDA-MB-468 cells were infected with AdCAMl or the mutants indicated, and the cell adhesion assay was performed as described in Example IX. The aggregation of cells is expressed as the decrease in the percentage of single cells.
Detailed Description ofthe Preferred Embodiments
The present inventors now have determined that C-CAM can act as a tumor suppressor. In light of this observation, there are at least two uses for C-CAM-related nucleic acids and constructs for their expression. First, in the context of cell culture, it may be possible to generate C-CAM negative cells by targeting endogenous C-CAM with antisense methodology in order to immortalize such cells. This may prove particularly interesting in the generation of cell lines for the study of cancer and, in particular, prostate and breast cancer. Second, the present invention addresses the need for improved therapy for cancer and other C-CAM-associated diseases. In particular, an expression construct capable of expressing a functional C-CAM product can be used to inhibit tumor cell proliferation. The following description provides a more detailed explanation of these and other aspects ofthe present invention.
C-CAM AND C-CAM-RELATED NUCLEIC ACIDS
A. C-CAM
The nucleic acid of the present invention may encode an entire C-CAM gene, a functional C-CAM protein domain. or any C-CAM polypeptide, peptide or fragment that is sufficient to affect cell adhesion. The C-CAM nucleic acid may be derived from genomic DNA, i.e., cloned directly from the genome of a particular organisms. In preferred embodiments, however, the nucleic acid encoding C-CAM would comprise of complementary DNA (cDNA). The term "cDNA" used here, is intended to refer to DNA prepared using messenger RNA (mRNA) as template. The advantage of using a cDNA, as opposed to genomic DNA or DNA polymerized from a genomic DNA or non- or partially-processed RNA template, is that the cDNA does not contain any non-coding sequences but, rather, contains only the coding region ofthe corresponding protein. There may be times when the full or partial genomic sequence is preferred, however, such as where the non-coding regions are required for optimal expression or where non-coding regions such as introns are to be targeted in an antisense strategy. Throughout the application, the term C-CAM is intended to refer to the rat C-CAM or cell-CAM 105, the human C-CAM homologue (biliary glycoprotein 1 (BGP1)), and all C-CAM homologues from other species.
(i) C-CAM Protein Structure C-CAM, like all other known cell adhesion molecules (CAMs), are large intrinsic cell-surface glycoproteins that are mobile in the plane ofthe membrane (Gall and Edelman 1981; Pollerberg et al, 1986). CAMs mediate cell recognition and adhesion and are of prime importance for the formation and integrity of tissues. The majority ofthe known CAMs belongs to one ofthe following families: -the immunoglobulin (Ig) superfamily (Williams et al, 1988), the cadherin family (Takeichi, 1988), the integrin superfamily (Hynes, 1987), the LEC-CAM family (Stoolman, 1989) and the H-CAM family (Stoolman, 1989). The cell adhesion
molecule C-CAM belongs to the immunoglobulin superfamily, and more specifically is a member ofthe carcinoembryonic antigen (CEA) gene family.
The Ig-superfamily is a large family that, in addition to the immunoglobulins, contains many other proteins, the majority being involved in cellular recognition phenomena (Williams et al, 1988). The common building block is the immunoglobulin domain of about 100 amino acid residues that is arranged as a sandwich of two sheets of anti-parallel β-strands. Different members ofthe superfamily have varying numbers of Ig-like domains. A list of putative CAMs presently known, that belong to the Ig-superfamily, is given in Table 1. One characteristic feature of CAMs in the Ig-superfamily is that they are calcium- independent, that is, they do not need calcium ions for their binding activity. Both homophilic and heterophilic binding occur among the members of this family.
There seem to be several subfamilies of CAMs in the Ig-superfamily. One of these is the carcinoembryonic antigen (CEA) family (Benchimol et al, 1989), which contains a large number of different proteins that can be either transmembrane, GPI- linked, or secreted (Khan et al, 1989). Several ofthe members ofthe CEA family cross-react immunologically. It has been reported that both CEA itself, which has seven Ig-domains, and NCA (nonspecific cross-reactive antigen), which has three Ig- domains can function both as homophilic and heterophilic, calcium-independent cell adhesion molecules (Benchimol et al. , 1989; Oikawa et al. , 1989).
A close examination ofthe amino acid sequence of rat C-CAM reveals that it is a member ofthe immunoglobulin superfamily (Aurivillius et al, 1990). Lin and Guidotti noted that the ecto-ATPase/C-CAM is highly homologous to human biliary glycoprotein 1 (BGPl), with 65% ofthe amino acids being identical (Lin et al, 1989). BGP 1 is a member of the CEA-family (Aurivillius et al. , 1990; Lin et al. , 1989). Thus, it has been concluded that C-CAM belongs to the CEA-subfamily of the immunoglobulin superfamily.
So far, two C-CAM isoforms, C-CAMl and C-CAM2, have been identified. Both isoforms are composed of a cytoplasmic domain, a 25 amino acid long
transmembrane domain, and an extracellular domain with four Ig-like domains (FIG. 1). Sixteen potential sites for N-glycosylation are found in the extracellular domain, a finding that agrees well with the chemical determination ofthe carbohydrate content in the mature protein (Obrink 1991). C-CAMl and C-CAM2 differ in their first Ig domains by 16 amino acids and in the length of their cytoplasmic domains (Culic et al, 1992). C-CAMl, but not C-CAM2, shows adhesion activity when expressed in a baculoviral vector in insect cells (Cheung et al, 1993a). C-CAM binds to itself in a homophilic manner. Further structural and functional analyses of C-CAMl by Cheung et al. (1993 a) indicated that the presence ofthe first Ig domain is essential for adhesion.
Table 1. CAMs in the Ig-superfamily
CAM Cell Type Species References
N-CAM Neuron, glia Mammals, birds, Williams et al, 1988 muscle amphibians Hansson et al, 1990
L-l Ng-CAM Neuron Ep Mouse, rat, Moos et al, 1988
NILE G4 Gila chicken Salzer et α/., 1987
MAG Man, mouse, rat, chicken, cow
Po Schwann Rat Lemke et al, 1988
Contactin Neuron Chicken Ranscht, 1988
Fl i Neuron Chicken Brϋmmendorf et al. , 1989
F3 Neuron Mouse Gennarini et al. , 1989
Fasciclin II Neuron Grasshopper Harrelson et tf/., 1988
Neuroglian Neuron, glia, Drosophila Bieber et α/., 1989 many other cell types
Amalgam Neuron Drosophila Seeger et α/,, 1988
TAG-1 Neuron Rat Furley et α/., 1990
C-CAM Ep. En. Lc. Rat, man άm et al, 1988;
Tingstrom et al. , 1990; Aurivillius et al, 1990
Table 1. CAMs in the Ig-superfamily (continued)
CAM Cell Type Species References
CEA Ep. Man Benchimol et al, 1989
NCA Ep. Lc. Man Oikawa et α/., 1989
DCC Ep. Man Fearoz et α/., 1990
GP42 Fibroblast Mouse Altruda et α/., 1989
MUC18 Melanoma Man Lehmann et α/., 1989
PECAMl/End Lc. En. 5M. Trc Man, cow Newman et al, 1990 o-CAM/CD31 En Man Elices et α/., 1990
VCAM1/ Lc. many cell Man, mouse Staunton et a/., 1988
INCAM-110 types Man Staunton et α/., 1989
ICAM1/CD54 En Man Streuli et α/., 1988
ICAM-2 Ly. kidney,
LAR prostate
CD2 Ly Man Williams and Barclay, 1988
LFA-3/CD58 Many cell types Man Williams and Barclay, 1988
CD4 Ly Man, mouse Williams and Barclay, 1988
CD8 Ly Man, mouse Williams and Barclay, 1988
MHC I All kinds Man, mouse, etc. Williams and Barclay, 1988
MHC II Mo. dendritic Man, mouse, etc. Williams and Barclay, 1988
TCR T-cells Man, mouse, etc. Williams and Barclay, 1988
CD28 T-cells Man Linsley et al, 1990
B7/BB-1 B-cells Man, mouse Linsley et al, 1990
B29 B-cells Mouse Hermanson et al, 1988
(ii) C-CAM Location and Function C-CAM antigens are expressed in a number of organs of mature rats (Odin et al, 1988). The tissue distribution within these organs is, however, limited. Thus. C- CAM is primarily expressed in various epithelia (including hepatocytes ofthe liver), endothelia of capillaries, small arteries and veins, and in megakaryocytes, platelets,
polymo honuclear leukocytes and a subset of mononuclear leukocytes (Odin et al, 1988). It has not been found in nervous tissues, muscle tissues or connective tissues.
C-CAM appears rather late in the fetal development ofthe liver and goes through transient down-regulation during regeneration after partial hepatectomy (Odin et al. , 1986). In this context, it is also interesting to note that the expression of C- CAM is significantly altered in hepatocellular carcinomas, so that it is either missing or chemically modified (Hinson et al, 1985; Hinson et al, 1989). In addition, Rosenberg et al. (1993) and Neumaier et al. (1993) demonstrated that mouse and human biliary glycoprotein, a C-CAM homologue, is down-regulated in colon tumors.
Odin et al. (1988) using highly sensitive immunodetection systems were not able to detect C-CAM in the prostate gland nor the epithelium ofthe urinary bladder. Yet the inventors have not only detected C-CAM in prostate and bladder cells but also identified the role of C-CAM in in these cells as a tumor cell supressor. C-CAM has not been detected in breast cancer cells, yet it is able to act as a tumor suppressor, as disclosed in Example X. The urinary bladder is a musculomembranous sac, situated in the anterior part ofthe pelvic cavity, that serves as a reservoir for urine which it recieves through the ureters and discharges through the urethra. While the prostate is a male gland that surrounds the neck ofthe bladder and the urethra. Example V, disclosed herein, demonstrated that C-CAM was associated with basal cells from the normal prostate gland obtained from fetal, juvenile and adult prostate. In contrast, there is a complete disappearance of C-CAM in prostate carcinoma, suggesting that down-regulation of C-CAM is associated with the onset of hyperplastic/neoplastic transformation. Examples I through IV, demonstrated that expression of C-CAMl suppresses the tumorigenicity of a prostatic cancer cell line, PC-3. Also, using an antisense strategy, endogenous C-CAM expression in a nontumorigenic prostatic epithelial cell line (NbE) was reduced, thereby inducing tumor formation by these cells. In Examples VI and VII, the delivery of C-CAM adenovirus was able to repress the growth of PC-3 induced tumors in mice. Finally,
Example X demonstrated that expression of C-CAMl suppressses the in vivo growth of a breast cancer cell line, MDA-MB-468.
Although a preferred embodiment ofthe invention is the inhibition of tumor proliferation, transformation and detection of cancer in prostate, breast and bladder cells, any cell or tissue which is affected by C-CAM expression is within the scope of this invention.
(iii) C-CAM Mechanism of Action Although the mechanisms by which C-CAM affects these processes are not clear, these cell-surface adhesion molecules most likely exert their biological effects through interactions with other cellular molecules, that transduce outside signals into the cells. For example, the integrins, which are Ca2+-dependent CAMs known to interact with a variety of extracellular matrices, have been shown to associate with several intracellular tyrosine kinases (Luna and Hitt, 1992). On the other hand, CAMs have also been shown to participate in the organization of cell architecture by connecting cytoskeleton molecules through an adherens-junction protein complex. Recent molecular genetic analyses (Trofatter et al, 1993) suggest that a potential tumor suppressor gene (NF-2) involved in neurofibromatosis belongs to the family of adherens junction molecules. Also, in the case of E-cadherin, at least three cytoplasmic proteins, α-, β-, and γ-catenin, are associated with the cytoplasmic domain of cadherin (Takeichi, 1991). These associated proteins, which are part ofthe adherens junction proteins, play important roles in maintaining cellular architecture (Geiger, 1983). Consistent with this observation, recently it was found that α- and β- catenin were also associated with the product of a potential tumor suppressor gene involved in colon carcinogenesis, APC (Rubinfeld et al , 1993 ; Su et al. , 1993). These observations suggest that a cell-adhesion molecule can regulate cell growth through indirect interactions with a tumor suppressor.
The cytoplasmic domain of C-CAMl contains several potential phosphorylation sites, including one for cAMP-dependent kinase and one for tyrosine
kinase. The putative tyrosine phosphorylation sequence is also within the consensus sequence for the antigen-receptor homology domain (Cambier and Campbell, 1992) that is postulated to be important for signal transduction from membrane-bound IgM molecules in B cells. These structural features suggest that the cytoplasmic domain of C-CAMl may be critical for signal transduction and that C-CAMl may interact with other kinases to elicit a negative signal for cell growth. Examples IX and X, disclosed herein, demonstrated that the cytoplasmic domain of C-CAMl is involved in suppressing growth ofthe breast tumor cell line MDA-MB-468, and that adhesion does not appear to be required for tumor suppression. It is also possible that the cytoplasmic domain of C-CAM 1 interacts with cytoskeletal proteins that modulate cellular morphology.
(iv) C-CAM and Cell Adhesion While nucleic acid encoding a C-CAMl (as disclosed herein as SEQ ID NOJ) is the preferred embodiment ofthe invention, it is believed that nucleic acid encoding C-CAM-related proteins will also function according to the present invention. For example, in certain embodiments, nucleic acids encoding any one ofthe domains of C-CAM, as seen in FIG. 1 and described above, may function according to the present invention. Thus, one embodiment ofthe invention may comprise a nucleic acid encoding all or part ofthe cytoplasmic domain, with or without phosphorylation sites. In another embodiment ofthe invention, a nucleic acid may encode for all, part or none ofthe transmembrane portion of C-CAM. In a further embodiment, a nucleic acid may encode for part or all ofthe extracellular domain, with or without sites for N-glycosylation. In yet a further embodiment, a nucleic acid encoding a domain or peptide from another CAM, such as a member ofthe Ig superfamily listed ih Table 1, may be included in the present invention. It is envisioned that, without undue experimentation, a nucleic acid encoding a CAM may be obtained comprising of several different CAM domains or peptides and still function according to the present invention.
It is also envisioned that a nucleic acid encoding a C-CAM or a related C- CAM may have variations within its sequences that are biological functional equivalents (see below). In order to function according to the present invention the nucleic acid encoding a C-CAM must affect cell adhesion. To test for such an affect, it is a simple matter to assay binding of a protein, encoded by a C-CAM nucleic acid, in vitro or by the use of transfection techniques as described in the Examples and disclosed herein.
In vitro binding assays have been performed on N-CAM and Ng-CAM linked to Covaspheres or other solid substrates, or in artificial lipid vesicles (Hoffman and Edelman, 1983; Sadoul et al. , 1983 ; Grumet and Edelman, 1988) to determine CAM binding kinetics and mechanisms. These methods also may be employed, alone or in conjunction with other methods, to determine the affect of related C-CAMs on adhesion.
Preferred methods for testing the affect a nucleic acid encoding a C-CAM has on cell adhesion properties, include the use of transfection studies. Methods for transfecting cells in vitro and for assaying cell adhesion and anchorage-independent growth are described in detail in Examples I through III, and IX, while assessment of in vivo tumorigenicity is described in Examples III, VI, VII and X.
(v) C-CAM Biological Functional Equivalents
As used in this application, the term "nucleic acid encoding a C-CAM" refers to a nucleic acid molecule that has been isolated free of total cellular nucleic acid. In preferred embodiments, the invention concerns a nucleic acid sequence essentially as set forth in SEQ ID NO: 1. The term "as set forth in SEQ ID NO: 1 " means that the nucleic acid sequence substantially corresponds to a portion of SEQ ID NOJ and has relatively few codons that are not identical, or functionally equivalent, to the codons of SEQ ID NOJ . The term "functionally equivalent codon" is used herein to refer to codons that encode the same amino acid, such as the six codons for arginine or serine,
and also refers to codons that encode biologically equivalent amino acids (as in Table 2 below).
Allowing for the degeneracy ofthe genetic code, sequences that have between about 50% and about 75%; or niore preferably, between about 76% and about 99% of nucleotides that are identical to the nucleotides of SEQ ID NOJ will be sequences that are "as set forth in SEQ ID NO: 1 ". Sequences that are essentially the same as those set forth in SEQ ID NOJ may also be functionally defined as sequences that are capable of hybridizing to a nucleic acid segment containing the complement of SEQ ID NO: 1 under standard conditions. Suitable hybridization conditions will be well known to those of skill in the art and are clearly set forth herein, e.g., see Example I.
Table 2.
Amino Acids Codons
Alanine Ala A ' GCA GCC GCG GCU
Cysteine Cys C UGC UGU
Aspartic acid Asp D GAC GAU
Glutamic acid Glu E GAA GAG
Phenylalanine Phe F UUC UUU
Glycine Gly G GGA GGC GGG GGU
Histidine His H CAC CAU
Isoleucine Ile I AUA AUC AUU
Lysine Lys K AAA AAG
Leucine Leu L UUA UUG CUA cue CUG cuu
Methionine Met M AUG
Asparagine Asn N AAC AAU
Proline Pro P CCA CCC CCG ecu
Glutamine Gin Q CAA CAG
Arginine Arg R AGA AGG CGA CGC CGG CGU
Serine Ser S AGC AGU UCA UCC UCG UCU
Threonine Thr T ACA ACC ACG ACU
Valine Val V GUA GUC GUG GUU
Tryptophan Trp w UGG
Tyrosine Tyr Y UAC UAU
Naturally, the present invention also encompasses DNA segments that are complementary, or essentially complementary, to the sequence set forth in SEQ ID NO:I Nucleic acid sequences that are "complementary" are those that are capable of base-pairing according to the standard Watson-Crick complementary rules. As used herein, the term "complementary sequences" means nucleic acid sequences that are substantially complementary, as may be assessed by the same nucleotide comparison set forth above, or as defined as being capable of hybridizing to the nucleic acid segment of SEQ ID NO:I under relatively stringent conditions such as those described herein. The DNA segments ofthe present invention include those encoding biologically functional equivalent C-CAM proteins and peptides. Such sequences may arise as a consequence of codon redundancy and functional equivalency that are known to occur naturally within nucleic acid sequences and the proteins thus encoded. Alternatively, functionally equivalent proteins or peptides may be created via the application of recombinant DNA technology, in which changes in the protein structure may be engineered, based on considerations ofthe properties ofthe amino acids being exchanged. Changes designed by man may be introduced tlirough the application of site-directed mutagenesis techniques, e.g., to introduce improvements to the adhesiveness ofthe protein or to test mutants in order to examine signal transducing activity at the molecular level.
If desired, one may also prepare fusion proteins and peptides, e.g., where the C-CAM coding regions are aligned within the same expression unit with other proteins or peptides having desired functions, such as for purification or immunodetection purposes (e.g., proteins that may be purified by affinity chromatography and enzyme label coding regions, respectively).
It will also be understood that amino acid and nucleic acid sequences may include additional residues, such as additional N-or C-terminal amino acids or 5 ' or 3' sequences, and yet still be essentially as set forth in one ofthe sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological protein activity where protein expression is concerned. The addition of terminal sequences particularly applies to coding nucleic acid sequences that may, for example, include various non-coding sequences flanking either of the 5' or 3' portions ofthe coding region, such as promoters.
As mentioned above, modification and changes may be made in the structure of C-CAM (as exemplified by SEQ ID NO:2) and still obtain a molecule having like or otherwise desirable characteristics. For example, certain amino acids may be substituted for other amino acids in a protein structure without appreciable loss of interactive binding capacity with structures such as, for example, antigen-binding regions of antibodies or binding sites on substrate molecules, receptors, or signal transduction. Since it is the interactive capacity and nature of a protein that defines that protein's biological functional activity, certain amino acid sequence substitutions can be made in a protein sequence (or, of course, its underlying DNA coding sequence) and nevertheless obtain a protein with like (agonistic) properties. Equally, the same considerations may be employed to create a protein or polypeptide with countervailing (e.g., antagonistic) properties. It is thus contemplated by the inventors that various changes may be made in the sequence of C-CAM proteins or peptides (or underlying DNA) without appreciable loss of their biological utility or activity.
It is also well understood by the skilled artisan that, inherent in the definition of a biologically functional equivalent protein or peptide, is the concept that there is a limit to the number of changes that may be made within a defined portion ofthe molecule and still result in a molecule with an acceptable level of equivalent biological activity. Biologically functional equivalent peptides are thus defined herein as those peptides in which certain, not most or all, ofthe amino acids may be substituted. In particular, where the N-terminal ofthe C-CAM protein is concerned, it is contemplated that only about 16 or more preferably, about 5 amino acids may be changed within a given peptide. Of course, a plurality of distinct proteins/peptides with different substitutions may easily be made and used in accordance with the invention.
Amino acid substitutions are generally based on the relative similarity ofthe amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. An analysis ofthe size, shape and type ofthe amino acid side-chain substituents reveals that arginine, lysine and histidine are all positively charged residues; that alanine, glycine and serine are all a similar size; and that phenylalanine, tryptophan and tyrosine all have a generally similar shape. Therefore, based upon these considerations, arginine, lysine and histidine; alanine, glycine and serine; and phenylalanine, tryptophan and tyrosine; are defined herein as biologically functional equivalents.
In making changes, the hydropathic index of amino acids may be considered. Each amino acid has been assigned a hydropathic index on the basis of their hydrophobicity and charge characteristics, these are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8): cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).
The importance ofthe hydropathic amino acid index in conferring interactive biological function on a protein is generally understood in the art (Kyte & Doolittie, 1982, incorporated herein by reference). It is known that certain amino acids may be substituted for other amino acids having a similar hydropathic index or score and still retain a similar biological activity. In making changes based upon the hydropathic index, the substitution of amino acids whose hydropathic indices are within ±2 is preferred, those which are within ±1 are particularly preferred, and those within ±0.5 are even more particularly preferred.
It is understood that an amino acid can be substituted for another having a similar hydrophilicity value and still obtain a biologically equivalent protein. As detailed in U.S. Patent 4,554,101, the following hydrophilicity values have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0 ± 1); glutamate (+3.0 ± 1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5 ± 1); alanine (-0.5); histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4).
In making changes based upon similar hydrophilicity values, the substitution of amino acids whose hydrophilicity values are within ±2 is preferred, those which are within ±1 are particularly preferred, and those within ±0.5 are even more particularly preferred.
While the preceding discussion has focused on functionally equivalent polypeptides arising from amino acid changes, it will be appreciated that these changes may be effected by alteration ofthe encoding DNA, taking into consideration also that the genetic code is degenerate and that two or more codons may code for the same amino acid.
In addition to the peptidyl compounds described herein, the inventors also contemplate that other sterically similar compounds may be formulated to mimic the key portions ofthe peptide structure. Such compounds, which may be termed peptidomimetics, may be used in the same manner as the peptides ofthe invention and hence are also functional equivalents. The generation of a structural functional equivalent may be achieved by the techniques of modelling and chemical design known to those of skill in the art. It will be understood that all such sterically similar constructs fall within the scope ofthe present invention.
B. Antisense Constructs
In an alternative embodiment, the C-CAM nucleic acid may encode the antisense version of any ofthe above full-length or fragmentary nucleic acids. The sense or coding constructs will generally be used in methods for inhibiting tumor proliferation where the lack of CAM function is a problem and replacement of CAM function is desired. However, in embodiments where overexpression of CAM is a problem, such as where inhibition or suppression of CAM expression is desired, antisense molecules may be employed.
The term "antisense nucleic acid" is intended to refer to the oligonucleotides complementary to the base sequences of CAM-encoding DNA and RNA. Antisense oligonucleotides, when introduced into a target cell, specifically bind to their target nucleic acid and interfere with transcription, RNA processing, transport and/or translation. Targeting double-stranded (ds) DNA with oligonucleotide leads to triple- helix formation; targeting RNA will lead to double-helix formation.
Antisense constructs may be designed to bind to the promoter and other control regions, exons, introns or even exon-intron boundaries of a gene. Antisense RNA constructs, or DNA encoding such antisense RNAs, may be employed to inhibit gene transcription or translation or both within a host cell, either in vitro or in vivo, such as within a host animal, including a human subject. Nucleic acid sequences which comprising "complementary nucleotides" are those which are capable of base-
pairing according to the standard Watson-Crick complementarity rules. That is, that the larger purines will base pair with the smaller pyrimidines to form only combinations of guanine paired with cytosine (G:C) and adenine paired with either thymine (A:T), in the case of DNA, or adenine paired with uracil (A:U) in the case of RNA.
As used herein, the terms "complementary" or "antisense sequences" mean nucleic acid sequences that are substantially complementary over their entire length and have very few base mismatches. For example, nucleic acid sequences of fifteen bases in length may be termed complementary when they have a complementary nucleotide at thirteen or fourteen positions with only a single mismatch. Naturally, nucleic acid sequences which are "completely complementary" will be nucleic acid sequences which are entirely complementary throughout their entire length and have no base mismatches.
While all or part ofthe gene sequence may be employed in the context of antisense construction, statistically, any sequence of 17 bases long should occur only once in the human genome and, therefore, suffice to specify a unique target sequence. Although shorter oligomers are easier to make and increase in vivo accessibility, numerous other factors are involved in determining the specificity of hybridization. Both binding affinity and sequence specificity of an oligonucleotide to its complementary target increases with increasing length. It is contemplated that oligonucleotides of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more base pairs will be used. One can readily determine whether a given antisense nucleic acid is effective at targeting ofthe corresponding host cell gene simply by testing the constructs in vitro to determine whether the endogenous gene's function is affected or whether the expression of related genes having complementary sequences is affected. In certain embodiments, one may wish to employ antisense constructs which include other elements, for example, those which include C-5 propyne pyrimidines. Oligonucleotides which contain C-5 propyne analogues of uridine and cytidine have
been shown to bind RNA with high affinity and to be potent antisense inhibitors of gene expression (Wagner et al, 1993).
As an alternative to targeted antisense delivery, targeted ribozymes may be used. The term "ribozyme" is refers to the an RNA-based enzyme capable targeting cleaving particular base sequences in C-CAM DNA and RNA. Ribozymes can either be targeted directly to cells, in the form of RNA oligo-nucleotides incorporating ribozyme sequences, or introduced into the cell as an expression construct encoding the desired ribozymal RNA. Ribozymes may be used and applied in much the same way as described for antisense nucleic acids.
EXPRESSION CONSTRUCTS
Throughout this application, the term "expression construct" is meant to include any type of genetic construct containing a nucleic acid coding for a gene product in which part or all ofthe nucleic acid encoding sequence is capable of being transcribed. The transcript may be translated into a protein, but it need not be. Thus, in certain embodiments, expression includes both transcription of a CAM gene and translation of a CAM mRNA into a CAM gene product. In other embodiments, expression only includes transcription ofthe nucleic acid encoding a CAM.
A. Promoters and Enhancers
In preferred embodiments, the nucleic acid encoding a CAM is under transcriptional control of a promoter. A "promoter" refers to a DNA sequence recognized by the synthetic machinery ofthe cell, required to initiate the specific transcription of a gene. The phrase "under transcriptional control" means that the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA polymerase initiation and expression ofthe gene.
The term promoter will be used here to refer to a group of transcriptional control modules that are clustered around the initiation site for RNA polymerase II. Much ofthe thinking about how promoters are organized derives from analyses of
several viral promoters, including those for the HSV thymidine kinase (tk) and SV40 early transcription units. These studies, augmented by more recent work, have shown that promoters are composed of discrete functional modules, each consisting of approximately 7-20 bp of DNA^ and containing one or more recognition sites for transcriptional activator proteins.
At least one module in each promoter functions to position the start site for RNA synthesis. The best known example of this is the TATA box, but in some promoters lacking a TATA box, such as the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation.
Additional promoter elements regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream ofthe start site, although a number of promoters have recently been shown to contain functional elements downstream ofthe start site as well. The spacing between elements is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the tk promoter, the spacing between elements can be increased to 50 bp apart before activity begins to decline. Depending on the promoter, it appears that individual elements can function either co-operatively or independently to activate transcription. The particular promoter that is employed to control the expression of a nucleic acid encoding a CAM is not believed to be important, so long as it is capable of expressing the nucleic acid in the targeted cell. Thus, where a human cell is targeted, it is preferable to position the nucleic acid coding region adjacent to and under the control of a promoter that is capable of being expressed in a human cell. Generally speaking, such a promoter might include either a human or viral promoter.
In the examples given, the human cytomegalovirus (CMV) immediate early gene promoter (Example VI), the SV40 early promoter and the Rous sarcoma long terminal repeat (Example I), were used to obtain high-level expression of C-CAM. However, the use of other viral or mammalian cellular promoters which are well-
known in the art also is suitable to achieve expression of a CAM, provided that the levels of expression are sufficient for a given purpose.
By employing a promoter with well-known properties, the level and pattern of expression of a CAM following transfection can be optimized. For example, selection of a promoter which is active specifically in prostate cells, such as the prostate- specific antigen (PA) promoter (Watt et al, 1986), will permit tissue-specific expression of a CAM. Further, selection of a promoter that is regulated in response to specific physiologic signals can permit inducible expression of CAM. For example, with the nucleic acid encoding CAM being expressed from the human PAI-1 promoter, expression is inducible by tumor necrosis factor. Tables 1 and 2 list several elements/promoters which may be employed, in the context ofthe present invention, to regulate the expression of CAM. This list is not intended to be exhaustive of all the possible elements involved in the promotion of CAM expression but, merely, to be exemplary thereof. Enhancers were originally detected as genetic elements that increased transcription from a promoter located at a distant position on the same molecule of DNA. This ability to act over a large distance had little precedent in classic studies of prokaryotic transcriptional regulation. Subsequent work showed that regions of DNA with enhancer activity are organized much like promoters. That is, they are composed of many individual elements, each of which binds to one or more transcriptional proteins.
The basic distinction between enhancers and promoters is operational. An enhancer region as a whole must be able to stimulate transcription at a distance; this need not be true of a promoter region or its component elements. On the other hand, a promoter must have one or more elements that direct initiation of RNA synthesis at a particular site and in a particular orientation, whereas enhancers lack these specificities. Aside from this operational distinction, enhancers and promoters are very similar entities.
Promoters and enhancers have the same general function of activating transcription in the cell. They are often overlapping and contiguous, often seeming to have a very similar modular organization. Taken together, these considerations suggest that enhancers and promoters are homologous entities and that the transcriptional activator proteins bound to these sequences may interact with the cellular transcriptional machinery in fundamentally the same way.
Below is a list of viral promoters, cellular promoters/enhancers and inducible promoters/enhancers that could be used in combination with the nucleic acid encoding a CAM in an expression construct (Table 3A and Table 3B). Additionally any promoter/enhancer combination (as per the Eukaryotic Promoter Data Base EPDB) could also be used to drive expression of a CAM.
Table 3A
ENHANCER
Immunoglobulin Heavy Chain
Immunoglobulin Light Chain
T-Cell Receptor
HLA DQ α and DQ β β-Interferon
Interleukin-2
Interleukin-2 Receptor
MHC Class II 5
MHC Class II HLA-DRα β-Actin
Muscle Creatine Kinase
Prealbumin (Transthyretin)
Elastase /
Metallothionem
Table 3A (continued)
ENHANCER
Collagenase
Albumin Gene α-Fetoprotein τ-Globin β-Globin c-fos c-HA-ras
Insulin
Neural Cell Adhesion Molecule (NCAM)
^ -Antitrypsin
H2B (TH2B) Histone
Mouse or Type I Collagen
Glucose-Regulated Proteins (GRP94 and GRP78)
Rat Growth Hormone
Human Serum Amyloid A (SAA)
Troponin I (TN I)
Platelet-Derived Growth Factor
Duchenne Muscular Dystrophy
SV40
Polyoma
Retroviruses
Papilloma Virus
Hepatitis B Virus
Human Immunodeficiency Virus
Cytomegalovirus
Gibbon Ape Leukemia Virus
Table 3B
Element Inducer
MT II Phorbol Ester (TFA) Heavy metals
MMTV (mouse mammary tumor Glucocorticoids virus) β-Interferon poly(rI)X poly(rc)
Adenovirus 5 E2 Ela
Collagenase Phorbol Ester (TPA)
Stromelysin Phorbol Ester (TPA)
SV40 Phorbol Ester (TFA)
Murine MX Gene Interferon, Newcastle Disease Virus
GRP78 Gene A23187 α-2-Macroglobulin IL-6
Vimentin Serum
MHC Class I Gene H-2kb Interferon
HSP70 Ela, SV40 Large T Antigen
Proliferin Phorbol Ester-TPA
Tumor Necrosis Factor FMA
Thyroid Stimulating Hormone α Thyroid Hormone Gene
B. Selectable Marker
In certain embodiments ofthe invention, the delivery and expression of a nucleic acid encoding a CAM in a cell may be identified in vitro or in vivo by including a selectable marker in the expression construct and under the same transcriptional control as the nucleic acid encoding a CAM. The selectable marker would preferably involve a phenotypic change to the transfected cell to easily identify
expression. Usually the inclusion of a drug selection marker aids in the discovery and selection of transformants. Alternatively enzymes such as Herpes Simplex thymidine kinase (tk) or chloramphenicol acetyltransferase (CAT) may be employed. The selectable marker employed is not believed to be important, so long as it is capable of being expressed simultaneously to the nucleic acid encoding a CAM. Further examples of selectable markers are well known to one of skill in the art.
C. Polyadenylation Signal
Where a cDNA insert is employed, one will typically desire to include a polyadenylation signal to effect proper polyadenylation ofthe CAM transcript. The nature ofthe polyadenylation signal is not believed to be crucial to the successful practice ofthe invention, and any such sequence may be employed. The inventors have employed the SV40 polyadenylation signal in that it was convenient and known to function well in the target cells employed.
D. Viral Expression Vectors
In preferred embodiments ofthe invention, the expression construct comprises a virus or engineered construct derived from a viral genome. The ability of certain viruses to enter cells via receptor-mediated endocytosis and to integrate into host cell genome and express viral genes stably and efficiently have made them attractive candidates for the transfer of foreign genes into mammalian cells (Ridgeway, 1988; Nicolas and Rubenstein, 1988; Baichwal and Sugden, 1986; Temin, 1986). The first viruses used as gene vectors were transforming DNA viruses including the papovaviruses (simian virus 40, bovine papilloma virus, and polyoma) (Ridgeway, 1988; Baichwal and Sugden, 1986) and adenoviruses (Ridgeway, 1988; Baichwal and Sugden, 1986). These have a relatively low capacity for foreign DNA sequences and have a restricted host spectrum. Furthermore, their oncogenic potential and cytopathic effects in permissive cells raise safety concerns. Murine retroviruses represent a more attractive alternative to the transforming DNA viruses (Nicolas and
Rubenstein, 1988; Temin, 1986). They can accommodate up to 8 kilobases of foreign genetic material and can be readily introduced in a variety of cell lines and laboratory animals (Nicolas and Rubenstein, 1988; Temin, 1986).
(i) Retroviruses
The retroviruses are a group of single-stranded RNA viruses characterized by an ability to convert their RNA to double-stranded DNA in infected cells by a process of reverse-transcription (Coffin, 1990). The resulting DNA then stably integrates into cellular chromosomes as a provirus and directs synthesis of viral proteins. The integration results in the retention ofthe viral gene sequences in the recipient cell and its decendents. The retroviral genome contains three genes, gag, pol, and env that code for capsid proteins, polymerase enzyme, and envelope components, respectively. A sequence found upstream from the gag gene, termed Ψ, functions as a signal for packaging ofthe genome into virions. Two long terminal repeat (LTR) sequences are present at the 5' and 3' ends ofthe viral genome. These contain strong promoter and enhancer sequences and are also required for integration in the host cell genome (Coffin, 1990).
In order to construct a retroviral vector, a nucleic acid encoding a CAM is inserted into the viral genome in the place of certain viral sequences to produce a virus that is replication-defective. In order to produce virions, a packaging cell line containing the gag, pol, and env genes but without the LTR and Ψ components is constructed (Mann et al. , 1983). When a recombinant plasmid containing a human cDNA, together with the retroviral LTR and Ψ sequences is introduced into this cell line (by calcium phosphate precipitation for example), the Ψ sequence allows the RNA transcript ofthe recombinant plasmid to be packaged into viral particles, which are then secreted into the culture media (Nicolas and Rubenstein, 1988; Temin, 1986; Mann et al, 1983). The media containing the recombinant retroviruses is then collected, concentrated, and used for gene transfer. Retroviral vectors are able to
infect a broad variety of cell types. However, integration and stable expression require the division of host cells (Paskind et al, 1975).
A novel approach designed to allow specific targeting of retrovirus vectors was recently developed based dn the chemical modification of a retrovirus by the chemical addition of lactose residues to the viral envelope. This modification could permit the specific infection of hepatocytes via sialoglycoprotein receptors.
A different approach to targeting of recombinant retroviruses was designed by Roux et al. in which biotinylated antibodies against a retroviral envelope protein and against a specific cell receptor were used. The antibodies were coupled via the biotin components by using streptavidin (Roux et al, 1989). Using antibodies against major histocompatibility complex class I and class I antigens, they demonstrated the infection of a variety of human cells that bore those surface antigens with an ecotropic virus in vitro (Roux et al, 1989).
There are certain limitations to the use of retrovirus vectors in all aspects of the present invention. For example, retrovirus vectors usually integrate into random sites in the cell genome. This can lead to insertional mutagenesis through the interruption of host genes or through the insertion of viral regulatory sequences that can interfere with the function of flanking genes (Varmus et al, 1981). Another concern with the use of defective retrovirus vectors is the potential appearance of wild-type replication-competent virus in the packaging cells. This can result from recombination events in which the intact Ψ sequence from the recombinant virus inserts upstream from the gag, pol, env sequence integrated in the host cell genome. However, new packaging cell lines are now available that should greatly decrease the likelihood of recombination (Markowitz et al, 1988; Hersdorffer et al, 1990). One limitation to the use of retrovirus vectors in vivo is the inability to produce retroviral vector titers greater than 10 infectious U/mL. TitersJO- to 1, 000- fold higher are necessary for many in vivo applications.
Several properties ofthe retrovirus have limited its use in prostate cancer treatment (Stratford-Perricaudet and Perricaudet, 1991): (i) Infection by retrovirus
depends on host cell division. In human prostate cancer, very few mitotic cells can be found in tumor lesions (Warner and Heston, 1991). (ii) The integration of retrovirus into the host genome may cause adverse effects on target cells, because malignant cells are high in genetic instability, (iii) Retrovirus infection is often limited by a certain host range, (iv) Retrovirus has been associated with many malignancies in both mammals and vertebrates, (v) The titer of retrovirus, in general, is 100- to 1, 000- fold lower than that of adenovirus.
(ii) Adenovirus Knowledge ofthe genetic organization of adenovirus, a 36 kb, linear and double-stranded DNA virus, allows substitution of a large piece of adenoviral DNA with foreign sequences up to 7 kb (Grunhaus and Horwitz, 1992). In contrast to retrovirus, the infection of adenoviral DNA into host cells does not result in chromosomal integration because adenoviral DNA can replicate in an episomal manner without potential genotoxicity. Also, adenoviruses are structurally stable, and no genome rearrangement has been detected after extensive amplification. Adenovirus can infect virtually all epithelial cells regardless of their cell cycle stage. So far, adenoviral infection appears to be linked only to mild disease such as acute respiratory disease in the human. Adenovirus is particularly suitable for use as a gene transfer vector because of its mid-sized genome, ease of manipulation, high titer, wide target-cell range, and high infectivity. Both ends ofthe viral genome contain 100-200 base pair (bp) inverted terminal repeats (ITR), which are cis elements necessary for viral DNA replication and packaging. The early (E) and late (L) regions ofthe genome that contain different transcription units are divided by the onset of viral DNA replication. The El region (EIA and E1B) encodes proteins responsible for the regulation of transcription ofthe viral genome and a few cellular genes. The expression ofthe E2 region (E2A and E2B) results in the synthesis ofthe proteins for viral DNA replication. These proteins are involved in DNA replication, late gene expression, and
host cell shut off (Renan, 1990). The products ofthe late genes, including the majority ofthe viral capsid proteins, are expressed only after significant processing of a single primary transcript issued by the major late promoter (MLP). The MLP (located at 16.8 m.u.) is particularly efficient during the late phase of infection, and all the mRNAs issued from this promoter possess a 5' tripartite leader (TL) sequence wliich makes them preferred mRNAs for translation.
In the current system, recombinant adenovirus is generated from homologous recombination between shuttle vector and provirus vector. Due to the possible recombination between two proviral vectors, wild-type adenovirus may be generated from this process. Therefore, it is critical to isolate a single clone of virus from an individual plaque and examine its genomic structure.
Generation and propagation ofthe current adenovirus vectors, which are replication deficient, depend on a unique helper cell line, designated 293, which was transformed from human embryonic kidney cells by AD5 DNA fragments and constitutively expresses El proteins (Graham, et al, 1977). Since the E3 region is dispensable from the adenovirus genome (Jones and Shenk, 1978), the current adenovirus vectors, with the help of 293 cells, carry foreign DNA in either the El, the E3 or both regions (Graham and Prevec, 1991). In nature, adenovirus can package approximately 105% ofthe wild-type genome (Ghosh-Choudhury, et al, 1987), providing capacity for about 2 extra kb of DNA. Combined with the approximately 5.5 kb of DNA that is replaceable in the El and E3 regions, the maximum capacity of the current adenovirus vector is under 7.5 kb, or about 15% ofthe total length ofthe vector. More than 80% ofthe adenovirus viral genome remains in the vector backbone and is the source of vector-borne cytotoxicity. Also, the replication deficiency ofthe El deleted virus is incomplete. For example, leakage of viral gene expression has been observed with the currently available adenovirus vectors at high multiplicities of infection (Mulligan, 1993).
Helper cell lines may be derived from human cells such as human embryonic kidney cells, muscle cells, hematopoietic cells or other human embryonic mesenchymal or epithelial cells. Alternatively, the helper cells may be derived from the cells of other mammalian species that are permissive for human adenovirus. Such cells include, e.g., Vero cells or other monkey embryonic mesenchymal or epithelial cells. As stated above, the preferred helper cell line is 293.
Other than the requirement that the adenovirus vector be replication defective, the nature ofthe adenovirus vector is not believed to be crucial to the successful practice ofthe invention. The adenovirus may be of any ofthe 42 different known serotypes or subgroups A-F. Adenovirus type 5 of subgroup C is the preferred starting material in order to obtain the conditional replication-defective adenovirus vector for use in the method ofthe present invention. This is because Adenovirus type 5 is a human adenovirus about which a great deal of biochemical and genetic information is known, and it has historically been used for most constructions employing adenovirus as a vector.
As stated above, the typical vector according to the present invention is replication defective and will not have an adenovirus El region. Thus, it will be most convenient to introduce the nucleic acid encoding CAM at the position from which the El coding sequences have been removed. However, the position of insertion of the CAM coding region within the adenovirus sequences is not critical to the present invention. The nucleic acid encoding CAM transcription unit may also be inserted in lieu ofthe deleted E3 region in E3 replacement vectors as described previously by Karlsson et. al. (1986).
Adenovirus is easy to grow and manipulate and exhibits broad host range in vitro and in vivo. This group of viruses can be obtained in high titers, e.g., 10 -10 plaque-forming unit (PFU)/ml, and they are highly infective. The life cycle of adenovirus does not require integration into the host cell genome. The foreign genes delivered by adenovirus vectors are expressed episomally, and therefore, have low genotoxicity to host cells. No side effects have been reported in studies of vaccination
with wild-type adenovirus (Couch et al, 1963; Top et al, 1971), demonstrating their safety and therapeutic potential as in vivo gene transfer vectors.
Adenovirus vectors have been used in eukaryotic gene expression (Levrero et al, 1991; Gomez-Foix et al, 1992) and vaccine development (Grunhaus and Horwitz, 1992; Graham and Prevec, 1992). Recently, animal studies suggested that recombinant adenovirus could be used for gene therapy (Stratford-Perricaudet and Perricaudet, 1991; Stratford-Perricaudet et al, 1990; Rich et α/., 1993). Experiments in administering recombinant adenovirus to different tissues include trachea instillation (Rosenfeld et al, 1991; Rosenfeld et al, 1992), muscle injection (Ragot et al, 1993), peripheral intravenous injection (Herz and Gerard, 1993), and stereotactic inoculation into the brain (Le Gal La Salle et al, 1993).
(iii) Other Viral Vectors as Expression Constructs Other viral vectors may be employed as expression constructs in the present invention. Vectors derived from viruses such as vaccinia virus (Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al, 1988) adeno-associated virus (AAV) (Ridgeway, 1988; Baichwal and Sugden, 1986; Hermonat and Muzycska, 1984) and herpesviruses may be employed. They offer several attractive features for various mammalian cells (Friedmann, 1989; Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al, 1988; Horwich et al, 1990).
With the recent recognition of defective hepatitis B viruses, new insight was gained into the structure-function relationship of different viral sequences. In vitro studies showed that the virus could retain the ability for helper-dependent packaging and reverse transcription despite the deletion of up to 80% of its genome (Horwich et al, 1990). This suggested that large portions ofthe genome could be replaced with foreign genetic material. The hepatotropism and persistence (integration) were particularly attractive properties for liver-directed gene transfer. Chang et al. recently introduced the chloramphenicol acetyltransferase (CAT) gene into duck hepatitis B virus genome in the place ofthe polymerase, surface, and pre-surface coding
sequences. It was cotransfected with wild-type virus into an avian hepatoma cell line. Culture media containing high titers ofthe recombinant virus were used to infect primary duckling hepatocytes. Stable CAT gene expression was detected for at least 24 days after transfection (Chang et al, 1991).
METHODSFORGENETRANSFER
In order to effect expression of sense or antisense CAM constructs, the expression construct must be delivered into a cell. This delivery may be accomplished in vitro, as in laboratory procedures for transforming cells lines, or in vivo or ex vivo (see below), as in the treatment of certain disease states. As described above, the preferred mechanism for delivery is via viral infection where the expression construct is encapsidated in an infectious viral particle.
Several non- viral methods for the transfer of expression constructs into cultured mammalian cells also are contemplated by the present invention. These include calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al, 1990) DEAE-dextran (Gopal, 1985), electroporation (Tur-Kaspa et al, 1986; Potter et al, 1984), direct microinjection (Harland and Weintraub, 1985), DNA-loaded liposomes (Nicolau and Sene, 1982; Fraley et al, 1979), cell sonication (Fechheimer et al , 1987), gene bombardment using high velocity microprojectiles (Yang et al, 1990), and receptor-mediated transfection (Wu and Wu, 1987; Wu and Wu, 1988). Some of these techniques may be successfully adapted for in vivo or ex vivo use.
Once the expression construct has been delivered into the cell the nucleic acid encoding CAM may be positioned and expressed at different sites. In certain embodiments, the nucleic acid encoding CAM may be stably integrated.into the genome ofthe cell. This integration may be in the cognate location and orientation via homologous recombination (gene replacement) or it may be integrated in a random, non-specific location (gene augmentation). In yet further embodiments, the
nucleic acid may be stably maintained in the cell as a separate, episomal segment of DNA. Such nucleic acid segments or "episomes" encode sequences sufficient to permit maintenance and replication independent of or in synchronization with the host cell cycle. How the expression construct is delivered to a cell and where in the cell the nucleic acid remains is dependent on the type of expression construct employed. In one embodiment ofthe invention, the expression construct may simply consist of naked recombinant DNA or plasmids. Transfer ofthe construct may be performed by any ofthe methods mentioned above which physically or chemically permeabilize the cell membrane. This is particularity applicable for transfer in vitro, however, it may be applied for in vivo use as well. Dubensky et al. (1984) successfully injected polyomavirus DNA in the form of CaPO4 precipitates into liver and spleen of adult and newborn mice demonstrating active viral replication and acute infection. Benvenisty and Neshif (1986) also demonstrated that direct intraperitoneal injection of CaPO4 precipitated plasmids results in expression ofthe transfected genes. It is envisioned that DNA encoding a CAM may also be transferred in a similar manner in vivo and express CAM.
Another embodiment ofthe invention for transferring a naked DNA expression construct into cells may involve particle bombardment. This method depends on the ability to accelerate DNA coated microprojectiles to a high velocity allowing them to pierce cell membranes and enter cells without killing them (Klein et al, 1987). Several devices for accelerating small particles have been developed. One such device relies on a high voltage discharge to generate an electrical current, which in turn provides the motive force (Yang et al, 1990). The microprojectiles used have consisted of biologically inert substances such as tungsten or gold beads. Selected organs including the liver, skin, and muscle tissue of rats and mice have been bombarded in vivo (Yang et al, 1990; Zelenin et al, 1991). This may require surgical exposure ofthe tissue or cells, to eliminate any intervening tissue between the gun and the target organ, i.e., ex vivo treatment. Again DNA encoding a
CAM may too be delivered via this method and still be incorporated by the present invention.
In a further embodiment ofthe invention, the expression construct may be entrapped in a liposome. Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991).
Liposome-mediated nucleic acid delivery and expression of foreign DNA in vitro has been very successful. Using the β-lactamase gene, Wong et al. (1980) demonstrated the feasibility of liposome-mediated delivery and expression of foreign DNA in cultured chick embryo, HeLa, and hepatoma cells. Nicolau et al. (1987) accomplished successful liposome-mediated gene transfer in rats after intravenous injection.
In certain embodiments ofthe invention, the liposome may be complexed with a hemagglutinating virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA (Kaneda et al, 1989). In other embodiments, the liposome may be complexed or employed in conjunction with nuclear nonhistone chromosomal proteins (HMG-1) (Kato et al, 1991). In yet further embodiments, the liposome may be complexed or employed in conjunction with both HVJ and HMG-1. In that such expression constructs have been successfully employed in transfer and expression of nucleic acid in vitro and in vivo, then they are applicable for the present invention.
Other expression constructs which can be employed to deliver a. nucleic acid encoding a CAM into cells are receptor-mediated delivery vehicles. These take advantage ofthe selective uptake of macromolecules by receptor-mediated endocytosis in almost all eukaryotic cells. Because ofthe cell type-specific
distribution of various receptors, the delivery can be highly specific (Wu and Wu, 1993).
Receptor-mediated gene targeting vehicles generally consist of two components: a cell receptor-specific ligand and a DNA-binding agent. Several ligands have been used for receptor-mediated gene transfer. The most extensively characterized ligands are asialoorosomucoid (ASOR) (Wu and Wu, 1987) and transferrin (Wagner et al, 1990). Recently, a synthetic neoglycoprotein, which recognizes the same receptor as ASOR, has been used as a gene delivery vehicle (Ferkol et al, 1993; Perales et al, 1994) and epidermal growth factor (EGF) has also been used to deliver genes to squamous carcinoma cells (Myers, EPO 0273085). In other embodiments, the delivery vehicle may comprise a ligand and a liposome. For example, Nicolau et al. (1987) employed lactosyl-ceramide, a galactose-terminal asialganglioside, incorporated into liposomes and observed an increase in the uptake ofthe insulin gene by hepatocytes. Thus, it is feasible that a nucleic acid encoding a CAM also may be specifically delivered into a cell type such as prostate, epithelial or tumor cells, by any number of receptor-ligand systems with or without liposomes. For example, the human prostate-specific antigen (Watt et al. , 1986) may be used as the receptor for mediated delivery of a nucleic acid encoding a C-CAM in prostate cells. In certain embodiments gene transfer may more easily be performed under ex vivo conditions. Ex vivo gene therapy refers to the isolation of cells from an animal, the delivery of a nucleic acid into the cells, in vitro, and then the return ofthe modified cells back into an animal. This may involve the surgical removal of tissue/organs from an animal or the primary culture of cells and tissues. Anderson et al. (US 5,399,346), and incorporated herein in its entirety, disclose of ex vivo therapeutic methods.
Primary mammalian cell cultures may be prepared in various ways. A preferred method is described, herein (Example I), for a human prostate carcinoma cell line (PC-3). However, many other cell cultures may be established from
tissues/cells in a similar manner, exemplary examples include prostate, breast, bladder, liver and intestines. In order for the cells to be kept viable while in vitro and contacting the cells with the expression construct it is necessary to ensure that the cells maintain contact with the correct ratio of oxygen and carbon dioxide and nutrients but are protected from microbial contamination. Cell culture techniques are well documented and are disclosed herein by reference (Freshner, 1992).
During in vitro culture conditions the expression construct may then deliver and express a nucleic acid encoding a C-CAM into the cells. Finally the cells may be reintroduced into the original animal, or administered into a distinct animal, in a pharmaceutically acceptable form by any ofthe means described below. Thus providing an ex vivo method of treating a mammal with a pathologic condition.
C-CAM EXPRESSION CONSTRUCTS IN COMBINATION WITH OTHER THERAPIES Tumor cell resistance to DNA damaging agents represents a major problem in clinical oncology. One goal of current cancer research is to find ways to improve the efficacy of chemo- and radiotherapy by combining it with gene therapy. For example, the heφes simplex-thymidine kinase (HS-tK) gene, when delivered to brain tumors by a retroviral vector system, successfully induced susceptibility to the antiviral agent ganciclovir (Culver, et al, 1992). In the context ofthe present invention, it is contemplated that C-CAM replacement therapy could be used similarly in conjunction with chemo- or radiotherapeutic intervention.
To kill cells, such as malignant or metastatic cells, using the methods and compositions ofthe present invention, one would generally contact a "target" cell with a C-CAM expression construct and at least one DNA damaging agent. These compositions would be provided in a combined amount effective to kill or inhibit proliferation ofthe cell. This process may involve contacting the cells with the C- CAM expression construct and the DNA damaging agent(s) or factor(s) at the same time. This may be achieved by contacting the cell with a single composition or
pharmacological formulation that includes both agents, or by contacting the cell with two distinct compositions or formulations, at the same time, wherein one composition includes the C-CAM expression construct and the other includes the DNA damaging agent. Alternatively, the C-CAM treatment may precede or follow the DNA damaging agent treatment by intervals ranging from minutes to weeks. In embodiments where the DNA damaging factor and C-CAM expression construct are applied separately to the cell, one would generally ensure that a significant period of time did not expire between the time of each delivery, such that the DNA damaging agent and C-CAM expression construct would still be able to exert an advantageously combined effect on the cell. In such instances, it is contemplated that one would contact the cell with both agents within about 12-24 hours of each other and, more preferably, within about 6-12 hours of each other, with a delay time of only about 12 hours being most prefened. In some situations, it may be desirable to extend the time period for treatment significantly, however, where several days (2, 3, 4, 5, 6 or 7) to several weeks (1, 2, 3, 4, 5, 6, 7 or 8) lapse between the respective administrations. It also is conceivable that more than one administration of either C-CAM or the DNA damaging agent will be desired. Various combinations may be employed, where C-CAM is "A" and the DNA damaging agent is "B":
A/B/A B/A/B B/B/A A/A/B B/B/B/A B/B/A/B
A/AB/B A/B/A/B A/B/B/A B/B/AA B/AB/A B/A/A/B
A/A/A/B B/A/A/A A/B/A/A A/A/B/A A/B/B/B B/AB/B
To achieve cell killing, both agents are delivered to a cell in a combined amount effective to kill the cell.
DNA damaging agents or factors are defined herein as any chemical compound or treatment method that induces DNA damage when applied to a cell. Such agents and factors include radiation and waves that induce DNA damage such
as, γ-inadiation, X-rays, UV-inadiation, microwaves, electronic emissions, and the like. A variety of chemical compounds, also described as "chemotherapeutic agents", function to induce DNA damage, all of which are intended to be of use in the combined treatment methods disclosed herein. Chemotherapeutic agents contemplated to be of use, include, e.g., adriamycin, 5-fluorouracil (5FU), etoposide (VP-16), camptothecin, actinomycin-D, mitomycin C, cisplatin (CDDP) and even hydrogen peroxide. The invention also encompasses the use of a combination of one or more DNA damaging agents, whether radiation-based or actual compounds, such as the use of X-rays with cisplatin or the use of cisplatin with etoposide. In certain embodiments, the use of cisplatin in combination with a C-CAM expression construct is particularly prefened as this compound.
In treating cancer according to the invention, one would contact the tumor cells with a DNA damaging agent in addition to the C-CAM expression construct. This may be achieved by inadiating the localized tumor site with DNA damaging radiation such as X-rays, UV-light, γ-rays or even microwaves. Alternatively, the tumor cells may be contacted with the DNA damaging agent by administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising a DNA damaging compound such as, adriamycin, 5-fluorouracil, etoposide, camptothecin, actinomycin-D, mitomycin C, or more preferably, cisplatin. The DNA damaging agent may be prepared and used as a combined therapeutic composition, or kit, by combining it with a C-CAM expression construct, as described above.
Agents that directly cross-link nucleic acids, specifically DNA, are envisaged and are shown herein, to eventuate DNA damage leading to a synergistic antineoplastic combination. Agents such as cisplatin, and other DNA alkylating may be used. Cisplatin has been widely used to treat cancer, with efficacious- doses used in clinical applications of 20 mg/m for 5 days every three weeks for a total of three courses. Cisplatin is not absorbed orally and must therefore be delivered via injection intravenously, subcutaneously, intratumorally or intraperitoneally.
Agents that damage DNA also include compounds that interfere with DNA replication, mitosis, and chromosomal segregation. Such chemotherapeutic compounds include adriamycin, also known as doxorubicin, etoposide, verapamil, podophyllotoxin, and the like. "Widely used in clinical setting for the treatment of neoplasms, these compounds are administered through bolus injections intravenously at doses ranging from 25-75 mg/m at 21 day intervals for adriamycin, to 35-50 mg/m for etoposide intravenously or double the intravenous dose orally.
Agents that disrupt the synthesis and fidelity of nucleic acid precursors, and subunits also lead to DNA damage. As such a number of nucleic acid precursors have been developed. Particularly useful are agents that have undergone extensive testing and are readily available. As such, agents such as 5-fluorouracil (5-FU), are preferentially used by neoplastic tissue, making this agent particularly useful for targeting to neoplastic cells. Although quite toxic, 5-FU, is applicable in a wide range of earners, including topical, however intravenous administration with doses ranging from 3 to 15 mg/kg/day being commonly used.
Other factors that cause DNA damage and have been used extensively include what are commonly known as γ-rays, X-rays, and/or the directed delivery of radioisotopes to tumor cells. Other forms of DNA damaging factors are also contemplated such as microwaves and UV-inadiation. It is most likely that all of these factors effect a broad range of damage on the precursors of DNA, the replication and repair of DNA, and the assembly and maintenance of chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 weeks), to single doses of 2000 to 6000 roentgens. Dosage ranges for radioisotopes vary widely, and depend on the half-life ofthe isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells.
The skilled artisan is directed to "Remington's Pharmaceutical Sciences" 15th Edition, chapter 33, in particular pages 624-652. Some variation in dosage will necessarily occur depending on the condition ofthe subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for
the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biologies standards.
The inventors propose that the regional delivery of C-CAM expression constructs to patients with C-CAM-linked cancers will be a very efficient method for delivering a therapeutically effective gene to counteract the clinical disease. Similarly, the chemo- or radiotherapy may be directed to a particular, affected region ofthe subjects body. Alternatively, systemic delivery of C-CAM expression construct or the DNA damaging agent may be appropriate in certain circumstances, for example, where extensive metastasis has occurred.
NUCLEIC ACID ENCODING C-CAM OR C-CAM AS MARKERS
In certain embodiments, a nucleic acid encoding a C-CAM or C-CAM may be employed for diagnostic puφoses. The absence or reduced/increased level of C-CAM nucleic acid encoding a C-CAM may be indicative of a disease state such as cancer. Thereby using nucleic acid encoding a C-CAM or C-CAM as a marker. There are numerous methods, well known to one of skill in the art, that may be employed in detecting a nucleic acid encoding C-CAM or a C-CAM. Example I, describes two methods for detecting nucleic acids encoding a C-CAM; Southern and Northern analysis. The level of C-CAM message was used as a marker to indicate tumorigenicity.
An alternative approach would be to detect C-CAMs with immunoassays using antibodies that bind to C-CAM. Western Blotting and FACS analysis are also described in Example I. Both techniques were employed to detect C-CAM expression on the cell surface. It will be readily appreciated that detection is not limited to the above techniques, and that there are numerous other methods which may be encompassed by the present invention.
Other, prefened immunoassays are the various types of enzyme linked immunosorbent assays (ELISAs) and radioimmunoassays (RIA) known in the art. Immunohistochemical detection using tissue sections is also particularly useful.
In ELISAs, an anti-C-CAM antibody (such as Ab669, as disclosed herein) is immobilized onto a selected surface exhibiting protein affinity, such as a well in a polystyrene microtiter plate. Then, a test composition containing the cells or cellular material, such as a clinical sample, is added to the wells. After binding and washing to remove non-specifically bound immunecomplexes, the bound C-CAM may be detected. Detection is generally achieved by the addition of another anti-C-CAM antibody that is linked to a detectable label. This type of ELISA is a simple
"sandwich ELISA". Detection may also be achieved by the addition of a second anti-C-CAM antibody, followed by the addition of a third antibody that has binding affinity for the second anti-C-CAM antibody, with the third antibody being linked to a detectable label. In another exemplary ELISA, the samples containing the cellular material to be tested for the level of C-CAM, are immobilized onto the well surface and then contacted with the antiC-CAM antibodies. After binding and appropriate washing, the bound immunocomplexes are detected. Where the initial anti-C-CAM antibodies are linked to a detectable label, the immunecomplexes may be detected directly. Again, the immunecomplexes may be detected using a second antibody that has binding affinity for the first anti-C-CAM antibody, with the second antibody being linked to a detectable label.
Competition ELISAs are also possible in which test samples compete for binding with known amounts of labeled C-CAM antigens or antibodies. The amount of reactive species in the unknown sample is determined by mixing the sample with the known labelled species before or during incubation with coated wells. The presence of reactive species in the sample acts to reduce the amount of labeled species available for binding to the well and thus reduces the ultimate signal.
Inespective ofthe format employed, ELISAs have certain features in common, such as coating, incubating or binding, washing to remove non-specifically bound species, and detecting the bound immunecomplexes. These are described as follows:
In coating a plate with either antigen or antibody, one will generally incubate the wells ofthe plate with a solution ofthe antigen or antibody, either overnight or for a specified period of hours. The wells ofthe plate will then be washed to remove incompletely adsorbed material. Any remaining available surfaces ofthe wells are then "coated" with a nonspecific protein that is antigenically neutral with regard to the test antisera. These include bovine serum albumin (BSA), casein and solutions of milk powder. The coating allows for blocking of nonspecific adsoφtion sites on the immobilizing surface and thus reduces the background caused by nonspecific binding of antisera onto the surface.
In ELISAs, it is probably more customary to use a secondary or tertiary detection means rather than a direct procedure. Thus, after binding ofthe C-CAM or anti-C-CAM antibody to the well, coating with a non-reactive material to reduce background, and washing to remove unbound material, the immobilizing surface is contacted with the clinical or biological sample to be tested under conditions effective to allow immunecomplex (antigen/antibody) formation. Detection ofthe immunecomplex then requires a labeled secondary binding ligand or antibody, or a secondary binding ligand or antibody in conjunction with a labeled tertiary antibody or third binding ligand.
"Under conditions effective to allow immunecomplex (antigen/antibody) formation" means that the conditions preferably include diluting the antigens and antibodies with solutions such as BSA, bovine gamma globulin (BGG) and phosphate buffered saline (PBS)/Tween. These added agents also tend to assist in the reduction of nonspecific background.
The suitable conditions also mean that the incubation is at a temperature and for a period of time sufficient to allow effective binding. Incubation steps are
typically from about 1 to 2 to 4 hours, at temperatures preferably on the order of 25° to 27°C, or may be overnight at about 4°C or so.
Following all incubation steps in an ELISA, the contacted surface is washed so as to remove non-complexed material. Washing often includes washing with a solution of PBS/Tween, or borate buffer. Following the formation of specific immunecomplexes between the test sample and the originally bound material, and subsequent washing, the occurrence of even minute amounts of immunecomplexes may be determined.
To provide a detecting means, the second or third antibody will have an associated label to allow detection. Preferably, this will be an enzyme that will generate color development upon incubating with an appropriate chromogenic substrate. Thus, for example, one will desire to contact and incubate the first or second immunecomplex with a urease, glucose oxidase, alkaline phosphatase or hydrogen peroxidase-conjugated antibody for a period of time and under conditions that favor the development of further immunecomplex formation (e.g., incubation for 2 hours at room temperature in a PBS-containing solution such as PBS-Tween). After incubation with the labeled antibody, and subsequent to washing to remove unbound material, the amount of label is quantified, e.g., by incubation with a chromogenic substrate such as urea and bromocresol puφle or 2,2'-azino-di-(3 -ethyl - benzthiazoline-6-sulfonic acid [ABTS] and H2O2, in the case of peroxidase as the enzyme label. Quantification is then achieved by measuring the degree of color generation, e.g., using a visible spectra spectrophotometer.
PHARMACEUTICAL COMPOSITIONS AND ROUTES OF ADMINISTRATION
Where clinical application of an expression construct comprising a nucleic acid encoding C-CAM is contemplated, it will be necessary to prepare the complex as a pharmaceutical composition appropriate for the intended application. Generally this will entail preparing a pharmaceutical composition that is essentially free of pyrogens.
as well as any other impurities that could be harmful to humans or animals. One also will generally desire to employ appropriate salts and buffers to render the complex stable and allow for complex uptake by target cells.
Aqueous compositions of the present invention comprise an effective amount ofthe expression construct and nucleic acid, dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium. Such compositions can also be refened to as inocula. The phrases "pharmaceutically or pharmacologically acceptable" refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, or a human, as appropriate. As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absoφtion delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients also can be incoφorated into the compositions.
Solutions ofthe active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions also can be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
The expression constructs and delivery vehicles ofthe present invention may include classic pharmaceutical preparations. Administration of therapeutic compositions according to the present invention will be via any common route so long as the target tissue is available via that route. This includes oral, nasal, buccal, rectal, vaginal or topical. Alternatively, administration will be by orthotopic, intradermal subcutaneous, intramuscular, intraperitoneal, or intravenous injection. Such compositions would normally be administered as pharmaceutically acceptable
compositions that include physiologically acceptable caniers, buffers or other excipients.
The therapeutic compositions ofthe present invention are advantageously administered in the form of injectable compositions either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection may also be prepared. These preparations also may be emulsified. A typical composition for such puφose comprises a pharmaceutically acceptable carrier. For instance, the composition may contain about 100 mg of human serum albumin per milliliter of phosphate buffered saline. Other pharmaceutically acceptable carriers include aqueous solutions, non-toxic excipients, including salts, preservatives, buffers and the like may be used. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oil and injectable organic esters such as ethyloleate. Aqueous carriers include water, alcoholic/aqueous solutions, saline solutions, parenteral vehicles such as sodium chloride, Ringer's dextrose, etc. Intravenous vehicles include fluid and nutrient replenishers. Preservatives include antimicrobial agents, anti-oxidants, chelating agents and inert gases. The pH and exact concentration ofthe various components the pharmaceutical composition are adjusted according to well known parameters.
Additional formulations which are suitable for oral administration. Oral formulations include such typical excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate and the like. The compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders. When the route is topical, the form may be a cream, ointment, salve or spray. An effective amount ofthe therapeutic agent is determined based on the intended goal, for example (i) inhibition of tumor cell proliferation or (ii) elimination of tumor cells. The term "unit dose" refers to physically discrete units suitable for use in a subject, each unit containing a predetermined-quantity ofthe therapeutic composition calculated to produce the desired responses, discussed above, in
association with its administration, i.e., the appropriate route and treatment regimen. The quantity to be administered, both according to number of treatments and unit dose, depends on the subject to be treated, the state ofthe subject and the protection desired. Precise amounts ofthe therapeutic composition also depend on the judgment ofthe practitioner and are peculiar to each individual. Kits
All the essential materials and reagents required for inhibiting tumor cell proliferation, transforming cells or detecting cancer cells, may be assembled together in a kit. This generally will comprise selected expression constructs. Also included may be various media for replication ofthe expression constructs and host cells for such replication. Such kits will comprise distinct containers for each individual reagent.
When the components ofthe kit are provided in one or more liquid solutions, the liquid solution preferably is an aqueous solution, with a sterile aqueous solution being particularly prefened. For in vivo use, the expression construct may be formulated into a pharmaceutically acceptable syringeable composition. In this case, the container means may itself be an inhalent, syringe, pipette, eye dropper, or other such like apparatus, from wliich the formulation may be applied to an infected area of the body, such as the prostate or breast, injected into an animal, or even applied to and mixed with the other components ofthe kit.
The components ofthe kit may also be provided in dried or lyophilized forms. When reagents or components are provided as a dried form, reconstitution generally is by the addition of a suitable solvent. It is envisioned that the solvent also may be provided in another container means. The kits ofthe present invention also will typically include a means for containing the vials in close confinement for commercial sale such as, e..g., injection or blow-molded plastic containers into which the desired vials are retained.
Inespective ofthe number or type of containers, the kits ofthe invention also may comprise, or be packaged with, an instrument for assisting with the injection/administration or placement ofthe ultimate complex composition within the body of an animal. Such an instrument may be an inhalent, syringe, pipette, forceps, measured spoon, eye dropper or any such medically approved delivery vehicle.
* * * * * * * * * * *
The following examples are included to demonstrate prefened embodiments ofthe invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice ofthe invention, and thus can be considered to constitute prefened modes for its practice. However, those of skill in the art should, in light ofthe present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope ofthe invention.
EXAMPLE I: C-CAM1 -Transfected PC-3 Cells
A. Materials and Methods 1. Plasmid Construction and Transfection into PCS and NbE
CeUs To construct sense and antisense C-CAM expression plasmids, a cDNA insert (1.7 kb) containing the entire coding sequence for C-CAMl (Lin and Guidotti, 1989; Lin et al, 1991, SEQ ID NOJ) was cloned into the Sa l site ofthe vector pRSN (Low et al. , 1991 ), a mammalian expression vector carrying neomycin acetyltransferase gene (neor), which confers neomycin resistance. The C-CAMl cDNA was placed under the control of both the Rous sarcoma virus long terminal repeat and the SV40 early promoter. The orientation of C-CAMl in pRSN was determined by restriction mapping. Digestion of sense clones with BamHI generates four fragments of; 2.7 Kb,
3.4 Kb, 2J Kb and 0.7 Kb in length. Digestion of antisense clones generates fragments of; 2.7 Kb, 3.4 Kb, 1.6 Kb and 1.2 Kb in length.
To produce transfected cells, 5 μg of C-CAMl expression plasmid mixed in 10 μl of Transfectam (Promega, Madison, WI) was added to parental PC-3 or NbE cells grown in T medium (80% Dulbecco's minimum essential medium plus 20% F-12 medium) containing 5% fetal bovine serum (FBS). To select for neomycin-resistant clones, the transfected cells were grown for 1 month in increasing concentrations of G418. The final concentration of G418 was 800 μg/ml and 1 mg/ml for PC-3 cells and NbE cells, respectively.
2. Cell Sorting by Flow Cytometry Membrane fluorescence staining was performed on a single-cell suspension with an anti-C-CAM polyclonal antibody (Ab669; Culic et al, 1992) and fluorescein isothiocyanate (FΙTC)-conjugated secondary antibodies (Cheung et al, 1993). FACS was performed with a dual-laser Vantage flow cytometer (Becton Dickinson,
Mountain View, CA) delivering 50 mW at 488 nm with an Enteφrise air-cooled laser. The flow cytometer was sterilized by a 30-min run with 70% ethanol and equilibration with sterile Isoton II (Coulter, Hialeah, FL) for 1 hr. Log green fluorescence was measured with a bandpass filter (530 nm 30 nm), and triggering mode was executed with forward light scatter set at a sufficiently high threshold to eliminate cell debris and dead cells (<5%). Drop delay was performed using the Autosort procedure (Becton Dickinson, Mountain View, CA). Analysis was performed using LYSYS II software (Becton Dickinson, Mountain View, CA).
3. Southern, Northern, and Western Blot Analyses
For Southern analysis, high-molecular-weight DNA was purified by the procedure of Davis et al. (1986). Twenty micrograms of high molecular weight DNA was digested with Hindlll overnight at 37°C and then subjected to Southern blot analysis as described previously (Hsieh et al, 1993) with a C-CAM cDNA probe
(Culic et al, 1992) or a neomycin acetyltransferase (neor) cDNA probe (Southern and Berg, 1982).
For Northern analysis, total cellular RNA was extracted from cells by using RNAzol B (Biotecx Laboratories Inc., Houston, TX) and a single-step purification protocol described by Chomcyzynski and Sacchi (1987). Twenty micrograms of RNA was subjected to Northern blot analysis by electrophoresis on a 0.9% agarose gel containing 2 M formaldehyde as described previously (Hsieh and Lin, 1994), and the blot hybridized with a random primer-labeled C-CAM cDNA probe (Culic et al. , 1992), neor cDNA probe or 28S RNA probe. To isolate total cellular protein for Western analysis, the cells were trypsinized into a single-cell suspension and counted with a hemacytometer. Aliquots ofthe cell suspension from each clone were boiled in sodium dodecyl sulfate sample buffer, and Western blot analysis performed as described previously (Cheung et al. , 1993) with anti-C-CAM antibody Ab669.
B. Results
1. C-CAMl -Transfected PC-3 Cells To examine the role of C-CAM in prostate cancer progression, the C-CAMl cDNA in the mammalian expression vector pRSN was transfected into a human prostate carcinoma cell line designated PC-3. This cell line is highly tumorigenic and found to be negative for C-CAM by both Northern and Western analyses. After transfection, the cells were grown in medium containing G418 to select for neomycin- resistant clones.
Immunofluorescence staining ofthe transfected PC-3 cells with anti-C-CAM antibody Ab669 was performed after 1 month of G418 selection. Although the immunofluorescence staining showed that C-CAMl was expressed on the cell surface, only a small portion of cells (about 10%) reacted with the polyclonal antibody against C-CAM (FIG. 2A). This result suggested that only a small population ofthe transfected cells expressed C-CAMl . To increase the proportion of C-CAMl -positive
cells, the C-CAMl -positive cell population was enriched to 92% by fluorescence- activated cell sorting (FACS) (FIG. 2B). Two clones, PC-LI and PC-L2, were isolated from the enriched population and characterized. Two additional clones, PC- L6 and PC-L9, were later isolated from this enriched population by using the same approach.
Southern blot analysis of genomic DNA isolated from various transfectants, digested with Hindlll and hybridized with the neomycin acetyltransferase (neor) cDNA probe, revealed several different DNA integration patterns. As expected, the parental PC-3 cells were negative for neor. PC-3 cells transfected with the PC-RSN vector alone (designated PC-RSN cells) showed a complex pattern of neor integration. Two patterns of integration were seen among the four C-CAMl -positive clones, PC- Ll and PC-L2 having one type of integration and PC-L6 and PC-L9 another. These data indicate that these four C-CAMl -positive clones were derived from at least two different cells. No C-CAM message was detected by Northern blot analysis in PC-3 or PC-
RSN cells, suggesting that C-CAM was either not expressed or expressed in very low levels in these cells. In PC-LI and PC-L2 cells, a single 3.0 kB C-CAMl mRNA was detected. Two C-CAM transcripts were found in PC-L6 and PC-L9 cells, the 3.0 kB transcript and a slightly larger one. This larger transcript may represent a fusion of the C-CAM and neor genes, because this band hybridized to both the C-CAM and
Neor probes. As predicted, the neor mRNA was expressed in all transfected clones but not in the parental PC-3 cells. Hybridization with 28 S rRNA, which served as an internal control, showed that similar amounts of RNA were loaded for each sample. Western blot analysis with anti-C-CAM antibody Ab669 revealed similar profiles of C-CAM protein expression in all four C-CAMl transfectants, while PC-3 and PC-RSN cells were negative for C-CAM expression. The C-CAMl. protein expressed from PC-3 transfectants was heterogeneous; the 105 kDa form was predominant. The heterogeneity may be due to different degrees of glycosylation since there are 16 potential N-linked glycosylation sites present in the extracellular
domain of C-CAMl. More C-CAMl protein was detected in PC-LI and PC-L2 cells than in PC-L6 and PC-L9 cells, suggesting that C-CAMl protein levels may be regulated differently in these clones.
EXAMPLE II - Cell Adhesion and Growth Characteristics of Transfected PC-3 Cells
A. Materials and Methods
1. Cell Adhesion Assay
Cells were resuspended at a concentration of 1 x 10 /ml. Cell suspensions (1 ml) in 1.5 -ml Eppendorf tubes were mixed gently at room temperature to allow formation of aggregates. Samples were taken over a 5-hr period, and the number of single cells was determined with a hemacytometer. The aggregation of cells was monitored as a decrease in the percentage of single cells.
2. In Vitro Growth Assay
The in vitro growth rate of C-CAMl -transfected PC-3 clones was measured with three different assays. In one method, cells were grown in T-medium containing 5% FBS, trypsinized and counted with a hemacytometer 24, 48, and 96 hr after plating. In a second method, 5,000 cells from each clone were grown on a 24-well plate with T-medium containing 1% FBS. The medium was changed every 4 days. The number of cells was determined every 48 hr using the crystal violet assay as described in Gleave et al. (1991) and incoφorated herein by reference. In a third method, cells were plated as above and every 24 hours, fresh medium containing 0J mCi of [ H]-thymidine was added. [ H]-thymidine incoφoration was determined after a 2-hr incubation as described in Chang and Chung (1989) and incoφorated herein by reference.
B. Results
To test the intercellular adhesion of C-CAMl expressed on the transfected PC- 3 cells, the ability of single cells to form aggregates in suspension was measured. The time course of aggregate formation for PC-3, PC-RSN, PC-LI, PC-L2, PC-L6, and PC-L9 cells, as measured by the decrease in the number of single cells, is shown in FIG. 3. PC-3 and PC-RSN cells, which did not express the C-CAMl protein, did not aggregate. In contrast, all ofthe C-CAMl transfectants formed aggregates. These results indicate that the C-CAMl expressed in PC-3 cells was able to elicit adhesion. Consistent with their higher level of C-CAMl protein expression, PC-LI and PC-L2 cells aggregated slightly more than PC-L6 and PC-L9 cells did.
The effect of C-CAMl on cell growth also was analyzed. The four C-CAMl transfected clones had growth rates (measured by counting the cells with a hemacytometer) of about 50% that of control cells. Similar results were obtained by measuring the increase in the number of cells by crystal violet staining (FIG. 4A) and by measuring the rate of DNA synthesis by [ HJthymidine incoφoration (FIG. 4B). Crystal violet staining showed that PC-RSN cells had a growth rate similar to that of parental PC-3 cells. In contrast, the growth rates ofthe C-CAMl -transfected cells were about 25% that ofthe control cells 6 days after plating (FIG. 4A). By day 8, PC- L6 and PC-L9 cells were growing faster than PC-LI and PC-L2 cells, perhaps because ofthe lower C-CAMl levels in PC-L6 and PC-L9 cells. The rate of DNA synthesis, measured by [ HJthymidine incoφoration, was noticeably lower than control levels in all ofthe C-CAMl -transfected cells (FIG. 4B). This finding suggests that the growth inhibition of C-CAMl -transfected cells may result from an alteration in the cell cycle.
EXAMPLE III- Suppression of Tumorigenicity of PC-3 Cells bv C-CAMl Expression
A. Materials and Methods
1. Measurement of Anchorage-Independent Growth The soft-agar assay described by Giancotti and Ruoslahti (1990), and incoφorated herein by reference, was used to measure the anchorage-independent growth of each transfected clone. Cells were plated onto 6-well plates, and colonies were scored in triplicate by two different investigators, 21 days after plating, by counting aggregates (>10 cells) in several randomly chosen areas.
2. Assessment of In Vivo Tumorigenicity
To determine the tumorigenicity of each transfected clone, 1 x IO6 cells/per site were injected at six sites in the flanks of 8- to 10- week-old male nude mice subcutaneously. Once a tumor became palpable, it was measured weekly and its size calculated using the formula for the volume of a hemiellipsoid, the geometric figure most nearly approximating the shape ofthe tumor: volume = length x width x height x 0.5236 (Rockwell et al, 1972).
B. Results Normal cells must attach to a substratum to grow, whereas tumorigenic cells do not. As a result of this property, they can form colonies on soft-agar plates (Shin et al, 1975). To determine the effect of C-CAMl expression on soft-agar colony formation by PC-3 cells, the inventors examined the anchorage-independent growth of the C-CAMl -transfected clones. These four clones formed significantly fewer colonies in soft-agar in three independent studies (Table 4A). In addition, the colonies of PC-LI, PC-L2, PC-L6, and PC-L9 cells were smaller than those of PC-3 and PC-RSN cells. These observations indicate that expression of C-CAMl may affect the tumorigenicity of PC-3 cells.
Table 4A. Anchorage-Independent Growth of C-CAMl-Transfected PC-3 Cells2
Anchorage-independent growth (% of control)
Clone Exp 1 Exp 2 Exp 3
PC-3 ND 100b 100b
PC-RSN 100b 100±2 89±3
PC-LI 52±2 45±1 ND
PC-L2 36±4 45±1 30±1
PC-L6 ND ND 50±3
PC-L9 ND ND 60±2
aAnchorage-independent growth was measured by triplicate counts ofthe colonies that had formed by day 21 after plating. The results are expressed as percentages of control (PC-RSN or PC-3) ± standard enor. ND, not determined. bControl, defmed as 100%.
Next, the ability of these cells to produce tumors in nude mice in vivo was measured. PC-3 cells previously have been shown to be highly tumorigenic when injected into nude mice (Kaighn et al, 1979). To test the transfected cells, cells from each clone were injected into the flanks of male athymic nude mice subcutaneously and the incidence of tumor formation and the volumes ofthe tumors monitored. As shown in Table 4, 60 days after injection, the tumor incidence was 67-94% for PC-3 cells and PC-RSN cells. In contrast, a much lower tumor incidence was observed in mice injected with C-CAMl -transfected cells. In addition, parental PC-3- and PC- RSN-induced tumors generally arose within 3 to 4 weeks of injection, whereas injecting the same number of C-CAMl -transfected cells into nude mice produced fewer or no tumors within the first 30 days (Table 4B). In addition, the tumors produced from transfected cells were much smaller (FIG. 5A and FIG. 5B). These
data indicate that expression of C-CAMl in PC-3 cells suppressed or delayed tumor growth in vivo.
Table 4B. Tumor Incidence Induced by C-CAMl-Transfected PC-3 Cells rumor incidenceJ%
Test i Test 2
Clone Day 30 Day 60 Day 30 Day 60
PC-3 12/36(33%) 24/36(67%) ND ND
PC-RSN 29/36(80%) 34/36(94%) 12/18(67%) 17/18(94%)
PC-LI 2/36(5%) 12/36(33%) ND ND
PC-L2 0/36(0%) 2/36(5%) ND ND
PC-L6 ND ND 0/18(0%) 0/18(0%)
PC-L9 ND ND 0/18(0%) 4/18(22%)
"Tumors larger than 10 mm3 were considered to be positive. ND, not determined.
Taken together, these results demonstrated that expression of C-CAMl markedly suppressed the tumorigenicity, as well as the tumor growth, of PC-3 cells.
EXAMPLE IV - Increased Tumorigenicity of NbE Cells by Transfection of Antisense C-CAMl Plasmid
A. Materials and Methods
1. In Vitro Characterization of Mac Clones
Plasmid construction and transfection of NbE cells were as described in Example I. Individual Mac clones derived from NbE cells transfected with antisense C-CAMl cDNA were characterized for cDNA integration and protein expression. For Southern blot analysis, 20 μg of high-molecular- weight DNA was isolated from each cell line, digested with HiήDϊll at 37°C overnight, and then subjected to Southern blot analysis. The blot was hybridized with a neor probe and a C-CAM
probe as described in Example I. Total protein (5 μg) from each cell line was subjected to Western blot analysis with the anti-C-CAM antibody, Ab669. The relative levels of C-CAM protein was determined by densitometrical scanning.
After growing in 1 mg/ml G418 for 1 month, transfected cells (antisense- 1, 1 x 10 cells/site) were injected into nude mice subcutaneously.
2. In Vitro Cell Cloning of NbE Sublines (Mac) Tumors were excised from animals and placed in serum-free T-medium containing antibiotics. After removing excess skin and blood clots, tissues were rinsed with serum-free T-medium, 3 times. Tissues were cut into 3 mm pieces and placed in a 6-well plate coated with FBS; then, a small amount of 10% FBS T- medium was added to cover each tumor for overnight incubation at 37°C. The medium was changed every 4 days and G418 (200 μg/ml) was added when epithelia started appearing on the dish. The concentration of G418 was gradually increased to a final concentration of 1 mg/ml within 1 month. The cells were then further cloned by the ring-cloning technique as described in Freshney (1987) and incoφorated herein by reference.
B. Results To further examine the tumor-suppressor activity of C-CAMl in prostate cancer development, the inventors tested whether down-regulation of C-CAM in a non-tumorigenic cell line could lead to tumor formation in nude mice. The NbE cell line, a prostatic epithelial cell line derived from the ventral prostate of a Noble rat (Chung et al, 1989), was chosen because it expresses detectable levels of C-CAM and does not cause tumor formation when injected into nude mice or into the syngeneic host (Chung et al, 1989). The antisense C-CAMl plasmid, constructed by inserting the full-length C-CAMl cDNA into pRSN in the anti-sense orientation, was used to reduce C-CAMl expression.
In the first study, NbE cells were transfected with an antisense C-CAMl vector. Transfected cells were selected by increasing concentrations of G418. After growing in 1 mg/ml G418 for 1 month, transfected cells (antisense- 1, 1 x IO6 cells/site) were injected into nude mice subcutaneously. Sixty days later, tumors appeared at all the antisense- 1 injection sites (Table 5 A), but no tumors appeared where parental NbE cells had been injected. The antisense-induced NbE tumors were excised from the mouse and cells were cloned from these tumors. Since antisense- transfected NbE cells are resistant to G418 treatment and the cells derived from the nude mouse are not, the antisense-transfected NbE cells can be specifically selected from total tumor tissues by G418 selection. After G418 selection for one month, six sublines (named Mac-1 to Mac-6) were isolated from six individual tumors. The tumorigenicities of these six cell lines were tested together with several control NbE cell lines, as shown in Table 5B.
To confirm the previous finding, the same antisense vector was transfected into NbE cells to generate a second transfected NbE cells (antisense-2). Other control NbE cell lines, including those transfected with sense and vector controls, also were generated and selected under the conditions used in the first study. When these cell lines were injected into nude mice, the antisense vector induced tumors at an incidence of 50% appeared 40 days after injection (Table 5B), with an average tumor volume similar to that ofthe previous study (Table 5 A), whereas no tumors developed in mice injected with sense and vector controls (Table 5B).
Table 5A. Tumor Incidence and Tumor Growth Induced by Antisense C-CAMl -Transfected NbE Cells
Tumor incidence (%) Tumor volume
(mm3)
NbE clones 60 days 60 days parental 0/6 (0%) 0 antisense-1 6/6 (100%) 49±9
Table 5B. Tumor Incidence and Tumor Growth Induced by Antisense C-CAMl-Transfected NbE Cells
Tumor incidence (%) Tumor volume (mm3)
NbE clones 14 days 40 days 14 days 40 days parental 0/18 (0%) 0/18 (0%) 0 0 plasmid control 0/18 (0%) 0/18 (0%) 0 0 sense 0/18 (0%) 0/18 (0%) 0 0 antisense-2 0/18 (0%) 9/18 (50%) 0 58±8
Mac-1 11/12(92%) 12/12(100%) 34±4 144±25
Mac-2 11/12(92%) 12/12(100%) 45±7 117±14
Mac-3 12/12(100%) 12/12(100%) 37±4 98±16
Mac-4 12/12(100%) 12/12(100%) 50±5 285±37
Mac-5 12/12(100%) 12/12(100%) 47±3 91±13
Mac-6 12/12(100%) 12/12(100%) 44±6 117±14
humors larger than 10 mm3 were considered to be positive.
Histopathologic examination of hematoxylin- and eosin-stained tumor tissues from these antisense-2 tumors revealed that they were anaplastic and poorly differentiated. In the same in vivo tumorigenicity study, all six anti-sense sublines, Mac-1 to Mac-6, showed aggressive tumor formation with almost 100% tumor incidence, and palpable tumors 14 days after inoculation. These results indicate that transfection of antisense C-CAMl into NbE cells changed the cells from non- tumorigenic to highly tumorigenic.
Southern analyses were used to determine the clonality of antisense NbE- derived sublines, Mac-1 to Mac-6. All Mac clones hybridized with both the neor and the C-CAM probes; however, two patterns of integration were observed. Mac-1, Mac -2, Mac-5, and Mac-6 had the same DNA integration pattern, while Mac-3 and
Mac-4 had a different pattern. These results indicate that these six sublines originated from two different clones.
Western immunoblotting indicated that the levels of C-CAM were significantly (10- to 100-fold) lower in all six sublines than in the parental cells. Results from the densitometrical scanning, were as follows: parental (100%), plasmid control (85±7%), Mac-1 (9±1%), Mac-2 (3±1%), Mac-3 (4±1%), Mac-4 (1±0%), Mac-5 (1±0%), Mac-6 (6±1%). Thus, the increased tumorigenicity ofthe antisense C- CAM-transfected cells conelated with their reduced C-CAM levels.
EXAMPLE V - Expression of C-CAM During Human Prostate Development
A. Materials and Methods
1. Immunohistochemistry Tissue samples from radical prostatectomy (25 patients) and transurethral resection ofthe prostate (1 patient) were obtained from the Department of Pathology at the M.D. Anderson Cancer Center. The tissue samples were immediately placed in tissue blocks with O.C.T. compound (Miles, Elkhart, IN) and frozen at -20°C. Both prostate carcinomas and normal prostatic tissues were included in this study. Serial 4 μm-thick sections were cut from each sample with a cryostat. One section was stained with hematoxylin and eosin for pathological evaluation and grading; adjacent sections were used for immunohistochemical staining. The prostate adenocarcinomas were graded according to the Gleason grading system. Prostatic intraepithelial neoplasia (PIN) was classified as low grade (PIN1) and high grade (PIN2 and PIN3) as agreed at the 1989 Workshop on Prostatic Dysplasia (Drago et al, 1989). In addition, prostate samples representative of prostate gland development, such as fetal prostates (30- and 36- week-old) and a prostate from a 13 -year-old boy were included in the study. These samples were provided as frozen sections by Sherwood et al. (1991).
For immunoperoxidase staining, tissue was placed on silicone coated slides, which were then rinsed in phosphate-buffered saline (PBS). The tissue was fixed in a solution of 95% methanol and 5% acetic acid at -20°C for 15 min. Endogenous peroxidase activity was blocked with 3% hydrogen peroxide in methanol at room temperature for 15 min. After the tissue was washed with PBS three times for 5 min. each, Superblock (Scytek Laboratories, Logan, UT) was applied for 20 min. at room temperature. Slides were then incubated with the polyclonal antibody specific against C-CAM (Ab 669, 1:2000 dilution in PBS containing 1% bovine serum albumin) overnight at 4°C. The negative controls were incubated with preimmune serum. A biotin-avidin amplification system using a StrAviGen™ Super Sensitive kit (Biogenex Laboratories, San Ramon, CA) with diaminobenzidine (DAB) as the chromogen was applied. A light green dye (Sigma Chemical Co., St. Louis, MO) was used for background counterstaining.
Immunohistochemical staining was evaluated by three observers. The pattern of staining was classified as positive with a continuous staining (staining in a continuous pattern sunounding any given gland), positive with a discontinuous staining (staining in a broken or discontinuous pattern sunounding any given gland), or negative staining (no staining at all).
Table 6: C-CAM Staining in the Normal Adult Prostate, BPH, PIN (A) and Primary Prostate Carcinomas (B)
(A)
Histology Zonal Cases Staining Pattern Origin
Continuous2 Discontinuous b
Normal Peripheral 20 20 (100%) 0
Normal Central 2 2 (100%) 0
Normal Transition 7 7 (100%) 0
Atrophy Peripheral 17 17 (100%) 0 Transition
BPH Transition 5 2 (40%) 3 (60%)c
PIN'' Peripheral 12 7 (58%) 5 (42%)e
(B)
Gleason Score Zonal Origin Cases Positive Negative
5-7 Transition 3 0 3 (100%)
Peripheral 16 0 16 (100%)
8-10 Peripheral 1 0 1 (100%)
Not determined 2 0 2 (100%)
Total 22 22 (100%)
Continuous: Uniform staining throughout the entire basal cell layer of each gland. bDiscontinuous: Non-uniform staining ofthe basal cell layer surrounding each gland. cIn all 3 of these cases the inventors observed a mixed staining pattern: some BPH glands had discontinuous staining, whereas other BPH glands had negative staining. dHigh grade PIN (PIN2 and PIN3). eIn 4 of 5 of these cases the inventors observed a mixed staining pattern:' some PIN glands had discontinuous staining, whereas other PIN glands had continuous staining. In the fifth case of PIN there was solely discontinuous staining. fZone not able to be determined.
B. Results
Arising from the urogenital sinus and the vesicourethral components ofthe cloaca. The bud stage (20-30 weeks gestation) is characterized by solid epithelial buds at the ends of ducts without a recognizable lumen (Xia et al, 1990). Using cell type-specific cytokeratin antibodies for either basal or luminal cells, Sherwood et al. clearly showed that only basal cells were present in these epithelial buds (1991). By 36 weeks of gestation, some buds are still visible; however, the majority have developed into acinotubular structures with identifiable lumens (Xia et al, 1990). To understand the expression pattern of C-CAM during prostate development,the inventors studied the same 30- week- and 36- week-old fetal prostate specimens by immunohistochemical staining using a polyclonal antibody specific against C-CAM, Ab 669. Recent data indicated that Ab 669 raises against rat C-CAM molecule can cross react with the human counteφart BGP-1 (Gao and Knowles, 1993) but appears not to cross-react with CEA and other immunoglobulin-like CAM's (Gao and Knowles, 1993). In the 30-week-old fetal prostate, C-CAM expression could be detected as typical plasma membrane staining associated with multiple basal cell layers in the epithelial buds. In contrast, the sunounding stromal compartment stained negatively. In addition to epithelial buds in the 36- week-old fetal prostate, there were acino-tubular structures with identifiable lumens. C-CAM expression localized predominantly in the basal cell layers of these maturing glands. Luminal epithelium showed weak if any staining. Furthermore, tissue obtained from a 13-year-old prostate exhibited a continuous positive staining of C-CAM associated with the basal cell layer, and again the luminal epithelium showed weak if any staining. In contrast, the antibody controls showed a negative C-CAM staining. In the normal adult prostate gland, C-CAM expression showed the same positive staining pattern in the basal cell layer as was observed in the fetal prostates. Taken together, these data
indicate that C-CAM expression in the normal human prostate gland is associated with basal cells throughout the early fetal stage into adulthood.
In contrast, the rat ventral prostate shows a different staining pattern; steady- state levels of C-CAM are detected in the luminal epithelium from intact animals. However, elevated levels of C-CAM are detected in the basal cell layer only after androgen deprivation (Hsieh and Lin. 1994). This difference in C-CAM staining between the two species may be due to differences in the proliferative potential of luminal epithelium. For example, in the intact rat prostate, proliferative activity is found in the luminal epithelium (English et al, 1987). In the human prostate, however, the majority of proliferative activity is confined to the basal cell population (Bonkhoffet /., 1994).
Consistent with the results from fetal prostate development, the inventors observed a continuous plasma membrane staining of C-CAM predominantly associated with basal cells in the normal glandular epithelium from the peripheral, central and transition zones ofthe prostate. As summarized in Table 3 A, the inventors observed the same continuous staining pattern of C-CAM in the basal cell layer in all specimens examined (29 cases) regardless of zonal origin. On the other hand, luminal cells showed weak if any staining. In addition, atrophic glands (17 cases) with a distinct basal cell layer exhibited a continuous C-CAM staining pattern in the basal cell layer in any given gland (Table 3A).
2. Decreased Expression of C-CAM in BPH and PIN Benign prostatic hypeφlasia (BPH), often found in the transition zone/periurethral gland region ofthe human prostate (McNeal, 1978), is considered a hypeφlastic growth of epithelium and/or mesenchyme. In this study, an overall decrease in C-CAM staining was observed in the epithelial compartment from BPH glands compared with adjacent normal glands in the transition zone. The overall C- CAM staining pattern of basal epithelium from BPH glands can be divided into two categories. First, as shown in Table 3 A, in 40% of specimens examined, the basal
epithelium from BPH glands showed a continuous staining pattern of C-CAM with a similar staining to normal glands, but the majority (60%) of specimens showed either a discontinuous staining pattern in the basal layer or no staining at all. However, in the adjacent normal (nonhypeφlastic) glands from the same tissue section, the basal cell layers exhibited a continuous C-CAM staining. Therefore, decreased C-CAM expression may be associated with hypeφlasia ofthe prostatic epithelium.
Prostatic intraepithelial neoplasia (PIN) is considered a precursor of prostate carcinoma (McNeal and Bostwick, 1986; Troncoso et al, 1989). Therefore, it is important to determine C-CAM expression in PIN. The inventors' finding on PIN are limited to high grade (PIN2 and PIN3) lesions that could be reproducibly identified on the frozen sections. Because low grade PIN (PIN1) could not be unequivocally distinguished from epithelial hypeφlasia or other minor epithelial atypias on frozen sections, it was not included in the inventors' evaluation.
As summarized in Table 3A, the overall C-CAM staining pattern associated with basal cells is altered in high grade PIN glands. For example, although some PIN glands still exhibited a continuous C-CAM staining pattern in the basal cell layer, adjacent PIN glands had a discontinuous pattern of C-CAM staining along the basal cell layer. Very often, this discontinuous pattern of C-CAM staining associated with PIN was seen adjacent to areas of carcinoma, which were completely negative for C- CAM staining (FIG. 4A and FIG. 4B). Notably, the inventors also observed a mixed pattern of both continuous and discontinuous staining associated with the basal layer within a single PIN gland.
These observations suggested that the altered and decreased C-CAM expression may be associated with the continuous progression from normal prostatic epithelium to premalignant transformation and finally to carcinoma (Bostwick and
Brawer, 1987). Moreover, these results indicated that altered C-CAM expression may be an early event associated with prostate cancer development.
3. Absent Expression of C-CAM in Primary Prostate Carcinomas Prostate cancer is a multifocal disease with a wide range of histologic patterns and biologic potential. The heterogeneous staining pattern of C-CAM in premalignant PIN glands prompted the examination of C-CAM expression in prostate cancers of different histologic grade and zonal origin. In all. 22 prostate carcinoma specimens examined, a complete absence of C-CAM staining was observed regardless of tumor grade and zonal origin (FIG. 4 and Table 3B). The carcinomas studied were moderately and poorly differentiated tumors (Gleason score 5-10). Although the inventors did not examine well-differentiated carcinomas (Gleason score 2-4), areas of histologic grade 2 present focally among the moderately differentiated tumors also were negative.
In contrast, normal glands from the same sections still retained a continuous staining pattern of C-CAM, indicating that the absence of staining in carcinoma was not due to staining artifact (FIG. 4C and FIG. 4D). All pre-immune serum controls were negative. Thus, the expression of C-CAM inversely conelated with the appearance of carcinoma. The complete loss of C-CAM even in the foci within moderately-differentiated tumors suggests that the loss of C-CAM occurs early in malignant transformation.
Consistent with the absence of C-CAM expression in human prostate cancer specimens, C-CAM also was not detected in several established human prostate cancer cell lines, including PC-3 (Example I), and DU-145 and LNCaP cells.
EXAMPLE VI - Construction and Analysis of the C-CAMl Recombinant Adenovirus A. Materials and Methods
1. Construction and large-scale production ofthe C-CAMl recombinant adenovirus To construct a recombinant adenovirus containing the C-CAMl gene, as shown in FIG. 6, C-CAMl cDNA (Lin and Guitti, 1989; Cheung et al, 1993a; SEQ
ID NOJ) was cloned into the EcoRI site ofthe multiple cloning sites ofthe pBSK vector (Stratagene. La Jolla, CA). Either a sense or antisense strand of C-CAMl cDNA was directionally cloned into the HiήDlll and NotI sites of a shuttle vector (pAdElCMV/pA). So that its expression was under the control of a cytomegalovirus (CMV) promoter, one ofthe very strong promoters (Boshart et al, 1985). The recombinant adenovirus was generated from cotransfection ofthe shuttle vector (30 μg) with the C-CAMl cDΝA insert and a pJM17 vector (20 μg) carrying both adenoviral genome (Ad5) and pBR322 sequences.
The two vectors were cotransfected into 293 cells using DOTAP reagent (Boehringer-Mannheim, Indianapolis, IN) according to the manufacture's protocol. The pBR322 sequences in pJM17 make the entire viral DNA too large to be packed into protein coat, which prevents the appearance of wild type virus (Graham and Prevec, 1991). In this study, two replication-deficient recombinant viruses, one containing the sense orientation of C-CAMl cDNA (AdCAM902) and the other containing the antisense orientation of C-CAM 1 cDNA (AdCAM 101), were generated from homologous recombination in a packaging cell line (293 cells). Each clone of viruses was isolated from a single plaque after reinfecting 293 cells (Graham and Prevec, 1991). Subsequently, a large amount of viral stocks were produced from 293 cells and purified by Inland Laboratories, Inc. (Austin, TX). The average titers of viral stocks were estimated to be 1 x 10 virions/ml as determined by A260 assay; or 1 x 10π plaque forming units (pfu/ml) for AdCAMlOl and 1 x 1010 pfu/ml for AdCAM902 as determined by a plaque assay.
2. Analysis ofthe structure ofthe recombinant adenovirus by PCR Adenoviral DNA was prepared as described previously (Zhang et al, 1993).
PCR™ (Polymerase chain reaction) was performed in a 50-ml reaction mixture containing 4 mM MgCl2, 50 mM KCl, 0.1% Triton® X-100, 200 mM of each deoxyribonucleotide triphosphate, 10 mM Tris-HCl (pH 9.0), 2 mM ofthe different primer sets (primer set A [5GATCCAACACAAGGAAATTC3',
5TCACTTCTTTTTGACTAC3']; primer set B [5'GGCCCACCCCTTGGCTTC3', 5TTGTAACCATTATAAGCTGC3']; or primer set C
[5TCGTTTCTCAGCAGCTGTTG3', 5'CATCTGAACTCAAAGCGTGG3']), and 1.0 unit of Taq DNA polymerase (Promega, Madison, WI). The reactions were carried out for 30 cycles, and each cycle was performed at 94°C for 0.5 min, at 56°C for 0.5 min, and 72°C for 1 min.
3. Determination of viral infectivity ofPC-3 cells by Fluorescent- activated cell scanning analysis PC-3 cells (5 x 10 cells) were plated on a 65-mm plate for 24 h, then different concentrations of viruses were added and incubated at 37°C for 24 h. Cells were trypsinized into a single-cell suspension and incubated with either pre-immune serum or anti-C-CAM polyclonal antibody (Ab669) and fluorescein isothiocyanate (FITC)- conj ugated secondary antibodies as described by Cheung et al, 1993a. Percentage of positive cells was determined by a dual-laser Vantage flow cytometer (Becton Dickinson, Mountain View, CA) as described in Example I.
4. Determination of C-CAMl expression by C-CAMl recombinant adenovirus using Northern and Western analyses To determine the levels of C-CAMl expression in viral-infected cells, the inventors performed both Northern and Westem assays as described in Example I. For the dose-dependent studies, PC-3 cells (5x10 cells) were infected with either AdCAMlOl or AdCAM902 at various ratios of virionsxells (0:1, 1:1, 5:1, and 20:1) for 24 h. Cells were harvested for the determination of C-CAMl mRNA and protein levels. For the time course studies, the same amount of PC-3 cells was infected with either AdCAMlOl or AdCAM902 at a 5:1 virionxell ratio and medium.was changed every 3 days. For the Northern blot analysis, cells were harvested for the determination of C-CAMl mRNA levels at day 4, 7, 10 and 14. Glyceraldehyde-3- phosphate dehydrogenase (GAPDH) was used as an intemal control. For the Westem
blot analysis, cells were harvested for the determination of C-CAMl protein levels at day 6, 14 an 20.
B. Results To ensure the completion of homologous recombination and the presence of
C-CAM in these recombinant adenoviruses, the inventors performed PCR using different sets of primers as described in Materials and Methods. As shown in FIG. 7, using a C-CAM-specific primer set (i.e., primer set A) from the C-terminal portion (from amino acid 413 to amino acid 519) of C-CAM (Lin and Guidotti, 1989), the inventors were able to amplify a 0.3 kB transcript from both AdCAMlOl and AdCAM902 DNA, indicating that both adenoviruses contained the C-CAM sequences.
Also, using primer set B for the flanking sequences from the human CMV promoter and SV40 polyadenylation site, a 2J kB full-length C-CAM cDNA transcript was detected in both vimses. These data indicated that the C-CAM insert was located between CMV promoter and SV40 polyadenylation. Moreover, using an adenovirus-specific primer (i.e., primer set C), an expected 0.86 kB PCR™ transcript appeared from both vimses, indicating that both vimses were generated from homologous recombination. Taken together, these data indicate that these two vimses contain the expected gene stmcture.
To characterize the infectivity of adenovims to prostatic cancer cells, PC-3 cells (5x105 cells) were plated in a 65-mm dish overnight prior to infection, then various ratios of viral particles per cell were added to cells and incubated at 37°C for 1, 2, and 4 day. The efficiency of viral infection was determined by fluorescent- activated cell scanning based on positive membrane staining of C-CAMl. As shown in FIG. 8, the background fluorescence was set at 20 FITC units based on the scanning of PC-3 cells infected with buffer control (FIG. 8 A, FIG. 8E, FIG. 81). PC-3 cells infected with AdCAMlOl (FIG. 8B, FIG. 8F, FIG. 8J) gave the same fluorescence profile as for the buffer control indicating that cells infected with
AdCAMlOl did not express C-CAM protein. On the other hand, C-CAM was expressed by PC-3 cells infected with AdCAM902 (FIG. 8C. FIG. 8D, FIG. 8G, FIG. 8H, FIG. 8K, FIG. 8L).
When the inventors determined the percentage of positive cells after AdCAM902 infection for one day, the inventors found that 48% of cells expressed C- CAM1 when the cells were infected at a 100:1 virionxell ratio (FIG. 8C), and 93% of cells expressed C-CAM when infected at a 1000:1 ratio (FIG. 8D), which is comparable to other report using β-gal adenovims (Li et al, 1993). These data indicate that C-CAMl expression in AdCAM902-infected PC-3 cells is dose- dependent. On the other hand, the inventors observed that maximal infection (-93%) plateaued within 24 h at the saturated viral concentration (FIG. 8D, FIG. 8H, FIG. 8L). However, under the subsaturated viral concentration, the infectivity rate increased from 48% at day 1 to 77% at day 4 in a time-dependent manner (FIG. 8C, FIG. 8G, FIG. 8K), suggesting that this recombinant adenovims can maintain its infectivity at least 4 days.
When PC-3 cells were infected with sense recombinant adenovirus (AdCAM902), both Northern and Westem blot analyses showed that C-CAMl expression could be detected 24 h after infection and that the level of C-CAMl expression depended on the number of vimses used for infection. Detection of C- CAM expression was easily observed at ratios of 5:1 and 20:1, virionsxell. A much weaker signal was detected from PC-3 cells infected with AdCAMlOl, using a C- CAM1 cDNA probe, suggesting the presence ofthe antisense C-CAMl message. Since antisense mRNA, in general, has a short half-life, this weak signal is expected. AdCAMlOl showed no C-CAMl protein expression, however. These results indicate that the sense recombinant adenovims (AdCAM902) is capable of expressing C-
CAM1. From the time course study, a continuous elevation of C-CAMl mRNA was detected in viral-infected PC-3 cells 14 days after infection. Similarly, the C-CAMl proteins were still detectable 20 days after infection. Since the viral genome was not detected 10 days after infection, these data suggest that the prolonged C-CAMl
expression in sense recombinant vims-infected cells may be due to the high stability of C-CAMl protein.
EXAMPLE VII - Tumor Suppressing Effect of C-CAMl Recombinant Adenovirus
A. Material and Methods
1. Measurement ofPC-3 tumor growth by in vivo administration of recombinant adenovirus To determine the efficacy of C-CAMl adenovirus on the growth of PC-3 tumors, the inventors injected lxlO6 cells/site at four sites in the flanks of 8- to 10- week-old male nude mice subcutaneously. Once the tumor became palpable, 50 μl of either recombinant adenovims or buffer control (Phosphate-buffered saline + 10% glycerol) were injected near the tumor area (i.e., subcutaneously above the tumors). The change in tumor volume was measured weekly and calculated using the formula described previously in Example III.
B. Results
Previous results, in Example II, indicated that increased C-CAMl expression in PC-3 cells reduces the in vitro growth of this cell line. Based on the in vitro time course of C-CAM expression in vims-infected cells (Example VI), the inventors tested the therapeutic efficacy of C-CAMl on preexisting PC-3 tumors by injecting (50 μl) of either sense or antisense C-CAMl -adenovims or buffer control into the area near the tumor mass. The growth of tumors was then monitored weekly. As shown in FIG. 9, the growth of PC-3-induced tumors was suppressed by C-CAMl adenovims treatment for at least a 3-week period. At week 6, the inventors observed that tumors regained the growth activity. The second dose (50 μl) of vims delivered at week 7 was able to continue tumor suppression for at least a 2-week period (FIG. 9). In the same study, during the first few weeks of viral injection, the inventors observed a small degree of tumor inhibition by antisense (AdCAMlOl) adenovims treatment
suggesting that the vims itself may cause some toxic effect on cells since the titer of AdCAMlOl was 10-fold higher than that of AdCAM902. However, from the AdCAMlOl -treated group, the growth of PC-3 induced tumors eventually resumed and the size of tumors were similar to that ofthe control (FIG. 9). Since C-CAMl adenovims can suppress the growth of small tumors, the inventors further examined the efficacy of AdCAM902 treatment on larger tumors, ranging from 40 mm to 75 mm , which represent more heterogenous tumors. Based on results in previous examples, the inventors estimated that the effective viral dosage needed to increase at least 3 -fold in order to inhibit the growth of larger tumors. However, it is difficult to deliver such a large volume (e.g. , 150 μl) to tumors at once; therefore, the vimses were equally divided into three dosages and delivered every week for 3 consecutive weeks. In this study, the inventors observed that AdCAM902 (FIG. IOC), but not control (FIG. IOA) or AdCAMlOl (FIG. 10B), was still able to suppress the growth of PC-3 tumors for at least 5 weeks starting from the first viral injection (time 0). In some cases, however, AdCAM902 failed to suppress the tumor growth if the tumor size reached more than 100 mm .
EXAMPLE VIII - Construction and Analysis of Recombinant Adenoviruses
This example shows the constmction and analysis of recombinant adenovimses containing a C-CAMl cDNA and the effects of C-CAMl expression on the in vivo tumorigenicity of MDA-MB-468 breast cancer cells. A. Materials and Methods
1. Construction of recombinant adenoviruses
To study the effects of C-CAMl expression on the in vivo tumorigenicity of the breast cancer cell line MDA-MB-468. a series of adenovims recombinants were made, as shown in FIG. 11 , containing wild-type, anti-sense, or mutant C-CAM cDNA. Recombinant adenovimses containing the full-length wild-type C-CAMl cDNA in the sense (AdCAM 1) and antisense (AdCAM 1 -AS) orientations were constmcted as described previously (Kleinerman et al, 1995). To constmct the
AdCAMl-ΔDl vims, a 1.5-kb Hindlll-Notl fragment containing the C-CAMl cDNA lacking the first Ig domain was isolated from pCRlOOO-ΔDl (Cheung et al, 1993a) and inserted into an adenoviral shuttle vector. XCMV, to generate the plasmid XCMV-CAM1-ΔD1. The recombinant adenovims AdCAM 1-ΔD1 was generated by co-transfection of the plasmids XCMV-C AM 1 -ΔD 1 and p JM 17, a vector that contains the adenovims genome, into the human embryonal kidney cell line 293 as described previously (Kleinerman et al, 1995).
To constmct the AdCAM-H458 vims, the CAM1-H458 cDNA fragment with flanking Hindlll-Notl sites was generated by PCR™ amplification with oligo 42 (GTCGACAΔGCHATGGAGCTAGCCTCGGCTCGTCTC) and oligo 43 rCTCGGCCGCGTCGACGGTATCGATAAGGTTGATATO as primers (the Hindlll and NotI sites are underlined) and pSK-H458 (Lin et al, 1995) as the template. The 1.6 kb product was subcloned into pCRII to yield pCRII-Adeno-H458. The DΝA fragment coding for CAM1-H458 was isolated from pCRII-Adeno-H458 by digestion with Hindlll and NotI, and the fragment was inserted into the adenoviral shuttle vector XCMV at the Hindlll-Notl site to generate XCMV-CAM1-H458. AdCAM-H458 was generated by co-transfection as described above.
To construct the AdCAM 1-G454 vims, a kinased Hindlll recognition sequence was inserted at the Smal site of pSK-IL60, which contains the sequence for CAM1-G454 (also called C-CAM3) (Cheung et al, 1993c). The 1.5 kb CAM1-G454 cDΝA fragment was excised from the plasmid with Hindlll and Xmnl and inserted into pBluescript pBSK (Stratagene, La Jolla, CA) to generate pSK-IL60-Adeno. A 1.5 kb Hindlll-Notl fragment containing the CAM1-G454 cDΝA, which lacks the C- terminal 65 amino acids of C-CAMl, was isolated from pSK-IL60-Adeno and inserted into the adenovims shuttle vector XCMV at the Hindlll-Notl site to generate XCMV-CAM1-G454. AdCAM-G454 was generated by co-transfection as described above.
2. Detection of C-CAM protein by FACS analysis. MDA-MB-468 cells were infected with recombinant adenovims at various vims to cell (V/C) ratios. After 24 hr. fluorescence staining of C-CAM expressing cells was performed with an anti-C-CAM polyclonal antibody (Ab669) and fluorescein isothiocyanate-conjugated secondary antibodies as described previously (Cheung et al, 1993a). FACS analysis was performed as described previously (Hsieh et al, 1995).
3. Immunoprecipitation and western blotting. To analyze the C-CAMl proteins expressed in MDA-MB-468 cells, aliquots of cell lysate from infected and uninfected cells were boiled in sodium dodecyl sulfate (SDS) sample buffer and analyzed by SDS-polyacrylamide gel electrophoresis (Laemmli, 1970). Westem immunoblotting with Ab669 was performed as previously described (Lin et al, 1995). To immunoprecipitate the C-CAMl proteins expressed in MDA-MB-468 cells, aliquots of cell lysate (50 μl) from infected MDA-MB-468 cells were mixed with an equal volume of denaturing buffer (1 mM EDTA, 1% SDS, and 1 mM dithiothreitol, pH 8.0) and boiled for 5 min. After removal of insoluble material by centrifugation, the supematants were diluted with immunoprecipitation buffer (150 mM NaCl, 1 mM EDTA, 0.5% deoxycholate, 1% Nonidet P-40, and 25 mM Tris-HCl, pH 7.5) to a final volume of 1 ml and incubated with 3 μl of antipeptide antibody and 20 μl of protein G-Sepharose (Pharmacia Inc., Piscataway, NJ) for 16 hr at 4°C with constant mixing. The immunoprecipitates were washed once with 0.8 ml of immunoprecipitation buffer containing 0.1 ml of saturated NaCl, then with 0.8 ml of immunoprecipitation buffer containing 0.1% SDS, and finally with 0.8 ml of immunoprecipitation buffer alone. The materials bound to protein G- Sepharose were eluted by boiling the protein G-Sepharose in SDS sample buffer. Westem immunoblotting with Ab669 was performed as previously described (Lin et al, 1995).
4. Tumorigenicity in nude mice MDA-MB-468 cells were infected with recombinant adenovims at V/C ratio of 10: 1. Twenty-four hr after infection, the cells were removed from the plates by trypsin digestion and washed twice with phosphate-buffered saline. One million cells were then injected subcutaneously into each of six sites in the left and right flanks of nude mouse and tumor growth was monitored weekly. Tumor volume was estimated by the method of Rockwell et al (1972).
B. Results To study the effects of C-CAMl expression on the in vivo tumorigenicity of the breast cancer cell line MDA-MB-468. a full-length C-CAMl cDNA was inserted into an adenoviral vector to generate a C-CAMl recombinant adenovims (AdCAM 1) as a gene transfer vehicle. The breast-tumor cell line MDA-MB-468 was highly tumorigenic when injected into nude mice, displaying tumor growth in 16/18 animals, or 89% (Table 7). .MDA-MB-468 cells infected with recombinant wild-type or mutant adenvirases displayed varying incidences of tumor growth: AdCAM 1, 2/18 (11%); AdCAMl-AS, 12/18 (67%); AdCAMl-ΔDl, 3/18 (17%), AdCAMl-H458, 14/18 (78%); AdCAMl-G454, 15/18 (83%) (Table 7). On westem immunoblots with a polyclonal antibody against C-CAM (Ab669), C-CAM protein expression was not detectable in MDA-MB-468 cells. This result is consistent with those observed in hepatoma and prostate cancer in that C-CAM is down-regulated in these tumors. To determine the expression efficiency of C-CAMl in MDA-MB-468 cells, the inventors infected them with AdCAM 1 at various vims to cell (V/C) ratios. Because C-CAMl is an integral transmembrane protein, the efficiency of C-CAM expression was determined by fluorescence-activated cell sorting (FACS) with a polyclonal antibody against C-CAMl (Ab669) (Kleinerman et al, 1995). About 45%, 56%,- 69%, 73% and 86% of cells expressed C-CAMl on their surfaces when infected with AdCAM 1 at the V/C ratios of 5:1, 10:1, 20:1, 30:1, and 50:1, respectively, for 24 hr. In addition, the total amounts of protein expressed, as reflected by the increase in
fluorescence intensity, also increased as the V/C ratio increased. These results suggest that MDA-MB-468 cells are susceptible to adenoviral infection and can efficiently express and process the protein product ofthe C-CAMl recombinant adenovims.
Table 7. Tumor incidence induced by C-CAMl and C-CAMl mutant recombinant adenovirus infection of MDA-MB-468 cells
Adenovirus Infection Tumor Incidence (%\
Control (no infection) 16/18 (89)
AdCAMl-AS 12/18 (67)
AdCAMl 2/18 (11) AdCAMl-ΔDl 3/18 (17)
AdCAMl-H458 14/18 (78)
AdCAMl -G454 15/18 f8 ^
Tumors larger than 10mm were considered to be positive.
Although the size of C-CAMl is predicted to be 53 kDa based on its cDNA sequence (Lin and Guidotti, 1989; Lin et al, 1991), the proteins expressed from MDA-MB-468 cells after infection with AdC-CAMl had a relative mass of 120 kDa, suggesting that the C-CAMl proteins were glycosylated. In addition to showing the 120 kDa protein, a westem blot also showed an approximately 85 kDa protein. It is possible that the 85 kDa protein represents a C-CAMl glycosylation variant, because westem analysis of AdCAMl -infected cell lysate after treatment with peptide N- glycosidase F revealed only one protein band of about 53 kDa. Similar protein species were observed when the cells were infected with C-CAMl mutant recombinant vimses . The AdCAM 1-ΔD1 mutant proteins were about 20 kDa smaller than those of AdCAMl , perhaps because the first Ig domain contains three potential N-linked glycosylation sites (Lin et al, 1991), and because the 102 amino acids coding for the first Ig domain were deleted. On the other hand, deletions in the
cytoplasmic domain (in AdCAMl -H458 and AdCAM 1-H454) decreased the masses ofthe proteins by only about ~7 kDa. The identities ofthe mutant proteins were further confirmed by immunoprecipitation with antipeptide antibody against the cytoplasmic domain (anti-C3) (Lin et al, 1991). AdCAMl and AdCAM 1-ΔD1 proteins were immunoprecipitated with antibody anti-C3, but AdCAMl-H458 and AdCAM 1-G454 proteins were not, consistent with the deletion ofthe cytoplasmic domain.
EXAMPLE IX - Cell adhesion assav of recombinant adenovirus infected MDA- MB-468 cells.
This example shows the cell-adhesive activity of breast cancer cells infected with recombinant adenovimses containing a wild type or mutant C-CAMl cDNA.
A. Materials and Methods
1. Cell adhesion assay MDA-MB-468 cells were infected with AdCAMl or its mutants. Twenty-four hr after infection, the cells were trypsinized from the tissue culture plates and resuspended in phosphate buffered saline. These cell suspensions (1 ml) were mixed gently at room temperature to allow the formation of cell aggregates. The number of single cells remaining in suspension was determined with a hemacytometer after 5 hr. The extent of cell aggregation was expressed as the decrease in the percentages of single cells.
B. Results
To test the cell-adhesive activity of these various mutants, cell-aggregation assays were performed. MDA-MB-468 cells were infected with recombinant adenovims at V/C ratio of 10:1. At 24 hr after infection, the cells were trypsinized, and their ability to form aggregates was monitored. As shown in FIG. 13, MDA-MB- 468 cells expressing wild-type C-CAMl protein were able to aggregate, as evidenced by the decrease in the percentage of single cells (about 50%), as compared with cells
infected with control antisense adenovims. Expression of AdCAM 1-ΔD1 did not confer cell adhesion (FIG. 13), which is consistent with the inventors' observations in the insect cell system (Cheung et al, 1993a). Both AdCAMl-H458 and AdCAM 1- G454 were able to cause MDA-MB-468 cells to aggregate. These results are in contrast to those ofthe inventors' insect cell studies, in which AdCAM 1-G454 had no cell-adhesion activity (Cheung et al, 1993c). These differences may be a consequence ofthe different cell types used for expression or the amount of protein expressed per cell.
EXAMPLE X - C-CAMl cytoplasmic domain involved in tumor suppression
This example shows the effects of expression of C-CAMl mutants on the in vivo tumorigenicity of MDA-MB-468 cells.
A. Materials and Methods
1. Tumorigenicity in nude mice MDA-MB-468 cells were infected with recombinant adenovims at V/C ratio of 10: 1. Twenty-four hr after infection, the cells were removed from the plates by trypsin digestion and washed twice with phosphate-buffered saline. One million cells were then injected subcutaneously into each of six sites in the left and right flanks of nude mouse and tumor growth was monitored weekly. Tumor volume was estimated by the method of Rockwell et al (1972).
B. Results
The tumor-suppressive activities ofthe C-CAMl mutants were studied by infecting MDA-MB-468 cells with the recombinant adenovimses at a V/C ratio of 10:1. The efficiency of infection was determined by flow cytometry at 24 hr after infection. About 45% ofthe cells infected with AdCAMl, AdCAM 1-ΔD1, or AdCAMl-H458, were positive for C-CAM staining. About 80% ofthe cells infected with AdCAM 1-G454 were positive for C-CAM staining. The reason for the higher efficiency of AdCAM 1-G454 expression is not clear. The infected cells were then
inj ected subcutaneously into nude mice, and tumor growth was monitored weekly. AdCAM 1-ΔD1 infection reduced both the tumor incidence and size in a fashion similar to that of infection with AdCAMl (Table 7 and FIG. 12 A and B). These results suggest that the adhesion activity of C-CAMl is not required for C-CAM 1- mediated tumor suppression. On the other hand, C-CAMl mutants with deletions in their cytoplasmic domains (AdCAMl-H458 and AdCAM 1-G454) did not suppress tumorigenicity, producing a tumor incidence and volume similar to those of controls (Table 7 and FIG. 12 A and B). These results strongly suggest that the cytoplasmic domain of C-CAMl is involved in C-CAMl -mediated tumor suppression.
REFERENCES
The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incoφorated herein by reference.
Anderson et al. US 5,399,346, 1995.
Aurivillius et al, "The cell adhesion molecule cell-CAM 105 is an ecto-ATPase and a member ofthe immunoglobulin superfamily," FEBS Lett., 264:267-269, 1990.
Baichwal and Sugden, "Vectors for gene transfer derived from animal DNA vimses: Transient and stable expression of transfened genes," In: Kucherlapati R, ed. Gene transfer. New York: Plenum Press, pp. 117-148, 1986.
Benchimol et al, "Carcinoembryonic antigen, a human tumor marker, functions as an intercellular adhesion molecule," Cell, 57:327-334, 1989.
Benvenisty and Neshif, "Direction introduction of genes into rats and expression of the genes," Proc. Nat. Acad. Sci. USA, 83:9551-9555, 1986.
Bonkhoff et al, "The proliferative function of basal cells in the normal and hypeφlastic human prostate," The Prostate, 24:114-118, 1994.
Boshart et al. , "A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus," Cell, 41:521-530, 1985.
Bostwick and Brawer, "Prostatic intra-epithelial neoplasia and early invasion in prostate cancer," Cancer, 59:788-794, 1987.
Bussemakers et al, "Decreased expression of E-cadherin in the progression of rat prostate cancer," Cancer Res., 52:2916-2922, 1992.
Cambier and Campbell, "Membrane immunoglobulin and its accomplices: new lessons from an old receptor," FASEB J., 6:3207-3217, 1992.
Chang and Chung, "Interaction between prostatic fibroblast and epithelial cells in culture: role of androgen," Endocrinology, 125:2719-2727, 1989.
Chang et al, "foreign gene delivery and expression in hepatocytes using a hepatitis B vims vector," Hepatology, 14J24A, 1991.
Chen and Okayama, "High-efficiency transfection of mammalian cells by plasmid
DNA," Mol. Cell Biol, 7:2745-2752, 1987.
Cheung et al, "Stmcture and function of C-CAMl," J. Biol. Chem., 268:24303-
24310, 1993a.
Cheung et al, "Cell-CAM105 isoforms with different adhesion functions are coexpressed in adult rat tissues and during liver development," J. Biol. Chem. ,
268:6139-6146, 1993b.
Cheung et al, "The cytoplasmic domain of C-CAM is required for C-CAM mediated adhesion function: Studies of a C-CAM transcript containing an unspliced intron," Biochem. J., 295:427-435, 1993c.
Chomcyzynski and Sacchi, "Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction," Anal. Biochem., 162:156-159, 1987.
Chung et al, "Co-inoculation of tumorigenic rat prostate mesenchymal cells with non-tumorigenic epithelial cells results in the development of carcinosarcoma in syngeneic and athymic animals," Int. J. Cancer, 43:1179-1187, 1989.
Coffin, "Retroviridae and their replication," In: Fields BN, Knipe DM, ed. Virology. New York: Raven Press, pp. 1437-1500, 1990.
Couch et al, "Immunization with types 4 and 7 adenovims by selective infection of the intestinal tract," Am. Rev. Resp. Dis., 88:394-403, 1963.
Coupar et al, "A general method for the constmction of recombinant vaccinia vims expressing multiple foreign genes," Gene, 68:1-10, 1988.
Culic et al, "Molecular cloning and expression of a new rat liver cell-CAM 105 isoform," Biochem. J., 285:47-53, 1992.
Culver et al, "In vivo gene transfer with retroviral vector-producer cells for treatment of experimental brain tumors," Science, 256:1550-1552, 1992.
Davis et al, "DNA preparation from cultured cells and tissue," In: Davis, L.G.,
Dibner, M.D., and Battey, J.F. (eds.), Basic Methods in Molecular Biology, New York: Elsevier, pp. 47-50, 1986.
Dubensky et al, "Direct transfection of viral and plasmid DNA into the liver or spleen of mice," Proc. Nat. Acad. Sci. USA, 81 :7529-7533, 1984.
Edelman, "Cell adhesion and the molecular processes of moφhogenesis," Annu. Rev. Biochem., 54:135-169, 1985.
Edelman and Crossin, "Cell Adhesion Molecules: Implications for a Molecular Histology," Annu. Rev. Biochem., 60:155-190, 1991.
English et al, "Response of glandular versus basal rat ventral prostatic epithelial cells to androgen withdrawal and replacement," The Prostate, 11 :229-242, 1987.
Fearon et al, Science, 247:49, 1990.
Fechheimer et al, "Transfection of mammalian cells with plasmid DNA by scrape loading and sonication loading," Proc. Natl. Acad. Sci. USA, 84:8463-8467,
1987.
Fraley et al, "Entrapment of a bacterial plasmid in phospholipid vesicles: Potential for gene transfer," Proc. Natl Acad. Sci. USA, 76:3348-3352, 1979.
Freshner, R.I. "Animal Cell Culture: a Practical Approach", Second Edition, Oxford New York, IRL Press, Oxford University Press, 1992.
Freshney, "Culture of Animal Cells: A Manual of Basic Technique," 2nd ed., New York, A.R. Liss, 1987.
Friedmann, "Progress toward human gene therapy," Science, 244:1275-1281, 1989.
Frixen et al, "E-cadherin-mediated cell-cell adhesion prevents invasiveness of human carcinoma cells," J. CeU Biol. 113:173-185, 1991.
Gall and Edelman, Science, 213:903-905, 1981.
Gao and Knowles, "The epidermal growth factor/cAMP-inducible EctoCa2+-ATPase of human hepatoma Li-7A Cells is similar to rat liver EctoATPase/Hepatocyte cell adhesion molecule (CellOCAM 105)," Archives Biochem. Biophy, 303:90- 97, 1993.
Geiger, "Membrane-cytoskeleton interaction." Biochim. Biophys. Acta, 737:305-341, 1983.
Ghosh and Bachhawat, "Targeting of liposomes to hepatocytes," In: Wu G, Wu C ed. Liver diseases, targeted diagnosis and therapy using specific receptors and ligands. New York: Marcel Dekker, pp. 87-104, 1991.
Ghosh-Choudhury et al, "Protein IX, a minor component ofthe human adenovims capsid, is essential for the packaging of full-length genomes," EMBOJ., 6:1733-1739, 1987.
Giancotti and Ruoslahti, "Elevated levels ofthe a5bj fibronectin receptor suppress the transformed phenotype of Chinese hamster ovary cells," Cell, 60:849-859, 1990.
Gleave et al, "Acceleration of human prostate cancer growth in vivo by factors produced by prostate and bone fibroblasts," Cancer Res., 51:3753-3761, 1991.
Gomez-Foix et al, "Adenovirus-mediated transfer ofthe muscle glycogen phosphorylase gene into hepatocytes confers altered regulation of glycogen,"
J. Biol. Chem., 267:25129-25134, 1992.
Gopal, "Gene transfer method for transient gene expression, stable transfection, and cotransfection of suspension cell cultures, " Mol Cell Biol. , 5:1188-1190, 1985.
Graham and Prevec. "Manipulation of adenovims vector," In: EJ. Munay (ed.), Methods in Molecular Biology: Gene Transfer and Expression Protocol, Clifton, NJ: Humana Press, 7:109-128, 1991.
Graham and van der Eb, "A new technique for the assay of infectivity of human adenovims 5 DNA", Virology, 52:456-467, 1973.
Graham et al, "Characteristics of a human cell line transformed by DNA from human adenovims type 5", J. Gen. Virol, 36:59-72, 1977.
Graham and Prevec, "Adenovirus-based expression vectors and recombinant vaccines," Biotechnology, 20:363-390, 1992.
Grumet and Edelman, ./. Cell Biol, 106:487-503, 1988.
Gmnhaus and Horwitz, "Adenovims as cloning vector," Seminar in Virology, 3:237- 252, 1992.
Grunicke and Maly, "Role of GTPase and GTPase regulatory proteins in oncogenesis," Crit. Rev. Oncog., 4:389-402, 1993.
Harland and Weintraub, "Translation of mammalian mRNA injected into Xenopus oocytes is specifically inhibited by antisense RNA," J. Cell Biol, 101 :1094- 1099, 1985.
Heπrionat and Muzycska, "Use of adenoassociated vims as a mammalian DNA cloning vector: Transduction of neomycin resistance into mammalian tissue culture cells." Proc. Nat. Acad. Sci. USA, 81 :6466-6470, 1984.
Hersdorffer et al. , "Efficient gene transfer in live mice using a unique retroviral packaging line," DNA Cell Biol, 9:713-723, 1990.
Herz and Gerard, "Adenovirus-mediated transfer of low density lipoprotein receptor gene acutely accelerates cholesterol clearance in normal mice," Proc. Natl. Acad. Sci. USA 90:2812-2816, 1993.
Hinson et al, "Alterations in the expression of a hepatocyte cell adhesion molecule by transplantable rat hepatocellular carcinomas," Cancer Res., 45:4742-3749,
1985.
Hixson and McEntire, "Detection of an altered form of cell-CAM 105 on rat transplantable and primary hepatocellular carcinomas," Cancer Res., 49:6788-
6794, 1989.
Hoffman and Edelman. Proc. Natl Acad. Sci. USA, 80:5762-5766, 1983.
Horwich et al, "Synthesis of hepadnavims particles that contain replication-defective duck hepatitis B vims genomes in cultured HuH7 cells," J. Virol, 64:642-650, 1990.
Hsieh et al, "Autocrine regulation of prostate-specific antigen gene expression in a human prostatic cancer (LNCaP) subline," Cancer Res., 53:2852-2857, 1993.
Hsieh and Lin, "Androgen regulation of cell adhesion molecule gene expression in rat prostate during organ degeneration: C-CAM belongs to a class of androgen- repressed genes associated with enriched stem/amplifying cell population after prolonged castration,"'-/. Biol. Chem. 269:3711-3716, 1994.
Hsieh et al, "Tumor suppressive role of an androgen-regulated epithelial cell adhesion molecule (C-CAM) in prostate carcinoma cell revealed by sense and antisense approaches," Cancer Res., 55:190-197, 1995.
Hynes, "Integrins: a family of cell surface reeptors," CeU, 48:549-554, 1987.
Jones and Shenk, "Isolation of deletion and substitution mutants of adenovims type 5," Cell, 13:181-188, 1978.
Kaighn et al , "Establishment and characterization of a human prostatic carcinoma cell line (PC-3)," Invest. Urol, 17:16-23, 1979.
Kaneda et al, "Increased expression of DNA cointroduced with nuclear protein in adult rat liver," Science, 243:375-378, 1989.
Kato et al, "Expression of hepatitis B vims surface antigen in adult rat liver," J. Biol.
Chem., 266:3361-3364, 1991.
Khan et al, "Molecular cloning and expression of cDNA for carcinoembryonic antigen-related glycoproteins: the pregnancy-specific β-glycoprotein fetal liver
NCA superfamily," In The Carcinoembryonic Antigen Gene Family (eds. A. Yachi and J E. Shively)., pp. 87-96, Elsevier Science Publishers, 1989.
Klein et al, "High-velocity microprojectiles for delivering nucleic acids into living cells," Nature, 327:70-73, 1987.
Kleinerman etal, "Application of a tumor suppressor (C-CAM l)-expressing recombinant adenovims in androgen-independent human prostate cancer therapy: A preclinical study," Cancer Res., 55:2831-2836, 1995.
Kyte & Doolittie, "A simple method for displaying the hydropathic character of a protein," J. Mol. Biol, 157(1):105-132, 1982.
Laemmli, "Cleavage of stmctural proteins during the assembly ofthe head of bacteriophage T4," Nature, 227:680-685, 1970.
Le Gal La Salle et al, "An adenovims vector for gene transfer into neurons and glia in the brain," Science, 259:988-990, 1993.
Levrero et al, "Defective and nondefective adenovims vectors for expressing foreign genes in vitro and in vivo " Gene, 101: 195-202, 1991.
Li et al, "Assessment of recombinant adenoviral vectors for hepatic gene therapy," Hum. Gene Ther., 4:403-409, 1993.
Lin and Guidotti, "Cloning and expression of a cDNA coding for a rat liver plasma membrane ecto-ATPase: the primary stmcture ofthe ecto-ATPase is similar to that of human biliary glycoprotein," J. Biol. Chem., 264:14408-14414, 1989.
Lin et al, "Immunochemical characterization of two isoforms of rat liver ecto-ATPase that show an immunological and stmctural identity with a glycoprotein cell- adhesion molecule with . 105000," Biochem. J., 278:155-161, 1991.
Lin. et al, "Stmcture and function of C-CAMl: Effects ofthe cytoplasmic domain on cell aggregation," Biochem. J.. 311 :2390-245, 1995.
Low et al, "Apical cell surface expression of rat dipeptidyl peptidase IV in transfected madin-darby canine kidney cells." J. Biol. Chem., 266:13391-13396, 1991.
Luna and Hitt, "Cytoskeleton-plasma membrane interactions," Science, 258:955-964. 1992.
Mann et al. "Constmction of a retrovims packaging mutant and its use to produce helper-free defective retrovims," Cell, 33:153-159, 1983.
Markowitz et al, "A safe packaging line for gene transfer: Separating viral genes on two different plasmids," J. Virol, 62:1120-1124. 1988.
Marx, "Learning how to suppress cancer," Science, 261:1385-1387, 1993.
Matsuura et al. , "Altered expression of E-cadherin in gastric cancer tissues and carcinomatous fluid," Brit. J. Cancer, 66:1122-1130, 1992.
McNeal, "Origin and evolution of benign prostatic enlargement," Invest. Urol, 15:340-345. 1978.
McNeal and Bostwick, "Intraductal dysplasia: a premalignant lesion ofthe prostate," Hum. Pathol, 17:64-71, 1986.
Mulligan, "The basic science of gene therapy," Science, 260:9260-932, 1993.
Myers, EPO 0273085
Neumaier et al, "Biliary glycoprotein, a potential human cell adhesion molecule, is down-regulated in colorectal carcinomas," Proc. Natl. Acad. Sci. USA. 90:10744-10748, 1993.
Nicolas and Rubenstein, "Retroviral vectors." In: Rodriguez RL, Denhardt DT, ed. Vectors: A survey of molecular cloning vectors and their uses. Stoneham: Butterworth, pp. 493-513, 1988.
Nicolau and Sene, "Liposome-mediated DNA transfer in eukaryotic cells," Biochim. Biophys. Acta, 721 :185-190, 1982.
Nicolau et al, "Liposomes as carriers for in vivo gene transfer and expression," Methods Enzymol, 149:157-176, 1987.
Obrink, "C-CAM (Cell-CAM 105)- a member ofthe growing immunoglobulin superfamily of cell adhesion proteins," BioEssays., 13:227-233, 1991.
Odin and Obrink, "Quantitative determination ofthe organ distribution ofthe cell adhesion molecule cell-CAM 105 by radioimmunoassay," Exp. Cell Res., 171:1-15, 1987.
Odin et al, "Immunohistochemical localization of cell-CAM 105 in rat tissues. Appearance in epithelia, platelets and granulocytes.," J. Histochem. Cytochem., 36:729-739, 1988.
Odin et al, "Chemical characterization of cell-CAM 105, a cell adhesion molecule isolated from rat liver membranes," Biochem. J., 236:559-568. 1986.
Oikawa et al, "Cell adhesion activity of non-specific cross-reacting antigen (NCA) and carcinoembryonic antigen (CEA) expressed on CHO cell surface: homophilic and heterophilic adhesion," Biochem. Biophys. Rev. Commun., 164:39-45, 1989.
Paskind et al, "Dependence of moloney murine leukemia vims production on cell growth," Virology, 67:242-248, 1975.
Pollerberg et al, Nature, 324:462-465, 1986.
Potter et al, "Enhancer-dependent expression of human k immunoglobulin genes introduced into mouse pre-B lymphocytes by electroporation," Proc. Nat.
Acad. Sci. USA, 81:7161-7165, 1984.
Ragot et al. , "Efficient adenovims-mediated transfer of a human minidystrophin gene to skeletal muscle of mdx mice," Nature, 361:647-650, 1993.
Renan, "Cancer genes: cunent status, future prospects, and applicants in radiotherapy/oncology," Radiother. Oncol, 19:197-218, 1990.
Rich et al, "Development and analysis of recombinant adenovimses for gene therapy of cystic fibrosis," Hum. Gene Ther., 4:461-476, 1993.
Ridgeway, "Mammalian expression vectors," In: Rodriguez RL, Denhardt DT, ed. Vectors: A survey of molecular cloning vectors and their uses. Stoneham:
Butterworth, pp. 467-492, 1988.
Rippe et al. , "DNA-mediated gene transfer into adult rat hepatocytes in primary culture," Mol. Cell Biol, 10:689-695, 1990.
Rockwell, et al., "Characteristics of a serially transplanted mouse mammary tumor and its tissue-culture-adapted derivative," J. Natl. Cancer Inst., 49:735-749, 1972.
Rosenberg et al, "The expression of mouse biliary glycoprotein, a carcinoembryonic antigen-related gene, is down-regulated in malignant mouse tissues," Cancer Res., 53:4938-4945, 1993.
Rosenfeld et al, "Adenovims-mediated transfer of a recombinant αl -antitrypsin gene to the lung epithelium in vivo," Science, 252:431-434, 1991.
Rosenfeld et al, "In vivo transfer ofthe human cystic fibrosis transmembrane conductance regulator gene to the airway epithelium," Cell, 68:143-155, 1992.
Roux et al. , "A versatile and potentially general approach to the targeting of specific cell types by retrovimses: Application to the infection of human cells by means of major histocompatibility complex class I and class II antigens by mouse ecotropic murine leukemia vims-derived viruses," Proc. Natl. Acad. Sci. USA, 86:9079-9083, 1989.
Rubinfeld et al, "Association ofthe APC gene product with β-catenin," Science, 262:1731-1734, 1993.
Sadoul et al, Nature, 304:347-349, 1983.
Sherwood et al. , "Differential expression of cytokeratin polypeptides in the basal and luminal epithelia ofthe human prostate," The Prostate, 18:303-314, 1991.
Shin et al, "Tumorigenicity of vims-transformed cells in nude mice is conelated specifically with anchorage independent growth in vitro," Proc. Natl. Acad. Sci. USA, 72:4435-4439, 1975.
Southem and Berg, "Transformation of Mammalian Cells to Antibiotic Resistance with a Bacterial Gene Under Control ofthe SV40 Early Region Promoter," Journal of 'Molecular and Applied Genetics, 1:327-341, 1982.
Stoolman, "Adhesion molecules controlling lymphocyte migration," CeU, 56:907-910, 1989.
Stratford-Perricaudet and Perricaudet." Gene transfer into animals: the promise of adenovims," p. 51-61, In: Human Gene Transfer, Eds, O. Cohen-Haguenauer and M. Boiron, Editions John Libbey Eurotext, France, 1991.
Stratford-Perricaudet et al, "Evaluation ofthe transfer and expression in mice of an enzyme-encoding gene using a human adenovims vector," Hum. Gene Ther., 1:241-256, 1990.
Su et al. , "Association ofthe APC tumor suppressor protein with catenins," Science, 262:1734-1737, 1993.
Takeichi, "Cadherin cell adhesion receptors as a moφhogenetic regulator," Science, 251:1451-1455, 1991.
Takeichi, "The cadherins: cell-cell adhesion molecules controlling animal moφhogenesis," Development, 102:639-655, 1988.
Temin, "Retrovims vectors for gene transfer: Efficient integration into and expression of exogenous DNA in vertebrate cell genome," In: Kucherlapati R, ed. Gene transfer. New York: Plenum Press, pp. 149-188, 1986.
Thompson et al, "Spatio-temporal expression of two cell-CAM 105 isoforms during development," Cell Growth and Differentiation, 4:257-268, 1993.
Top et al, "Immunization with live types 7 and 4 adenovims vaccines. II. Antibody response and protective effect against acute respiratory disease due to adenovims type 7," J. Infect. Dis., 124:155-160, 1971.
Trofatter et al, "A novel moesin-, ezrin-, radixin-like gene is a candidate for the neurofibromatosis 2 tumor suppressor," Cell, 72:791-800, 1993.
Troncoso et a , "Prostatic intraepithelial neoplasia and invasive prostatic adenocarcinoma in cystoprostatectomy specimens," Supplement to Urology, XXXIV:52-56, 1989.
Tur-Kaspa et al, "Use of electroporation to introduce biologically active foreign genes into primary rat hepatocytes," Mol. Cell Biol, 6:716-718, 1986.
Umbas et al, "Expression ofthe cellular adhesion molecule E-cadherin is reduced or absent in high-grade prostate cancer," Cancer Res., 52:5104-5109, 1992.
Varmus et al. , "Retrovimses as mutagens: Insertion and excision of a nontransforming provims alter the expression of a resident transforming provirus-," Cell, 25:23- 36, 1981.
Wagner et al, Science, 260:1510-1513, 1993.
Wamer and Heston, "Future developments of nonhormonal systemic therapy for prostatic carcinoma," Urol. Clin. N. Am., 18:25-33, 1991.
Wong et al. , "Appearance of β-lactamase activity in animal cells upon liposome mediated gene transfer," Gene, 10:87-94, 1980.
Wu and Wu, "Evidence for targeted gene delivery to HepG2 hepatoma cells in vitro,"
Biochemistry, 27 :887 '-892, 1988.
Wu and Wu, "Receptor-mediated in vitro gene transfections by a soluble DNA canier system," J. Biol. Chem., 262:4429-4432, 1987.
Xia et al, "Fetal prostate growth and development," Pediatric Pathology, 10:527-537, 1990.
Yang et al, "In vivo and in vitro gene transfer to mammalian somatic cells by particle bombardment," Proc. Natl Acad. Sci. USA, 87:9568-9572, 1990.
Zelenin et al. , "High- velocity mechanical DNA transfer ofthe chloramphenicol acetyltransferase gene into rodent liver, kidney and mammary gland cells in organ explants and in vivo," FEBS Lett., 280:94-96, 1991.
Zhang et al, "Generation and identification of recombinant adenovims by liposome- mediated transfection and PCR™ analysis," Biotechniques, 15:868-872, 1993.
SEQUENCE LISTING
(1) GENERAL INFORMATION: (i) APPLICANT:
NAME: " BOARD OF REGENTS, THE UNIVERSITY OF TEXAS
SYSTEM STREET: 201 West 7th Street
CITY: Austin STATE: Texas
COUNTRY: United States of America POSTAL CODE: 78701 TELEPHONE NO: (512)499-4462 TELEFAX: (512)499-4523
(ii) INVENTORS: Hsieh. Jer-Tsong and Lin. Sue-Hwa
(iii) TITLE OF INVENTION: C-CAM EXPRESSION CONSTRUCTS AND
THEIR APPLICATION IN CANCER THERAPY
(iv) NUMBER OF SEQUENCES: 2
(v) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Arnold, White & Durkee (B) STREET: P.O. Box 4433
(C) CITY: Houston
(D) STATE: Texas
(E) COUNTRY: United States of America
(F) ZIP: 77210
(vi) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS (D) SOFTWARE: Patentin Release #1.0, Version #1.30
(vii) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: Unknown
(B) FILING DATE: Concurrently Herewith (C) CLASSIFICATION: Unknown
(viii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: USSN 08/494,622
(B) FILING DATE: 23 JUNE 1995 (C) CLASSIFICATION: UNKNOWN
(ix) ATTORNEY/AGENT INFORMATION:
(A) NAME: Highlander, Steven L.
(B) REGISTRATION NUMBER: 37,642 (C) REFERENCE/DOCKET NUMBER: INGN030P--
(x) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (512) 418-3000
(B) TELEFAX: (512) Al '4-1 '577
(C) TELEX: 79-0924
(2) INFORMATION FOR SEQ ID NO: 1 :
(i) SEQUENCE CHARACTERISΗCS:
(A) LENGTH: 1921 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "DNA"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1 : GCAGGCAGCC GTGTTGGAGC CAAATCTCTT CCCCAAGAGA AGAACCTAGC AGGCAGCAGA 60
GACTATGGAG CTAGCCTCGG CTCGTCTCCT CAGAGGGCAG ATTCCCTGGA GGGGACTACT 120
GCTCACAGCC TCACTTTTAA CCTACTGGAG CCCTCTCACC ACTGCCCAAG TCACCGTAGA 180
CGCTGTGCCA CCCAACGTTG TTGAGGAGAA GAGCGTTCTT TTACTCGCTC ACAATCTGCC 240
10
GCAGGAGTTC CAAGTCTTTT ACTGGTACAA GGGAACCACT TTGAATCCAG ACAGTGAAAT 300
TGCACGATAT ATAAGATCCG ATAATATGAG TAAAACAGGA CCTGCATACA GCGGCAGAGA 360
15 GACAATATAC AGCAATGGAT CCTTGTTCTT CCAAAATGTC AACAAGACTG ACGAGAGAGC 420 °
I
CTACACACTA TCTGTGTTTG ATCAACAATT TAATCCTATA CAAACGTCTG TGCAATTTCG 480 TGTATACCCC GCATTACAAA AGCCCAACGT CACAGGTAAC AACTCCAATC CCATGGAGGG 540
20
TGAGCCCTTC GTATCATTAA TGTGTGAACC GTACACTAAC AATACCAGCT ACCTGTGGAG 600
CAGAAATGGT GAAAGCCTCT CAGAAGGTGA CAGGGTGACG TTCTCTGAGG GCAACAGGAC 660
25 TCTCACTTTA CTCAACGTCA GGAGGACTGA CAAAGGATAC TATGAGTGTG AAGCCCGGAA 720
CCCAGCGACT TTCAATCGAA GTGACCCATT CAACCTGGAC GTTATCTATG GTCCGGACGC 780
CCCAGTTATA TCCCCTCCAG ATATTTATTT GCATCAAGGG TCAAACCTCA ACCTCTCCTG 840
30
CCATGCAGAC TCTAACCCTC CCGCACAGTA CTTTTGGCTT ATCAATGAGA AGCTCCAGAC 900
ATCCTCCCAA GAGCTCTTTA TCTCCAACAT CACTACTAAC AATAGCGGAA CCTATGCCTG 960
CTTCGTCAAT AACACTGTCA CTGGCCTCAG TCGCACCACA GTCAAGAACA TTACAGTCTT 1020
TGAGCCAGTG ACTCAGCCCT CCATCCAAAT CACCAACACC ACAGTCAAAG AACTAGGCTC 1080
TGTGACCCTG ACCTGCTTCT CAAAGGACAC TGGAGTCTCC GTCCGATGGC TTTTCAATAG 1140
CCAGAGTCTG CAGCTCACAG ACAGGATGAC GCTCTCCCAG GACAACAGCA CCCTCAGAAT 1200
10
AGACCCTATT AAGAGAGAAG ATGCCGGGGA CTATCAGTGT GAGATCTCCA ACCCGGTCAG 1260
TTTCAGGATA AGTCACCCAA TCAAGCTGGA CGTAATACCT GATCCAACAC AAGGAAATTC 1320
15 TGGCCTCTCA GAGGGTGCCA TTGCAGGCAT TGTGATTGGA TCTGTGGCTG GAGTGGCCCT 1380
O oo
AATAGCAGCG CTGGCATACT TCCTTTATTC CAGGAAGACT GGCGGGGGAA GTGACCATCG 1440
AGATCTCACA GAGCACAAAC CCTCAACCTC CAGCCACAAT CTGGGTCCTT CTGACGACTC 1500
20
TCCTAACAAG GTGGATGACG TCTCATACTC TGTCCTGAAC TTCAATGCCC AGCAATCCAA 1560
ACGACCAACT TCAGCCTCTT CAAGCCCCAC AGAAACAGTT TATTCGGTAG TCAAAAAGAA 1620
25 GTGACATTGT CTGTCCTGCT GACTGCACCA GTGATGCATT CCAGATTCTC TGTCACGGAG 1680
AGACCCTGCA CACAGCGCAC GTGCGCGTGC ACACACACAC ACACACACAC ACACATGCAC 1740
ACACACACGC ACACACGCAC GCACACACAC ACATGCACAC ACGCACACAC ACATGTATAC 1800
30
ACTCTATTGA CTCCTTCCGT GTTAATAGAA GAAAAGGTGT ATCCTGGAGC CTACAGAAAA 1860
CCCAACCCTT TCTAGGCATT AAAATTTGGC CGAGAGAGAG GAACCAAAAC GGCCCACCCC 1920 G 1921
o
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISΗCS: (A) LENGTH: 519 amino acids (B) TYPE: amino,acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
Met Glu Leu Ala Ser Ala Arg Leu Leu Arg Gly Gin Ile Pro Trp Arg 1 5 10 15
Gly Leu Leu Leu Thr Ala Ser Leu Leu Thr Tyr Trp Ser Pro Leu Thr 20 25 30
Thr Ala Gin Val Thr Val Asp Ala Val Pro Pro Asn Val Val Glu Glu 35 40 45
Lys Ser Val Leu Leu Leu Ala His Asn Leu Pro Gin Glu Phe Gin Val 50 55 60 Phe Tyr Trp Tyr Lys Gly Thr Thr Leu Asn Pro Asp Ser Glu lie Ala 65 70 75 80
Arg Tyr Ile Arg Ser Asp Asn Met Ser Lys Thr Gly Pro Ala Tyr Ser 85 90 95
Gly Arg Glu Thr Ile Tyr Ser Asn Gly Ser Leu Phe Phe Gin Asn Val 100 105 110
Asn Lys Thr Asp Glu Arg Ala Tyr Thr Leu Ser Val Phe Asp Gin Gin 115 120 125
Phe Asn Pro Ile Gin Thr Ser Val Gin Phe Arg Val Tyr Pro Ala Leu 130 135 140 Gin Lys Pro Asn Val Thr Gly Asn Asn Ser Asn Pro Met Glu Gly Glu 145 150 155 160
Pro Phe Val Ser Leu Met Cys Glu Pro Tyr Thr Asn Asn Thr Ser Tyr 165 170 175
Leu Trp Ser Arg Asn Gly Glu Ser Leu Ser Glu Gly Asp Arg Val Thr 180 185 190
Phe Ser Glu Gly Asn Arg Thr Leu Thr Leu Leu Asn Val Arg Arg Thr 195 200 205
Asp Lys Gly Tyr Tyr Glu Cys Glu Ala Arg Asn Pro Ala Thr Phe Asn 210 215 220
Arg Ser Asp Pro Phe Asn Leu Asp Val Ile Tyr Gly Pro Asp Ala Pro 225 230 235 240
Val Ile Ser Pro Pro Asp Ile Tyr Leu His Gin Gly Ser Asn Leu Asn 245 250 255
Leu Ser Cys His Ala Asp Ser Asn Pro Pro Ala Gin Tyr Phe Trp Leu 260 265 270
Ile Asn Glu Lys Leu Gin Thr Ser Ser Gin Glu Leu Phe Ile Ser Asn 275 280 285
Ile Thr Thr Asn Asn Ser Gly Thr Tyr Ala Cys Phe Val Asn Asn Thr 290 295 300
Val Thr Gly Leu Ser Arg Thr Thr Val Lys Asn Ile Thr Val Phe Glu 305 310 315 320 Pro Val Thr Gin Pro Ser Ile Gin Ile Thr Asn Thr Thr Val Lys Glu
325 330 335
Leu Gly Ser Val Thr Leu Thr Cys Phe Ser Lys Asp Thr Gly Val Ser 340 345 350
Val Arg Trp Leu Phe Asn Ser Gin Ser Leu Gin Leu Thr Asp Arg Met 355 360 365
Thr Leu Ser Gin Asp Asn Ser Thr Leu Arg Ile Asp Pro Ile Lys Arg 370 375 380
Glu Asp Ala Gly Asp Tyr Gin Cys Glu Ile Ser Asn Pro Val Ser Phe 385 390 395 • 400 Arg Ile Ser His Pro Ile Lys Leu Asp Val Ile Pro Asp Pro Thr Gin
405 410 415
Gly Asn Ser Gly Leu Ser Glu Gly Ala Ile Ala Gly Ile Val Ile Gly 420 425 430
Ser Val Ala Gly Val Ala Leu Ile Ala Ala Leu Ala Tyr Phe Leu Tyr 435 440 445
Ser Arg Lys Thr Gly Gly Gly Ser Asp His Arg Asp Leu Thr Glu His 450 455 460
Lys Pro Ser Thr Ser Ser His Asn Leu Gly Pro Ser Asp Asp Ser Pro 465 470 475 480 Asn Lys Val Asp Asp Val Ser Tyr Ser Val Leu Asn Phe Asn Ala Gin
485 490 495
Gin Ser Lys Arg Pro Thr Ser Ala Ser Ser Ser Pro Thr Glu Thr Val 500 505 510
Tyr Ser Val Val Lys Lys Lys 515