WO1996040199A9 - Methods of inhibiting phagocytosis - Google Patents

Abstract

The present invention relates, in general, to methods of treating diseases resulting from interactions between immune complexes and Fc receptors. In particular, the present invention relates to methods of modulating the clearance of antibody-coated cells from the circulation by inhibiting phagocytosis and to methods of modulating the interaction of immune complexes with tissue Fc receptors. Further, the invention relates to methods of modulating the activation of immunological processes mediate by Fc receptor activation resulting from antibody-antigen/receptor interaction.

Description

METHODS OF INHIBITING PHAGOCYTOSIS

This is a contmuation-m-part of Application No. 08/483,530, filed June 7, 1995, which is a continuation-m-part of Application No. 08/316,425, filed Septemoer 30, 1994, which is a contmuation-m-part cf Application No. 08/129,381, filed September 30, 1993, the contents of which are incorporated herein by reference.

TECHNICAL FIELD

The present invention relates, in general, to methods of treating diseases resulting from interactions between immune complexes and Fc receptors. In particular, the present invention relates to methods of modulating the clearance of antiooαy-coated cells, viruses, or soluiole antigens by inhibiting phagocytosis, and to methods cf modulating tne interaction of immune complexes witn cellular or tissue Fc receptors The invention also relates to tne modulation of those immune reactions for whicn the reaction of antigen-antibody complexes with Fc receptors is an important initiating step.

BACKGROUND OF THE INVENTION

Certain immunological disorders are characterized by a disturbance in the expression of monocyte or or m combination with more conventional drug therapies .

SUMMARY OF THE INVENTION

It is a general object of the invention to provide a method of modulating the clearance of antibody-coated cells or immune complexes, for example, by inhibiting the pnagocytic potential of cells tearing Fc receptors

It is a specific oD ecz of the invention to provide metnods of regulating the clearance of immune complexes from a mammal. In addition, it is a specific object of the invention to provide a method of inhibiting the binding cf immune complexes to membrane-bound Fc receptors (and/or inhibiting ingestion of such complexes) , thereoy inhibiting tne sequelae of undesirable tissue damage

It is a further oo ect of the invention to provide constructs and compounds suitable for use in the above-described metnods.

In one embodiment, the present invention relates to a method of preventing the phagocytosis of immune complexes (eg IgG-containing immune complexes) ano/or the release of intracellular biologically active products by cells interacting with immune complexes An example of the present method comprises introducing into phagocytic cells of the mammal that are in contact with the immune complexes (eg, IgG-containmg immune complexes) an inhibitor of a kinase endogenous to the represented by systemic lupus erythematosus and rheumatoid arthritis. In these diseases, chronic inflammation is present m the joints, tendons, kidneys, lung, heart and other organs. In rheumatoid arthritis, for example, breakdown of joint cartilage into the synovial fluid of the joint is present in later stages of the disease. In systemic lupus erythematosus, however, cartilage or bone degradation is not usually found Systemic lupus erythematosus and rheumatoid artnπtis are often present in conjunction with other types of autoimmune disease. In systemic lupus erythematosus and rheumatoid arthritis, tissue destruction is associated with the presence of IgG-containmg complexes m the circulation It is believed that recognition of these complexes in tissues by cells having Fc receptors initiates or increases tissue destruction by macrophages and possibly other cells sucn as polymorphonuclear leukocytes m these tissues. Reaction with tnese Fc receptors initiates a range of immune-associated reactions that may harm oody tissues m proximity to these Fc receptor bearing cells .

Diseases that involve tne interaction of IgG-containmg immune complexes with macrophage Fc receptors are often treated with corticosteroids, or immunosuppressants . These treatments can have diverse and serious side effects. The present invention offers alternative treatment approaches that can be used alone complementary to endogenous mRNA encoding the Fc receptor, and iii) a termination sequence (polyadenylation signal) functional in the cell. The construct is introduced under conditions such that the complementary strand is transcribed and binds to the endogenous mRNA thereby reducing expression of the Fc receptor and inhibiting the phagocytic potential of the cell. Furtner oojects and advantages of the present invention will be clear from the description tnat follows. It will be appreciated that the disclosure should be read m light of the teachings available m the art relating to the isolation and cloning of tne three classes of FCY receptors (FcγRI, FcyRII and Fcy RIII) (see, for example, Allen and Seed, Science 243:378 (1989) ; Hibbs et al, Proc. Natl. Acad. Sci. USA 85:2240 (1988) ; J. Exp. Med. 166:1668 (1987) ; van de Winkle et al , FASEB J., 5:A964 (1991; , BΓOOKΞ et al , J. Exp. Med. 170:369 (1989) ; Stuart et al, EMBO J. 8:3657 (1989) ; Qui et al , Science 248:732 (1990) ; Simmons and Seed, Nature 333:568 (1988) ; see also, Schreiber et al, Clin. Immunol. Immunopath. 62:S66 (1992) .

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows a schematic representation of

FcγRIIIA γ wild type and mutants. Shown above the schematic diagram of the γ chain are signal sequence cells that activates an Fc receptor present at the membrane of the cells.

In another emocdiment, the present invention relates to a method of preventing the clearance of immune complexes (eg, IgG-containing immune complexes) from a mammal that comprises introducing into hematopoietic cells (eg phagocytic cells) of the mammal that are m contact witn the immune complexes a molecule that specifically prevents Fc receptor expression at tne memorane of tne cells.

In a further e oooiment, the present invention relates to a method of inhibiting the binding of immune complexes (eg, IgG-containmg immune complexes) present in a mammal to membrane-bound Fc receptors. The me nod comprises introducing into the mammal a soluole Fc receptor that competes with the memtrane-bound Fc receptor for binding to the immune complex. The introduction is effected under conditions sucn that binding of the immune complex to the membrane-bound Fc receptor is inhibited.

In yet another embodiment, the present invention relates to a method of inhibiting tne phagocytic potential of a mammalian cell bearing an Fc receptor The method comprises introducing mto the cell a construct comprising, in the 5 '-3' direction cf transcription: i) a promoter functional the cell, n) a segment of double-stranded DNA the transcribed strand of which comprises a sequence 8 containing α and y (M2A) . (G) and (H) : transfectants containing α and y (DMA; . No phagocytosis of EA is seen in D, F and H. Pictures show images magnified by lOOOx.

Figure 3 shows tyrosine phosphorylation of the wild type and mutant γ chains by in vi tro kinase assay. The γ chain was immunoprecipitated with anti-γ antisera from lysates of COS-1 transfectants. In vi tro pnospnorylated samples were run on a 12.5% reducing SDS-PAGE gel. The gel was treated with IN KOH to remove phosphoseπne and threonine, dried and the autoradiogram was examined after 4 days. lane 1: Sham transfectants with FcyR IIA- and pSVL vector without y cDNA insert. lanes 2: FcγRIIIA α + wild type numan γ. lane 3: FcγRIIIA - wild type mouse γ. lane 4: FcyRIIIA α + MIA. lane 5: FcγRIIIA α + M2A. lane 6: FcyRIIIA + DMA. The phosphorylated γ chains are denoted by an arrow (snown on tne lower right side! . The arrow with an asterisk (shown on the upper right side) is a specific tyrosine phosphoprotein band at approximately 40 kDa.

Figures 4A-4D are a Ca mobilization following FcγRIIIA stimulation. Measurement of [Ca ]ι m individual cells was carried out during crosslinking of FcyRIIIA. The time points when anti-FcγRIII mAb, ep ephrine (positive control) and calcium lonophore were added are denoted by arrows each figure. (S) , external peptides (E) , transmembrane domain (TM) , and cytoplasmic domain (CY) . The expanded area shows an area of the nucleotide sequence of the γ chain containing the conserved motif. In this Figure, the murine γ chain is shown. The conserved am o acids of the gene family of the γ and ζ chain genes are denoted by the underline. The N-proximal tyrosine encoded by the TAC codon of tne nucleotides 235-237 (Ra et al , J. Biol . Chem. 264:15323 (1989) ) was conservatively replaced with a pnenyialamne encoded by TTC (clones MIA and MIB) . Similarly, the C-proximal tyrosine encoded by TAT (168-270) was replaced with a phenylalanine encoded by TTT (clones M2A and M2B) . For the double tyros e-substitution mutants, both the N- and C-proximal tyrosmes were replaced with phenylalanine (clones DMA and DMB) . Solid lines of the mutants represent identical sequences to that of the wild type γ gene.

Figures 2A and 2B snow binding and phagocytosis of IgG-sensitized RBCs (EA) by transfected COS-1 cells. Bmdmg of EA by transfected COS-1 cells (left panel: A, C, E and G) . Phagocytosis of EA by transfected COS-l cells (right panel; B, D, F, and H) . (A) and (B) . binding and phagocytosis of COS-l cells transfected with FcyRIIIA o. and wild type γ. Three of the phagocytosed RBCs shown with wild type γ are marked by arrows in Figure (B) , (C) and (D) : transfectants containing α and γ (MIA) . (E) and (F) : transfectants 10

Circled nucleotides in the three staggered frames are the common sequence of target III with minimum secondary structures .

Figure 6 shows secondary structure of the stem-loop Syk antisense ODN. The stem domain of the 7 nucleotide length is formed by complementary terminal sequence with nucleotide content of only G and C m the 5' and 3' termini. The loop domain consists of three antisense sequences; the 5 ' -CTGTCAGCCATGCCG-3 ' sequence shown with squares is complementary to target I in Syk mRNA (see Figure 5) , the 5 ' -GCTTCTTGAGGAG-3 ' sequence shown in triangles is complementary to target II, and the 5 ' -TGTCTTGTCTTTGTC-3 ' sequence shown with circles is complementary to target III which is also denoted with circles in Figure 5. The three different antisense sequences were tandemly joined the 5' to 3' order for targets I, III, and II, respectively. #S indicates the phosphorothioate modification, the 5-prime terminus has one phosphorothioate modification and the 3-prime terminus has two.

Images were acquired at either 340 or 380 nm excitation (emission = 510 nm) . 340/380 ratios were converted to [Ca ] i based on calibration with Fura-2. The responses of MIA, M2A and DMA transfectants were greatly decreased compared to WT transfectants .

Figure 5 shows selection of a target sequence (target III) for the stem-loop antisense ODN. The entire Syk mRNA sequence was scanned three times with a RNA secondary structure prediction program to find sequences free cf secondary structures. Each scanning was performed 33 bases apart in a 99-nucleotide frame (denoted as frames A, B, and C) sequentially. The most open sequence in three staggered scannings was chosen as a target sequence. The top rectangle with dots represents cDNA sequence of human Syk mRNA (Law et al, J. Biol . Chem . 269:12310 (1994) ; . The three target sites for the stem-loop Syk antisense ODN are shown above the Syk mRNA sequence line as three short solid lines, denoted I, II, and III. Target sites I, II and III correspond to nucleotides no. 159 to 173 (the area surrounding the translation initiation codon) , no. 451 to 463 and no. 802 to 816, respectively. Target III is shown as an example in this Figure. Targets I and II were chosen in the same manner. Putative secondary structures in the area of Syk mRNA containing the target III sequence are shown in the three staggered frames of 99 nts each, frame A, frame B, and frame C. 12

Figure 10. Inhibition of Syk kinase expression in RBL-2H3 cells by stem-loop rat Syk antisense oligonucleotides (ODN) . A. Examination of Syk expression by RT-PCR using rat Syk primers. Lane 1, cells treated with Syk antisense ODN: Lane 2, cells treated Syk sense ODN; lane 3, reagent control; Lane 4, no treatment; Lane 5, molecular weight markers.

B. Examination of β-actin expression by RT-PCR using rat β-actin primers. Lane 1, cells treated with Syk antisense ODN; Lane 2, cells treated with Syk sense ODN; Lane 3, reagent control; Lane 4, no treatment; Lane 5, molecular weight markers. -=β-actin.

C. Examination of FceRI y chain expression by RT-PCR using γ chain primers in rat Syk anisense ODN treated RBL-2H3 cells. Lane 1, cells treated with Syk antisense ODN; Lane 2, cells treated with Syk sense ODN; Lane 3, reagent control; Lane 4, no treatment; Lane 5, molecular weight markers. -=y chain.

Figure 11. Structure of human Syk/ZAP-70 chimeras .

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates, at least in part, to methods of 'modulating the clearance from a mammal (eg, from the circulation of a mammal) of antibody-coated cells. Accordingly, the invention provides methods of treating immunologic disorders, Figure 7 shows inhibition of Syk antisense ODNs on phagocytosis in monocytes. Monocytes (1 x 10^s cells/ml) were incubated with complexes of 4 μg/ml of LIPOFECTAMINE and ODNs (1.0 μM each of the linear control or the linear Syk antisense ODNs, or 0.2 μM each of the stem-loop control or the stem-loop Syk antisense ODN) for 2 days, and the phagocytosis of IgG-sensitizεd red blood cells (EA) was examined. Phagocytic index (PI) = number of ingested RBCs/100 cells. Each bar represents the mean ± SEM of three separate experiments .

Figure 8. Effect of Syk antisense ODNs on Syk mRNA m monocytes. Total RNA was isolated from monocytes (1 x IO⁵ cells/ml) treated with complexes of 4 μg/ml of LIPOFECTAMINE and the ODNs (1.0 μM each of the linear control or the linear Syk antisense ODN, or 0.2 μM each of the stem-loop control or the stem-loop Syk antisense ODN) for 2 days, and cDNA was synthesized from total RNA with random hexanucleotide primers. PCR was performed with Syk cDNA as templates with two Syk primers (Syk-H and Syk-M) . PCR products were analyzed by Southern hybridization and hybridized bands were visualized by chemiluminescent detection reagents.

Figure 9. Comparison of rat and human Syk antisense. 14 also provides a method of inhibiting expression of Fc receptors by introducing into receptor-producing cells Fc receptor antisense constructs. The invention also provides methods of degrading Fc receptor RNA using, for example, ribozymes.

Inhibition of Fc Receptor Mediated Siσnal Transduction Events:

In one embodiment , the present invention relates to a method of preventing ingestion (eg phagocytosis) of immune complexes (eg IgG-coated cells) by inhibiting phosphorylation of core sequences within the cytoplasmic domain of Fc receptors. Phosphorylation of cytoplasmic residues of FcγRIIA and the γ subunit of FcγRIIIA has been shown to be essential for signal transduction events involved in phagocytosis (Indik et al, Trans. Ass. Amer. Phys. 105:214 (1992) ; Park et al, Clin. Res. 41:324A (1993) ; Darby et al, Blood 79:352A (1992) ; Mitchell et al, Clin. Res. 41:189A (1993) ; Huang et al , J. Biol. Chem. 267:5467 (1992) ; Hunter et al, Clin. Res. 41:244A (1993) ; Park et al, J. Clin. Invest. 92:2073 (1993) ) . More specifically, phosphorylation of tyrosine residues present within the motif E-X8-D-X2-Y-X2-L-X12-Y-X2-L. present in the cytoplasmic domain of FcyRIIA, and the motif D/E-X2.7-D/E-Y-X2-L-X7-Y-X2-L. present in the cytoplasmic domains of the y and ζ chains of FcRIIIA, is required for phagocytic signal transduction (the such as autoimmune diseases, characterized by interactions of immune complexes (eg, IgG-containmg immune complexes) with Fc receptors (for example, those present on the surface of macrophages) , and immune mediated diseases such as asthma. The methods of the invention result in Fc receptor expression and/or function being altered so that phagocytosis of IgG antibody-coated cells is reduced. (One skilled tne art will appreciate that patients suffering from immune complex diseases such as lupus erythematosus and rheumatoid artnritis may benefit from protocols designed so as to increase clearance of circulating immune complexes the liver and spleen and thereby prevent their deposition in tissues such as the kidney and in the joints. This increase can be effected by stimulating liver and splenic macrophages using protocols for introducing sequences encoding Fc receptors described in tne commonly owned application entitled "Methods of Stimulating Phagocytosis" filed concurrently herewith, the entire disclosure of which is incorporated herein by reference.)

More specifically, the mvention provides methods of inhibiting Fc receptor function by inhibiting the phosphorylation of Fc receptor components and associated molecules that are required for phagocytic signal transduction and by introducing into the circulation soluble Fc receptors that compete with the membrane bound receptor for immune complex (eg, IgG-containmg immune complex) binding. The invention 16

The peptide inhibitor of the invention, or mimetic thereof, can be introduced into target cells directly, for example, using liposomes. (See also approaches descriDed in Science 26.1877 (1993) for administration of peptides modified so as to render them capable of crossing cellular lipid membranes.) Alternatively, a DNA sequence encoding the peptide inhibitor can be introduced using gene therapy protocols so that the peptide is produced intracellularly. The inhibitor or inhibitor encodmg sequence can be administered to the cells of the lung, mcludmg macrophages, m the form of an aerosol. The inhibitor or inhibitor encodmg sequence can be present in the aerosol as a particle (e.g. liposome, or non-infectious bacteria, for example, Listeria. m the case of tne encodmg sequence) that is phagocytosed by the pulmonary macrophages. Phagocytosis results m the introduction into tne macrophages cf the inhibitor or inhibitor encodmg sequence. Viral vectors can also oe used to introduce the peptide inhibitor encodmg sequence of the invention into cells of the pulmonary tree. The vectors can be introduced as an aerosol and can take the form of a replication defective herpes or adenoviral vector. Retroviral vectors can also be used. (See, generally, Ba occhi et al, Nat. Genet. 3:229 (1993) ; Lemarchand et al, Circ . Res., 72:1132 (1993) ; Ram et al, Cancer Res. 53:83 (1993) ; Crystal, Am. J. Med. 92:445 (1992) ; Yoshimura et al, Nucl. Acids Res. 20:3233 (1992) ; Morecki et al , Cancer Immunol. numbers following the letter X denote the number of amino acids at that position; X can be any amino acid but X2 within a Y-X2-L is preferably the amino acids present in a Y-X2-L sequence of the cytoplasmic domain of FcyRIIA or the y chain of FcγRIII) . It appears that the second Y-X2-L of these core sequences (motifs) is particularly important for phagocytosis. The present invention contemplates the introduction into target cells of an inhibitor of the kinase (s) responsible for phosphorylation. In a specific embodiment, the inhibitor is a peptide that includes a sequence similar to, if not identical to, at least a functional portion of a tyrosme-contair.ing motif (note, for example, the underlined portions of the motifs set forth above) and thus serves as a competitive inhibitor of the kinase (s) . As an example, the inhibitor can take the form of an Fc receptor devoid of the extracellular domain or devoid of the extracellular and transmembrane domams. Alternatively, the inhibitor can be structurally distinct from the above motifs, or functional portions thereof, and can inhibit phosphorylation competitively or non-competitively (eg, a mimetic of the active peptide can be used having a structural conformation similar to the binding site of the active peptide) . For mast cells, or other Fee receptor bearing cells (eg macrophages) , the sequences of the γ chain of FceRI necessary for mediator release (eg, histamine, cytokines and leukotrienes) can be inhibited using this strategy. 18 sequences (eg, RNA splicing and 5' untranslated sequences for which they were specific, for example, in FcyRIIA RNA or FcyRIIIA γ chain RNA) and the enzymatic activity associated with the ribozyme would result in digestion and thus removal of the RNA specifying functional sequences of the receptor necessary for phagocytic signal transduction. RNA sequences specifying the sequences of the y chain of FceRI necessary for mediator release (eg, histamine, cytokines and leukotrienes) can be eliminated using this strategy.

Where advantageous, continuous in vivo production of the ribozyme can be effected using ex vivo constructed packaging cells (eg, Psi2-like cells,- see Miller and Rosman, Biotechniques 7:980, 1989 and

Current Protocols in Molecular Biology 111:9.1, 1992 (Supp. 17) ) . One skilled in the art will appreciate that a suicide gene can be included in such a cell so that ribozyme production can be terminated. A further approach to inhibiting receptor phosphorylation involves the use of a ribozyme or an antisense construct that targets Syk encoding sequences (see Example V) . The Syk gene product, but not the gene product of ZAP-70 of the Syk kinase family, has been shown to stimulate FcyRI and FcγRIIIA phagocytosis mediated by both the γ and ξ chains. (ZAP-70 in the presence of certain Src related tyrosine kinases can stimulate FcyRI and FcγRIIIA phagocytosis.) Thus, by targeting Syk sequences, inhibition of Syk expression Immunother. 32:342 (1991) ; Culver et al , Hum. Gene Ther. 1:399 (1990) ; Culver et al, Transplant. Proc, 23 :170 (1991) . )

Blood monocytes can be transformed (infected) ex vivo with the peptide inhibitor encoding sequence of the invention and then remtroduced mto the patient so that the inhibitor is produced n vi vo .

An alternative approach to inhibiting phosphorylation involves the use of ribozymes that recognize RNA sequences specifying Fc receptor phosphorylation sites (eg, m FcyRIIA and/or m the γ subunit of FcγRIIIA) , as well as RNA sequences specifying enzyme active sites. Introduction of the ribozyme can be effected using a carrier such as a liposome coated with IgG so as to direct insertion to Fcy receptor bearing cells. Alternatively, IgE-coated liposomes can be used to direct the ribozyme to mast cells or basopniles, or other cells bearing the IgE receptor FceRI with its associated v suounit . One skilled the art will appreciate tnat this is an approach suitable for use in treating allergic disorders. The γ subunit of the IgE receptor is responsible for transmitting the signal inducing the release of intracellular mediators by Fee receptor bearing cells such as mast cells. The destruction of the γ chain RNA is predicted to inhibit the release of these bioactive products.

In accordance with the above approach, ribozymes administered as described would bind to a few selected 20 between the second SH2 domain and the catalytic (kinase) domain has been replaced with the interval region of ZAP-70. This chimera acts like ZAP-70. Similarly, a ZAP-70 mutant has been constructed m which the interval region of ZAP-70 has been replaced with the interval region of Syk kinase This chimera acts like Syk kinase These experiments with chimeras of Syk and ZAP-70 indicate that the sequences in the interval region between the second SH2 domain and the catalytic (kinase) domain are responsible for the ability of Syk to mteract with Fcy receptor signaling. (See Park and Schreiber, Proc Natl Acad. Sci USA 92:7381 (1995) and references cited therein for region/domain description) Chimeras were produced using overlap PCR using wild type Syk and ZAP-70 )

The identification of the interval sequence of Syk kinase as being responsible for signal transduction events, including those involved in phagocytosis, makes possible a screen that can be used to test compounds (eg peptides or mimetics) for their ability to selectively inhibit sucn events. For example, a test compound can be contacted with a polypeptide comprising the Syk interval region, or portion thereof of at least 3, 5 or 7 amino acids or larger portions, for example, of at least 20, 50 or 100 amino acids (eg a chimera comprising the ZAP-70 SH2 and kinase domains and the Syk interval sequence) , and a polypeptide comprising the ZAP-70 interval region (eg a chimera comprising the Syk SH2 and kinase domams and the ZAP-70 interval and dependent phosphorylation can be effected. Constructs and ribozymes suitable for use in this method can be readily selected by one skilled in the art (see Yagi et al, Biochem. Biophys. Res. Comm. 200:28 (1994) , Law et al, J. Biol. Chem. 269:12310 (1994) for Syk gene sequence) .

Chimeras of Syk and ZAP-70 have been used to determine the sequence responsible for differences in signaling between Syk and ZAP-70. A ZAP-70 mutant in which the ZAP-70 SH2 domains and the ZAP-70 interval region between the second SH2 domain and the catalytic domain have been replaced with the Syk SH2 domains and interval region (Figure 11) . The studies indicate that this chimera acts like Syk in that it enhances the Fcy receptor mediated phagocytic signaling. In parallel, a Syk kinase mutant has been constructed in which the Syk SH2 domains and the Syk interval region have been replaced with the ZAP-70 SH2 domains and interval region. This chimera acts like ZAP-70 in that it does not increase Fcy receptor mediated signaling (COS-l cell transfectants and phagocytic signaling are one readout) . Further chimeras of Syk and ZAP-70 have been produced. A Syk mutant has been constructed in which the SH₂ domain has been replaced with the SH2 domain of ZAP-70. This chimera acts like Syk kinase. Similarly, a ZAP-70 mutant has been constructed in which the SH2 domain has been replaced with the SH2 domain of Syk kinase. This chimera acts like ZAP-70. A Syk mutant has been constructed in which the interval region 22 using techniques descriDed herein. Optimum dosmg can be readily determmed. The Syk interval sequence (eg between the second SH2 domain and the catalytic (kinase; domain] (eg purified or isolated form) or portion thereof of at least 5 or 6 ammo acids, cr mimetics thereof, are withm the scope of the mvention and can be formulated and used as descπoed above.

As discussed below, the present mvention a so contemplates the use of Syk antisense constructs to hiDit mediator leg n stamme release from cells bearing an Fes receptor, such as mast cells (see Example VI) Inhibition of histamine (a mast cell mediator) release, for example, is of therapeutic importance in tne treatment of asthma Preferred targets of Syk antisense constructs are describeα below (see also Examples V and VI) The constructs can be administered systemically or directly to the lung (eg aerosol administration) Delivery can be effected usmg tne techniques described herein 'including liposome formulations) Optimum dos g will depend cn the patient, and the construct and mode of administration used.

Soluble Fc Receptors :

In a further embodiment, the present invention relates to a method of inhibiting the interaction between immune complexes (eg, IgG-containmg immune complexes) and membrane-associated Fc receptors and sequence) . Compounds that bind the former polypeptide but not the latter are putative selective inhibitors of signaling events mediated by Syk interval sequences (including phagocytosis and mediator release from mast cells and other Fee receptor bearing cells) . Such compounds can also be tested by introducing mto Syk- deficient, potentially phagocytic cells (eg Fcy receptor bearing cells, including COS cells bearing an Fcy receptor) a construct encoding a polypeptide comprising the Syk interval sequence (eg a construct encodmg the chimera described above) , contacting that cell with the test compound and assaying for the ability of the cell to carry out phagocytosis; phagocytosis being a readout for signaling by Syk kinase. Compounds that inhibit phagocytosis can be expected to inhibit other signaling events mediated by Syk interval region sequences. Compounds that inhibit the phagocytic potential of the cells expressing the Syk interval region can then be tested for stability, toxicity, etc in accordance w th standard protocols.

This approach can also be used to screen for compounds (eg peptides or mimetics) that inhibit mast cell, or other Fee receptor bearing cell, mediator release (eg histamine release) . Peptides and mimetics identified using the above- described screen, or otherwise identified, can be formulated as pharmaceutical compositions and administered, for example, systemically or directly to the lung (eg via an aerosol) . Delivery can be effected 24 the α and y chams of FcyRIII, the first designation indicating the source of the extracellular domain and the second the source of the cytoplasmic domain: 1:1, I, IIA, IIA IIA, I:IIA, α:γ, α, α:IIA, I:γ Soluble receptors, depending on their nature, can be prepared chemically or recombinantly (Horton et al, Biotechniques 8:528 (1990) ) . The soluble receptors can be administered systemically or to the lung as described aoove connection with inhibitors of receptor phosphorylation When m vivo synthesis of soluble receptors from sequences encoding same is to be effected, such sequences are inserted mto appropriate vectors (see above; and operably linked to regulatory sequences functional m the target cell.

Antisense Constructs:

In a further embodiment, the present invention relates to a method of inhibiting Fc receptor expression in mammalian host cells by introducing into such cells an antisense construct comprising, m the 5 ' -3 ' direction of transcription: i) a promoter functional in the cells, ii) a segment of double-stranded DNA, the transcribed strand of which includes a sequence complementary to the endogenous mRNA of the Fc receptor the expression of which is to be inhibited, and m) a termination sequence functional «ιn the host cells. This embodiment of the invention makes it possible to regulate the expression thereby suppressing the clearance of such complexes by phagocytosis (alternatively, the signalling through the Fc receptor resultmg in the release of intracellular mediators) . The method involves introducing mto the circulation a soluble form of the Fc receptor that competes with the memorane bound form for immune complex binding. Transcripts of certam soluble forms have oeen identified cells of megakaryocytic and monocyte/myeloid lineages (Rappaport et al , Exp. Hemotol . 21:689 (1993; ; Warmerdam et al , J. Exp. Med. 172:19 (1990) ; . These transcripts lacκ sequences coding for tne transmembrane receptor region but retain sequences coding for the cytoplasmic domain. The present mvention contemplates the production and use of soluble Fc receptors that include an extracellular domain alone cr in combination with a cytoplasmic domain. Suitable receptors are capable of competing with membrane dound Fc receptors for bmdmg of IgG-coated cells. Soluble receptors of the invention can take the form of FcyRI, FcyRII or FcγRIII extracellular domains alone or bmdmg portions thereof (alternatively, a soluble receptor of FceRI can be employed taking the form of an extracellular domain alone or bmdmg portion thereof) . As noted above, cytoplasmic domains, or portions thereof, can also be present. The following are examples of possible soluble receptors where the "I" and "IIA" correspond to FcyRI and FcyRIIA, respectively, and where o. and y correspond to 26 structures that provide better access for antisense oligonucleotides, the entire Syk mRNA sequence was scanned witn an RNA secondary-structure predication program. Sy mRNA was scanned in three staggered frames, and the most "open" sequences with minimum secondary structures were chosen. Stem-loop antisense oligonucleotide reduced the phogocytic signal more dramatically than a mixture of three Imear antisense oligonucleotides. The higher efficacy of the stem-loop Syk antisense oligonucleotide may ce cue to better stability from nuclease digestion. Third, Syk antisense oligonucleotides were also complexed, for example, with cationic liposomes, to improve delivery to the cells. The stablility of the stem-loop Syk antisense oligonucleotides markedly improved wnen complexed w th liposomes. A stem-loop antisense oligonucleotide directed at, for example, the FcyRIIIA γ subunit mRNA has also be used. With the use of peripheral blood monocytes and the stem-loop v-cnain antisense oligonucleotide, the monocyte γ-cham message, assessed by RT-PCR, was decreased by >80% Liposomes can be delivered to the reticuloendothelial system, for which monocytes/macrophages are a major residential cell population. The complex of liposome- stem-loop Syk antisense oligonucleotide is advantageous for use as a therapeutic agent (s) for lmmunologic disorders requiring down-regulation of Fcy receptor- mediated function m monocytes/macrophages. Syk kinase is also associated with FceRI and with the B-cell of a specific Fc receptor cells producmg multiple receptor classes. Th s specificity can be achieved by selectmg for inclusion in the DNA segment (di) above) sequences unique to the mRNA of the endogenous Fc receptor.

As indicated above, the invention also relates to antisense constructs that target Syk kinase encodmg seσuences . In such constructs, di) above is a segment of double-stranded DNA, the transcribed strand cf which includes a sequence complementary to endogeneous mRNA of Syk kinase

Factors that affect the efficacy of antisense oligonucleotides include stability of the antisense oligonucleotides, their delivery into the cell cytoplasm, and their accessibility to the target mRNA. Syk antisense oligonucleotides of the present invention are modified three steps to address these issues. First, phospnodiester links at the 5' or 3 ' terminus, preferably both, are modified, for example, witn phosphorothioates. Second, a stem-loop structure is used to protect the antisense sequence in the loop domam from nucleases . The stem has complementary terminal sequences, for example, with only Gs and Cs . The loop domain has, for example, three antisense sequences targeting different sites of Syk mRNA. mRNA forms secondary structures by mtramoleculear hybridization, and mRNA secondary structures may inhibit access of antisense oligonucleotides to target sequences. To identify sequences with "open" 28 known in the art, including those described above (see also Example V - there, linear and stem-loop Syk antisense oligonucleotides (ODNs) modified with phosphorothioate show partial resistance to serum nucleases. When complexed with liposomes, antisense ODNs with phosphorothioate modifications at 5' and 3' termini are even more stable. Stem-loop Syk antisense ODN with phosphorothioate modifications exhibit exceptional stability in serum) . In addition tc the above approaches for inhibiting phagocytosis, the present invention also relates to a method of effecting inhibition by introducing into a cell having phagocytic potential FcγRIIB (eg FcγRIIB2) , which is capable of inhibiting the function of Fcγ receptors, including FcγRIIA (Hunter et al , FASEB J. June 1996, New Orleans, LA) . Introduction of FcγRIIB can be effected by transfecting/infecting a target cell with a construct comprising a sequence encoding FcyRIIB, or portion thereof that effects the inhibition (Brooks et ai, J. Exp. Med. 170:1369 (1989) ; Indik et al , Blood 83:2072 (1994) ) . Suitable constructs can be selected by one skilled in the art.

The following non-limiting Examples describe certain aspects of the invention in greater detail.

EXAMPLE I

Production of Recombinant Soluble FcγRII I antigen receptor. The stem-loop Syk antisense oligonucleotide is also useful for investigating intracellular signaling events through these receptors and for developing therapeutic agents to modulate the signals mediated by these receptors.

In accordance with the antisense embodiment of the present invention, the sequence complementary to the endogenous mRNA target is at least 15 nucleotides in length, preferably, at least 30 and, most preferably, at least 50. The sequence is typically less than 5000 nucleotides in length, preferably less than 2000, and most preferably less than 1000. The sequence can be complementary to a translated or untranslated region of the target mRNA (see, for example, McKenzie et al , Molec. Immunol. 29:1165 (1992) , Matsuda et al , Mol.

Biol. Cell 7: in press, July (1996) ) . Both the length of the antisense sequence and the mRNA site to which it binds can vary depending on the nature of the antisense sequence, the mRNA site and the degree of inhibition sought. Optimization of these parameters can be effected without undue experimentation.

Appropriate regulatory sequences and vectors can be selected from those known in the ar . Administration of the antisense construct, for example, to the lung and to the spleen, can be carried out as described above using both in vivo and ex vivo transformation protocols. One skilled in the art will appreciate that the antisense transcript itself can be introduced directly into the target cells using methods 3 0 EXAMPLE II

Function of Soluble FcγRIII

The functions of soluble FcγRIII proteins are assessed both in vi tro and in vivo . The effect of soluble Fc receptors on IgG-immune complex binding to cellular membrane-bound receptors depends on several factors including the local concentrations cf the ligand and soluble receptor, the surface density cf the membrane-bound receptor, the valence of the ligand and the relative affinities cf the two receptor forms for ligand. The limiting factors in the interaction cf soluble FcγRIII receptors with ligand and cellular membranes can be deciphered using available model systems . The m vi tro assay systems rely on the competition of soluble receptors with cell memdrane receptors for labeled IgG ligand and IgG-coated erythrocytes (EA) . Fcγ receptor-negative cells are transfected with transmembrane FcγRIII molecules that retain the functional capacity to bind and ingest IgG-containing immune complexes and antibody-coated cells (Ruiz and Schreiber, J. Clin. Invest. 88:149 (1991)) . These assays are used to examine the function of soluble receptors and the ability of soluble receptors to interfere with membrane receptor detection of both EA and oligomeric forms of IgG. The function of soluble FcγRIII is also examined in vivo . In these studies, an Recombinant soluble FcyRIII proteins can be produced using expression vectors as described below. The soluble protein can correspond to FcγRIII with the transmembrane domain removed. The constructs can be introduced into mammalian cells under conditions such that expression of the receptor encoding sequence occurs . The recombinant proteins thus produced are isolated both from the cell lysates and from the supernatants .

Transfection of adherent cells or cells in suspension: Transfection of adherent cells, eg, CHO cells or COS cells, or an appropriate suspension cell system will be performed. Permanent transfectants expressing soluble forms of Fcγ receptor will be established by eiectroporation, calcium phosphate or other established methods. Transfected cells will be allowed to grow 48 hours and selected media containing Geneticin at 2 mg/ml (Gibco BRL, Gaithersburg, Maryland) or other selection drug. After approximately twelve weeks, positive colonies will be isolated and expanded for further characterization of the clones. The isolated dlones will be examined by enzyme-linked immunoassay (ELISA) using ELISA plates (Dynatech, Alexandria, Virginia) to select a transfectant cell line expression the highest quantity of the soluble receptor. Mass culture of adherent transfectants will be achieved by employing the hollow-fiber tissue culture system. 32 tyrosine residue followed by the substitution of the C- erminal tyrosine residue. Six clones from each mutant were isolated and subjected to DNA sequencing. Two clones from each tyrosine substitution were randomly selected for further studies from several clones with correct DNA sequence.

Transient transfec ion : FcγRIIIA isoforms, FcγRIIIA-γγ, FcγRIIIA- ζζ, were generated by cotrans ection of COS-l cells with cDNA of y or ζ as well as cDNA of α. Transfections of cDNAs were carried out with a modified DΞAE-Dextran method. Briefly, 300,000 COS-l cells were seeded on 35 mm well plates 24 hours prior to transfection. Plates of 70 to 80 % confluence were washed twice and incubated for 30 mmutes with Dulbeco' s Modification of Eagle's Medium (DMEM, Gibco BRL, Grand Island, NY) before transfection. Four μg of plasmid DNA (0.5 μg/μl) was slowly added to 1 ml of a transfection buffer containing Nu medium (DMEM with 10 % of NuSerum [Collaborative Biomedical, Two Oak Park, Bedford, MA] , 1 mg/ml of DΞAE Dextran and 100 μM chloroquine. The transfection buffer contammg DNA was added to COS-l cells with incubation for 4 hours at 37°C. Cells were then shocked with 10% DMSO in phosphate buffered salme (PBS) for 2 minutes, washed twice with DMEM and grown in NuSerum supplemented DMEM. Cells were studied 48 hours following transfection. established experimental animal model is used to study whether soluble FcγRIII administered in vivo alters the clearance of antibody coated cells (Ruiz and Schreiber, J. Clin. Invest. 88:149 (1991)) . The immunoregulatory potential of soluble FcγRIII is examined in this manner.

EXAMPLE III

Cytoplasmic Tyrosine Residues Required For Phagocytic Signal Mediation

Experimental Protocols :

Plasmid construction and in troduction of poin t mu tations :

The pSVL eucaryotic expression vector (Pharmacia LKB, Piscataway, NJ) was employed for expression of FcyRIIIA in COS-l cells. huFcγRIIIA cDNA was cloned into the Xbal and BamHl cloning sites of pSV . Similarly, muFcyRIIIA γ cDNA was cloned into Xhol and BamHl cloning sites. TCR/FcγRIIIA ζ was cloned into the Xbal and BamHl cloning sites of pSVL. Conservative replacement of cytoplasmic tyrosines of the y chain by phenylalanine was achieved using the two step overlap-extension polymerase chain reaction (PCR) (Horton et al , Biotechniques 8:528 (1990)) . Double tyrosine substitution mutants were constructed sequentially by the substitution of the N-terminal 34 solutions, and phagocytosis (ingested EA) was determined by light microscopy. Results obtained were analyzed by Student's T-test.

In vi tro kinase assay:

₇ Transfected cells (2 X 10 cells) were washed once with

PBS and incubated sequentially on ice with 5 μg/ml each of anti-FcyRIII mAb and goat anti-mouse IgG for 10 minutes. Cells were washed once with PBS and incubated at room temperature for 3 minutes before adding 1.5 ml of lysis buffer (150 M NaCl. 25 mM Hepes [pH 7.4] and 1% polyoxyethylene IC cleyl ether [BRIJ-96; Sigma, St. Louis, MO] ) containing phosphatase and protease inhibitors . Inhibitors of phosphatases and proteases (ImM EGTA, 1 mM Na orthovanadate, 1 mM PMSF, 10 μg/ml aprotinin, 50 μg/mi leupeptin, and 100 μg/ml soybean trypsin inhibitor) were added fresn to lysis buffer. After 15 minutes of lysis on ice, cell lysates were centrifuged for 30 mmutes at 4°C to clarify. The FcγRIIIA-γ chain was immunoprecipitated with anti-human Y antiserum (provided by Jean-Pierre Kinet , NIAID-NIH, Rockville, MD) and Protein A-sepharose CL4B (Signa, St. Louis, MO) in lysis buffer. Pellets were washed three times in lysis buffer and once in low salt buffer (100 mM NaCl, 25 mM Hepes, pH 7.4 and 5 mM MnCl ) . Pellets were incubated (20°C, 10 min.) with 30 μl of a mixture containing 25 mM Hepes, pH 7.4 , 5 mM MnCl , 5 mM p-nitrophenyl-phosphate, 1 μM cold ATP (Boehringer Mannheim, Indianapolis, IN) and 5 μCiγ- [ 32P]ATP (6000 Immunofluorescence staining and flow cytofluor ime try Transfected cells were harvested with stammg buffer (PBS contammg 0.02 % sodium azide and 0.1% BSA; using transfer pipettes Cells were centrifuged, resuspended m 60 μl of sta mg buffer and incubated with either the anti-FcγRIII mAb, 3G8 (Unkeless et al, Annu. Rev. Immunol. 6:251 (1988)) , or an isotype control for 30 mmutes at 4°C. Cells were washed and stained with fluorescem- onjugated goat anti-mouse IgG (Tago Inc. Burlingame, CA) . The stained cells were examined using a FACStar flowcytotreter (Becton Dickinson Co., Mountain View, CA) .

Binding and pnagocytosis of IgG-sensi ized RBCs

9 (EA) : Sterile sheep red blood cells (10 /ml/ in calcium and magnesium-free PBS were sensitized by incubation with an equal volume of a subagglutmatmg titer of raobit ant -sneep RBC antioody (Cappel

Laboratories, Cochranvill , PA^ The IgG-sensitized

RBCs (EA) were washed twice with PBS and resuspended to

Q a final concentration of 10 /ml for overlaying on transfected COS-l cells. Cells were examined for rosetting () 10 EA per COS-l cell) and phagocytosis as described previously (Indik et al, J Clin. Invest. 88:A66 (1991) ) For the analysis of phagocytosis, COS-l cells bound with EA (after three washings) were subjected to a brief hypotonic shock (35 seconds) with hypotonic PBS to remove surface bound EA. The cells were then stained with Wright-Giemsa staining 36

Phagocytosis Mediated bv FcyRIIIA a and Associated v and Chains :

Wild type y and ζ cDNAs of FcyRIIIA were cotransfected with the FcγRIIIA-α chain into COS-l cells to examine their ability to induce phagocytosis of EA (sensitized RBC) . Surface expression of FcyRIIIA was determined by flow cytometry and was equally efficient in cotransfection with either γ or ζ (Table 1) . The mean fluorescence intensity (FMI) for cotransfected cells stained with anti-FcγRIII mAB increased by 15 fold compared to cells stained with an IgG isotype control or compared to mock-transfected cells stained with anti-FcγRIII mAB (Table 1) . The transfectants were examined for their ability to bind and phagocytose IgG sensitized RBCs (EA) .

Approximately 50% of COS-l transfectants avidly bound EA (Table 1) . Microscopic examination of COS-l cells transfected with wild type γ consistently showed the ingestion of EA by 20+5 % of the cells examined (p(θ.02) . Thus, phagocytosis of EA was detected in approximately 40% of COS-l cell transfectants that bound EA. In contrast, cotransfectants containing the ζ chain revealed 3.8% of cells with ingested EA (p(0.02) (Table 1) . Moreover, in ζ-containing cells which demonstrated phagocytosis the average number of ingested EA per cell was reduced to less than one half the level of that observed with γ. COS-l cells transfected with all three cDNAs, ct , γ, and ζ, revealed Ci or 222 TBq/mmol ; Dupont NEN, Boston, MA) . Reactions were stopped by adding reducmg SDS-PAGE sample buffer and labelled proteins were separated on a 12.5% reducmg SDS-PAGE gel. The gel was fixed in methanol/acetic acid, treated with 1 N KOH (2 hrs at

55°C) to remove phosphoserme and threonine, dried and autoradiogrammed for 4 days .

[Ca ]ι Mobilization: COS-l cells plated on glass coverslips were incubated with 2 μM Fura-2/AM (Calbiochem. San Diego, CA) for 30 mmutes, washed twice and the coverslips then transferred to a Leidem cell chamoer (Medical Systems, Greenville, NY) for multiple single-cell measurements of [Ca ]ι. FcyRIIIA receptors were crosslinked either with biotinylated anti-FcγRIII followed by the addition of streptavidin or with anti-FcγRIII mAB 3G8 wnole IgG. As a positive control, 10 μM epinephr e was added to crosslink epinephrme receptors expressed on COS cells. Calcium imaging was performed using a 40x fluorescence objective on a Nikon Diaphot microscope with the image-1 AT quantitative fluorescence system (Universal Imaging, West Chester, PA) . Images were acquired at either 340 or 380 nm excitation (emission = 510 nm) . 340/380 ratio images were calculated on a pixel by pixel basis and the average 340/380 ratio withm each ceil determmed at each time point. 340/380 ratios were converted to [Ca ] I based on solution calibration using free Fura-2 acid. TABLE 1. FcγRIIIA expression and Phagocytosis by COS-l Cells Transfected with FcγRIIIA (γ and/or ζ).

Phagocytosis Rosetting

FcvRIIIA MFΓ Pl§ (% Cells +) (% Cells +)

α + pSVL (Sham) 15 0 0 0 a * v 254 129±21 0 20±5 0 49±3 0 α + ζ 220 193±3 2 3 3±0 7 50±1 7 α + ζ + γ 205 77±51 0 16±3 2 46±2 0

Transfection efficiency was determined by flow cytometry. The mean fluorescence intensity (MFI) is shown for one of 3 separate experiments with similar results. Internalized RBCs were miscroscopically scored (lOOOx) . Results are expressed as the mean ± SEM for phagocytosis and binding (rosetting) of EA. At least 3 separate experiments were performed for each clone. For each experiment, 1500 cells were counted at 5 randomly selected sites. *Mean Fluorescence Intensity. ^§PI (Phagocytic Index) : number of RBCs internalized per 100 COS-l cells. 16% cells with ingested EA, showing consistent attenuation in phagocytosis (Table 1) . In contrast, neither sham transfectants with EA nor transfectants with E (non-sensitized RBC) exhibited any binding or phagocytosis .

40

TABLE 2. FcγRIIIA expression and Phagocytosis by COS-l Cells Transfected with FcyRIIIA - /y(wild type or mutants) .

Phagocytosis Rosetting

FcvRIIIA MFI' Pl§ (% Cells +) (% Cells +)

α + pSVL (Sham) 15 0 0 0 α + γ (WT) 254 129±21.0 20±5.0 49*3.0 a + γ ( 1A) 259 0.3*0.2 0.2±0.1 49±2.5 α + γ (M1B) 303 1.0*1.0 1.0*1.0 50*1.5 a * Y (M2A) 232 <0.04 <0.02 49*1.5 α + Y (M2B) 256 <0.02 <0.02 48*3.0 α + Y (DMA) 222 <0.02 <0.02 48*2.5 α + Y (DMB) 328 <0.02 <0.02 49*2.0

See Table 1 for legend

Two Cytoplasmic Tγrosines of the v Cham are Reouired for Phagocytosis:

To study the effect of the two conserved y chain tyrosmes on FcyRIIIA mediated phagocytosis, the N-proximal (clones MIA and MIB) or C-proximal (clones M2A and M2B) tyrosmes were individually replaced by phenylalanine. For mutants with double tyrosine substitutions, both tyrosmes were replaced by phenylalanine (DMA and DMB) (Fig. 1) . MFI measured by flow cytofluorimetry and % of positive cells with rosetting demonstrated similar surface expression of the receptor complexes in all transfectants bearing γ mutants and wild type γ (Table 2) . These comparable levels of expression indicate that tyrosine residues m the cytoplasmic tail of the γ chain are not necessary for formation of the FcγRIIIA receptor complex required for surface expression. Results summarized in Table 2 are as follows: Ml γ mutants showed more than 99% reduction in phagocytic activity as shown by phagocytic index (PI) ( ≤ 1 % of transfectants with ingested EA and minimal ingested EA per phagocytos g cell) (p{0.02) ; M2 and DM γ mutants demonstrated essentially no phagocytosis (1 among 5000 cells examined) (Table 2, Fig. 2) . 42

TABLE 3. The Effect of Tyrphostin 23 (Tyr 23) on Phagocytosis by COS-l Cells Transfected with FcγRIIIA-a/γ

Tyr 23 Rosetting

(Concentration') PI* (C Cells)

O μM 125±24 49±3

25 μM 68±4 52±9

50 μM 26±7 52±8

100 μM 16±6 49±7

200 μM 1.2±1 47±5

400 μM 0 48±3

400 μM + washing 63±7 44±6

"PI. Phagocytic Index

Inhibition of Phagocytosis bv Tvrophostin 23:

To investigate whether phagocytosis requires phosphorylation of tyrosine residues, COS-l cells cotransfected with FcγRIIIA-α and wild type y were incubated with increasing concentrations of tyrphostin 23 (tyr 23) , an inhibitor of tyrosine kinases (Yaish et al, Science 242:933 (1988)) . Tyr 23 decreased phagocytosis in a dose dependent manner, with 50% inhibition at 25 μM and complete inhibition at 200-400 μM (p 0.01) (Table 3) . In contrast, tyr 23 did not affect the binding of EA. Inhibition of phagocytosis was not associated with reduction in viability, since transfectants pretreated with tyr 23 (400 μM) followed by washing had phagocytic activity partially (3 hr wash, Table 3) or completely (overnight wash, data not shown) restored.

44 following FcγRIIIA crosslinking was measured in individual transfected cells (WT, MIA, M2A or DMA) using digital video microscopy (Fig. 4) . Epinephrme, which evokes a Ca ^" signal in COS cells, was used as a positive control in ail experiments. Transfectants with the WT receptor complex showed a typical transient calcium rise following cross-linking with biocmvlated anti-FcyRIII followed by the addition of streptavidin or with anti-FcγRIII whole IgG. In 5 consecutive experiments (169 celisj , 58% of ceils responded tc anti-FcγRIII with a calcium signal at least 50% as large as than induced by 10 μM epinephrme (Fig. 4, Table 4) . In contrast, COS-l cells transfected with either MIA, M2A or DMA showed markedly diminished calcium responses to anti-FcyRIII, although in one of four experiments significant calcium mobilization was evoked m MIA transfected COS-l cells.

Tyrosine Residues of the v Subunit are Phosphorylated In Vi tro :

The possibility that tyrosine residues of the v cnain are pnosphorylated was examined by in vi tro kinase assays using COS-l transfectants. Results shown in Fig. 4 demonstrate that the tyrosine residues of the wild type γ chains are phosphorylated m vi tro . In contrast, the mutant γ chain transfectants and the snam transfectants snowed no detectable pnosphorylaticn. Since the single tyrosine substitution mutants (MIA and M2A) did not exhibit pnosphorylaticn on the remaining tyrosine residues, t is likely that phosphorylation of either one of the two tyrosine residues requires the other tyrosine residue to be intact (Fig. 3) . These phosphorylation data correlate well with the ability of the γ cham to induce a phagocytic signal, as suostitution of either one of tne tyrosine residues largely eliminates pnagocytosis (Table 2, Fig. 2) .

The in vi tro kinase assay demonstrated a distinct band cf approximately 40 kDa present in all lanes except the sham transfectants. This band may represent an associated phospnoprotem cσprecipitatmg with γ.

Cytoplasmic Tyrosmes of v are Required for Mobil ι?3tιon of Ca

To examine whether the γ chain tyrosmes are required for calcium mobilization, the calcium response 46 using NK cells and lymphocytes or fibroblasts transfected with chimeric or mutated receptors (Darby et al, Blood 79:352A Nov. (1992)) FcγRIII m its native state on pulmonary macrophage or cultured monocytes (M) was examined in order to study the physiologically relevant protein tyrosme kinases (PTK) and phosphotyrosine containing substrates durmg macrophage signal transduction. Witπm seconds after FcγRIII crosslinking with Fab antiboαy, Western blot analysis revealed a characteristic pattern cf phospnotyrosme supstrates. This response was transient with most substrates peaking at 5 mm and declining after 10-20 mm Phosphotyrosine patterns were indistinguishable in fresh macrophage and cultured monocytes, validating the latter as a useful in vi tro model. P62, a protein associated with pl20" GAP, although not GAP itself, was identified by specific immunoprecipitation as one of these nosphotyrosme substrates A second substrate was found to oe p95 a hematopoietic oncogene product whicn is also tyrosme phosphorylated after TCR, slg and FceRI activation The kinase PTK72/Syk, heretofore identified only in B cell slg and mast cell FceRI signaling, was also a major phosphotyrosine substrate after macrophage FcγRIII activation. In vi tro kinase assays of anti-Syk immune complexes revealed a 3-4 fold increase in Syk autophosphorylation at 5-10 mm. after receptor ligation. Syk has also been found to be present in

TABLE 4. The Effect of Tyrosine Substitutions on Calcium Mobilization Evoked by Cross-Linking of FcγRIIIA

No. of No. of % of Cells

FcγRIII Experiments Cells Responding*

α -!- γ ( WT 5 169 57.8 α -t- γ (MIA) 4 123 16.0 α + γ (M2A) 4 1 17 2.8 α + γ (DMA) 4 70 3.7

*Cells were scored as responding if the calcium response as more than 50% of that observed with 10 μM epinephrine

EXAMPLE IV

Macrophage FcyRIII Signaling Induces Protein Tyrosine Kinase Activation

Specific tyrosine residues in the intracellular FcyRIIIγ subunit have been identified as necessary for signal transduction and subsequent effector functions, 48

57 mer containing sequences complementary to three different target sites, target I (the area of the translation initiation, nucleotide no. 159 to 173) , target II (451 to 463) , and target III (802 to 816) of Syk mRNA (Law et ai, J^". Biol . Chem . 269:12310 (1994) ) (Figure 5) . The stem-loop Syk antisense ODN forms a stem and loop structure by itself and was designed to contain minimal intramolecular secondary structures in the loop domain (Figure 6) . The sequence of the stem-loop Syk antisense ODN is

5 ' -GGGGGGGCTGTCAGCCATGCCGTGTCTTGTCTTTGTCGCTTCTTGAGGAGCC CCCCC-3 ' . Linear 17 mer control ODN has a random sequence of 5 ' -GCCCAAGATGATTCCAG-3 ' . Stem-loop 61 mer control ODN has a random sequence of 5 ' -ATGGAATCATCTTGGGCATTCATTCGTTCCTCAAAGAAGAATATGAA-3 ' within the loop domain. The linear and stem-loop control ODNs were also modified at both the 5-prime and 3-prime termini by phosphorothioates.

Preparation of liposomes: One μg each of the control scrambled phosphodiester ODNs, the linear and stem-loop Syk antisense ODNs in 50 μl of PBS were incubated with 4 μg (2 μl) of LIPOFECTAMINE™ (GIBCO BRL, Life Technologies, Inc. Gaithersburg, MD) . The ODN-liposome complexes were allowed to form at the room temperature for 45 min.

Monocytes isolation and culture: Peripheral blood mononuclear cells from healthy individuals were immunoprecipitates of the γ chain FcγRIIIA suggesting that Syk is associated with phosphorylated γ chain.

EXAMPLE V

Antisense Oligonucleotides

Two antisense oligonucleotides (ODN) were designed for human Syk mRNA A linear antisense ODN was used to target tne area surrounding the translation initiation codon The otner was designed to have a stem-loop structure, whicn can nybridize to three different sites of human Syk mRNA. These Syk antisense ODNs were employed to investigate tne role of the Syk tyrosine kinase the Fcγ receptor mediated phagocytic signal m cultured monocytes.

Construction cf antisense oligodeoxynucleotides Antisense or scrambled control ODNs were modified to be protected from nucleases . One phosphodiester backbone at tne 5-prime terminus and two at the 3 -prime terminus were modified with phosphorothioate. Prediction of secondary structures of Syk mRNA (Law et al , J. Biol. Chem. 269:12310 (1994)) and ODNs were carried out with the MaoDNASIS program (Hitachi Software, San Bruno, CA) on a Macintosh computer. Linear 17 mer Syk antisense ODN, having the sequence of 5 ' -CGCTGTCAGCCATGCCG-3 ' , targets the area surrounding the translation initiation codon of Syk mRNA. Stem-loop Syk antisense ODN is a 50

37°C for 2 days. The same volume cf ODN-liposome mixture was also added to each well on Day 2, indicating that 1 x 10^s monocytes were incubated with ODN-liposome complexes containing 4 μg/ml of LIPOFECTAMINE and 1.0 μM of the linear control, 1.0 μM of the linear Syk antisense ODN or C.2 μM of the stem-loop control, or 0.2 μM of the stem-loop Syk antisense ODN for 2 days.

Preparation of IgG-sens tized red blood cells (EA) : 1 x 10" Sheep red blood cells (RBCs, /ml (Roc land Inc., Gilbertville, PA) were sensitized with an equal volume of the highest subagglutmating concentration of rabbit anti-sheep RBC antibody (Cappel Laooratones, West Chester, PA) at 37°C for 30 mm. The IgG-sensitized RBCs were washed twice and resuspended m PBS to a final concentration of 1 x IO⁹ RBCs/mi as described previously (Schreiber et al , J. Cl . Invest. 56:1189 (1975) ) .

Phagocytosis of IαG-sensitized RBCs (EA) : Monocytes treated with antisense ODNs were incubated at 37°C for

30 mm with EA at a ratio of 100:1 (EA to monocytes) .

Cells were briefly exposed to hypotonic PBS to remove adherent EA. The cells were then stained with

Wright-Giemsa and phagocytosed RBCs were microscopically scored (xlOOO) . One hundred monocytes were chosen in a random manner and then internalized EA were expressed as the phagocytic index. 4 9 isolated by a standard adherence procedure (Darby et al, J. Immunol. 152:5429 (1994)) . Briefly, the heparinized blood was centrifuged on Ficoll-Hypaque (Lymphocyte Separation Medium; Organon Teknika, Durham, NC) and interface cells were washed twice in PBS.

Mononuclear cells were resuspended in complete medium containing RPMI 1640 (GIBCO BRL, Life Technologies, Inc. Gaithersburg, MD) with 10% heat-inactivated FCS and 2 mM L-glutamine. Cells were allowed to adhere at 37°C onto tissue culture flasks precoated with FCS.

After 45 to 90 min non-adherent cells were removed with extensive washing in HBSS. Cells were harvested by vigorous agitation. The yield of monocytes ranged from 2 - 6 x 10^" cells/500 ml of blood. Monocytes were routinely more than 98% viable judged by trypan blue exclusion. Isolated monocytes were maintained in RPMI 1640 supplemented with L-glutamine (2 mM) and 10% heat-inactivated FCS at 37°C with 5% CO-,.

Oligodeoxynucleotides treatment of cells. 1 x 10^s Monocytes were incubated with ODN-liposome complexes containing 2 μg/ml of LIPOFECTAMINE and 0.5 μM of the linear control, 0.5 μM of the linear Syk antisense ODN or 0.1 μM of the stem-loop control, 0.1 μM of the stem-loop Syk antisense ODN in 0.3 ml of RPMI 1640 medium without FCS in a 24-well plate (Falcon; Becton Dickinson Labware, Lincoln Park, NJ) at 37°C for 4 h. Medium was added to a 1 ml final volume with RPMI 1640 containing 10% FCS and cells were then incubated at 52

564) . The PCR products were analyzed by Southern hybridization.

Southern hybridization. RT-PCR products were electrophoresed on a 1.5% agarose gel. DNA was transferred onto a nylon membrane (NEN Research

Products, Boston, MA) The transferred membrane was hybridized with biotinylated internal prooe (Syκ-pS. 5 ' -GGGAGTGGTAGTGGCAGAGG-3 ' , nucleotide No. 408 to 427 > in 6 x SSPΞ and 50% formamide. After wasnmg the membrane 0.1 x SSC at 50°C, the hybridized pands were visualized by cnemilummescent detection reagent (PROTOGΞNE^""¹ Nucleic Acid Detection System, GIBCO BRL, Life Technologies, Inc. Gaithersburg, MD) .

Results Monocytes mcuoated with the linear Syk antisense

ODN (1 μM) exhibited a reduced level of phagocytosis. Phagocytosis reduced by 49%, shown as the phagocytic index (PI, from 220 _ 8.8 to 113 ± 12.3 ) . Monocytes incubated with the stem-loop Syk antisense ODN (0.2 μM) exhibited an even greater reduction m phagocytosis by 89% (PI from 220 ± 8.8 to 24 ± 4.2) (Figure 7) . Botn scrambled control ODNs, the lmaer (1 μM) or stem-loop (0.2 μM) ODN, did not significantly affect FcyRIIA mediated phagocytosis. Similarly, liposomes alone did not reduce FcyRIIA mediated phagocytosis. FcyRII expression did not change with any of the treatments as measured by flow cytometric analysis m cultured Flow cytometry analysis: Monocytes were incubated with anti-FcyRI (32.2) (Indik et al, Blood 83:2072 (1994) ) or anti-FcγRII (IV.3) (Indik et ai , Blood 83:2072 ■1994) ) or anti-FcγRIII (3G8) moAb (Park et al , J. Clm. Invest. 92:1967 (1993) , Park et al , J. Clin.

Invest. 92:2073 (1993) ) at 4°C for 30 mm, then washed twice with calcium and magnesium-free PBS containing 0.1% bovine serum albumin (BSA) and 0.02% sodium azide and labeled with FITC-conπugated goat anti-mouse F(ac' 2 IgG 'Tago, Burlingame, CA) at 4°C for 30 mm. Cells were then wasned and fixed with 1% paraformaldehyde. Fluorescence was measured on a FACStar (Becton Dickinson, Mountain View, CA) , and mean fluorescence intensity data and contour plots were generated using Consort 30 software. For all samples, 10,000 events were recorded on a logarithmic fluorescence scale.

Reverse transcrioed polymerase chain reaction (RT-PCR) : Total RNA was isolated from monocytes treated w th scrambled control and Syk antisense ODNs. cDNA was synthesized from total RNA with random hexanucleotide primers (Boehringer Mannneim, Indianapolis, IN) . PCR was performed with synthesized cDNA as templates with two primers. Syk-H primer: 5 ' -GGTGTGTGCCCTCCGGCC-3 ' correspondmg to nucleotide No. 122 to 139 of Syk mRNA (Law et al, J. Biol. Chem. 269:12310 (1994) ) , Syk-M primer: 5 ' -CTGCAGGTTCCATGT-3 ' (nucleotide No. 550 to 54 EXAMPLE VI

Inhibition cf Histamine Release by Stem-loop Syk Antisense Oligonucleotides (ODNs)

Experimental design Cell culture: RBL-2H3 cells (histamine containing rat mast cells) were grown minimal essential medium supplemented with 17% fetal bovine serum, 100 U of penicillin and 100 μg of streptomycin per ml and 4mM glutamine at 37°C m 5% C0₂. Cells were seeded onto 1.6 cm plates or 24 well plates at a concentration of 1 x 10⁵ cells per well for 24h before assay.

Construction of antisense ODNs: To protect from nuclease digestion, antisense and sense control ODNS were modified by adding one phosphorothioate at the 5- prime terminus and two at the 3-prime terminus of the phosphodiester backbone. Three linear Syk antisense ODNs were designed: Target-I linear Syk antisense ODN ⁽5 'ATTGCCCGCCATGTCT3 ' , nucleotides 319 to 333 including the translating initiation codon of Syk mRNA) , Target-II (5 'GATTTGATTCTTGAG3 ' , nucleotides 1175 to 1189), Target-Ill (5 'ATTTGGTAGTATCCCT3 ' , nucleotides 1465 to 1479) . Stem-loop Syk antisense ODN is a 60 mer comprising sequences complementary to the three target sites (Fig. 9) (see also Example V above) . monocytes. These results demonstrate that the Syk tyrosine ,<mase is a major signal transducer for the FcyRIIA mediated phagocytosis monocytes and indicate that association between FcyRIIA and the Syk kinase (as well as tyrosine pnosphorylation) are important m phagocytosis of IgG-coated ceils.

Next, it was determmed whether the reduced phagocytosis in monocytes correlated with Syk mRNA levels. Quantitative RT-PCR (reverse transcr oed-polymerase cna reaction) was employed to determine intracellular levels of Syk mRNA m monocytes. Total RNA was isolated from monocytes (1 x 10= ceils/ l) treated with Syk antisense ODNs and used to synthesize the first strand cDNA. As shown Figure 8, the linear Syk antisense ODN (1.0 μM) substantially reduced Syk mRNA. The stem-loop Syk antisense ODN (0.2 μM) completely eliminated Syk mRNA (Figure 8 . In contrast, two scramoled control ODNs (1.0 uM of the imear control or C.2 μM of tne stem-loop control) as well as liposomes alone did not reduce Syk mRNA. These results show that Syk antisense ODNs, both the linear and stem-loop ODNs, are able to degrade Syk mRNA m a sequence specific manner in monocytes. Furthermore, the stem-loop Syk antisense ODN showed its efficacy over linear antisense molecules for targeting mRNA. 56 receptor FceRI as described below, and measuring histamine release using an enzyme immunoassay kit

(Immunotech, France) . Twenty four well plates containing 1X10= RBL-2H3 cells per well m 1.0 ml EMEM were incubated overnight at 37°C. The cells were washed once with PBS and incubated on ice with 1.0 ml PAGCM fa standard histamine release buffer) and 100 μl of FceRI antibody for 30 mm. Following one gentle wash with PBS, the RBL-2H3 ceils were incuoateα as follows: 1.0 ml of PAGCM buffer alone (negative control) , 1.0 ml cf PAGCM buffer contammg 10 μi of calcium lonophore (50 μg/ml stock¹ _^positive control) , or 1.0 ml of PAGCM containing 10 ul of goat anti-mouse antibody (1 mg/ml) for 30 mm. at 37°C. The PAGCM buffer containing histamme was removed from the cells and assayed by enzyme immunoassay. One hundred μl standards were included to produce a standard curve .

Resul ts

The data presented in Fig. 10A demonstrate that Syk expression in RBL-2H3 cells is markedly inhibited by the presence of Syk antisense ODN but not by the presence of Syk sense ODN. Treatment of RBL-2H3 cells with Syk antisense ODN does not affect S-actm expression (Fig. 10B) . Similarly, treatment cf RBL-2H3 cells with Syk antisense ODN does not affect γ chain expression.

Following FceRI and goat anti-mouse antibody crosslinking, RBL-2H3 cells treated with stem-loop Syk ODN treatment of cells: 5 x 10⁴ or 1 x 10^s RBL-2H3 cells were seeded m each well of a 24 well plate 24hr before lipofection details. ODN-liposome complexes were added twice, once on day 2 and once on day 3. Each time, 4 μl DOTAP (a "lipofectamine") (1 μg/1 μi stock) and 2 μl ODN (1 μg/μl) were allowed to form complexes EMEM (75 μl total volume) . The ODN- liposome complexes were added to each well containing 175 μi culture medium without serum. The cells were cuoated at 37°C for 24hr. A second volume of ODN- liposome complexes '75 μl) was added, the culture medium was adjusted to 5% FCS (final volume 1.0 ml) and the transfected R3L-2H3 cells were incubated at 37°C for one additional day before assay for histamme release .

Reverse transcribed polymerase chain reaction (RT-PCR) : Total RNA was isolated from RBL-2H3 cells treated with Syk sense control cr Syk antisense ODN. cDNA was synthesized from total RNA with random hexanucleotide primers and oligo !d)T. PCR was performed with synthesized cDNA as templates using two primers, Rat-5 Syk: 5 ' -TTTGGCAACATCACCCGG-3 ' (nucleotides 368 to 386 and Rat-3 Syk primer: 5 • -ACTTATGATGGCTTGCTC-3 ' (nucleotides 748 to 762) . γ chain and S-actin primers were used as a control .

Histamine release assay: The histamine release assay was performed by cross-linking the rat RBL-2H3 cell IgE 58 WHAT IS CLAIMED IS:

1. A method of preventing phagocytosis of immune complexes in a mammal comprising introducing mto phagocytic cells of said mammal that are in contact with said immune complexes an inhibitor of a kinase endogenous to said cells associated with an Fc receptor present at the membrane of said cells, said introduction being effected under conditions such that the pnagocytic potential of said cells is inhibited.

2 The method according to claim 1 wherein said immune complexes are IgG-containmg immune complexes.

3. The method according to claim 1 wherein said inhibitor is a peptide or mimetic.

4. The method according to claim 3 wherein said peptide is introduced directly mto said ceils

5. The method according to claim 3 wherein said peptide is incorporated mto a liposome prior to introduction into said cells.

6. The method according to claim 3 wherein a DNA sequence encodmg said peptide is introduced mto said cells under conditions such that said DNA sequence is expressed and said peptide thereby produced. antisense ODNs released 74% less histamine compared to control cells treated with sense DNA.

Anti-FceRI and Goat antimouse antibody

Sense DNA 1.9 ng of histamme released

Antisense 0.5 ng of histam e released (74% mhib.)

All documents cited above are incorporated herein by reference .

While tne invention has been described m connection w th what is presently considered to be the most practical and preferred embodiment, t is to be understood that the invention is not to be limited to the disclosed embodiment, but on the contrary, is intended to cover various modifications and equivalent arrangements included withm the spirit and scope of the appended claims.

Claims

60 receptors comprising introducing into said mammal a soluble Fc receptor that competes with said membrane-bound Fc receptor for bmdmg to said immune complexes, wnerem said introduction is effected under conditions such that binding of said immune complexes to said membrane-bound Fc receptor is inhibited

14. The method according to claim 13 wnerem said immune complexes are IgG-contammg immune complexes

15. The method according to claim 13 wnerem said soluble Fc receptor consists essentially of tne extracellular domain of an Fcy receptor, or cmdmg portion thereof.

16. The method according to claim 13 wnerem said soluble Fc receptor comprises an extracellular domain from a first Fcγ receptor type or an Fee receptor type and a cytoplasmic domain from a second Fcγ receptor type wherein at least one of said first and second receptor types is FcyRI or the or y chain cf FcγRIII.

17. A method of inhibiting the phagocytic potential of a mammalian cell expressing an Fc receptor comprising introducing mto said cell a construct comprising, in the 5' -3' direction of transcription: i) a promoter functional in said cell, ii) a segment of double-stranded DNA the transcribed strand of which comprises a sequence 7. The method according to claim 3 wherein said peptide comprises a sequence correspondmg to the tyrosme-contaming motif of the cytoplasmic domain FcyRIIA or the γ chain of FcγRIIIA cr of FceRI.

8. The method according to claim 3 wherein said peptide comprises the sequence Y-X2-L wherein X2 is any two ammo acids

9 The method accordmg to claim 8 wnerem X2 represents tne ammo acids of a Y-X2-L sequence of the cytoplasmic domain of FcyRIIA or the γ chain of FcγRIIIA or of FceRI

10 A method cf preventing the clearance of immune complexes from a mammal comprising introducing mto phagocytic cells of said mammal that are contact with said immune complexes a molecule that speciflcially degrades transcripts encodmg Fc receptors present at the membrane cf said cells .

11 The method according to claim 10 wherein said immune complexes are IgG-containing immune complexes

12. The method according to claim 10 wnerem said molecule is a ribozyme .

13. A method of inhibiting the binding of immune complexes present a mammal to membrane-bound Fc 62 reducing expression of Syk kinase and inhibiting the phagocytic and signaling potential of said cell.

20. The method according to claim 19 wherein said Fc receptor is FcyRI, FcγRIIA or FcγRIIIA.

21. A method of inhibiting the phagocytic potential of a mammalian cell expressing an Fc receptor comprising introducing mto said cell a nucleic acid complementary to an endogenous mRNA encodmg Syk kinase, wherein said nucleic acid is introduced under conditions such that said nucleic acid binds to said mRNA and thereby inhibits translation of said mRNA into Syk kinase .

22. The method according to claim 21 wherein said Fc receptor is FcyRI, FcγRIIA or FcγRIIIA.

23. The method according to claim 19 wherein said sequence is complementary to a region of said endogenous mRNA free of secondary structure.

24. The method according to claim 21 wherein said nucleic acid is complementary to a region of said mRNA free of secondary structure .

25. The method according to claim 21 wherein said nucleic acid has a stem-loop structure. complementary to endogenous mRNA encodmg said Fc receptor, and m) a termination sequence functional m said cell, wherein said construct is introduced under conditions such that said complementary strand is transcribed and binds to said endogenous mRNA thereby reducmg expression of said Fc receptor and inhibiting the pnagocytic potential cf said cell.

18 The method according to claim 17 wnerem said sequence complementary to endogenous mRNA is complementary to an untranslated region of said mRNA.

19. A method of inhibiting the phagocytic potential of a mammalian cell expressing an Fc receptor comprising introducing into said ceil a construct comprising, in the 5' -3' direction cf transcription: ) a promoter functional in said cell, ii) a segment of double-stranded DNA the transcribed strand of which comprises a sequence complementary to endogenous mRNA encodmg Syk kinase, and m) a termination sequence functional m said cell, wherein said construct is introduced under conditions such that said complementary strand is transcribed and binds to said endogenous mRNA thereby 64

31 The method according to claim 30 wherein said inhibitor is a peptide or mimetic.

32 The method according to claim 31 wherein said peptide comprises the sequence Y-X2-L, wherein X2 represents any two ammo acid

33 The method according to claim 32 wherein X2 represents the ammo acids of a Y-X2-L sequence of tne cytoplasmic domain of the γ chain FceRI

34 A construct comprising, m the 5 '-3' direction of transcription

I) a promoter, ii) a segment of double-stranded DNA the transcribed stand of which comprises a sequence complementary to Fc receptor mRNA , and m) a termination sequence, wherein said promoter, double-stranded DΝA and termination sequence are operably linked

35. A cell comprising said construct according to claim 34 , wherein said promoter and said termination sequence are functional in said cell

36. A soluble Fc receptor consisting essentially of the extracellular domain of an Fcγ or Fee receptor, or bmdmg portion thereof . 26. The method according to claim 21 wherein said nucleic acid has the sequence shown in Figure 5 or

Figure 6.

27. A method of inhibiting the phagocytic potential of a mammalian cell expressing an Fc receptor comprising introducing mto said cell a nucleic acid complementary to an endogenous mRNA encoding said Fc receptor, wherein said nucleic acid is introduced under conditions sucn that said nucleic acid binds to said mRNA and thereby inhibits translation of said mR A mto said Fc receptor.

28. The method according to claim 27 wherein said nucleic acid is an RΝA molecule.

29. The method according to claim 27 wherein said nucleic acid is complementary to an untranslated region

30. A method of inhibiting the signal transduction of the γ subunit of the IgE receptor FceRI comprising introducing mto cells bearing said receptor an inhibitor of a kinase endogenous to said cells that activates said signal transduction of said FceRI receptor or the γ subunit thereof, said introduction being effected under conditions such that said signal transduction is inhibited. 66 the Y-X2-L sequence of the cytoplasmic domain of FcyRIIA or the γ chain of FcγRIIIA or of FceRI.

44. The method according to claim 1 wherein said inhibition reduces or prevents regional tissue damage resulting from monocyte or neutrophil activation.

45. A method of inhibiting the phagocytic potential of a Syk-producing cell comprising introducing into said cell an antisense construct or ribozyme that targets Syk encoding sequences present in said cell under conditions such that production of Syk is inhibited.

46. A method of inhibiting the phagocytic potential of a cell comprising introducing into said cell FcyRIIB under conditions such that said inhibition is effected.

47. The method according to claim 30 wherein said kinase is Syk kinase.

48. A method of inhibiting signal transduction of the y subunit of the IgE receptor FceRI comprising introducing into cells bearing said receptor an antisense construct that targets Syk encoding sequences present in said cell under conditions such that said signal transduction is inhibited. 37. A soluble Fcγ receptor comprising an extracellular domain from a first Fcγ receptor type and a cytoplasmic domain from a second Fcγ receptor type, wherein at least one of said first and second receptor types is FcyRI or the o. or γ chain of FcγRIII.

38. A DNA molecule encoding the soluble receptor of claim 36.

39. A DNA molecule encoding the soluble receptor of claim 37.

40. A peptide consisting essentially of the tyrosine-containing motif of the cytoplasmic domain of FcyRIIA or the γ chain of FcγRIIIA or FceRI, or functional portion thereof.

41. A DNA molecule encoding the peptide of claim 40.

42. A cell comprising the peptide according to claim 40.

43. A peptide that inhibits phagocytosis, or mediator release from mast cells, comprising a portion of the cytoplasmic domain of FcyRIIA or of the y chain of FcγRIIIA or of FceRI that contains the sequence Y-X2-L, wherein X2 represents the two amino acids of 68 said cells or an agent that selectively inhibits signal transduction mediated by Syk interval region sequences under conditions such that said inhibition is effected.

5 . The method according to claim 53 wherein said cell is present in a lung of an asthma patient.

55. A nucleic acid having the sequence set forth m Figure 5 or Figure 6.

56. An antisense construct comprising m the 5'- 3' direction of transcription: i) a promoter, and ii) a segment of double stranded DNA the transcribed strand of which comprises a sequence complementary to Syk kinase mRNA operably linked to said promoter.

57. The construct according to claim 56 wherein said sequence complementary to Syk kinase mRNA is complementary to a region of Syk kinase mRNA that surrounds or includes the translation initiation codon.

58. The construct according to claim 56 wherein said sequence complementary to Syk kinase mRΝA is complementary to a region of Syk kinase mRNA that has minimum secondary structure . 49. The method of claim 48 wherem said cells are present in the lungs of an asthma patient.

50. The method according to claim 49 wherein said introduction is effected by administering said construct to the lungs of said patient via aerosol or systemic administration.

51. The method according to claim 47 wherein said inhibitor targets the interval region between tne second SH2 domain and catalytic (kinase) domain of Syk kinase.

52. A method of screening a test compound for the ability to selectively inhibit signal transduction mediated by the interval region of Syk kinase comprising contacting said compound with a poiypeptide that comprises the Syk interval sequence and a polypeptide comprising the ZAP70 interval sequence and determining whether said compound binds said Syk interval sequence or said Zap 70 interval sequence, compounds that bind said Syk interval sequence but not said ZAP70 interval sequence being capable of said selective inhibition.

53. A method of inhibiting the release of a mediator from a Syk-producing cell comprising introducing into said cell an antisense construct or ribozyme that targets Syk encoding sequences present in 59. A pharmaceutical composition comprising Syk kinase interval region, or portion thereof of at least 6 amino acids, or mimetic thereof, and a pharmaceutically acceptable carrier.