WO1996041878A1 - Nucleic acid molecule and its uses in determining pathogenicity of staphylococcus - Google Patents

Abstract

The present invention relates generally to an isolated nucleic acid molecule which is obtainable from one or more pathogenic isolates of Staphylococcus aureus. The subject nucleic acid molecule is useful for determining whether a Staphylococcus aureus strain is pathogenic. The invention further provides proteins encoded by said isolated nucleic acid molecule and immunologically interactive molecules capable of binding to same. The invention further provides pharmaceutical preparations comprising one or more of the subject protein molecules for the prophylactic treatment of individuals against pathogenic strains of S. aureus.

Description

Nucleic acid molecule and its uses in determining pathogenicity of Staphylococcus

The present invention relates to an isolated nucleic acid, reagents, a method of determining whether a Staphylococcus strain is pathogenic and tests for use in the method.

Bibliographic details of the publications referred to by author id this specification are collected at the end of the description. Sequence identity numbers (SEQ ID NOs.) for the nucleotide and amino acid sequences referred to in the specification are defined after the bibliography.

Throughout this specification and the claims that follow, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.

Staphylococcus particularly S. aureus are significant pathogens in hospitals and in general practice, yet these organisms are often found harmlessly associated with humans (Noble & White, 1983). S. aureus, for example, is among the five most commonly reported pathogens (11.2%) in hospitals (Jarvis & Martone, 1992; Schaberg et al, 1991). The organism appears to show considerable genetic malleability (Novick, 1993), with a capacity to develop resistance and probably to vary its virulence (Skurray et al, 1988; Amabiel-Cuevas & Chicurel, 1992). Methicillin-resistant S. aureus (MRS A) is recognised internationally as the cause of many hospital-acquired infections (Archer & Mayhall, 1983; Boyce, 1989; El- Adhami et al, 1991; Musser & Kapur, 1992; Stewart et al, 1993).

The population structure of MRSA and pathogenic populations of Staphylococcus aureus have been examined using a variety of techniques including enzyme electrophoretic typing (Musser et al, 1990; Musser & Selander, 1990) and restriction fragment length polymoφhisms (RFLP) (El-Adhami et al, 1991; Stewart et al, 1993). Analysis of Staphylococci and other bacteria (eg. Neisseria meningitidis, Haemophilus influenzae, Salmonella spp, etc.) indicate that resistant and pathogenic populations are clonal in structure. That is, they are populations in which the genome appears to be conserved and recombination frequencies are low (for a review see Krawiec & Riley, 1991); the amount of diversity among isolates is less than would be expected if the genomes were to recombine freely. Accordingly, it appears that a chromosome-wide linkage (or chromosomal genotype) tends to be maintained in the pathogenic bacterial populations (Krawiec & Riley, 1991; Smith, 1991). This suggests that particular genes and combinations of genes may be selected for in the clinical environment.

By contrast, the clinical methicillin-sensitive Staphylococcus aureus (MSSA) and non- clinical (or community) S. aureus isolates show a great degree of genetic diversity (El- Adhami, 1991; El-Adhami & Stewart, manuscript in preparation). Community S. aureus isolates are a population in which selection pressure for virulence and resistance may not occur. RFLP analysis showed that these isolates were not closely related to each other or to the resistant types (ie. non-clonal in structure). However, physical mapping of the genomes of selected isolates from the different groups showed that genome organisation (order of fragments within the circular chromosome) of the non-clonal MSSA and community isolates is well conserved and appears to be very similar to that of the clonal clinical isolates (El- Adhami & Stewart, manuscript in preparation).

In work leading up to the present invention the inventors identified and isolated genetic sequences which are indicative of infection of a host organism, tissue or cell by a pathogenic Staphylococcus aureus strain or a strain which is related to a pathogenic strain or belonging to the same clonal group as a pathogenic strain. The isolated genetic sequences provide the means by which pathogenic infection of a host animal by S. aureus may be determined in a rapid, convenient assay. Furthermore, the isolated genetic sequences of the invention provide the means for development of vaccines for the prophylactic treatment of a host organism, tissue or cell which is capable of being infected by a pathogenic strain of S. aureus. Accordingly, a first aspect of the present invention provides an isolated nucleic acid molecule which is indicative of a pathogenic Staphylococcus aureus, wherein said molecule is obtainable from a pathogenic S. aureus and present at high frequency in pathogenic isolates of S. aureus.

In a preferred embodiment of the present invention, the isolated nucleic acid molecule is further characterised as being either not present or present at a low frequency in one or more commensal isolates of S. aureus.

More preferably, the isolated nucleic acid molecule of the invention is further characterised as comprising at least one copy of the repeated nucleotide sequence motif:

CGATAGCGTAACAAAATATGGACCTGTAAAAGGAGACTCG

or a complementary sequence or a homologue, analogue or derivative thereof.

Even more preferably, the repeated nucleotide sequence motif is repeated at least two times and more preferably still, at least four times and still more preferably at least six times in the nucleic acid molecule of the invention.

In a particularly preferred embodiment of the invention, the nucleic acid molecule comprises a sequence of nucleotides or is complementary to a sequence of nucleotides which is at least 40% identical to the sequence set forth in SEQ ID NO: 1 or a homologue, analogue or derivative thereof.

More particularly preferred, the percentage similarity to the sequence set forth in SEQ

ID NO: 1 is at least 50%. Even more particularly preferred, the percentage similarity is at least

60-65%. Still more particularly preferred, the percentage similarity is at least 70-75%. Yet still more particularly preferred, the percentage similarity as at least 80-90%, including at least 91% or 93% or 95%. In a most particularly preferred embodiment, the invention provides an isolated nucleic acid molecule which is indicative of a pathogenic Staphylococcus aureus, wherein said molecule is obtainable from a pathogenic S. aureus and present at high frequency in pathogenic isolates of S. aureus and comprises the sequence set forth in SEQ ID NO: 1 or a complementary sequence, homologue, analogue or derivative thereof.

For the purposes of nomenclature, the sequence shown in SEQ ID NO: 1 relates to a strain-specific or species-specific gene sequence isolated from the clmically-significant, methicillin-sensitive Staphylococcus aureus strain 8325-4 (i.e. ISP8, Patel et al. , 1989). The sequence set forth in SEQ ID NO: 1 or a homologue, analogue or derivative thereof is present at a high frequency in other pathogenic strains of S. aureus, but is present at a low frequency only in commensal isolates of S. aureus, as shown in the examples incoφorated herein.

The term "isolated nucleic acid molecule" as used herein means that the nucleic acid molecule has been purified away from other nucleic acids, proteinaceous and non- proteinaceous components with which it is normally associated.

The term "nucleic acid molecule" used herein refers to a molecule made up of natural or synthetic purines and pyrimidines. The molecule may be DNA such as genomic DNA, cDNA or chemically-synthesised DNA or alternatively, RNA such as mRNA, tRNA, rRNA or synthetic RNA. The nucleic acid molecule may be in single or double stranded, linear, covalently closed or circular form. Unless otherwise indicated the nucleic acid bases described herein are designated according to the IUPAC code.

The term "obtainable from Staphylococcus aureus" used herein means that the nucleic acid may be obtained from this source but is not limited to being so obtained.

As used herein, the term "pathogenic isolate", "pathogenic strain" or similar term shall be taken to refer to any strain of Staphylococcus aureus which is capable of inducing an infection in a host organism, tissue or cell, for example certain methicillin-sensitive and methicillin-resistant strains. Wherein the host for a pathogenic S. aureus is a whole organism or multicellular tissue or organ, infection of the host by a pathogenic S. aureus is characterised by a disease state therein (i.e. a disturbance in the normal functioning of the host). Wherein the host is a cell, including a cell culture or non-differentiated mass of cells, infection by a pathogenic S. aureus is characterised by a disturbance in the normal growth of the cell or cell culture or non-differentiated mass of cells. Alternatively, the infection may be visually apparent in the cell or cell culture or cell mass. For the present puφoses, "disease" shall be taken to include a disturbance in the growth of a cell or cell culture or cell mass, or a visually-apparent bacterial infection in a cell or cell culture or cell mass. A pathogenic strain shall also be taken to refer to a strain which is likely to be pathogenic because it is closely related at the genetic level to a pathogenic strain, for example belonging to the same clonal group.

For the present pmpose, the term "pathogenic" isolate or strain shall be taken to be synonymous with the term "clinically-significant" isolate or strain.

For the present puφoses, an "infection" may be a hospital-acquired infection or an infection acquired in a non-hospital environment. Those skilled in the art will be aware that a hospital-acquired pathogenic Staphylococcus aureus may be transmitted from a hospital environment to the wider community and further, that it is also possible for an infection acquired outside a hospital environment may be introduced into such an environment by a carrier of the pathogen. For example, a host may acquire a pathogenic S. aureus in a hospital environment and following or during treatment of the disease state, sufficient viable pathogenic bacteria remain in the host for their transfer to another host in a different environment to occur. The present invention is not limited by the environment in which an infection by a pathogenic S. aureus has been acquired.

As used herein, the term "commensal isolate" or "non-pathogenic isolate" or similar term shall be taken to refer to any strain of Staphylococcus aureus which, although it may be pathogenic under appropriate conditions, is in the situation at hand, harmlessly associated with a host organism, tissue or cell and does not induce a hospital-acquired infection therein. Most commonly, commensal isolates of S. aureus are present in healthy individuals. Such isolates tend to be, but are not always, sensitive to more than two antibiotics selected from the list comprising gentamycin, penicillin, chloramphenicol, tetracycline, methicillin, erythromycin and kanamycin.

Those skilled in the art will be aware that it is not possible to distinguish between pathogenic and commensal isolates of Staphylococcus aureus by their antibiotic resistance profiles alone. Clearly, some pathogenic strains are sensitive to a range of antibiotics, while other pathogenic strains are resistant to all of the antibiotics listed supra.

The term "hospital-acquired infection" as used herein shall be taken to refer to an infection which is caused by a virulent Staphylococcus aureus bacterium or other microorganism such as another bacterium, a virus or mycoplasma, wherein said infection is characterised by a disease state in a host organism or cell attributable to the virulent bacterium or other microorganism and wherein said virulent bacterium or other microorganism occurs in a laboratory such as, but not limited to, a pathology, serology, biochemistry or microbiology laboratory or, alternatively, a hospital, dental or medical surgery or other healthcare environment.

The term "hospital" shall be taken to include a veterinary hospital or surgery for the treatment of animals such as livestock animals or domestic animals.

The frequency of occurrence of the subject nucleic acid molecule in a microorganism is determined by any means known to those skilled in the art. Preferably, the frequency of the nucleic acid molecule is determined by polymerase chain reaction and/or nucleic acid hybridisation analyses.

A "high frequency" of occurrence of the subject nucleic acid molecule refers to its occurrence, as determined by polymerase chain reaction and hybridisation analyses, in at least 50% of pathogenic strains of Staphylococcus aureus, preferably at least 60% of pathogenic strains, more preferably at least 75% and even more preferably at least 90% of all pathogenic strains of S. aureus.

The term "present at a low frequency" in the present context shall be taken as meaning that less than 20% of commensal Staphylococcus aureus strains carry the sequence, as determined by polymerase chain reaction and hybridisation analyses. Preferably less than 10% of commensal strains, more preferably less than 5 % and even more preferably less than 2 % of commensal S. aureus strains will carry the nucleic acid molecule of the present invention.

The present invention is not to be limited by the means used to detect the subject nucleic acid molecule as those skilled in the art will be aware of means other then polymerase chain reaction or hybridisation analyses which may be employed for such detection.

For the present puφose, "homologues" of a nucleotide sequence shall be taken to refer to an isolated nucleic acid molecule which is substantially the same as the nucleic acid molecule of the present invention or its complementary nucleotide sequence, notwithstanding the occurrence within said sequence, of one or more nucleotide substitutions, insertions, deletions, or rearrangements.

"Analogues" of a nucleotide sequence set forth herein shall be taken to refer to an isolated nucleic acid molecule which is substantially the same as a nucleic acid molecule of the present invention or its complementary nucleotide sequence, notwithstanding the occurrence of any non-nucleotide constituents not normally present in said isolated nucleic acid molecule, for example carbohydrates, radiochemicals including radionucleotides, reporter molecules such as, but not limited to DIG, alkaline phosphatase or horseradish peroxidase, amongst others.

"Derivatives" of a nucleotide sequence set forth herein shall be taken to refer to any isolated nucleic acid molecule which contains significant sequence similarity to said sequence or a part thereof. Generally, the nucleotide sequence of the present invention may be subjected to mutagenesis to produce single or multiple nucleotide substitutions, deletions and/or insertions. Nucleotide insertional derivatives of the nucleotide sequence of the present invention include 5 ' and 3 ' terminal fusions as well as intra-sequence insertions of single or multiple nucleotides or nucleotide analogues. Insertional nucleotide sequence variants are those in which one or more nucleotides or nucleotide analogues are introduced into a predetermined site in the nucleotide sequence of said sequence, although random insertion is also possible with suitable screening of the resulting product being performed. Deletional variants are characterised by the removal of one or more nucleotides from the nucleotide sequence. Substitutional nucleotide variants are those in which at least one nucleotide in the sequence has been removed and a different nucleotide or nucleotide analogue inserted in its place.

The genetic sequence is particularly useful for the puφose of distinguishing the clinical Staphylococcus aureus strain 8325-4 from other commensal or non-pathogenic strains of bacteria, in particular other strains of S. aureus which do not possess the subject genetic sequence, in particular the sequence set forth in SEQ ID NO: 1 or a homologue, analogue or derivative thereof.

Accordingly, an alternative embodiment of the invention provides an isolated nucleic acid molecule which is indicative of infection of a host organism, tissue or cell or medical implement by a pathogenic Staphylococcus aureus strain wherein said isolated nucleic acid molecule is :

(i) present at high frequency in pathogenic isolates of S. aureus and either not present or present at a low frequency in one or more commensal isolates of S. aureus; and

(ii) comprises at least one copy of the nucleotide sequence motif: CGATAGCGTA ACA AA ATATGGACCTGTAA AAGGAGACTCG or a complementary sequence or a homologue, analogue or derivative thereof.

Even more preferably, the repeated nucleotide sequence motif is repeated at least two times and more preferably still, at least four times and still more preferably at least six times in the nucleic acid molecule of the invention.

In a particularly preferred embodiment, the present invention provides an isolated nucleic acid molecule which is indicative of infection of a host organism, tissue or cell or medical implement by a pathogenic Staphylococcus aureus strain wherein said isolated nucleic acid molecule is :

(i) present at high frequency in pathogenic isolates of S. aureus and either not present or present at a low frequency in one or more commensal isolates of S. aureus;

(ii) comprises at least one copy of the repeated nucleotide sequence motif:

CGATAGCGTAACAAAATATGGACCTGTAAAAGGAGACTCG or a complementary sequence or a homologue, analogue or derivative thereof; and

(iii) comprises a sequence of nucleotides or is complementary to a sequence of nucleotides which is at least 40% identical to the sequence set forth in SEQ ID NO:

1 or a homologue, analogue or derivative thereof.

The host organism, tissue or cell may be any eukaryotic mammalian cell which is a usual host of a pathogenic strain of Staphylococcus aureus including but not limited to human, domestic animal or livestock animal cells. The present invention is particularly directed to cells in vivo, but may also extend to the use of the subject nucleic acid molecule as an indicator of infection of isolated cells, such as cultured cells, by a pathogenic strain of S. aureus.

Particularly preferred cells according to the present invention are cells associated with a wound site, such as a burn, surgical wound, cut or abrasion, being an accidental or intentional wound, blood cell, bodily fluid such as sputum, lung fluid, urine or vaginal exudate, faeces, epidermal cell, bone or joint cell or food cell, the only requirement being that said cell is capable of being infected by a pathogenic Staphylococcus aureus.

A "medical implement" may be any implement used in a hospital as hereinbefore defined which is likely to come into contact with a pathogenic Staphylococcus aureus bacterium, such as a surgical catheter, surgical swab, gauze, hospital linen or other such implements and at least capable of maintaining a pathogenic S. aureus cell in a form such that it is capable of subsequently infecting a host organism, tissue or cell as hereinbefore defined.

The term "indicative of infection of a host organism, tissue or cell by a pathogenic Staphylococcus aureus" means that the presence of the nucleic acid molecule in an 5. aureus isolate correlates with the presence of a pathogenic isolate in said cell as the causative agent of infection or disease. An isolate bearing the nucleic acid molecule is either pathogenic or is sufficiently related to pathogenic strains to be likely to be pathogenic and may be a member of the same clonal group. The nucleic acid molecule could also be a marker of pathogenicity in species other than S. aureus.

In a further alternative embodiment, the present invention provides an isolated nucleic acid molecule which is capable of hybridising under at least low stringency conditions to at least 20 contiguous nucleotides contained within the nucleotide sequence set forth in SEQ ID NO: 1 or a complementary strand, homologue, analogue or derivative thereof.

For the piuposes of defining the level of stringency, a low stringency is defined herein as being a hybridisation and/or a wash carried out in 6xSSC buffer, 0.1 % (w/v) SDS at 28°C. Generally, the stringency is increased by reducing the concentration of SSC buffer, and/or increasing the concentration of SDS and/or increasing the temperature of the hybridisation and/or wash. Conditions for hybridisations and washes are well understood by one normally skilled in the art. For the pmposes of clarification of parameters affecting hybridisation between nucleic acid molecules, reference can conveniently be made to pages 2.10.8 to 2.10.16. of Ausubel et al. (1987), which is herein incoφorated by reference.

In a particularly preferred embodiment the present invention provides an isolated nucleic acid molecule which is capable of hybridising under at least low stringency conditions to at least 20 contiguous nucleotides contained within the nucleotide sequence set forth in SEQ ID NO: 1 or a complementary strand, homologue, analogue or derivative thereof wherein said nucleic acid molecule is obtained from a Staphylococcus aureus and is present at high frequency in clinically-significant isolates of S. aureus.

More particularly preferred, the nucleic acid molecule of the invention is either not present or present at a low frequency in commensal isolates of Staphylococcus aureus.

In an even more particularly preferred embodiment, the nucleic acid molecule further comprises the sequence of nucleotides set forth in SEQ ID NO: 1 or a homologue, analogue or derivative thereof.

In an alternative embodiment, the present invention provides an isolated nucleic acid molecule which encodes or is complementary to a nucleic acid molecule which encodes at least one surface protein or surface-like protein of a pathogenic Staphylococcus aureus strain.

Preferably, the isolated nucleic acid molecule of the invention encodes a sequence of amino acids substantially as set forth in any one of SEQ ID NO: 2 or SEQ ID NO: 3 or is at least 40% identical thereto.

For the puφoses of nomenclature, the amino acid sequences set forth in SEQ ID NOS:

2 and 3 correspond to polypeptides encoded, respectively, by nucleotide residues 189 to 2650 and 2880 to 3455 of the nucleotide sequence set forth in SEQ ID NO: 1. The polypeptides are specific to a pathogenic strain of Staphylococcus aureus or at least are present at a high frequency in a pathogenic strain of S. aureus, but only at a low frequency in commensal strains of S. aureus. As a consequence, the polypeptide products may be used as markers for identifying a pathogenic strain of S. aureus in a host organism, tissue or cell.

5 The term "surface protein or surface-like protein" as used herein shall be taken to refer to any polypeptide or protein species or a fragment thereof, including a synthetic, recombinant or naturally-occurring polypeptide or protein which is comprised of a sufficient proportion of hydrophilic amino acids such that it may be predicted from its hydrophilic index to be found on the surface of a cell, rather than within the membrane of a cell.

10

The present invention extends to any nucleic acid molecule which encodes a fragment of a surface protein or surface-like protein as defined herein, although said fragment is derived from a region of the surface protein or surface-like protein which is found associated with a membrane system or functions as an anchor thereto.

15

Preferably the nucleic acid molecule according to any of the foregoing embodiments is in a biologically pure form. Preferably the purity of the nucleic acid molecule is represented by at least 40% nucleic acid molecule, preferably at least 60% nucleic acid molecule, more preferably at least 75 % nucleic acid molecule, even more preferably at least

20 85 % nucleic acid molecule and still more preferably at least 90% nucleic acid molecule relative to other nucleic acids and non-nucleic acid material as determined by nucleotide sequence, homology, activity or any other convenient means.

The genetic sequences of the present invention are particularly useful as genetic probes 25 to identify and/or isolate similar genes or genetic sequences from other pathogenic strains of Staphylococcus aureus.

Accordingly, a second aspect of the invention contemplates a method of identifying a first nucleic acid molecule from Staphylococcus aureus which is indicative of a pathogenic

30 S. aureus strain, said method comprising contacting genomic DNA, mRNA, cDNA derived from said S. aureus or a part or fragment thereof, or a source thereof, with a hybridisation effective amount of a second nucleic acid molecule which comprises the nucleotide sequences set forth in SEQ ID NO: 1 or its complementary nucleotide sequence or a part, homologue, analogue or derivative thereof, and then detecting said hybridisation.

The first nucleic acid molecule may be in a recombinant form, in a virus particle, bacteriophage particle, yeast cell, animal cell, plant cell or any biological sample or medical implement containing a S. aureus cell, in particular a pathogenic S. aureus. Preferably, the first nucleic acid molecule originates from a pathogenic strain of Staphylococcus aureus and/or hybrids or derivatives and/or ancestral progenitors of same. In addition, the first nucleic acid molecule may be bound to a support matrix, for example nylon, nitrocellulose, polyacrylamide, agarose, amongst others.

Preferably, the second genetic sequence is detectably labelled with a reporter molecule capable of giving an identifiable signal (e.g. a radioisotope such as ³²P or ³⁵S or a biotintylated molecule).

The term "detectably labelled" used herein means that the nucleic acid molecule is labelled with a label or reporter such that the resultant hybrid itself is directly detectable. Alternatively the nucleic acid molecule may be indirectly labelled. These methods are well known to those skilled in the art, and include radiolabeling, and labeled antibody binding. Detection can be achieved by directly labeling the probe with a ligand as, for example, biotin which specifically binds to the protein streptavidin, and the ligand can be a carrier for a chemiluminescent reaction component, as for example streptavidin linked covalently to alkaline phosphatase or horseradish peroxidase. All of these methods are well-known to one of ordinary skill in the art, and render the nucleic acid molecule detectably labeled.

Direct radiolabeling of the probes of the present invention is possible by attaching radioactive isotopes such as ³²P to the phosphate groups of the phosphate-sugar backbone of the probe molecule. Those of ordinary skill in the art will appreciate that labelling with other radioactive labels such as ³H, or ¹³⁵ I is also possible. Once the probes are labeled radioactively, detection is accomplished by exposure to X-ray sensitive photographic film or phosphor imager. Subsequent development of the film will enable one to visually detect the presence or absence of hybridisation. These methods are well-known to those of ordinary skill in the art, for example in Sambrook et al (1989) which is incoφorated herein in the references.

In a particularly preferred embodiment of the present invention, there is provided a method of identifying a first nucleic acid molecule from Staphylococcus aureus which is indicative of a pathogenic S. aureus strain, said method comprising contacting genomic DNA, mRNA, cDNA derived from said S. aureus or a part or fragment thereof, or a source thereof, with a hybridisation effective amount of a second nucleic acid molecule which comprises the nucleotide sequences set forth in SEQ ID NO: 1 or its complementary nucleotide sequence or a part, homologue, analogue or derivative thereof, and then detecting said hybridisation, wherein said genetic sequence further comprises a sequence of nucleotides substantially as set forth in any one of SEQ ID Nos: 4, 5, 6, 7, 8, 9 or 10 or is at least 40% identical thereto.

An alternative method contemplated in the present invention involves hybridising under at least low stringency condition, one or more nucleic acid primer molecules of at least

10 contiguous nucleotides in length derivable from SEQ ID NO: 1 or its complementary nucleotide sequence to a nucleic acid template molecule and amplifying copies of said template or a part or fragment thereof in a polymerase chain reaction.

According to this embodiment of the invention, the template molecule is herein defined as a genetic sequence which is at least 40% identical at the nucleotide sequence level to SEQ ID NO: l or to its complementary nucleotide sequences. The polymerase chain reaction, a technique that is well known to those skilled in the art.

Preferably, the nucleic acid primer molecule or molecule effective in hybridisation is contained in an aqueous mixture of other nucleic acid primer molecules. More preferably, the nucleic acid primer molecule is in a substantially pure form.

In an even more preferred embodiment, the nucleic acid primer molecule is any nucleotide sequence of at least 10 contiguous nucleotides in length derived from, or contained within the nucleotide sequence as set forth in SEQ ID NO: 1.

Still more preferably, the nucleic acid primer molecule comprises at least 20 contiguous nucleotides in length, even more preferably at least 30 contiguous nucleotides in length and still more preferably at least 40 contiguous nucleotides in length derivable from SEQ ID NO: 1 or its complementary nucleotides substantially the same as any one or more of SEQ ID Nos: 4, 5, 6, 7, 8, 9 or 10 or its complementary nucleotide sequence or a homologue, analogue or derivative thereof.

The template molecule may be in a recombinant form, in a virus particle, bacteriophage particle, bacterial cell, yeast cell, animal cell, plant cell or any biological sample or medical implement which comprises a S. aureus cell. Preferably, the nucleic acid template molecule originates from a pathogenic strain of Staphylococcus aureus and/or hybrids or derivatives and/or ancestral progenitors of same.

In a particularly preferred embodiment, the nucleic acid template molecule comprises a sequence of at least 30 contiguous nucleotides in length derived from or contained within the sequence set forth in any one of SEQ ID Nos: l, 4,5,6,7,8,9 or 10 or a complementary sequence or a homologue, analogue or derivative thereof.

In another aspect, the present invention provides a method of determining whether a Staphylococcus strain is pathogenic, said method comprising contacting a biological sample containing nucleic acid from a Staphylococcus strain with a nucleic acid probe comprising at least 10 contiguous nucleotides derived from SEQ ID NO: l or its complement or a homologue, analogue or derivative thereof under at least low stringency hybridisation conditions and for a time sufficient to allow for hybridisation between the nucleic acid in the sample and the probe to occur and then detecting said hybridisation.

In a preferred embodiment, said nucleic acid probe further comprises one or more of the sequences set forth in SEQ ID Nos; 4-10 or a homologue, analogue or derivative thereof.

According to this aspect of the invention, hybridisation between the probe and the nucleic acid molecule in the sample is most likely to occur when the sample contains a pathogenic Staphylococcus aureus strain.

The term "Staphylococcus" refers to the species comprising that genus. Preferably the species used in the method is Staphylococcus aureus, but the method could be extendible to other Staphylococcus species which harbour the genetic sequence where the genetic sequence is a marker of pathogenicity.

The nucleic acid probe may be RNA or DNA, including a synthetic oligonucleotide molecule, plasmid DNA molecule or contained in any other nucleic acid molecule. Furthermore, the probe may be single-stranded or double-stranded.

The probe may be modified by the attachment of any reporter molecule to facilitate the detection of hybridisation. Preferably the probe is detectably labelled using a reporter molecule comprising a radioactive isotope such as ³²P or ³⁵S.

Those skilled in the art will be familiar with the construction of suitable probes and the conditions sufficient to obtain stable hybridisation. Such methods are disclosed, for example, in Sambrook et al (1989).

The sample may be any biological sample which contains a Staphylococcus aureus cell, including, but not limited to a biological sample derived from a wound site, blood cell, bodily fluid such as urine, faeces or vaginal exudate, epidermal cell, bone or joint cell or food cell, or a medical implement as hereinbefore defined which is contaminated with a Staphylococcus aureus cell.

Those skilled in the art will be familiar with how to prepare a sample containing a Staphylococcus cell. This typically involves lysis of cells contained in the sample, in particular lysing the Staphylococcus cells. Sample preparation may further include gel electrophoresis of the contents and then transfer to a membrane or direct dot blot, followed by probing with a suitably labelled probe, under at least low stringency conditions. Alternatively, where the sample is limited or the level of S. aureus contamination of the sample or the S. aureus cell count in the sample is low, it may be possible to amplify the S. aureus DNA as hereinbefore described, prior to electrophoresis of the sample and subsequent nucleic acid hybridisation.

The only requirement for what constitutes a suitably prepared sample is that it comprise representative nucleic acid sequences for the species of Staphylococcus contained therein. This means that most and preferably all of the complement of Staphylococcus genetic sequences in the form of RNA, DNA or protein are present in the prepared sample, such that the detection means used will be able to detect the relevant sequences when present in the intact bacterium.

A further aspect of the present invention is directed to a genetic construct comprising an isolated nucleic acid molecule as described herein.

Preferably, the gene sequence is related to or a functional derivative, part fragment, homologue, or analogue of the nucleotide sequence defined by any one or more of SEQ ID NO: 1 or SEQ ID NOs: 4-10 inclusive.

The present invention extends to genetic constructs designed to facilitate the expression of a nucleic acid molecule as described herein, in which case the genetic construct will comprise, in addition to the subject nucleic acid molecule, a promoter and optional other regulatory sequences that modulate expression of the nucleic acid molecule. The promoter may be any promoter capable of expression in a bacterial or mammalian cell.

It is well known in the art that the promoter sequence used in the expression vector will also vary depending upon the level of expression required and whether expression is intended to be constitutive or regulated. Examples of eukaryotic cells contemplated herein include mammalian, yeast, insect or plant cells and examples of prokaryotes include Escherichia coli, Salmonella sp., Bacillus sp. and Pseudomonas sp. Typical promoters suitable for expression in bacterial cells such as E. coli include, but are not limited to, tac promoter, the lacz promoter, or the phage lambda λ_L or λ_R promoters.

The subject nucleic acid molecule may be genomic DNA or cDNA and may correspond in sequence exactly with the nucleotide sequence as set forth in SEQ ID NO: 1 or SEQ ID NOs: 4, 5, 6, 7, 8, 9 or 10, or it may contain one or more nucleotide substitutions, additions and/or deletions, either dispersed throughout, or clustered.

Yet another aspect of the present invention provides a recombinant gene product which comprises at least one surface protein or surface-like protein as hereinbefore defined of a pathogenic strain of Staphylococcus aureus.

Preferably, the gene product has a sequence that is identical to, or contained within the amino acid sequence set forth in SEQ ID NO: 2, or SEQ ID NO: 3 or a homologue, analogue or derivative thereof which is at least 40% identical thereto.

The present invention also extends to a synthetic peptide comprising any part of the amino acid sequence set forth in SEQ ID NO: 2 and/or SEQ ID NO: 4, or a derivative having at least 40% similarity to all or a part thereof.

Preferably the peptide is in biologically pure form. Preferably the purity of the peptide is represented by at least 40% peptide, preferably at least 60% peptide, more preferably at least 75 % peptide, even more preferably at least 85 % peptide and still more preferably at least 90% peptide relative to other peptides, proteinaceous and non- proteinaceous material as determined by amino acid sequence, homology, activity or any other convenient means.

Derivatives of the polypeptides of the invention include single or multiple amino acid substitutions, deletions and/or additions to the molecule. Conveniently, these are prepared by first making single or multiple nucleotide substitutions, deletions and/or additions to the nucleic acid molecule encoding the polypeptide. Alternatively, once the amino acid sequence is known, amino acids can be chemically added by established techniques and in any sequence required to give the desired mutant. All such derivatives are encompassed by the present invention.

Amino acid insertional derivatives of the polypeptides of the present invention include amino and/or carboxyl terminal fusions as well as intra-sequence insertions of single or multiple amino acids. Insertional amino acid sequence variants are those in which one or more amino acid residues are introduced into a predetermined site in the protein although random insertion is also possible with suitable screening of the resulting product. Deletional variants are characterised by the removal of one or more amino acids from the sequence. Substitutional amino acid variants are those in which at least one residue in the sequence has been removed and a different residue inserted in its place. Typical substitutions are those made in accordance with Table 1.

Where a derivative is produced by amino acid substitution, the amino acids are generally replaced by other amino acids having like properties, such as hydrophobicity, hydrophilicity, electronegativity, bulky side chains and the like. Amino acid substitutions are typically of single residues. Amino acid insertions will usually be in the order of about 1-10 amino acid residues and deletions will range from about 1-20 residues. Preferably, deletions or insertions are made in adjacent pairs, i.e. a deletion of two residues and a corresponding insertion of two residues. TABLE 1 Suitable residues for amino acid substitutions

Original Residue Exemplary Substitutions

Ala Ser

Arg Lys Asn Gin; His

Asp Glu

Cys Ser

Gin Asn; Glu

Glu Asp Gly Pro

His Asn; Gin

He Leu; Val

Leu He; Val

Lys Arg; Gin; Glu Met Leu; He; Val

Phe Met; Leu; Tyr

Ser Thr

Thr Ser

Tφ Tyr Tyr Tφ; Phe

Val He; Leu; Met

The amino acid variants referred to above may be readily made using synthetic peptide techniques well known in the art, such as solid phase peptide synthesis and the like, or by recombinant DNA manipulations. Techniques for making substitution mutations at predetermined sites in DNA having known or partially known sequence are well known and include, for example, M13 mutagenesis. The manipulation of DNA sequence to produce variant proteins which manifest as substitutional, insertional or deletional variants are conveniently described, for example, in Sambrook et al (1989).

Other examples of recombinant or synthetic mutants and derivatives of a polypeptide include single or multiple substitutions, deletions and/or additions of any molecule associated therewith such as carbohydrates, lipids and/or proteins or polypeptides.

The isolated recombinant polypeptides set forth in SEQ ID Nos: 2 and 3 are useful as polypeptide components in vaccine preparations which, when administered to a human or other animal capable of being infected by a pathogenic Staphylococcus aureus, confer immunity or resistance, or at least improve resistance of a host organism, tissue or cell to said pathogenic bacterium.

In a further alternative embodiment, the polypeptide of the invention is useful as a marker for the identification of a pathogenic strain or Staphylococcus aureus.

According to this embodiment, the detection of the subject polypeptide by any means known in the art, for example SDS/polyacrylamide gel electrophoresis, immunoassay, enzyme assay or other means may be used. In the case of an immunoassay, it is first necessary to produce an immunologically interactive molecule to the polypeptide of the invention.

In a further alternative embodiment, the polypeptides of the invention are also useful in the production of immunologically interactive molecules, such as antibodies, or functional derivatives thereof.

Accordingly, a further aspect of the invention further contemplates an antibody that binds to a surface protein or surface-like protein of a pathogenic Staphylococcus aureus as hereinbefore defined or a homologue, analogue or derivative thereof.

In a preferred embodiment of the invention, said antibody is further capable of binding to a sequence of amino acids that is identical to, or contained within the sequence set forth in SEQ LD NO: 2, or SEQ ID NO: 3 or a homologue, analogue or derivative thereof which is at least 40% identical thereto.

In particular, an antibody as contemplated herein includes any antibody which is capable of binding to any region of a recombinant gene product derived from a Staphylococcus aureus, wherein said gene product is present at a high frequency in pathogemc strains of S. aureus and at a low frequency in commensal strains of S. aureus or is a surface protein or surface-like protein as hereinbefore defined. In a particularly preferred embodiment, the antibody is capable of binding to a contiguous or non-contiguous region of at least 5 amino acid residues derived from SEQ ID NO: 2 or SEQ ID NO: 3.

Furthermore, the present invention extends to recombinant and synthetic antibodies and to antibody hybrids. A "synthetic antibody" is considered herein to include fragments and hybrids of antibodies.

Furthermore, the antibodies may be monoclonal or polyclonal and may be selected from naturally occurring antibodies to a gene product or may be specifically raised to a recombinant S. aureus gene product. In the case of me latter, the gene product may first need to be associated with a carrier molecule. The present invention contemplates whole antibodies, antibody fragments, poly functional antibody reagents, monoclonal antibodies, single-chain antigen-binding molecules, or in general any substance comprising one or more specific binding sites from an anti-hybrid antibody. When in the form of whole antibody, it can belong to any of the classes and subclasses of known immunoglobulins, e.g., IgG, IgM, and so forth. Any fragment of any such antibody which retains specific binding affinity for the hybridized probe can also be employed, for instance, for fragments of IgG conventionally known as Fab, F(ab'), and F(a')₂- In addition, aggregates, polymers, derivatives and conjugates of immunoglobulins or their fragments can be used where appropriate.

The immunoglobulin source for the antibody reagent can be obtained in any available manner such as conventional antiserum, monoclonal antibody techniques, and recombinant 5 genetic engineering of single-chain antigen-binding molecules. Antiserum can be obtained by well-established techniques involving immunization of an animal, such as a mouse, rabbit, guinea pig, sheep or goat, with an appropriate immunogen. Antiserum can also be obtained from a human or animal patient which has been infected by S. aureus. The immunoglobulins can also be obtained by somatic cell hybridisation techniques, such resulting in what are 10 commonly referred to as monoclonal antibodies, also involving the use of an appropriate immunogen. Single-chain antigens are recombinantly engineered by insertion of a DNA segment coding for a linker polypeptide into a plasmid such that the linker will be expressed linking the two antigen-binding variable domains.

15 Both polyclonal and monoclonal antibodies are obtainable by immunisation with a recombinant gene product, native protein or extract derived from a pathogenic S. aureus and either type is utilisable for immunoassay s. The methods of obtaining both types of sera are well known in the art. Polyclonal sera are less preferred but are relatively easily prepared by injection of a suitable laboratory animal such as a mouse, rabbit, guinea pig, sheep or goat

20 with an effective amount of recombinant gene product, or antigenic or immunointeractive parts thereof, collecting serum from the animal and isolating specific sera by any of the known immunoadsorbent techniques.

The use of monoclonal antibodies in an immunoassay is particularly preferred because 25 of the ability to produce them in large quantities and the homogeneity of the product. The preparation of hybridoma cell lines for monoclonal antibody production derived by fusing an immortal cell line and lymphocytes sensitised against the immunogenic preparation can be done by techniques which are well known to those who are skilled in the art (see, for example, Douillard and Hoffman, 1981; Kohler and Milstein, 1975; Kohler and Milstein, 30 1976). The antibodies and/or the recombinant S. aureus gene products of the present invention are particularly useful for the immunological screening of biological samples derived from a host organism, tissue or cell infected with a pathogemc strain of S. aureus to detect the presence of said pathogen therein.

In one embodiment, specific antibodies are used to screen for pathogenic Staphylococcus aureus isolates in a host organism, tissue or cell. Techniques for the assays contemplated herein are known in the art and include, for example, sandwich assays and ELISA.

It is within the scope of this invention to include any second antibodies (monoclonal, polyclonal or fragments of antibodies) directed to the first mentioned antibodies discussed above. Both the first and second antibodies may be used in detection assays or a first antibody may be used with a commercially available anti-immunoglobulin antibody.

The detection of a pathogenic Staphylococcus aureus strain in a host organism, tissue or cell may be accomplished in a number of ways such as by Western blotting and ELISA procedures. A wide range of immunoassay techniques are available as can be seen by reference to US Patent Nos. 4,016,043, 4, 424,279 and 4,018,653. These, of course, include both single-site and two-site or "sandwich" assays of the non-competitive types, as well as in the traditional competitive binding assays. These assays also include direct binding of a labelled antibody to a target.

Sandwich assays are among the most useful and commonly used assays and are favoured for use in the present invention. A number of variations of the sandwich assay technique exist, and all are intended to be encompassed by the present invention. Briefly, in a typical forward assay, an unlabelled antibody is immobilised on a solid substrate and the sample to be tested brought into contact with the bound molecule. After a suitable period of incubation, for a period of time and under conditions sufficient to allow formation of an antibody-antigen complex, a second antibody specific to the antigen, labelled with a reporter molecule capable of producing a detectable signal is then added and incubated, allowing time sufficient for the formation of another complex of antibody-antigen-labelled antibody. Any unreacted material is washed away, and the presence of the antigen is determined by observation of a signal produced by the reporter molecule.

In this case, the first antibody is raised to a recombinant gene product encoded specifically by a pathogenic strain of Staphylococcus aureus and the antigen is derived from a pathogenic strain of S. aureus, preferably in a host organism, tissue or cell, host organism, tissue or cell extract or biological sample suspected of being contaminated with said strain.

The results may either be qualitative, by simple observation of the visible signal, or may be quantitated by comparing with a control sample containing known amounts of hapten. Variations on the forward assay include a simultaneous assay, in which both sample and labelled antibody are added simultaneously to the bound antibody. These techniques are well known to those skilled in the art, including any minor variations as will be readily apparent. In accordance with the present invention the sample is one which might contain a pathogemc S. aureus or a gene product thereof and include crude or purified protein extracts.

In the typical forward sandwich assay, a first antibody raised against a recombinant

S. aureus gene product is either covalently or passively bound to a solid surface. The solid surface is typically glass or a polymer, the most commonly used polymers being cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene. The solid supports may be in the form of tubes, beads, discs of microplates, or any other surface suitable for conducting an immunoassay. The binding processes are well-known in the art and generally consist of cross-linking, covalent binding or physically adsoφtion, the polymer-antibody complex is washed in preparation for the test sample. An aliquot of the sample to be tested is then added to the solid phase complex and incubated for a period of time sufficient (e.g. 2-40 minutes) and under suitable conditions (e.g. 25 °C) to allow binding of any antigen present in the sample to the antibody. Following the incubation period, the reaction locus is washed and dried and incubated with a second antibody specific for a portion of the first antibody. The second antibody is linked to a reporter molecule which is used to indicate the binding of the second antibody to the hapten.

An alternative method involves immobilising the target molecules in the biological sample and then exposing the immobilised target to specific antibody which may or may not be labelled with a reporter molecule. Depending on the amount of target and the strength of the reporter molecule signal, a bound target may be detected by direct labelling with the antibody. Alternatively, a second labelled antibody, specific to the first antibody is exposed to the target-first antibody complex to form a target-first antibody-second antibody tertiary complex. The complex is detected by the signal emitted by the reporter molecule.

By "reporter molecule" as used in the present context, is meant a molecule which, by its chemical nature, provides an identifiable signal which allows the detection of antigen- bound antibody. Detection may be either qualitative or quantitative. The most commonly used reporter molecules in this type of assay are either enzymes, fluorophores or radionuclide containing molecules (i.e. radioisotopes) and chemiluminescent molecules for example LUMI- PHOS 530 (registered trade mark of LuminGen Inc., Detroit, Michigan, USA) or an antidigoxygenin conjugate.

In the case of an enzyme immunoassay, an enzyme is conjugated to the second antibody, generally by means of glutaraldehyde or periodate. As will be readily recognised, however, a wide variety of different conjugation techniques exist, which are readily available to the skilled artisan. Commonly used enzymes include horseradish peroxidase, glucose oxidase, beta-galactosidase and alkaline phosphatase, amongst others. The substrates to be used with the specific enzymes are generally chosen for the production, upon hydrolysis by the corresponding enzyme, of a detectable colour change. Examples of suitable enzymes include alkaline phosphatase and peroxidase. It is also possible to employ fluorogenic substrates which yield a fluorescent product rather than the chromogemc substrates noted above. In all cases, the enzyme-labelled antibody is added to the first antibody-hapten complex, allowed to bind, and then the excess reagent is washed away. A solution containing the appropriate substrate is then added to the complex of antibody-antigen-antibody. The substrate will react with the enzyme linked to the second antibody, giving a qualitative visual signal, which may be further quantitated, usually spectrophotometrically, to give an indication of the amount of hapten which was present in the sample. The term "reporter molecule" also extends to use of cell agglutination or inhibition of agglutination such as red blood cells on latex beads, and the like.

Alternately, fluorescent compounds, such as fluorescein and rhodamine, may be chemically coupled to antibodies without altering their binding capacity. When activated by illumination with light of a particular wavelength, the fluorochrome-labelled antibody adsorbs the light energy, inducing a state to excitability in the molecule, followed by emission of the light at a characteristic colour visually detectable with a light microscope. As in enzyme immunoassays (EIA), the fluorescent labelled antibody is allowed to bind to the first antibody- hapten complex. After washing off the unbound reagent, the remaining tertiary complex is then exposed to the light of the appropriate wavelength the fluorescence observed indicates the presence of the hapten of interest. Immunofluoresence and EIA techniques are both very well established in the art and are particularly preferred for the present method. However, other reporter molecules, such as radioisotope, chemilummescent or bioluminescent molecules, may also be employed.

One of ordinary skill will appreciate that any enzyme may be coupled to the bound antibodies for puφoses of detection, including horseradish peroxidase and glutaraldehyde, and corresponding color-developing reagents applied. Specifically, the chemilummescent reagent "LUMI-PHOS 530^®", LuminGen, Inc., Detroit, Michigan, allows the detection of hybrids on conventional X-ray film. Alternatively, antidigoxigenin conjugates that would be suggested to one of ordinary skill include the fluoresces anti-digoxigenin-rhodamine, and anti- digoxigenin-fluorescein; and for electron microscopy anti-digoxigenin-(second antibody conjugated to gold). The use of chromophoric labels can be detected by sight or by conventional means, such as by a light microscope. Recordation is by conventional color microphotography. Fluorescent or chemilumescent labels emit light that may be detected by sight or by photomultiplier type. Gold-conjugated labeling is used in electron microscopy to detect hybridisation and to image the larger moφhological features of the infected cell. Radiolabeled probes may be exposed to X-ray sensitive film and image analysis software such as a densitometer or phosphor imager.

It will be readily apparent to the skilled technician how to vary the above assays and all such variations are encompassed by the present invention.

The invention also extends to an immunologically reactive molecule capable of binding a nucleic acid hybrid molecule, wherein said hybrid comprises a first nucleic acid molecule as hereinbefore defined hybridised to a second nucleic acid molecule present in or derived from a biological sample or medical implement.

When the immunologically interactive molecule is used to detect a hybrid nucleic acid molecule, it will usually be labeled with a reporter molecule as hereinbefore defined.

Alternatively, the antibody reagent can be detected based on a native property such as its own antigenicity. Further, antibody can be detected by complement fixation or the use of labeled protein A, as well as other techniques known in the art for detecting antibodies.

Where the Staphylococcus cell count of the sample is low, the sensitivity of detection may be enhanced by amplifying Staphylococcus genetic sequences using the polymerase chain reaction before hybridising the nucleic acid molecule of the invention or using an immunologically interactive molecule to detect said hybrids.

In another aspect the present invention contemplates use of the isolated peptide described above as a vaccine for Staphylococcus, particularly S. aureus. Thus in a further aspect the present invention is directed to a vaccine for Staphylococcus said vaccine comprising an immunogenically effective amount of a peptide or part of said peptide, which is encodable by the 3.5 kb or 40 bp nucleic acid molecules described earlier together with a pharmaceutically acceptable carrier or diluent.

In the following description, the peptide or part peptide of the present invention is referred to as the "active ingredient". The vaccine preparation is conveniently referred to below as "the pharmaceutical composition".

The active ingredient of the pharmaceutical composition is contemplated to exhibit excellent activity in stimulating, enhancing or otherwise facilitating an immune response in patients when administered in an amount which depends on the particular case. For example, from about 0.5 μg to about 20 mg of peptide per kilogram of body weight per day may be administered. Dosage regima may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered in one or more of daily, weekly or monthly or in other suitable time intervals or the dose may be proportionally reduced as indicated by the exigencies of the situation. The active compound may be administered by injection in a convenient manner but may be administered via a genetic sequence in a viral or bacterial vector.

The active compounds may also be administered in dispersions prepared in glycerol, liquid polyethylene glycols, and/or mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

The pharmaceutical forms suitable for in vivo administration include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. It is also well known to those skilled in the art that vaccine preparation may be delivered by oral means. Alternatively, the vaccine may be delivered as a coating on a gold or tungsten particle or other particle via a biolistic means, to a target cell or tissue. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thormerosal and the like. In many cases, it will be preferable to include isotomc agents, for example, sugars or sodium chloride. Prolonged absoφtion of the injectable compositions can be brought about by the use in the compositions of agents delaying absoφtion, for example.

Sterile injectable solutions are prepared by incoφorating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incoφorating the various sterilized active ingredient(s) into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze-drying technique which yield a powder of me active ingredient plus any additional desired ingredient from previously sterile- filtered solution thereof.

As used herein "pharmaceutically acceptable carriers and/or diluents" include any and all solvents, dispersion media, aqueous solutions, coatings, antibacterial and antifungal agents, isotonic and absoφtion delaying agents, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, use thereof in the composition is contemplated. Supplementary active ingredients can also be incoφorated into the compositions.

A further aspect of the present invention contemplates a kit for the rapid and convenient detection of a pathogenic Staphylococcus, in particular a pathogenic S. aureus in a biological sample such as serum, mucus, tissue extract, or biological fluid or in a medical implement as hereinbefore defined.

The kit is compartmentalized to receive several first containers adapted to contain a polypeptide according to any of the embodiments hereinbefore described and several second containers adapted to contain an antibody which recognises said polypeptide, wherein said antibody is optionally labelled with a reporter molecule capable of producing a detectable signal as hereinbefore described. If the antibody of the second container is not labelled with a reporter molecule, then there are also provided several third containers which contain a second antibody which recognises the first antibody and is conjugated to a reporter molecule. If the reporter molecule is an enzyme, then several fourth containers are provided which contain a substrate molecule for said enzyme to facilitate detection of the enzyme linked to a polypeptide:antibody complex, or to a polypeptide: antibody: antibody complex when a second antibody has been used. The reporter molecule used in this kit may also be a radio-isotope, a fluorescent molecule, or bioluminescent molecule, amongst others. Optionally, the first, second, third and fourth containers of said kit may be colour-coded for ease-of use.

In an exemplified use of the subject kit, a control reaction is carried out in which the contents of the first container are contacted with the contents of the second container for a time and under conditions sufficient for an antibody: polypeptide complex to form in said first container. At the same time the sample to be tested is contacted with the contents of the second container for a time and under conditions sufficient for an antibody:polypeptide complex to form in said second container. If the antibody of the second container provided is not labelled with a reporter molecule, then the complexes produced in said first and second containers are contacted with the antibody of the third container for a time and under conditions sufficient for a tertiary polypeptide:antibody:antibody complex to form. The polypeptide: antibody complex or polypeptide:antibody:antibody complex is then subjected to a detecting means as hereinbefore described. In analysing the results obtained using said kit, the control reaction carried out in said first container should always provide a positive result upon which to compare the results obtained in said second container which contains the test sample.

In an alternative embodiment, the kit of the present invention is also useful for the rapid and convenient assay of infection by a pathogenic Staphylococcus bacterium, in particular S. aureus in an human or other animal, in which case the sample being tested is derived from a human or other animal suspected of being infected with said bacterium.

The present invention further contemplates a kit for the rapid detection of a pathogenic Staphylococcus, in particular a pathogenic S. aureus in a biological sample, said kit being compartmentalized to contain in a first compartment, one or more nucleic acid molecules which encode, or are complementary to a nucleic acid molecule as hereinbefore defined. In a particularly preferred embodiment, the first compartment is adapted to contain one or more nucleic acid molecules which are at least 40% identical to the nucleotide sequence set forth in SEQ LD Nos:l, 4,5,6,7,8,9 or 10 or its complement or a derivative, homologue or analogue thereof.

In the Figures:

Figure 1: is a photographic representation showing the detection of recombinant plasmid DNA with a nucleic acid molecule which is specific for the pathogemc Staphylococcus aureus strain ISP8. Plasmid recombinants (lanes 2-5) were hybridised with radiolabelled pooled total DNA obtained from 30 individual commensal isolates (top panel) and total ISP8 DNA (lower panel). Lane 1 contains pTZ19U DNA. Hybridisation signals in lanes other than lane 4 are due to non-specific binding of the DNA probes to plasmid DNA.

Figure 2: is a photographic representation showing the detection of pathogen-specific nucleic acid sequences in pathogenic (top panel) and commensal (lower panel) isolates of Staphylococcus aureus. Total genomic DNA was obtained from isolates and digested with H dIII and then hybridisaed with the fragment set forth in SEQ ID NO: 4. Variation in signal intensity is most likely due to differences in DNA loading per lane. Clinical isolates not showing a detectable signal are antibiotic-sensitive and non-clonal. Commensal isolates showing a detectable signal are antibiotic-sensitive and clonal. Sizes of DNA fragments are indicated on the right-hand side of the figure.

Figure 3: is a photographic representation showing the amplification products generated from various Staphylococcus aureus isolates using the primers WAS 3' and WAS 2R. Lane 1 shows a pTZ19U marker; lane 2 contains no added DNA; Lane 3 contains the amplification product obtained using S. aureus ISP8 genomic DNA as a template; Lanes 4-13 inclusive contain the amplification products obtained using other isolates (lanes 4-6 and 8-11 are from clonal isolates while lanes 7, 12 and 13 are from non-clonal isolates).

Figure 4: is a schematic representation showing the open reading frame 1 (ORF1) and summarising the structure of the repeated units which comprise the 40bp nucleotide repeat sequence revealed by nucleotide sequence analysis. The numbers below the boxes indicate nucleotide positions within ORF1. Numbers within the boxes indicate the number of the repeat unit.

Figure 5: is a schematic representation showing the analysis of the amino acid sequences encoded by ORF1 (SEQ ID NO:2). The predicted hydrophilicity profile was determined according to Kyte and Doolittle (1982) using a window of seven amino acid residues. The vertical axis indicates the relative hydrophilicity (positive values) or relative hydrophobicity (negative values). The horizontal axis denoted the amino acid residue position. Surface probability, antigenic index and secondary structure predictions were determined using the Mac Vector 3.5 (IBI) computer software which utilises a combination of algorithms. Values greater than 0.5 on the vertical axis indicate amino acids exposed to the surface of the membrane. Values greater than 0.0 indicate surface peaks that might comprise highly antigenic sites. CF indicates Chou and Fasman (1978) predictions, while RG indicates Robson-Garnier (Gamier et al, 1978) predictions and CfRg indicates a combination of the two predictive methods for determining the secondary structure of proteins. Hlx indicates helix; Sht indicates beta sheet and Trn indicates a beta-turn

Figure 6: is a schematic representation showing the analysis of the amino acid sequences encoded by ORF2 (SEQ ID NO:3). The predicted hydrophilicity profile was determined according to Kyte and Doolittle (1982) using a window of seven amino acid residues. The vertical axis indicates the relative hydrophilicity (positive values) or relative hydrophobicity (negative values). The horizontal axis denoted the amino acid residue position. Surface probability, antigenic index and secondary structure predictions were determined using the Mac Vector 3.5 (IBI) computer software which utilises a combination of algorithms. Values greater than 0.5 on the vertical axis indicate amino acids exposed to the surface of the membrane. Values greater than 0.0 indicate surface peaks that might comprise highly antigenic sites. CF indicates Chou and Fasman (1978) predictions, while RG indicates Robson-Garnier (Garnier et al, 1978) predictions and CfRg indicates a combination of the two predictive methods for determining the secondary structure of proteins. Hlx indicates helix; Sht indicates beta sheet and Trn indicates a beta-turn.

The invention is further described with reference to the following non-limiting Examples.

EXAMPLE 1

Bacterial strains

Staphylococcus aureus strain 8325-4 (ISP8, Patel et al., 1989) was kindly provided by Dr Peter Pattee, Iowa State University. The standard reference strain NCTC 8325 (parent of ISP8), though originally isolated in England in the 1950s, appears to be similar, as determined by RFLP analysis, to recent types of MRSAs and to some recent MSSAs isolated in Australia. Thus, ISP8 was identified as belonging to the clonal population, and was selected as representative of the clinically significant clonal isolates, which include MSSAs and MRSAs closely related to ISP8.

Strain ANS46 is a methicillin-multiresistant Staphylococcus aureus (MRSA) extensively studied in this and other laboratories, and is representative of a group (referred to as type 46) which was dominant in major hospitals in the eastern Australian states during 1982 and 1986 (Heneine & Stewart, 1986; Gillespie et al, 1987; Matthews et al, 1987; Skinner et al, 1988; Inglis et al, 1991; Dubin et al, 1992). The second Australian MRSA strain lb is representative of a group referred to as type I (subtype b), a clonal group prevalent in hospitals in Canberra, Australia, during the period 1989-1990 (El-Adhami et al, 1991). Strains SK565 and SK597 are from a collection of MRSA isolates kindly provided by Dr RA Skurray, Sydney University, Sydney, Australia. These two strains were isolated during the period 1981-1982; the former was isolated from Royal Brisbane Hospital, Brisbane, and the latter was isolated from Royal Prince Alfred Hospital, Sydney, Australia (Lyon et al, 1984).

Clinical MSSA isolates, obtained from the Woden Valley Hospital, Canberra (1993), were isolated from infection sites; they express resistance to three or fewer antibiotics of the nine commonly tested for this orgamsm.

Community or commensal Staphylococcus aureus (COSA) isolates were collected by nasal swabbing from a random selection of healthy individuals (university students with no recent history of staphylococcal disease) in Canberra during 1990; these express resistance to not more than two antibiotics. Isolates were identified as S. aureus isolates by their ability to grow and ferment mannitol on 5% (w/v) NaCl nutrient agar (Oxoid), and by a positive coagulase test. Antibiotic susceptibilities were tested by the BBL Sensi-Disc System (Bection Dickinson).

EXAMPLE 2

DNA preparation

Growth and preparation of cells have been described previously (Matthews et al, 1987; Inglis et al, 1990; Stewart et al, 1994b). For the preparation of DNA in agarose, exponentially growing cells (00₆₀₀=0.15) were harvested by centrifugation at 8000 φm for 15 min at 4°C, washed in lOmM TrisCl pH 7.6, 1M NaCl, and embedded in 1 % high purity low melting temperature (LMT; SeaPlaque, FMC, Rockland, ME) agarose. The cell walls were digested in the presence of lysostaphin (50μg/ml) in a lysis solution (1M NaCl, lOOmM EDTA, 6mM Tris Cl pH 7.6, 0.5 % Sarkosyl, 0.2% deoxycholate, 20mg/ml DNAase-free RNAase, 1 mg/ml lysozyme) at 37°C for 4 h. The lysis solution was discarded and the agarose plugs were incubated in ESP solution (0.5M sodium EDTA pH 9.3, 1 % Sarkosyl, 0.5 mg/ml proteinase K) at 50°C for 24h. The DNA plugs were then washed and digested with endonucleases as described by Inglis et al. (1990).

The isolates used and their antibiotic resistance phenotypes are presented in Table 2.

For total cellular DNA preparation, overnight, shaken cultures were harvested, cells washed, and cell walls lysed in TES (30mM TrisCl pH 8.0, 50 mM NaCL, 5m MEDTA) plus 2.5M NaCl and lysostaphin at 30μg/ml. The lysed suspension was then extracted with Tris-equilibrated phenol (pH 8.0), and the DNA was precipitated with ethanol, dried and dissolved in 0.5ml TE buffer (lOmM TrisCl pH 8.0, lmM EDTA) by gentle repeated inversion overnight at 4°C. DNAase-free RNAase was then added to 50μg/ml and the solution incubated at 37°C for 30 min, and was purified by layering onto 3.8ml of IM NaCl, 20mM TrisCl Ph 8.0 and centrifugation at 58000 φm for 2h at 20°C (Matthews et al, 1987). The buffer was then drained and the dried DNA pellet was dissolved in TE buffer.

EXAMPLE 3

Subtractive hybridisation

ISP8 DNA was digested with the endonuclease Taql (Pharmacia), while community

DNA was denatured and fragmented by mixing with NaOH (final concentration 0.3 M) and heating to 100°C for 10 min. The mix was neutralized with Tris.Cl, pH 7.5 and concentrated HCI (Matthews et al, 1987). Fragmented community DNA was then mixed with Taql restricted ISP8 DNA at a ratio of 200: 1, boiled at 100° C for 10 min, and then allowed to anneal at 65 °C for approx. 18 hr. An aliquot of the annealed DNA mix was mixed with AccI (Pharmacia) restricted, dephosphorylated pTZ19U (BioRad) at a ratio of 10: 1 , in the presence of T4 DNA ligase (Pharmacia). The ligated DNA was used to transform electrocompetent E. coli MCI 061.1, and transformants were plated onto ampicillin-containing media (Sambrook et al, 1989). TABLE 2 Antibiotic susceptibility phenotypes for the MRSA, MSSA and COSA isolates.

Isolates* Airtibfotfct

Gm E£ Cm l£ Mς Em Km

ANS46 R R R R R R R type lb R R R R R R R type H^" R R R R R R R

R177 R R R R R R R

RIO R R S R R R R

R28 R R S R R R R

R29 R R S R R R R

R38 R R R R R R R

SK565 R R R R R R R

SK597 R R R R R R R

ISP8

S174 R R S R S R s

SI S R S S S R s

S2 S R S S s s s

S3 S R S S s IR s

m S4 s S S S s S R

S5 s R S S s S s

S6 s R S IR s R s

S7 s R S IR s S s

S8 s R S IR s R s

S9 s R S S s R s

S10 s R S S s S s

Sll s S S S s S s Isolates Antibiotic

Gm Es Cm l£ ME Em Km

S12 S R s s s s s

S13 S R s s s s s

S14 s R s R s s s

S15 S s s s s s s

S16 S R s R s s s

S17 s R s S s s s

S18 s R s S s s s

S19 s R s ΓR s s s

Col s R s s s s s

Co5 s R s S s s s

Co7 s R s s s s s

Co8 s R s S s s s

Co9 s R s s s s s

Coll s R s s s s s

Co 12 s R s s s s s

Co 13 s R s s s s R

Col4 s R s R s R s

Col6 s R s s s R s

Col7 s R s s s R s

Col8 s R s s s s s

Col9 s R s s s s s

Co31 s R s R s s s

Co32 s S s s s s s

Co34 s R s s s s s

Co36 s s s s s s s

Co38 s S s s s s s

Co41 s s s s s s s

Co43 s R s s s s s Table 2 :* isolate nomenclature is as described in text. ANS46, type lb, type II, R-isolates, and SK-isolates are methicillin-multiresistant S. aureus (MRSA) isolates, all of which have closely related RFLP types (data not shown); Co- indicates commensal (community) S. aureus isolates; R-indicates MRSA isolates; SK-indicates MRSA isolates kindly provided by Dr RA Skurray; S- indicates clinical methicillin-sensitive isolates (MSSA) of which ISP8 is a member. t Gm, gentamycin; Pc, penicillin; Cm, chloramphenicol; Tc, tetracycline; Mc, methicillin, Em, erythromycin; Km, kanamycin. S, sensitive, R, resistant, IR, intermediate resistance (the zone of inhibition falls between that determined for standard S and R strains; BBL Sensi- Disc System).

EXAMPLE 4

Screening transformants for ISP8 DNA

Colonies were screened by "cracking" (K C Reed), Cracking consisted of the following method:

Sterile toothpicks, used to pick well-isolated colonies from the plates of transformed cells, were dipped into a 25 μl aliquot of freshly prepared cracking solution (50mM NaOH, 0.5% SDS, 5mM EDTA, 10% glycerol, 0.01 % bromocresol green) and twirled quickly, then discarded. The samples were then heated at 68 °C for 30 min, cooled at room temperature, and loaded onto a 1 % agarose gel and electrophoresed. After electrophoresis, the gel was stained with ethidium bromide (2/ g/ml) for 10 min, destained in water for 30 min and then photographed.

Plasmids were prepared by the alkaline lysis method (Sambrook et al, 1989), electrophoresed in 1 % agarose in lx TAE electrophoresis buffer under standard electrophoresis conditions (Sambrook et al, 1989), and transferred to Nylon membranes (Hybond N⁺; Amersham). Standard cloning and screening methods (Sambrook et al, 1989) were used to clone the full length specific DNA identified in subtractive hybridisation.

EXAMPLE 5 Filter Hybridisation

DNA probes were prepared from total chromosomal DNA from ISP8, community isolates (separately), and from plasmids using the Megaprime DNA labelling system (Amersham, a random-printing method; Feinberg and Vogelstein, 1983, 1984). Filters were hybridized in 2x PE, 7% SDS, and 1 % BSA at 70^βC for 16-18 h, then washed three times (10 min each) in 2x SSC, 0.1 % SDS at room temperature, followed by two 10 min washes in 0.5x SSC, 1 % SDS at 70°C. The filters were the exposed to Fuji X-ray film at -70°C. Results are presented in Figure 1.

EXAMPLE 6

Experimental strategy for construction of ISP8 DNA library

Based on the deduced similarities in the genome organisation of different

Staphylococcus aureus isolates (El-Adhami and Stewart, in preparation), the method of subtractive hybridisation (Lamar and Palmer, 1984) and cloning was applied to detect and identify the presence of any unique DNA sequences associated with the clinical and clonal populations of S. aureus but not with commensal (community) ones.

The S. aureus strain NCTC 8325-4 (ISP8, a variant of the standard strain NCTC 8325 isolated from a clinical environment in the 1950s; Pattee, 1993) was used as a representative of the types with greater clinical virulence. This strain is related to the recent climcal types identified in major hospitals on the Eastern-Australian coast. It has been extensively mapped, both physically and genetically (Pattee, 1993). This strain does not carry any of the repeat sequences, such as IS elements, transposons, plasmids, or bacteriophages identified to date for the staphylococci. Unique DNA sequences may be accessible by deletion enrichment, since such sequences can be considered "deleted" from the commensal isolates. To achieve sufficient enrichment of target sequences, a pool of sheared community DNA prepared from ten different isolates (with great differences in their RFLP patters; El-Adhami and Stewart, in preparation) were used in 200: 1 excess to drive hybridisation of Taql restricted DNA from ISP8 (Lamar and Palmar, 1984).

ISP8 specific-DNA, sharing no homology to the community DNA, was free to re- anneal and was subsequently cloned by standard cloning techniques into pTZ19U. Electroporation was used to transform E. coli MC106.1, and transformants were plated onto ampicillin-containing media (Sambrook et al, 1989).

Recombinant plasmids, obtained from subtractive hybrid isolation and ligation, were screened by hybridisation to DNA probes generated from ISP8 total DNA, and from the pooled community isolates total DNA. A second round of hybridisation was carried out in which the plasmid with the specific DNA was used as a probe to hybridize to Nylon membranes with Hrødlll restricted DNA from twenty climcal isolates, and another twenty community isolates (different from the ones used in the initial subtractive hybridisation process). One plasmid carrying ISP8 specific-DNA was recovered which hybridized, under stringent conditions, to an identical size fragment (approx. l lkb of H dIII restricted DNA) in 12/20 clinical isolates and 3/30 community isolates (Figure 2). The positively hybridizing isolates belonged to the genetically closely related types (clones); ie. clones of greater clinical virulence. EXAMPLE 7

PCR-based assay to determine pathogenic Staphylococcus aureus isolates

DNA obtained from seven clonal pathogenic isolates of Staphylococcus aureus and three non-pathogenic isolates were screened by using synthetic oligonucleotide primers designated WAS 3' (SEQ ID NO: 6) and WAS 2R (SEQ ID NO: 8) The synthetic oligomers were used for PCR amplification of a nucleic acid molecule of approximately 300 bp in length. Standard PCR conditions were used.

As shown in Figure 3, the 300 bp DNA fragment amplified during the PCR reaction was only produced when DNA isolated from clonal pathogenic strains was used as template DNA, indicating that the amplification reaction using these primers provides a successful diagnostic assay for clonal pathogenic S. aureus isolates.

EXAMPLE 8

Nucleotide sequence analysis

Analysis and sequencing of the inserted DNA revealed a 40bp insert of unique sequence (SEQ ID NO:4). The sequence was examined against the Genbank data base (IUBio archives, USA) in search for possible homologous sequences with no significant homologies retrieved. RFLP analysis using a number of restriction endonucleases revealed that this sequence hybridized to a fragment approx. 3.5 kb of a Dral restricted ISP8 DNA.

Accordingly, a genomic library was generated from Dral restricted ISP8 representing fragments within 2-4 kb in size. These fragments were ligated into pBluescript (Stratagene) and used to transform E. coli MC1061.1 cells. The generated library was screened by using synthetic oligomers designed from the sequenced 40 bp insert (primer WAS 3'; SEQ ID NO:6) and from sequence obtained from cycle sequencing genomic DNA described below (primer WAS 2R; SEQ ID NO: 8) utilizing PCR amplification.

Primers (24 mers in both 5' and 3' directions) were designed from me 40 bp sequence (SEQ ID NO:4) and were used to obtain more sequence information by cycle sequencing. The above oligonucleotides and the following primers were used for sequence extension.

WAS 5' (SEQ ID NO:5) 5'-CGATAGCGTAACAAAATATGGACC-3',

WAS 3' (SEQ ID NO:6) 5'-CGAGTCTCCTTTTACAGGTCCATA-3', WAS 2 (SEQ ID NO:7) 5'-GCGTCGTTATTGTCTTCTCACCT-3\

WAS 2R (SEQ ID NO: 8) 5 '-AGGTGAGAAGACAATAACGACGC-3 ' ,

WAS 3 (SEQ ID NO: 9) 5'-CAGGAGAGAAAGAGGAAGTTCCAG-3' or

WAS 3R (SEQ ID NO: 10) 5 '-CTGGAACTTCCTCTTTCTCTCCTG-3 '

The 3.487 kb DNA fragment was sequenced by generating deletion subclones using the Promega Erase-a-Base system. Methods for deletion, subcloning and sequencing are provided in the Promega Users Guide.

Further sequencing was carried out and the uncertain bases of the 3.5 kb fragment were assigned and reading frames were analysed. The 3.5 kb fragment appears to have two open reading frames (ORFs). ORF 1 is 2.475 kb and encodes a protein of 824 amino acids whereas ORF 2 only 576 bp which encodes a protein of 192 amino acids. EXAMPLE 9

Features of the nucleotide sequence

The sequenced DNA fragment obtained in Example 8 was examined for open reading frames (ORFs) in the six possible frames using the software Mac Vector 3.5 (IBI), and major large ORF(ORFl) of 2.475 kb encoding 824 amino acids was identified (the second largest ORF identified was only 576bp). The coding region of ORFl starts with the initiation codon ATG at nt 179 (another possible start codon is TTG at nucleotide 191), and terminates with the stop codon TGA at nt 3,650. A possible Shine-Dalgarno (1974) sequence (ribosome binding site, RBS) is found 14 nucleotides upstream from the start codon, and a few potential -35 and -10 promoter sequences were also identified. Although there was another ATG start codon at nucleotide 41, it is unlikely that it is utilised because there is no potential RBS upstream from this position.

The second largest ORF (ORF2) identified in the third translational frame starts with a GTG initiation codon at nucleotide 2,880, and terminates with a TAG codon at position 3,456. Although GTG is not a commonly used initiation codon, it has been reported to have this function in the synthesis of several bacterial proteins (Signas et al, 1989). The nucleotide base composition for both ORFl and 2 is A and T rich, with only 37.5% and 39.3% G+C for the 2.475kb and 576bp coding regions, respectively, which is close to the composition of Staphylococcus aureus DNA. Codon usage analysis revealed a preference for A/T bases at the third position of the codons with only 21 % G/C, which is comparable to other structural genes of S. aureus (Wada et al, 1990). EXAMPLE 10

Repeating unit region of ORFl

Beginning at nucleotide 265 of the DNA sequence, there are six large tandem repeating units that make up approx. 66% of the DSA sequence. Each repeating unit consists of approx. 384 nucleotides encoding 128 amino acids, and the entire repeating region contains 768 amino acids composed of the six repeated units. Sequence analysis revealed that the six repeated units are highly homologous differing only in 11-14 nucleotides of the 384bp, most of which appear at the same nucleotide position within each repeated unit (data not shown). All of the nucleotide differences between the repeated units can be explained by point mutations, and resulted in five to eight amino acid differences between the repeating units comprising the deduced protein sequence.

EXAMPLE 11

Analysis of the deduced amino acid sequence for ORFl and ORF 2

A hydropathy profile of the deduced amino acid sequences of ORFl and ORF2 shows the pronounced hydrophilicity of the predicted protein products (Figs 5 and 6). Also shown are the surface probability, antigenic index, and secondary structure generated for each using the software Mac Vector 3.5, which reveal characteristics specific of surface proteins or surface-like proteins.

The deduced amino acid sequence for ORF 1 and ORF2 predicts pi values of 4.83 and 8.75, and calculated molecular weights of 90,783 daltons (D) and 21,038D, respectively. Both predicted protein products are rich in lysine and proline amino acids, with each making up approx. 13% of the total amino acid sequence in the translated products. A BLAST search for amino acid similarities identified homologies of ORFl with neurofilament triplet proteins from human and mouse, collagen alpha type proteins, and the surface associated C protein alpha antigen of group B streptococci (data not shown). It is noteworthy that ORFl has a similar structure to the C alpha antigen gene, which contains nine identical 246 nucleotide tandem repeating units. The shared similarities between the C alpha antigen protein and ORFl encompassed the repeated region, with 26% amino acids identical, and 18% conservative substitutions over a region of 642 amino acids.

Analysis of the sequence of ORFl revealed structural properties, in particular the tandemly repeated units, shared by a number of Gram-positive surface proteins that are thought to be involved in the pathogenesis of bacterial infections (Michel et al, 1992). Protein A, collagen adhesion, and fibronectin binding protein of S. aureus, and M proteins of group A Streptococcus, IgG binding proteins from both group A and G Streptococcus, and the C protein alpha antigen of group B Streptococcus have been reported to consist of tandemly repeated regions, which are highly homologous and are thought to be a result of series of stepwise gene duplication events (Uhlen et al, 1984; Signas et al, 1989; Wren 1991; Michel et al, 1992; Patti et al, 1992). It is possible that such repeated units are important for generating genotypic and phenotypic variability by acting as sites for gene rearrangements leading to deletion or duplication, events which result in antigenic diversification. As pointed out earlier, the changes among the repeated units of ORFl can be explained by point mutations, and interestingly, the majority of the changes appeared at identical nucleotide positions within each of the repeated units. It is possible that duplication of DNA is a mechanism to amplify mutations within a repeat, which would create antigenic diversity (Michel et al, 1992).

Although a search for possible amino acid signal sequence homologies utilising information described for other Gram-positive signal sequences was carried out, no similarities were identified. This is similar to a situation reported for a S. aureus peptidoglycan hydrolase-encoding gene, ZytA encoding an amidase, which has been reported to lack a signal sequence (Wang et al, 1991). Whether the failure to identify signal sequences for ORFl and ORF2 is due to sequence divergence, or is due to their absence cannot be answered at present.

Interestingly, a sequence (LPTGE) similar to the hexapeptide consensus LPXTGE, which has been found to be conserved among other Gram-positive and is thought to mediate the binding of surface proteins to the cell wall, appears throughout ORFl. A similar sequence, LPKTGL, was identified in ORF2 at the C-terminal end of this amino acid sequence, which might be important for cell wall/membrane anchoring.

Further analyses are required to identify these proteins and the mechanisms involved in the synthesis and production of these two protein sequences, and to examine their important and role in pathogenesis.

Analysis of the ORF2 amino acid sequence showed weak homology to proline-rich proteins such as sporozoite surface protein 2 from Plasmodium yoelii, neurofilament triplet M protein from chicken, and a glutamic acid-specific endopeptidase from S. aureus (data not shown).

EXAMPLE 12

Epidemiological significance

The spread of virulent strains of S. aureus wiu in hospital environments is presumably determined by a complex interaction of microbial, host, and environmental factors. Recently, Ewald (1993, 1994) argued that hospitals and other institutions where some individuals physically attend to the needs of others provide fertile opportunities for the selection of particularly virulent strains. This is because attendants provide a potential vector mechanism whereby pathogens are transferred from one patient to another. This increased transfer, followed by the selection of the most fit types possessing the appropriate combination of gene(s) necessary for their survival and success in hospital environments, would lead to increased virulence. For example, such a selection is seen in infectious outbreaks caused by MRSA isolates, whereby the introduction of an MRSA into a hospital environment and the increased administration of antibiotics lead to rapid spread and persistence of MRSA types and increased patient colonisation (Peacock et al, 1980; Boyce 1989; Boyce et al., 1981; Locksley et al, 1982). However, selection for particular types in the clinical environment cannot be simply explained by antibiotic selection for the resistant types. RFLP analysis shows that in hospitals antibiotic sensitive S. aureus closely related to the MRSA types also exist. These isolates share the nucleotide sequences of the present invention invariably associated with the closely related MRSA types (ie. a clonal population). It is interesting that these related types have been dominant in Australian hospitals for more than a decade (El- Adhami, 1991; Stewart et al, 1993). Although other nonrelated MSSA types were identified to exist alongside the clonal types, the former were isolated from non-outbreak infections, and did not carry DNA sequences homologous to the nucleotide sequences of the invention. There is no evidence to indicate that these MSSAs were involved in severe infections, colonisation, or spread within the hospital environment. The epidemiological data available are insufficient to permit any conclusions about whether those unrelated types are community acquired or hospital acquired, or whether they cause milder infections than the types carrying the specific DNA.

EXAMPLE 13

Expression and purification of recombinant polypeptides encoded by ORFl and ORF2

The DNA sequences corresponding to ORFl and ORF2 and encoding the polypeptides set forth in SEQ ID NOs:2-3 are cloned into an expression plasmid of the pGEX series behind the C-terminus of Sj26, glutathione- S-transferase, to produce the expression plasmids pGEX-

ORF1 and pGEX-ORF2, respectively. Induction of the lac promoter of the expression plasmids results in high level expression of a fusion protein in each case.

Affinity chromatography of the fusion proteins on a glutathione-Sepharose column, followed by cleavage with thrombin, yields the free form of the polypeptides. Alternatively, elution from the column with glutathione yields the corresponding GST fusion proteins.

EXAMPLE 14

Antibody preparations

The recombinant fusion proteins produced in Example 13 and subsequently cleaved using thrombin are used to elicit antibodies in rabbits. Antigen preparations are formulated with 0, 10 or lOOμg protein in incomplete Freund's adjuvant (IF A; 1:1, oil:water). Animal hosts, preferably rabbits are injected intramuscularly (i/m) (1ml) into the left hind leg for the primary inoculation and 4 weeks later boosted with an i/m injection of the same preparation into the right hind leg.

If required, further injections are performed until high titre antibodies are obtained to the ORFl and ORF2 polypeptides.

EXAMPLE 15

Serology

Sera are collected from all animals before the primary inoculations and then at weekly intervals until 4 weeks post secondary inoculation. Sera are stored at -20 °C until assayed for antibodies using the enzyme immunoassay (EIA) described below. Pre-bleed sera from all animals are screened for antibodies to the polypeptides prior to the commencement of experiments and any animals demonstrating significant antibody levels thereto (i.e. EIA OD > 0.2 at 1/300 serum dilution) are excluded. For the EIA, thrombin cleaved protein, purified from the GST moiety, is bound to 96-well microtitre plates (Nunc Maxisorb) by incubating 0.2μg per well in lOOμl of 50mM carbonate buffer (pH 9.6) for 20hrs at 20°C. The plates are then post-coated (lhr at 20°C) with lOOμl per well of phosphate buffered saline (PBS: 0.9% w/v, pH 7.2) containing 1% (w/v) sodium casein. After 4 washes with phosphate buffered saline containing 0.05% (v/v) Tween 20 (PBST), lOOμl of serial dilutions of serum samples are added to the wells for lhr at 20^DC. The plates are then washed 4 times with PBST before the addition of lOOμl per well of a 1/1000 dilution of horseradish peroxidase conjugated anti-ORFl or anti- ORF2 polypeptide IgG in PBST for 1 hr at 20°C. Plates are washed 5 times with PBST and lOOμl of tetra-methyl benzidine (TMB) substrate (Bos et al, 1981) added to each well for 30min at 20°C before the reaction is stopped by the addition of 50μl of 0.5M H2SO4 per well and the absorbance read at 450nm.

EXAMPLE 16

Immunological detection of pathogenic Staphylococcus isolates

Soluble protein extracts obtained from several clonal pathogenic and commensal isolates of Staphylococcus aureus are screened by ELISA as described in Example 15, using antibodies derived from Example 14, which are capable of binding to the polypeptides encoded by ORFl (SEQ ID NO:2) and ORF2 (SEQ ID NO:3).

Significant EIA absorbances are only produced when protein isolated from a clonal pathogenic strain is used in ELISA reactions, indicating that the assay provides a successful diagnostic assay for clonal pathogenic S. aureus isolates. Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.

REFERENCES

1. Amabiel-Cuevas, C and Chicurel, M (1992). Cell 70: 189-199.

2. Archer, G and Mayhall, C (1983). Journal of Clinical Microbiology 18: 395-399.

3. Ausubel, F.M. et al (1987) In: Current Protocols in Molecular Biology, Wiley Interscience (ISBN 047140338).

4. Boyce J M (1989). Infect. Pis. Clin, N. Am. 3, 901-913.

5. Bovce. J. Landrv. T and DuPont H fl98lY Infections Control 2: 110-116.

6. Chou, P and Fasman, G (1978). Advances in Enzymology and Related Areas of Molecular Biology 47: 45-148.

7. Douillard and Hoffman (1981). Basic Facts about Hybridomas. In: Compendium of Immunology Vol II (ed. Schwarz)

8. Dubin DT, Chikramane SG, Inglis B, Matthews PR, Moon-McDermott L & Stewart PR (1992). Journal of General Microbiology. 138, 169-180.

9. El-Adhami W, Roberts L, Vickery A. Inglis B, Gibbs A & Stewart PR (1991). Journal of General Microbiology 137, 2713-2720.

5

10. Ewald, P (1993^s). Scientific American April: 56-62.

11. Ewald, P (1994). Evolution of Infectious Disease. Oxford University Press, New York.

10 12. Gamier, J, Osguthoφe, D and Robson, B (1978). Journal of Molecular Biology 120: 97-120.

13. Gillespie, M.T., Lyon, B.R., Loo, L.S.L., Matthews, P.R., Stewart, P.R. & Skunary, R.A. (1987). FEMS Microbiology letters 43. 165-171.

15

14. Heneine, N. & Stewart, P.R. (1986) Journal of Antimicrobial Chemotherapy 17, 705- 715.

15. Inglis, B., Matthews, P.R. & Stewart, P.R. (1990) Journal of General Microbiology 20 136, 2231-2239.

16. Jarvis, W.R. & Martone, WJ. (1992). Journal of Antimicrobial Chemotherapy 29 (Suppl. A): 19-24.

25 17. Kohler and Milstein (1975) Nature, 256: 495-499

18. Kohler and Milstein (1976) Eur. J. Immunology. 6: 511-519

19. Krawiec, S. & Riley, M. (1991). Microbiological Reviews 54, 502-539. 30 20. Kyte, J. and Doolittle, R. (1982)Journal of Molecular Biology 157: 105-132.

21. Lamar, E.E. & Palmer, E. (1984). Cell 37:171-177. 5

22. Locksley, R., Cohen, M., Quinn, T., Tompkins, L., Coyle, M., Kirihara, J.M. and Counts, G.W. (1982). Annals of Internal Medicine 97: 317-324.

23. Lyon, B., luorio, J., May, J. and Skurray, R. (1984). Journal of Medical Microbiology 10 17: 79-89.

24. Matthews, P.R., Reed, K.C. & Stewart, P.R. (1987). Journal of General Microbiology 133, 1919-1929.

15 25. Michel, J., Madoff, L, Olson, K, Kling, D, Kasper, D and Ausubel, F (1992). Proc. Natl Acad. Science (USA) 89: 10060-10064.

26. Musser, J.M. & Kapur, V. (1992). Journal of Clinical Microbiology 30, 2058-2063.

20 27. Musser, J.M. & Selander, R.K. (1990). Genetic analysis of natural populations of Streptococcus aureus. In Molecular Biology of the Staphylococci. pp. 59-67. Edited by R Novick. New York. VCH publishing.

28. Musser, J, Schlievert, P, Chow, A, Ewan, P, Kreiswirth, B, Rosdahl, VT, Naidu, AS, 25 Witte, W and Selander, RK (1990). Proc. Natl Acad. Science (USA) 87:225-229.

29. Noble, W.C. & White, M.I. (1983). Staphylococcal skin infection in man. In Staphylococci and Staphylococcal infections, vol. 1, pp. 165-191. Edited by CSF Easmon & C Adlam. Academic Press, London.

30 30. Novick, R.P. (1993). Streptococcus. In Bacillus subtilis and Other Gram-Positive Bacteria: Biochemistry, Physiology, and Molecular Genetics. Edited by AL Sonenshein, JA Hoch & R Losick. American society for Microbiology, Washington, DC.

5

31. Pattee, P. A. (1993). Genetic and physical map of Streptococcus aureus NUCTC 8325. In Genetic Maps, sixth edition, pp. 106-113. Edited by S.J. O'Brien. Cold Spring Harbor, New York.

10 32. Patel, A.H., Foster, TJ. & Pattee, P.A. (1989). Physical and genetic mapping of the protein A gene in the chromosome of Streptococcus aureus 8325-4. Journal of General Microbiology 135, 1799-1807.

33. Peacock, J., Marsik, F, and Wenzel, R. (1980). Methicillin-resistant Staphylococcus 15 aureus: introduction and spread within a hospital. Annals of Internal Medicine 93 :

526-532.

34. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Second Edition. Cold Spring Harbor Laboratory Press.

20

35. Schaberg, D.R., Culver, D.H. & Gaynes, R.P. (1991). Major trends in the microbial etiology of nosocomial infection. American Journal of Medicine. 91 (Suppl. 3B); 72- 75.

25 36. Signas, C. et al. (1989). Nucleotide sequence of the gene for a fibronectin-binding protein from Staphylococcus aureus: use of this peptide sequence in the synthesis of biologically active peptide. Proceedings of the National Academy of Science of the United States of America 86: 699-703.

30 37. Skinner, S., Inglis, B., Matthews, P.R. & Stewart, P.R. (1988). Mercury and tetracycline resistance genes and flanking repeats associated with methicillin resistance on the chromosome of Streptococcus aureus. Molecular Microbiology 2, 289-297.

5 38. Skurray, R.A., Lyon, B.R., Gillespie, M.T., Tennent, J.M., Byrne, M.E., Messerotti, LJ. & May, J.W. (1988). Multiresistant Streptococcus aureus: genetics and evolution of epidemic Australian strains. Antimicrobial Chemotherapy 21 (Suppl. C): 19-38.

10 39. Smith, J.M. (1991). Theories of Sexual Section. TREE 6 (5): 146-151.

40. Stewart, P.R., El-Adhami, W., Inglis, B. & Franklin, J.C. (1993). Analysis of an outbreak of variably methicillin-resistant Streptococcus aureus with chromosomal RFLPs and mec region probes. Journal of Medical Microbiology 38, 270-277.

15

41. Uhlen, M., Guss, B., Nilsson, B., Gatenbeck, S., Philipson, L. and Lindberg, M. (1984). Complete sequence of the staphylococcal gene encoding protein A. A gene evolved through multiple duplications. Journal of Biological Chemistry 259: 1695-1702.

20 42. Wada, K., Aota, S., Tsuchiya, R., Ishibashi, G., Gojobori, T. and Ikemura, T. (1990). Codon usage tabulated from the GenBank genetic sequence data. Nucleic Acids Research 18: 2367-2411.

43. Wang, X., Wilkinson, B. and Jayaswal, R. (1991). Sequence analysis of a 25 Staphylococcus aureus gene encoding a peptidoglycan hydrolase activity. Gene 102:

105-109.

44. Wren, B. (1991). A family of clostridial and streptococcal ligand-binding proteins with conserved C-terminal repeat sequences. Molecular Microbiology 5: 797-803.

30 SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: The Australian National University

(ii) TITLE OF INVENTION: Nucleic acid molecule and its uses in determining pathogenicity of Staphylococcus

(iii) NUMBER OF SEQUENCES: 10

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Davies Collison Cave, Patent Attorneys

(B) STREET: 1, Little Collins Street

(C) CITY: Melbourne

(D) STATE: Victoria

(E) COUNTRY: Australia

(F) ZIP: 3000

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentin Release #1.0, Version #1.25

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: PCT International

(B) FILING DATE: 13-JUN-1996

(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: AU PN3507/95

(B) FILING DATE: 13-JUN-1995

(viii) ATTORNEY/AGENT INFORMATION: (A) NAME: SLATTERY, JOHN M

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 61 3 9254 2777

(B) TELEFAX: 61 3 9254 2770

(2) INFORMATION FOR SEQ ID NO:l:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 3486 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS : single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Staphylococcus aureus

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 179..2650

(ix) FEATURE: (A) NAME/KEY: CDS

(B) LOCATION: 2880..3455

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

AAATGATGTC ATCTTAACTT ATGTTGCTTC AACTGGTAAA ATGAGAGCAG AATATGCTGG 60

TAAAACTTGG GAGACTTCAA TAACAGATTT AGGTTTATCT ACAAATCAGG CATATAATTT 120

CTTAATTACA TCTAGTCAAA GATGGGGCCT TAATCAAGGG ATAAATGCAA ATGGCTGG 178

ATG AGA ACT GAC TTG AAA GGT TCA GAG TTT ACT TTT ACA CCA GAA GCG 226 Met Arg Thr Asp Leu Lys Gly Ser Glu Phe Thr Phe Thr Pro Glu Ala 1 5 10 15

CCA AAA ACA ATA ACA GAA TTA GAA AAA AAA GTT GAA GAG ATT CCA TTC 274 Pro Lys Thr lie Thr Glu Leu Glu Lys Lys Val Glu Glu lie Pro Phe 20 25 30

AAG AAA GAA CGT AAA TTT AAT CCG GAT TTA GCA CCA GGG ACA GAA AAA 322 Lys Lys Glu Arg Lys Phe Asn Pro Asp Leu Ala Pro Gly Thr Glu Lys 35 40 45

GTA ACA AGA GAA GGA CCA AAA GGT GAG AAG ACA ATA ACG ACA CCA ACA 370 Val Thr Arg Glu Gly Pro Lys Gly Glu Lys Thr lie Thr Thr Pro Thr 50 55 60

CTA AAA AAT CCA TTA ACT GGA GTA ATT ATT AGT AAA GGT GAA CCA AAA 418 Leu Lys Asn Pro Leu Thr Gly Val lie lie Ser Lys Gly Glu Pro Lys 65 70 75 80

GAA GAG ATT ACA AAA GAT CCG ATT AAT GAA TTA ACA GAA TAC GGA CCT 466 Glu Glu lie Thr Lys Asp Pro lie Asn Glu Leu Thr Glu Tyr Gly Pro 85 90 95

GAA ACA ATA GCG CCA GGT CAT CGA GAC GAA TTT GAT CCG AAG TTA CCA 514 Glu Thr lie Ala Pro Gly His Arg Asp Glu Phe Asp Pro Lys Leu Pro 100 105 110

ACA GGA GAG AAA GAG GAA GTT CCA GGT AAA CCA GGA ATT AAG AAT CCA 562 Thr Gly Glu Lys Glu Glu Val Pro Gly Lys Pro Gly lie Lys Asn Pro 115 120 125

GAA ACA GGA GAC GTA GTT AGA CCA CCG GTC GAT AGC GTA ACA AAA TAT 610 Glu Thr Gly Asp Val Val Arg Pro Pro Val Asp Ser Val Thr Lys Tyr 130 135 140

GGA CCT GTA AAA GGA GAC TCG ATT GTA GAA AAA GAA GAG ATT CCA TTC 658 Gly Pro Val Lys Gly Asp Ser lie Val Glu Lys Glu Glu lie Pro Phe 145 150 155 160

GAG AAA GAA CGT AAA TTT AAT CCT GAT TTA GCA CCA GGG ACA GAA AAA 706 Glu Lys Glu Arg Lys Phe Asn Pro Asp Leu Ala Pro Gly Thr Glu Lys 165 170 175

GTA ACA AGA GAA GGA CAA AAA GGT GAG AAG ACA ATA ACG ACA CCA ACA 754 Val Thr Arg Glu Gly Gin Lys Gly Glu Lys Thr lie Thr Thr Pro Thr 180 185 190 CTA AAA AAT CCA TTA ACT GGA GAA ATT ATT AGT AAA GGT GAA TCG AAA 802 Leu Lys Asn Pro Leu Thr Gly Glu lie lie Ser Lys Gly Glu Ser Lys 195 200 205

GAA GAA ATC ACA AAA GAT CCG ATT AAT GAA TTA ACA GAA TAC GGA CCA 850 Glu Glu lie Thr Lys Asp Pro lie Asn Glu Leu Thr Glu Tyr Gly Pro 210 215 220

GAA ACG ATA ACA CCA GGT CAT CGA GAC GAA TTT GAT CCG AAG TTA CCA 898 Glu Thr lie Thr Pro Gly His Arg Asp Glu Phe Asp Pro Lys Leu Pro 225 230 235 240

ACA GGA GAG AAA GAG GAA GTT CCA GGT AAA CCA GGA ATT AAG AAT CCA 946 Thr Gly Glu Lys Glu Glu Val Pro Gly Lys Pro Gly lie Lys Asn Pro 245 250 255

GAA ACA GGA GAT GTA GTT AGA CCA CCG GTC GAT AGC GTA ACA AAA TAT 994 Glu Thr Gly Asp Val Val Arg Pro Pro Val Asp Ser Val Thr Lys Tyr 260 265 270

GGA CCT GTA AAA GGA GAC TCG ATT GTA GAA AAA GAA GAG ATT CCA TTC 1042 Gly Pro Val Lys Gly Asp Ser lie Val Glu Lys Glu Glu 'lie Pro Phe 275 280 285

GAG AAA GAA CGT AAA TTT AAT CCT GAT TTA GCA CCA GGG ACA GAA AAA 1090 Glu Lys Glu Arg Lys Phe Asn Pro Asp Leu Ala Pro Gly Thr Glu Lys 290 295 300

GTA ACA AGA GAA GGA CAA AAA GGT GAG AAG ACA ATA ACG ACA CCA ACA 1138 Val Thr Arg Glu Gly Gin Lys Gly Glu Lys Thr lie Thr Thr Pro Thr 305 310 315 320

CTA AAA AAT CCA TTA ACT GGA GTA ATT ATT AGT AAA GCT GAA CCA AAA 1186 Leu Lys Asn Pro Leu Thr Gly Val lie He Ser Lys Ala Glu Pro Lys 325 330 335

GAA GAA ATC ACA AAA GAT CCG ATT AAT GAA TTA CCA GAA TAC GGA CCA 1234 Glu Glu He Thr Lys Asp Pro He Asn Glu Leu Pro Glu Tyr Gly Pro 340 345 350

GAA ACG ATA ACA CCA GGT CAT CGA GAC GAA TTT GAT CCG AAG TTA CCA 1282 Glu Thr He Thr Pro Gly His Arg Asp Glu Phe Asp Pro Lys Leu Pro 355 360 365

ACA GGA GAG AAA GAA GAA GTT CCA GGT AAA CCA GGA ATT AAG AAT CCA 1330 Thr Gly Glu Lys Glu Glu Val Pro Gly Lys Pro Gly He Lys Asn Pro 370 375 380

GAA ACA GGA GAC GTA GTT AGA CCA CCG GTC GAT AGC GTA ACA AAA TAT 1378 Glu Thr Gly Asp Val Val Arg Pro Pro Val Asp Ser Val Thr Lys Tyr 385 390 395 400

GGA CCT GTA AAA GGA GAC TCG ATT GTA GAA AAA GAA GAG ATT CCA TTC 1426 Gly Pro Val Lys Gly Asp Ser He Val Glu Lys Glu Glu He Pro Phe 405 410 415

AAG AAA GAA CGT AAA TTT AAT CCG GAT TTA GCA CCA GGG ACA GAA AAA 1474 Lys Lys Glu Arg Lys Phe Asn Pro Asp Leu Ala Pro Gly Thr Glu Lys 420 425 430 GTA ACA AGA GAA GGC CAA AAA GGT GAG AAG ACA ATA CCG ACG CCA ACA 1522 Val Thr Arg Glu Gly Gin Lys Gly Glu Lys Thr He Pro Thr Pro Thr 435 440 445

CTA AAA AAT CCA TTA ACT GGA GAA ATT ATT AGT AAA GGT GAA TCG AAA 1570 Leu Lys Asn. ro Leu Thr Gly Glu He He Ser Lys Gly Glu Ser Lys 450 455 460

GAA GAA ATC ACA AAA GAT CCG ATT AAT GAA TTA ACA GAA TAC GGA CCA 1618 Glu Glu He Thr Lys Asp Pro He Asn Glu Leu Thr Glu Tyr Gly Pro 465 470 475 480

GAA ACG ATA ACA CCA GGT CAT CGA GAC GAA TTT GAT CCG AAG TTA CCA 1666 Glu Thr He Thr Pro Gly His Arg Asp Glu Phe Asp Pro Lys Leu Pro 485 490 495

ACA GGA GAG AAA GAG GAA GTT CCA GGT AAA CCA GGA ATT AAG AAT CCA 1714 Thr Gly Glu Lys Glu Glu Val Pro Gly Lys Pro Gly He Lys Asn Pro 500 505 510

GAA ACA GGA GAC GTA GTT AGA CCA CCG GTC GAT AGC GTA CAA AAA TAT 1762 Glu Thr Gly Asp Val Val Arg Pro Pro Val Asp Ser Val -Gin Lys Tyr 515 520 525

GGA CCT GTA AAA GGA GAC TCG ATT GTA GAA AAA GAA GAA ATT CCA TTC 1810 Gly Pro Val Lys Gly Asp Ser He Val Glu Lys Glu Glu He Pro Phe 530 535 540

AAG AAA GAA CGT AAA TTT AAT CCT GAT TTA GCA CCA GGG ACA GAA AAA 1858 Lys Lys Glu Arg Lys Phe Asn Pro Asp Leu Ala Pro Gly Thr Glu Lys 545 550 555 560

GTA ACA AGA GAA GGA CAA AAA GGT GAG AAG ACA ATA ACG ACG CCA ACA 1906 Val Thr Arg Glu Gly Gin Lys Gly Glu Lys Thr He Thr Thr Pro Thr 565 570 575

CTA AAA AAT CCA TTA ACT GGA GAA ATT ATT AGT AAA GGT GAA TCG AAA 1954 Leu Lys Asn Pro Leu Thr Gly Glu He He Ser Lys Gly Glu Ser Lys 580 585 590

GAA CAA ATC ACA AAA GAT CCG ATT AAT GAA TTA ACA GAA TAC GGA CCA 2002 Glu Gin He Thr Lys Asp Pro He Asn Glu Leu Thr Glu Tyr Gly Pro 595 600 605

GAA ACG ATA ACA CCA GGT CAT CGA GAC GAA TTT GAT CCG AAG TTA CCA 2050 Glu Thr He Thr Pro Gly His Arg Asp Glu Phe Asp Pro Lys Leu Pro 610 615 620

ACA GGA GAG AAA GAG GAA GTT CCA GGT AAA CCA GGA ATT AAG AAT CCA 2098 Thr Gly Glu Lys Glu Glu Val Pro Gly Lys Pro Gly He Lys Asn Pro 625 630 635 640

GAA ACA GGA GAT GTA GTT AGA CCA CCG GTC GAT AGC GTA ACA AAA TAT 2146 Glu Thr Gly Asp Val Val Arg Pro Pro Val Asp Ser Val Thr Lys Tyr 645 650 655

GGA CCT GTA AAA GGA GAC TCG ATT GTA GAA AAA GAA GAA ATT CCA TTC 2194 Gly Pro Val Lys Gly Asp Ser He Val Glu Lys Glu Glu He Pro Phe 660 665 670 GAG AAA GAA CGT AAA TTT AAT CCT GAT TTA GCA CCA GGG ACA GAA AAA 2242 Glu Lys Glu Arg Lys Phe Asn Pro Asp Leu Ala Pro Gly Thr Glu Lys 675 680 685

GTA ACA AGA GAA GGA CAA AAA GGT GAG AAG ACA ATA ACG ACG CCA ACA 2290 Val Thr Arg Glu Gly Gin Lys Gly Glu Lys Thr He Thr Thr Pro Thr 690 695 700

CTA AAA AAT CCA TTA ACT GGA GAA ATT ATT AGT AAA GGT GAA TCG AAA 2338 Leu Lys Asn Pro Leu Thr Gly Glu He He Ser Lys Gly Glu Ser Lys 705 710 715 720

GAA GAA ATC ACA AAA GAT CCG ATT AAT GAA TTA ACA GAA TAC GGA CCA 2386 Glu Glu He Thr Lys Asp Pro He Asn Glu Leu Thr Glu Tyr Gly Pro 725 730 735

GAA ACG ATA ACA CCA CGT CAT CGA GAC GAA TTT GAT CCG AAG TTA CCA 2434 Glu Thr He Thr Pro Arg His Arg Asp Glu Phe Asp Pro Lys Leu Pro 740 745 750

ACA GGA GAG AAA GAG GAA GTT CCA GGT AAA CCA GGA ATT AAG AAT CCA 2482 Thr Gly Glu Lys Glu Glu Val Pro Gly Lys Pro Gly He- Lys Asn Pro 755 760 765

GAA ACA GGA GAT GTA GTT AGA CCA CCG GTC GAT AGC GTA ACA AAA TAT 2530 Glu Thr Gly Asp Val Val Arg Pro Pro Val Asp Ser Val Thr Lys Tyr 770 775 780

GGA CCT GTA AAA GGA GAC TCG ATT GTA GAA AAA GAA GAA ATT CCA TTC 2578 Gly Pro Val Lys Gly Asp Ser He Val Glu Lys Glu Glu He Pro Phe 785 790 795 800

GAG AAA GAA CGT AAA TTT AAT CCT GAT TTA GCA CCA GGG ACA GAA AAA 2626 Glu Lys Glu Arg Lys Phe Asn Pro Asp Leu Ala Pro Gly Thr Glu Lys 805 810 815

GTA ACA AGA GAA GGA CAA AAT TGG TGAGAAGACA ATAACGACGC CAACACTAAA 2680 Val Thr Arg Glu Gly Gin Asn Trp 820

AAATCCATTA ACTGGAGAAA TTATTAGTAA AGGTGATTCG AAAGAAGAAA TCACAAAAGA 2740

TCCAGTTAAT GAATTAACAG AATTCGGTGG CGAGAAAATA CCGCAAGGTC ATAAAGATAT 2800

CTTTGATCCA AACTTACCAA CAGATCAAAC GGAAAAAGTT CCAGGTAAAC CAGGAATCAA 2860

GAATCCAGAC ACAGGAAAA GTG ATC GAA GAG CCA GTG GAT GAT GTG ATT AAA 2912

Val He Glu Glu Pro Val Asp Asp Val He Lys 1 5 10

CAC GGA CCA AAA ACG GGT ACA CCA GAA ACA AAA ACA GTA GAG ATA CCG 2960 His Gly Pro Lys Thr Gly Thr Pro Glu Thr Lys Thr Val Glu He Pro 15 20 25

TTT GAA ACA AAA CGT GAG TTT AAT CCA AAA TTA CAA CCT GGT GAA GAG 3008 Phe Glu Thr Lys Arg Glu Phe Asn Pro Lys Leu Gin Pro Gly Glu Glu 30 35 40

CGA GTG AAA CAA GAA GGA CAA CCA GGA AGT AAG ACA ATC ACA ACA CCA 3056 Arg Val Lys Gin Glu Gly Gin Pro Gly Ser Lys Thr He Thr Thr Pro 45 50 55 ATC ACA GTG AAC CCA TTA ACA GGT GAA AAA GTT GGC GAG GGT CAA CCA 3104 He Thr Val Asn Pro Leu Thr Gly Glu Lys Val Gly Glu Gly Gin Pro 60 65 70 75

ACA GAA GAG ATC ACA AAA CAA CCA GTA GAT AAG ATT GTT GAG TTC GGT 3152 Thr Glu Glu He Thr Lys Gin Pro Val Asp Lys He Val Glu Phe Gly 80 85 90

GGA GAG AAA CCA AAA GAT CCA AAA GGA CCT GAA AAC CCA GAG AAG CCG 3200 Gly Glu Lys Pro Lys Asp Pro Lys Gly Pro Glu Asn Pro Glu Lys Pro 95 100 105

AGC AGA CCA ACT CAT CCA AGT GGC CCA GTA AAT CCT AAC AAT CCA GGA 3248 Ser Arg Pro Thr His Pro Ser Gly Pro Val Asn Pro Asn Asn Pro Gly 110 115 120

TTA TCG AAA GAC AGA GCA AAA CCA AAT GGC CCA GTT CAT TCA ATG GAT 3296 Leu Ser Lys Asp Arg Ala Lys Pro Asn Gly Pro Val His Ser Met Asp 125 130 135

AAA AAT GAT AAA GTT AAA AAA TCT AAA ATT GCT AAA GAA TCA GTA GCT 3344 Lys Asn Asp Lys Val Lys Lys Ser Lys He Ala Lys Glu' Ser Val Ala 140 145 150 155

AAT CAA GAG AAA AAA CGA GCA GAA TTA CCA AAA ACA GGT TTA GAA AGC 3392 Asn Gin Glu Lys Lys Arg Ala Glu Leu Pro Lys Thr Gly Leu Glu Ser 160 165 170

ACG CAA AAA GGT TTG GTC TTT AGT AGT ATT TAT TGG AAT TGC TGG ATT 3440 Thr Gin Lys Gly Leu Val Phe Ser Ser He Tyr Trp Asn Cys Trp He 175 180 185

AAT GTT ATT GGC TCG TAGAAGAAAG AATTAAAATA ATTCATAATT T 3486

Asn Val He Gly Ser 190

(2) INFORMATION FOR SEQ ID N0:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 824 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

Met Arg Thr Asp Leu Lys Gly Ser Glu Phe Thr Phe Thr Pro Glu Ala 1 5 10 15

Pro Lys Thr He Thr Glu Leu Glu Lys Lys Val Glu Glu He Pro Phe 20 25 30

Lys Lys Glu Arg Lys Phe Asn Pro Asp Leu Ala Pro Gly Thr Glu Lys 35 40 45

Val Thr Arg Glu Gly Pro Lys Gly Glu Lys Thr He Thr Thr Pro Thr 50 55 60

Leu Lys Asn Pro Leu Thr Gly Val He He Ser Lys Gly Glu Pro Lys 65 70 75 80 Glu Glu He Thr Lys Asp Pro He Asn Glu Leu Thr Glu Tyr Gly Pro 85 90 95

Glu Thr He Ala Pro Gly His Arg Asp Glu Phe Asp Pro Lys Leu Pro 100 105 110

Thr Gly Glu Lys Glu Glu Val Pro Gly Lys Pro Gly He Lys Asn Pro 115 120 125

Glu Thr Gly Asp Val Val Arg Pro Pro Val Asp Ser Val Thr Lys Tyr 130 135 140

Gly Pro Val Lys Gly Asp Ser He Val Glu Lys Glu Glu He Pro Phe 145 150 155 160

Glu Lys Glu Arg Lys Phe Asn Pro Asp Leu Ala Pro Gly Thr Glu Lys 165 170 175

Val Thr Arg Glu Gly Gin Lys Gly Glu Lys Thr He Thr Thr Pro Thr 180 185 190

Leu Lys Asn Pro Leu Thr Gly Glu He He Ser Lys Gly'Glu Ser Lys 195 200 205

Glu Glu He Thr Lys Asp Pro He Asn Glu Leu Thr Glu Tyr Gly Pro 210 215 220

Glu Thr He Thr Pro Gly His Arg Asp Glu Phe Asp Pro Lys Leu Pro 225 230 235 240

Thr Gly Glu Lys Glu Glu Val Pro Gly Lys Pro Gly He Lys Asn Pro 245 250 255

Glu Thr Gly Asp Val Val Arg Pro Pro Val Asp Ser Val Thr Lys Tyr 260 265 270

Gly Pro Val Lys Gly Asp Ser He Val Glu Lys Glu Glu He Pro Phe 275 280 285

Glu Lys Glu Arg Lys Phe Asn Pro Asp Leu Ala Pro Gly Thr Glu Lys 290 295 300

Val Thr Arg Glu Gly Gin Lys Gly Glu Lys Thr He Thr Thr Pro Thr 305 310 315 320

Leu Lys Asn Pro Leu Thr Gly Val He He Ser Lys Ala Glu Pro Lys 325 330 335

Glu Glu He Thr Lys Asp Pro He Asn Glu Leu Pro Glu Tyr Gly Pro 340 345 350

Glu Thr He Thr Pro Gly His Arg Asp Glu Phe Asp Pro Lys Leu Pro 355 360 365

Thr Gly Glu Lys Glu Glu Val Pro Gly Lys Pro Gly He Lys Asn Pro 370 375 380

Glu Thr Gly Asp Val Val Arg Pro Pro Val Asp Ser Val Thr Lys Tyr 385 390 395 400

Gly Pro Val Lys Gly Asp Ser He Val Glu Lys Glu Glu He Pro Phe 405 410 415 Lys Lys Glu Arg Lys Phe Asn Pro Asp Leu Ala Pro Gly Thr Glu Lys 420 425 430

Val Thr Arg Glu Gly Gin Lys Gly Glu Lys Thr He Pro Thr Pro Thr 435 440 445

Leu Lys Asn Pro Leu Thr Gly Glu He He Ser Lys Gly Glu Ser Lys 450 455 460

Glu Glu He Thr Lys Asp Pro He Asn Glu Leu Thr Glu Tyr Gly Pro 465 470 475 480

Glu Thr He Thr Pro Gly His Arg Asp Glu Phe Asp Pro Lys Leu Pro 485 490 495

Thr Gly Glu Lys Glu Glu Val Pro Gly Lys Pro Gly He Lys Asn Pro 500 505 510

Glu Thr Gly Asp Val Val Arg Pro Pro Val Asp Ser Val Gin Lys Tyr 515 520 525

Gly Pro Val Lys Gly Asp Ser He Val Glu Lys Glu Glu' He Pro Phe 530 535 540

Lys Lys Glu Arg Lys Phe Asn Pro Asp Leu Ala Pro Gly Thr Glu Lys 545 550 555 560

Val Thr Arg Glu Gly Gin Lys Gly Glu Lys Thr He Thr Thr Pro Thr 565 570 575

Leu Lys Asn Pro Leu Thr Gly Glu He He Ser Lys Gly Glu Ser Lys 580 585 590

Glu Gin He Thr Lys Asp Pro He Asn Glu Leu Thr Glu Tyr Gly Pro 595 600 605

Glu Thr He Thr Pro Gly His Arg Asp Glu Phe Asp Pro Lys Leu Pro 610 615 620

Thr Gly Glu Lys Glu Glu Val Pro Gly Lys Pro Gly He Lys Asn Pro 625 630 635 640

Glu Thr Gly Asp Val Val Arg Pro Pro Val Asp Ser Val Thr Lys Tyr 645 650 655

Gly Pro Val Lys Gly Asp Ser He Val Glu Lys Glu Glu He Pro Phe 660 665 670

Glu Lys Glu Arg Lys Phe Asn Pro Asp Leu Ala Pro Gly Thr Glu Lys 675 680 685

Val Thr Arg Glu Gly Gin Lys Gly Glu Lys Thr He Thr Thr Pro Thr 690 695 700

Leu Lys Asn Pro Leu Thr Gly Glu He He Ser Lys Gly Glu Ser Lys 705 710 715 720

Glu Glu He Thr Lys Asp Pro He Asn Glu Leu Thr Glu Tyr Gly Pro 725 730 735

Glu Thr He Thr Pro Arg His Arg Asp Glu Phe Asp Pro Lys Leu Pro 740 745 750 Thr Gly Glu Lys Glu Glu Val Pro Gly Lys Pro Gly He Lys Asn Pro 755 760 765

Glu Thr Gly Asp Val Val Arg Pro Pro Val Asp Ser Val Thr Lys Tyr 770 775 780

Gly Pro Val Lys Gly Asp Ser He Val Glu Lys Glu Glu He Pro Phe 785 790 795 800

Glu Lys Glu Arg Lys Phe Asn Pro Asp Leu Ala Pro Gly Thr Glu Lys 805 810 815

Val Thr Arg Glu Gly Gin Asn Trp 820

(2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 192 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

Val He Glu Glu Pro Val Asp Asp Val He Lys His Gly Pro Lys Thr 1 5 10 15

Gly Thr Pro Glu Thr Lys Thr Val Glu He Pro Phe Glu Thr Lys Arg 20 25 30

Glu Phe Asn Pro Lys Leu Gin Pro Gly Glu Glu Arg Val Lys Gin Glu 35 40 45

Gly Gin Pro Gly Ser Lys Thr He Thr Thr Pro He Thr Val Asn Pro 50 55 60

Leu Thr Gly Glu Lys Val Gly Glu Gly Gin Pro Thr Glu Glu He Thr 65 70 75 80

Lys Gin Pro Val Asp Lys He Val Glu Phe Gly Gly Glu Lys Pro Lys 85 90 95

Asp Pro Lys Gly Pro Glu Asn Pro Glu Lys Pro Ser Arg Pro Thr His 100 105 110

Pro Ser Gly Pro Val Asn Pro Asn Asn Pro Gly Leu Ser Lys Asp Arg 115 120 125

Ala Lys Pro Asn Gly Pro Val His Ser Met Asp Lys Asn Asp Lys Val 130 135 140

Lys Lys Ser Lys He Ala Lys Glu Ser Val Ala Asn Gin Glu Lys Lys 145 150 155 160

Arg Ala Glu Leu Pro Lys Thr Gly Leu Glu Ser Thr Gin Lys Gly Leu 165 170 175

Val Phe Ser Ser He Tyr Trp Asn Cys Trp He Asn Val He Gly Ser 180 185 190 (2) INFORMATION FOR SEQ ID N0:4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 40 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS : single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: CGATAGCGTA ACAAAATATG GACCTGTAAA AGGAGACTCG 40

(2) INFORMATION FOR SEQ ID NO:5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: CGATAGCGTA ACAAAATATG GACC 24

(2) INFORMATION FOR SEQ ID NO: 6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: CGAGTCTCCT TTTACAGGTC CATA 24

(2) INFORMATION FOR SEQ ID NO:7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 23 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: GCGTCGTTAT TGTCTTCTCA CCT

23

(2) INFORMATION FOR SEQ ID NO:8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 23 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: AGGTGAGAAG ACAATAACGA CGC 23

(2) INFORMATION FOR SEQ ID NO:9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: CAGGAGAGAA AGAGGAAGTT CCAG 24

(2) INFORMATION FOR SEQ ID NO: 10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: CTGGAACTTC CTCTTTCTCT CCTG 24

Claims

CLAIMS:

1. An isolated nucleic acid molecule which is indicative of a pathogenic Staphylococcus aureus, wherein said nucleic acid molecule is obtainable from a pathogemc S. aureus and present at a high frequency as hereinbefore defined in pathogemc isolates of S. aureus.

2. The isolated nucleic acid molecule of claim 1, further characterised as being either not present or present at a low frequency as hereinbefore defined in commensal isolates of S. aureus.

3. The isolated nucleic acid molecule of claim 2, further comprising at least one copy of the nucleotide sequence set forth in SEQ ID NO:4 or a complementary sequence, homologue, analogue or derivative thereof.

4. The isolated nucleic acid molecule of claim 3, wherein the number of copies of the nucleotide sequence set forth in SEQ ID NO:4 is at least two.

5. The isolated nucleic acid molecule of claim 4, wherein the number of copies of the nucleotide sequence set forth in SEQ ID NO:4 is at least four.

6. The isolated nucleic acid molecule of claim 5, wherein the number of copies of the nucleotide sequence set forth in SEQ ID NO:4 is at least six.

7. The isolated nucleic acid molecule of claim 6, further comprising a sequence of nucleotides which is at least 40% identical to the sequence set forth in SEQ ID NO: l or a complementary sequence, homologue, analogue or derivative thereof.

8. The isolated nucleic acid molecule of claim 7, wherein the percentage identity to SEQ ID NO: l is at least 50%.

9. The isolated nucleic acid molecule of claim 8, wherein the percentage identity to SEQ ID NO: l is at least 60-65%.

10. The isolated nucleic acid molecule of claim 9, wherein the percentage identity to SEQ 5 ID NO: 1 is at least 70-75 % .

11. The isolated nucleic acid molecule of claim 10, wherein the percentage identity to SEQ ID NO: l is at least 80-90%.

10 12. The isolated nucleic acid molecule of claim 11, wherein said nucleic acid molecule comprises a sequence identical to SEQ ID NO:l or a complementary sequence or homologue, analogue or derivative thereof.

13. An isolated nucleic acid molecule which is indicative of infection of a host organism, 15 tissue or cell or a medical implement by a pathogemc S. aureus strain, wherein said nucleic acid molecule is:

(i) present at a high frequency as hereinbefore defined in pathogenic isolates of S. aureus and either not present or present at a low frequency as hereinbefore defined in commensal isolates of S. aureus; and 20 (ii) comprises at least one copy of the sequence set forth in SEQ ID NO:4 or a complementary sequence, homologue, analogue or derivative thereof.

14. The isolated nucleic acid molecule of claim 13, wherein the number of copies of the nucleotide sequence set forth in SEQ ID NO:4 is at least two.

25

15. The isolated nucleic acid molecule of claim 14, wherein the number of copies of the nucleotide sequence set forth in SEQ ID NO: 4 is at least four.

16. The isolated nucleic acid molecule of claim 15, wherein the number of copies of the 30 nucleotide sequence set forth in SEQ ID NO:4 is at least six.

17. The isolated nucleic acid molecule of claim 16, further comprising a sequence of nucleotides which is at least 40% identical to the sequence set forth in SEQ ID NO: l or a complementary sequence, homologue, analogue or derivative thereof.

5 18. The isolated nucleic acid molecule of claim 17, wherein the percentage identity to SEQ ID NO:l is at least 50%.

19. The isolated nucleic acid molecule of claim 18, wherein the percentage identity to SEQ ID NO:l is at least 60-65%.

10

20. The isolated nucleic acid molecule of claim 19, wherein the percentage identity to SEQ ID NO: 1 is at least 70-75 % .

21. The isolated nucleic acid molecule of claim 20, wherein the percentage identity to 15 SEQ ID NO: l is at least 80-90%.

22. The isolated nucleic acid molecule of claim 21, wherein said nucleic acid molecule comprises a sequence identical to SEQ ID NO: 1 or a complementary sequence or homologue, analogue or derivative thereof.

20

23. The isolated nucleic acid molecule of any one of claims 12 to 22, wherein the host organism, tissue or cell is a mammal or a mammalian tissue or cell which is a usual host for S. aureus.

25 24. The isolated nucleic acid molecule of claim 23, wherein the mammal is a human or the mammalian tissue or cell is of human origin.

25. The isolated nucleic acid molecule of claim 23 wherein the mammal is a domestic or livestock animal. 30

26. An isolated nucleic acid molecule which is capable of hybridising under at least low stringency conditions as hereinbefore defined to at least 20 contiguous nucleotides contained within SEQ ID NO: l or a complementary strand, homologue or analogue thereof.

5 27. The isolated nucleic acid molecule of claim 26, wherein said nucleic acid molecule is obtained from a S. aureus and is present at a high frequency as hereinbefore defined in pathogenic isolates of S. aureus.

28. The isolated nucleic acid molecule of claim 27, wherein said nucleic acid molecule is 10 present at a low frequency in commensal isolates of S. aureus.

29. An isolated nucleic acid molecule which comprises a nucleotide sequence which encodes or is complementary to a nucleotide sequence which encodes at least one surface protein or surface-like protein as hereinbefore defined of a pathogenic S. aureus strain.

15

30. The isolated nucleic acid molecule of claim 29, wherein the surface protein or surface¬ like protein comprises a sequence of amino acids is substantially as set forth in any one of SEQ ID NO:2 or SEQ ID NO:3 or is at least 40% identical thereto.

20 31. A method of identifying a nucleic acid molecule from Staphylococcus aureus which is indicative of a pathogenic S. aureus strain, said method comprising contacting genomic DNA, mRNA, cDNA derived from said S. aureus or a part or fragment thereof or a source thereof with a hybridisation effective amount of the nucleotide sequence set forth in SEQ ID NO: 1 or a complementary sequence or a homologue, analogue or derivative thereof and then

25 detecting said hybridisation.

32. The method of claim 31, wherein the nucleotide sequence further comprises a sequence substantially as set forth in any one of SEQ ID Nos: 4- 10 or is at least 40% identical thereto. 30

33. A method of identifying a nucleic acid molecule from Staphylococcus aureus which is indicative of a patfiogenic S. aureus strain, said method comprising hybridising under at least low stringency conditions one or more nucleic acid primer molecules comprising at least 10 contiguous nucleotides in length derivable from SEQ ID No: l or a complementary

5 sequence thereof to a nucleic acid template molecule derived from a pathogenic S. aureus and amplifying copies of said template or a part or fragment thereof in a polymerase chain reaction.

34. The method of claim 33 wherein any one or more primer molecules is substantially 10 the same as any one of SEQ ID Nos:4-10 or a complementary sequence or a homologue, analogue or derivative thereof.

35. A method of determining whether a Staphylococcus strain is pathogenic, said method comprising contacting a sample containing nucleic acid from said strain with a nucleic acid

15 probe comprising at least 10 contiguous nucleotides derived from SEQ ID NO: l or its complement or a homologue, analogue or derivative thereof under at least low stringency hybridisation conditions and for a time sufficient to allow for hybridisation between the nucleic acid in the sample and the probe to occur and then detecting said hybridisation.

20 36. The method according to claim 35, wherein the probe further comprises a sequence of nucleotides set forth in any one of SEQ ID Nos:4-10.

37. The method according to claim 35 or 36, wherein the sample is a biological sample.

25 38. The method according to claim 37 wherein the biological sample is derived from a wound site, blood cell, bodily fluid such as, but not limited to, sputum, lung fluid, urine or vaginal exudate, faeces, an epidermal cell, bone tissue or joint tissue.

39. The method according to claim 35 or 36 or 37 wherein the sample is obtained from 30 a medical implement as hereinbefore defined.

40. A genetic construct which comprises an isolated nucleic acid molecule according to any one or more of claims 1 to 30.

41. The genetic construct according to claim 40, wherein the isolated nucleic acid 5 molecule is placed operably in connection with a promoter sequence capable of modulating its expression.

42. The genetic construct according to claim 41 wherein the promoter is capable of modulating expression in a prokaryotic cell.

10

43. The genetic construct according to claim 41 wherein the prokaryotic cell is a bacterial cell.

44. The genetic construct according to claim 41 or 42 or 43 wherein the promoter is the 15 tac promoter sequence.

45. A recombinant gene product which comprises at least one surface protein or surface¬ like protein as hereinbefore defined of a pathogenic strain of Staphylococcus aureus.

20 46. The recombinant gene product according to claim 45 wherein said gene product is present at a high frequency in pathogenic strains of S. aureus and at a low frequency in commensal isolates of S. aureus.

Al. A recombinant gene comprising a sequence of amino acids identical to or contained 25 within SEQ ID NO:2 or a homologue, analogue or derivative which is at least 40% identical thereto.

48. A recombinant gene product comprising a sequence of amino acids identical to or contained within SEQ ID NO: 3 or a homologue, analogue or derivative which is at least 40% 30 identical thereto.

49. An antibody molecule which is capable of binding to a recombinant gene product according to any one of claims 45 to 48.

50. The antibody molecule according to claim 49 when used in an immunoassay to detect 5 a pathogenic strain of S. aureus in a biological sample, said immunoassay comprising contacting the antibody with the biological sample for a time and under conditions sufficient for an antigen: antibody complex to form and then detecting said complex formation.

51. A vaccine for Staphylococcus comprising an immunogenically effective amount of a 10 recombinant gene product according to any one of claims 45 to 48 or part or derivative thereof together with a pharmaceutically acceptable carrier or diluent.

52. A kit for the rapid and convenient detection of a pathogenic Staphylococcus aureus in a biological sample comprising:

15 (i) one or more first containers adapted to contain a recombinant gene product according to any one of claims 45 to 48 or a part or derivative thereof; and (ii)one or more second containers adapted to contain an antibody which recognises said polypeptide,

20 53. The kit according to claim 52 wherein said antibody is labelled with a reporter molecule capable of producing a detectable signal.

54. The kit according to claim 53 wherein the reporter molecule is an enzyme.

25 55. The kit according to claim 52 further comprising one or more third containers which contain a second antibody which recognises the first antibody and is conjugated to a reporter molecule.

56. The kit according to claim 55 wherein the reporter molecule is an enzyme. 30

57. The kit according to claim 54 or 56 further comprising one or more additional containers comprising a substrate molecule for said enzyme to facilitate detection of the enzyme when bound to a polypeptide: antibody complex, or to a polypeptide: antibody: antibody complex.

58. A kit for the rapid detection of a pathogenic Staphylococcus aureus in a biological sample, said kit comprising in a first compartment one or more nucleic acid molecules which encode, or are complementary to a nucleic acid molecule according to any one of claims 1 to 30.