WO1996039820A1 - Procedes d'inactivation de leucocytes et d'inhibition de la production de cytokines dans des produits sanguins - Google Patents

Procedes d'inactivation de leucocytes et d'inhibition de la production de cytokines dans des produits sanguins Download PDF

Info

Publication number
WO1996039820A1
WO1996039820A1 PCT/US1996/009836 US9609836W WO9639820A1 WO 1996039820 A1 WO1996039820 A1 WO 1996039820A1 US 9609836 W US9609836 W US 9609836W WO 9639820 A1 WO9639820 A1 WO 9639820A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
psoralen
platelets
blood
platelet
Prior art date
Application number
PCT/US1996/009836
Other languages
English (en)
Inventor
Derek J. Hei
George D. Cimino
Joshua Grass
Laurence Corash
Original Assignee
Cerus Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cerus Corporation filed Critical Cerus Corporation
Priority to AU62674/96A priority Critical patent/AU6267496A/en
Publication of WO1996039820A1 publication Critical patent/WO1996039820A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L2/00—Methods or apparatus for disinfecting or sterilising materials or objects other than foodstuffs or contact lenses; Accessories therefor
    • A61L2/0005—Methods or apparatus for disinfecting or sterilising materials or objects other than foodstuffs or contact lenses; Accessories therefor for pharmaceuticals, biologicals or living parts
    • A61L2/0011—Methods or apparatus for disinfecting or sterilising materials or objects other than foodstuffs or contact lenses; Accessories therefor for pharmaceuticals, biologicals or living parts using physical methods
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L2/00—Methods or apparatus for disinfecting or sterilising materials or objects other than foodstuffs or contact lenses; Accessories therefor
    • A61L2/0005—Methods or apparatus for disinfecting or sterilising materials or objects other than foodstuffs or contact lenses; Accessories therefor for pharmaceuticals, biologicals or living parts
    • A61L2/0082—Methods or apparatus for disinfecting or sterilising materials or objects other than foodstuffs or contact lenses; Accessories therefor for pharmaceuticals, biologicals or living parts using chemical substances
    • A61L2/0088—Liquid substances
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L2/00—Methods or apparatus for disinfecting or sterilising materials or objects other than foodstuffs or contact lenses; Accessories therefor
    • A61L2/02—Methods or apparatus for disinfecting or sterilising materials or objects other than foodstuffs or contact lenses; Accessories therefor using physical phenomena
    • A61L2/08—Radiation
    • A61L2/10—Ultraviolet radiation
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L2/00—Methods or apparatus for disinfecting or sterilising materials or objects other than foodstuffs or contact lenses; Accessories therefor
    • A61L2/16—Methods or apparatus for disinfecting or sterilising materials or objects other than foodstuffs or contact lenses; Accessories therefor using chemical substances
    • A61L2/18—Liquid substances or solutions comprising solids or dissolved gases

Definitions

  • the present invention provides new methods of inactivating T-cells and inhibiting cytokine production in blood products by treating blood products with a psoralen compound in the presence of ultraviolet light.
  • the present invention specifically provides new methods of preventing graft versus host disease (GVHD).
  • red blood cells whole blood collected from volunteer donors for transfusion recipients is typically separated into its components: red blood cells, platelets, and plasma. Each of these fractions are individually stored and used to treat a multiplicity of specific conditions and disease states.
  • the red blood cell component is used to treat anemia
  • the concentrated platelet component is used to control bleeding
  • the plasma component is used frequently as a source of Clotting Factor VIII for the treatment of coagulopathies or for plasma replacement of therapeutic apheresis in certain diseases.
  • all blood cell preparations should be from freshly drawn blood and then immediately transfused to the recipient.
  • the logistics of operating a blood donor center preclude this possibility in the vast majority of cases. Transfusions are needed day and night and it is difficult, if not impossible, to arrange for donor recruiting at unusual hours. Consequently, modern blood donor centers must use stored blood products. While it is a practical necessity to store blood for transfusion use, the storage can significantly effect the effectiveness and safety of the blood product.
  • blood storage procedures are subject to regulation by the government as a way of reducing potential ill effects of storage. The maximum storage periods for the blood components collected in these systems are specifically prescribed. For example, whole blood components collected in an "open" (i.e.
  • non-sterile system must, under governmental rules, be transfused within twenty-four hours and in most cases within six to eight hours.
  • whole blood components are collected in a "closed" (i.e. sterile) system the red blood cells can be stored up to forty-two days (depending upon the type of anticoagulant and storage medium used) and plasma may be frozen and stored for even longer periods.
  • G VHD graft versus host disease
  • TA-GVHD transfusion associated GVHD
  • the currently accepted treatment for blood products containing cellular components is treatment with gamma irradiation to inactivate T-cells. This treatment reduces the risk of graft-versus-host disease in immunocompromised patients.
  • Anderson, K.C. Clinical indications for blood component irradiation. In: Irradiation of Blood Components, Baldwin, M.L. and Jeffries, L.C. ed.,
  • PBMCs isolated from patients receiving 8-MOP PUVA (psoralen UVA) treatment for psoriasis were also shown to express lower levels of mRNA encoding for IL-lb, IL-6, IL-8, and TNF-a.
  • the observed inhibition of cytokine synthesis in PBMCs from PUVA patients may contribute to the clinical effects of PUVA.
  • Ullrich found that treating donor marrow with 8-MOP plus UVA inactivated T-cells and suppressed both the incidence of graft-versus-host disease and the incidence of graft failure.
  • Ullrich, S.E. "Photoinactivation of T-cell function with psoralen and UVA radiation suppresses the induction of experimental murine graft-versus-host disease across major histocompatability barriers," J. Invest. Dermatol. 96: 303-308 (1991).
  • 8- MOP the compound used in these prior treatment methods, 8- MOP
  • 8-MOP is not ideal for several reasons.
  • FNHTRs febrile nonhemolytic transfusion reactions
  • cytokine levels The storage of blood products can also result in undesired production or elevation of cytokine levels.
  • the complex interactions among immune response cells are mediated by this group of secreted low molecular-weight proteins that are collectively designated cytokines.
  • Cytokines are hormone-like substances secreted by a wide variety of cells, including (but not limited to) lymphocytes (B and T), macrophages, fibroblasts, and endothelial cells.
  • lymphocytes B and T
  • macrophages macrophages
  • fibroblasts fibroblasts
  • endothelial cells endothelial cells.
  • the existence of these very active biologic agents has been known for over 30 years. It is now known that the cytokines consist of a broad class of glycoproteins that have TABLE 1
  • I ra IL-1 receptor antagonist I ra IL-1 receptor antagonist
  • cytokines generally contain from approximately 60 to 200 amino acid residues each, with a relative molecular weight of from 15 to 25 kilo Daltons. At least 35 distinct cytokines have been elucidated (Table 1). Blajchman, M.A., "Cytokines in Transfusion Medicine,” 33:1 (1993).
  • Cytokine production may have significant ill effects on recipients of platelet transfusions.
  • febrile nonhemolytic transfusion reactions were previously believed to be caused by reactions between recipient anti- leukocyte alloantibodies and leukocytes from transfused platelet units.
  • Decary, F. et al. "An investigation of nonhemolytic transfusion reactions," Vox Sang. 46: 277 (1984); Heinrich, D., Mueller-Eckhardt, C, Stier, W. "The specificity of leukocyte and platelet alloantibodies in sera of patients with nonhemolytic transfusion reactions," Vox Sang. 25: 442 (1973). Since then, cytokines generated in platelet units during storage have been implicated as mediators of FNHTRs.
  • interleukin 8 interleukin 8
  • IL-6 interleukin 6
  • TNF-a tumor necrosis factor a
  • TNF a tumor necrosis factor a
  • IL-6 interleukin 6
  • Inhibition of cytokine generation during the storage of platelet units may minimize the occurrence of FNHTRs.
  • Blood products containing cellular components are routinely treated with gamma irradiation to inactivate T-cells thereby reducing the risk of graft-versus-host disease in immunocompromised patients.
  • Anderson, K.C. Clinical indications for blood component irradiation. In: Irradiation of Blood Components. Baldwin, M.L. and Jeffries, L.C. ed., American Assoc. of Blood Banks, Bethesda, MD (1992) pp. 31. Pelszynski et al.
  • a method is needed which can inactivate T-cells and inhibit cytokine synthesis in blood products during storage, while preserving the biological function of the blood product. Specifically, a method is needed which can inactivate T-cells and inhibit cytokine production in platelets during storage while preserving the biological function of the platelets.
  • FIG. 1 is a perspective view of one embodiment of the device of the present invention.
  • FIG. 2 is a cross-sectional view of the device shown in FIG. 1 along the lines of 2—2.
  • FIG. 3 is a cross-sectional view of the device shown in FIG. 1 along the lines of 3—3.
  • FIG. 4 is a cross-sectional view of the device shown in FIG. 1 along the lines of 4—4.
  • FIG. 5 shows the relationship between white blood cell counts in single random donor platelet units (solid squares) and levels of IL-8 following seven days of storage.
  • the single open triangle represents a single unit which was excluded from the linear regression.
  • the linear regression for the seven remaining unpooled random donor platelet units had a linear correlation coefficient of 0.98.
  • the white blood cell count and IL-8 level for the random donor platelet unit which was prepared by pooling the eight individual units is indicated by the open circle.
  • FIG. 6 is a graph comparing IL-8 generation during 7-day storage of untreated (solid squares) pooled random donor platelet units with identical units treated by gamma-irradiation (solid circles), photochemical treatment (PCT) with
  • FIG. 7 is a graph of controls demonstrating the requirement of UVA illumination in the presence of psoralen for complete elimination of cytokine synthesis.
  • Untreated control solid circles
  • UVA illumination only solid squares
  • Compound 2 only open squares
  • PCT with Compound 2 open circles.
  • Controls were also performed by adding Compound 2 to either plasma (diamonds) or PAS (triangles) solutions and illuminating with UVA before adding to platelets.
  • FIG. 8 is a graph showing the levels of IL-lb, IL-6, and TNF-a for untreated random donor platelet units and units treated with Compound 2 and UVA and stored over a 7-day period.
  • Levels of both IL-6 and TNF-a in the untreated control solid circles, solid triangles) and the photochemically decontaminated sample (open circles, open triangles, dashed line).
  • FIG. 9 is a graph depicting the levels of IL-8 generated in platelet units enriched with white blood cells following 5-day storage. Platelets (pool of 5- random donor platelet concentrates) were enriched with white blood cells prepared by Ficoll gradient to a final level of 4.3 x IO 6 WBC/mL. The "Note
  • Spiked control is the pooled platelets without added white blood cell preparation. The remaining samples were enriched with white blood cells and treated as indicated. The samples containing 8-MOP, AMT and Compound 2 were all illuminated with 1.9 J/cm 2 UVA.
  • FIG. 10 summarizes the levels of modification of DNA by 8-MOP (circle),
  • AMT triangle
  • Compound 2 squares
  • Data were obtained from platelet units enriched with 4.3 x IO 6 WBC/mL.
  • Psoralen was added to each platelet unit to the indicated final concentration and illuminated to 1.9 J/cm 2 .
  • FIG. 11 shows the correlation between levels of DNA modification and day-5 levels of IL-8 produced in platelet units treated with 8-MOP, AMT, and
  • FIG. 12A schematically shows the standard blood product separation approach used presently in blood banks.
  • FIG. 12B schematically shows an embodiment of the present invention whereby synthetic media is introduced to platelet concentrate prepared as in FIG.
  • FIG. 12C schematically shows one embodiment of the decontamination approach of the present invention applied specifically to platelet concentrate diluted with synthetic media as in FIG. 12B.
  • FIG. 13A is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 2 at 100 ⁇ M (PCD) on platelet function as measured by platelet count, "n" represents the number of experiments represented by the data point.
  • FIG. 13B is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 2 at 100 ⁇ M (PCD) on platelet function as measured by platelet aggregation, "n" represents the number of experiments represented by the data point.
  • FIG. 13C is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 2 at 100 ⁇ M (PCD) on platelet function as measured by GMP-140 expression, "n" represents the number of experiments represented by the data point.
  • FIG. 13D is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 2 at 100 ⁇ M (PCD) on platelet function as measured by pH. "n” represents the number of experiments represented by the data point.
  • FIG. 14A is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 6 at 100 ⁇ M (PCD) on platelet function as measured by platelet count, "n” represents the number of experiments represented by the data point.
  • FIG. 14B is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 6 at 100 ⁇ M (PCD) on platelet function as measured by platelet aggregation, "n” represents the number of experiments represented by the data point.
  • FIG. 14C is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 6 at 100 ⁇ M (PCD) on platelet function as measured by GMP-140 expression, "n" represents the number of experiments represented by the data point.
  • FIG. 14D is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 6 at 100 ⁇ M (PCD) on platelet function as measured by pH. "n” represents the number of experiments represented by the data point.
  • FIG. 15A is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 17 at 100 ⁇ M (PCD) on platelet function as measured by platelet count, "n" represents the number of experiments represented by the data point.
  • FIG. 15B is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 17 at 100 ⁇ M (PCD) on platelet function as measured by platelet aggregation, "n” represents the number of experiments represented by the data point.
  • FIG. 15C is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 17 at 100 ⁇ M (PCD) on platelet function as measured by GMP-140 expression, "n” represents the number of experiments represented by the data point.
  • FIG. 15D is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 17 at 100 ⁇ M (PCD) on platelet function as measured by pH.
  • FIG. 16A is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 18 at 100 ⁇ M (PCD) on platelet function as measured by platelet count, "n” represents the number of experiments represented by the data point.
  • FIG. 16B is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 18 at 100 ⁇ M (PCD) on platelet function as measured by platelet aggregation, "n" represents the number of experiments represented by the data point.
  • FIG. 16C is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 18 at 100 ⁇ M (PCD) on platelet function as measured by GMP-140 expression, "n" represents the number of experiments represented by the data point.
  • FIG. 16D is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 18 at 100 ⁇ M (PCD) on platelet function as measured by pH. "n” represents the number of experiments represented by the data point.
  • FIG. 17 is a graph showing the t-cell inactivation kinetics in platelet concentrate with AMT and Compound 2 plus 1 Joule /cm ⁇ UVA
  • FIG. 18 is a graph showing Leukocyte DNA Adduct formation with the psoralens AMT, 8-MOP and Compound 2 plus 1.9 Joules /cm2 UVA in PC.
  • the present invention provides new methods of inhibiting the proliferation of cells or inhibiting the production of cytokines in blood products by treating blood products with a psoralen compound in the presence of ultraviolet light prior to storage and transfusion.
  • a psoralen compound in the presence of ultraviolet light prior to storage and transfusion.
  • the present invention contemplates a method of inactivating leukocytes or inhibiting cytokine production in blood preparations, comprising the steps of: providing, in any order, i) a psoralen; ii) photoactivating means for photoactivating said psoralen; and iii) said blood preparation; adding said psoralen to said blood preparation; photoactivating said psoralen under conditions such that the leukocytes are inactivated or production of the targeted cytokines are inhibited.
  • the invention contemplates that the treated blood preparation may then be stored.
  • said blood preparation comprises either plasma or platelets, for example, pooled platelets, platelet rich plasma or buffy coat platelets.
  • treated pooled platelets are stored for more than 4 hours prior to in vivo use.
  • said platelets are in a synthetic media.
  • said synthetic media is added to said platelets such that said platelets are suspended in mixture having a residual plasma concentration between approximately 8 and 40% by volume.
  • a method for inhibiting cytokine production in blood preparations suspected of containing cells capable of producing cytokines comprising the steps of: a) providing, in any order, i) a psoralen; ii) photoactivating means for photoactivating said psoralen; and iii) said blood preparation; b) adding said psoralen to said blood preparation; c) photoactivating said psoralen under conditions such that the production of cytokines from said cells is inhibited, wherein said cells are inhibited from producing cytokines, so as to create a treated blood preparation; and d) storing said treated blood preparation.
  • said blood preparation comprises platelets, or that said platelets comprise pooled platelets, which may or may not have been stored for at least 4 hours prior to in vivo use.
  • the platelets may be in a synthetic media.
  • the synthetic, media may be added to said platelets such that said platelets are suspended in mixture having a residual plasma concentration between approximately 8 and 40% by volume.
  • the photoactivating means is contemplated to comprise, in one embodiment, a photoactivation device capable of emitting a given intensity of a spectrum of electromagnetic radiation comprising wavelengths between 320 nm and 400 nm. In a specific embodiment, the intensity is between 1 and 30 mW/cm ⁇ , and the blood preparation is exposed to said intensity for between 1 second and thirty minutes.
  • the psoralen may be added to the blood preparation at a concentration of between 1 and 500 ⁇ M, or specifically, between 10 and 150 ⁇ M. It is contemplated that the psoralen comprises a 4'-primaryamino-substituted psoralen. It is further contemplated that two or more psoralens be used together. In one embodiment the psoralen is in a solution comprising water, saline, or a synthetic media prior to adding said psoralen to said blood preparation. It is contemplated that the cells that may be inhibited by the present methods include lymphocytes, an in some cases, prior to step (b) the lymphocytes comprise white blood cells at a minimum concentration of IxlO 6 cells/ml.
  • Another method for inhibiting cytokine production in a platelet preparation suspected of containing cells capable of producing cytokines comprising the steps of: a) providing, in any order, i) a psoralen in a phosphate buffered, aqueous salt solution; ii) photoactivating means for photoactivating said psoralen; and iii) a platelet preparation containing plasma; b)removing a portion of said plasma from said platelet preparation and adding said solution to said platelets such that said platelets are suspended in mixture having a residual plasma concentration between approximately 8 and 40% by volume; and c) activating said psoralen in said mixture with said photoactivating means under conditions such that the production of cytokines from said cells is inhibited so as to create a treated platelet preparation, wherein said cells are inhibited from producing cytokines; and d) storing said treated platelet preparation.
  • the solution may further comprise sodium acetate and sodium citrate.
  • the means for activating comprises a photoactivation device capable of emitting a given intensity of a spectrum of electromagnetic radiation comprising wavelengths between 320 nm and 400 nm. and the intensity may further be between .1 and 25 mW/cm ⁇ . In an embodiment of the present invention, the mixture is exposed to said intensity for between one and ten minutes.
  • the psoralen may be 8-methoxypsoralen or 4'- (4-amino 2-oxa)butyl-4,5',8-trimethylpsoralen.
  • the cells inhibited by methods of the present invention are contemplated to include lymphocytes, which may be present prior to step (b) at a concentration of 1x10 ⁇ cells/ml or greater in specific.
  • the platelet preparation may comprise pooled platelets, which in one embodiment are stored for at least 4 hours in step (d).
  • Yet another method encompassed by the present invention for inhibiting cytokine production in pooled platelets suspected of containing cells capable of producing cytokines comprises the steps of: providing, in any order, i) a psoralen in a phosphate buffered, aqueous salt solution; ii) photoactivating means for photoactivating said psoralen; and iii) pooled platelets containing plasma; removing a portion of said plasma from said pooled platelets and adding said solution to said pooled platelets such that said pooled platelets are suspended in mixture having a residual plasma concentration between approximately 8 and 40% by volume; and activating said psoralen in said mixture with said photoactivating means under conditions such that the production of cytokines from said cells is inhibited so as to create a treated pooled platelet preparation, wherein said cells are inhibited from producing cytokines; and storing said treated pooled platelet preparation.
  • the solution may contain sodium acetate and sodium citrate.
  • the photoactivating means comprises a photoactivation device capable of emitting a given intensity of a spectrum of electromagnetic radiation comprising wavelengths between 320 nm and 400 nm. and in one embodiment, the intensity is between .1 and 25 mW/cm ⁇ . The mixture may specifically be exposed to said intensity for between one and ten minutes.
  • the psoralen is 8-methoxypsoralen or 4'-(4- amino-2-oxa)butyl-4,5',8-trimethylpsoralen.
  • the cells inhibited by the present invention may comprise lymphocytes, which in turn may comprise white blood cells at a concentration greater than 1x10 ⁇ cells/ml.
  • pooled platelets are stored for at least 4 hours after treatment.
  • the present invention contemplates a specific method of inhibiting cytokine production in platelet preparations for transfusion, suspected of containing lymphocytes capable of producing cytokines, comprising the steps of: providing, in any order, a phosphate buffered, aqueous salt solution comprising 4'-(4-amino-2-oxa)butyl-4,5',8-trimethylpsoralen at a concentration between approximately 1 ⁇ g/ml and 300 ⁇ g/ml; photoactivating means for photoactivating said 4'-(4-amino-2-oxa)butyl-4,5',8-trimethylpsoralen; and a platelet preparation comprising platelets and plasma; removing a portion of said plasma from said platelet preparation and adding said solution to said platelets such that said platelets are suspended in mixture having a residual plasma concentration between 8 and 25% by volume; and activating said 4'-(4-amino-2- oxa)butyl-4,5',8-trimethylpsoralen
  • the means for activating may comprise a photoactivation device capable of emitting a given intensity of a spectrum of electromagnetic radiation comprising wavelengths between 320 nm and 400 nm. It is further contemplated that the platelet preparation comprises pooled platelets, and that prior to step (b) said lymphocytes comprise white blood cells at a minimum concentration of 1x10 ⁇ cells/ml.
  • the present invention contemplates a method of inhibiting protein expression by leukocytes in a blood preparation, comprising the steps of: providing, in any order, i) a psoralen; ii) photoactivating means for photoactivating said psoralen; and iii) said blood preparation; adding said psoralen to said blood preparation; photoactivating said psoralen under conditions such that the protein expression from said leukocytes is inhibited, so as to create a treated blood preparation; and storing said treated blood preparation.
  • the present invention contemplates a method of inactivating leukocytes in blood preparations, comprising the steps of: providing, in any order, i) a psoralen; ii) photoactivating means for photoactiva ing said psoralen; and iii) said blood preparation suspected of containing leukocytes; adding said psoralen to said blood preparation; and photoactivating said psoralen under conditions such that leukocytes in said blood preparation are inactivated.
  • the blood preparation comprises platelets, such as pooled platelets.
  • the platelets are selected from the group consisting of buffy coat platelets and platelet rich plasma.
  • the platelets are in a synthetic media, and the synthetic media is added to said platelets such that said platelets are suspended in mixture having a residual plasma concentration between approximately 8 and 40% by volume.
  • Yet another method of inactivating T-cells in platelet preparations comprising the steps of: providing, in any order, i) a phosphate buffered, aqueous salt solution and an aminopsoralen; ii) photoactivating means for photoactivating said aminopsoralen; and iii) a platelet preparation; removing said plasma from said platelet preparation and adding said solution to said platelets such that said platelets are suspended in mixture having a residual plasma concentration between approximately 8 and 40% by volume; and activating said aminopsoralen in said mixture with said photoactivating means under conditions such that the proliferation of T-cells is inhibited so as to create a treated blood preparation.
  • the present invention provides new methods of inhibiting cytokine production and inactivating T-cells in blood products by treating blood products with a psoralen compound, then photoactivating the compound by exposing the blood product to ultraviolet light.
  • the present invention specifically provides methods of using new and known compounds to inhibit cytokine production and inactivate T-cells in blood products to be used in vivo and in vitro without significantly effecting blood product function or exhibiting mutagenicity, thereby preventing TA-GVHD and FNHTRs.
  • the methods of the present invention also result in the inactivation of any pathogens in the blood products treated.
  • the method of the present invention are examples of the present invention.
  • psoralens as the photochemical agent to inactivate nucleic-acid-dependent entities such that their nucleic acid can not be replicated or transcribed.
  • the agents contemplated are low molecular weight compounds that react with nucleic acid when activated by UVA light.
  • the reaction between psoralens and nucleic acid results in either single covalent reactions (monoadducts) or crosslinking of the nucleic acid (di- adducts) which prevent the replication of nucleic acid-dependent entities.
  • Psoralens have been shown to be effective at inactivating a variety of both single and double-stranded RNA and DNA viruses.
  • Psoralens target nucleic acid and react to form either covalent crosslinks or monoadditions to nucleic acid when activated by illumination with ultraviolet A light. Hanson, C, "Photochemical inactivation of viruses with psoralens: An overview," Blood Cells 18: 7-25 (1992). Psoralen-modified nucleic acid can not be processed by enzymes such as reverse transcriptase which suggests that complete blockage of the transcription process can be achieved. Diseases which are transmitted by viral and bacterial contaminants in transfused blood products can therefore be effectively eliminated by photochemical decontamination.
  • the present invention contemplates devices and methods for photoactivation and specifically, for photoactivation of photoreactive nucleic acid binding compounds.
  • the present invention contemplates devices having an inexpensive source of electromagnetic radiation that is integrated into a unit.
  • the present invention contemplates a photoactivation device for treating photoreactive compounds, comprising: a) means for providing appropriate wavelengths of electromagnetic radiation to cause photoactivation of at least one photoreactive compound; b) means for supporting a plurality of samples in a fixed relationship with the radiation providing means during photoactivation; and c) means for maintaining the temperature of the samples within a desired temperature range during photoactivation.
  • the present invention also contemplates methods, comprising: a) supporting a plurality of sample containers, containing one or more photoreactive compounds, in a fixed relationship with a fluorescent source of electromagnetic radiation; b) irradiating the plurality of sample containers simultaneously with electromagnetic radiation to cause photoactivation of at least one photoreactive compound; and c) maintaining the temperature of the sample within a desired temperature range during photoactivation.
  • the major features of one embodiment of the device of the present invention involve: A) an inexpensive source of ultraviolet radiation in a fixed relationship with the means for supporting the sample containers, B) rapid photoactivation, C) large sample processing, D) temperature control of the irradiated samples, and E) inherent safety.
  • Type A405-TLGW/05 long wavelength ultraviolet lamp manufactured by P. W. Allen Co., London placed above the virus samples in direct contact with the covers of petri dishes containing the samples, and was run at room temperature. The total intensity delivered to the samples under these conditions was 1.3 x 10 5 photons /second cm 2 (or 0.7 mW/cm 2 or .0007 J/cm 2 sec) in the petri dish. Hearst, J. E., and Thiry, L., Nucleic Acids Research, 4:1339 (1977).
  • the present invention contemplates several preferred arrangements for the photoactivation device, as follows.
  • a preferred photoactivation device of the present invention has an inexpensive source of ultraviolet radiation in a fixed relationship with the means for supporting the sample vessels.
  • Ultraviolet radiation is a form of energy that occupies a portion of the electromagnetic radiation spectrum (the electromagnetic radiation spectrum ranges from cosmic rays to radio waves).
  • Ultraviolet radiation can come from many natural and artificial sources. Depending on the source of ultraviolet radiation, it may be accompanied by other (non-ultraviolet) types of electromagnetic radiation (e.g. visible light).
  • Particular types of ultraviolet radiation are herein described in terms of wavelength. Wavelength is herein described in terms of nanometers (“nm"; 10"9 meters). For purposes herein, ultraviolet radiation extends from approximately 180 nm to 400 nm.
  • a radiation source when a radiation source, by virtue of filters or other means, does not allow radiation below a particular wavelength (e.g. 320 nm), it is said to have a low end “cutoff” at that wavelength (e.g. "a wavelength cutoff at 300 nanometers”). Similarly, when a radiation source allows only radiation below a particular wavelength (e.g. 360 nm), it is said to have a high end “cutoff” at that wavelength (e.g. "a wavelength cutoff at 360 nanometers”).
  • any photochemical reaction it is desired to eliminate or least minimize any deleterious side reactions.
  • Some of these side reactions can be caused by the excitation of endogenous chromophores that may be present during the photoactivation procedure.
  • the endogenous chromophores are the nucleic acid bases themselves. Restricting the photoactivation process to wavelengths greater than 320 nm minimizes direct nucleic acid damage since there is very little absorption by nucleic acids above 313 nm.
  • the nucleic acid is typically present together with additional biological constituents. If the biological fluid is just protein, the 320 nm cutoff will be adequate for minimizing side reactions (aromatic amino acids do not absorb above 320 nm). If the biological fluid includes other analytes, there may be constituents that are sensitive to particular wavelengths of light. In view of the presence of these endogenous constituents, it is intended that the device of the present invention be designed to allow for irradiation within a small range of specific and desirable and thus avoid damage blood components. The preferred range of desirable wavelengths is between 320 and 350 nm.
  • BLB type fluorescent lamps are designed to remove wavelengths above 400 nm. This, however, only provides an upper end cutoff.
  • the device of the present invention comprises an additional filtering means.
  • the filtering means comprises a glass cut-off filter, such as a piece of Cobalt glass.
  • the filtering means is BK-7 glass, available from Shott Glass Technologies, Inc. Duryea, PA.
  • the filtering means comprises a liquid filter solution that transmits only a specific region of the electromagnetic spectrum, such as an aqueous solution of Co(N ⁇ 3)2- This salt solution yields a transmission window of 320-400 nm.
  • the aqueous solution of Co(N ⁇ 3)2 is used in combination with NiS ⁇ 4 to remove the 365 nm component of the emission spectrum of the fluorescent or arc source employed.
  • the Co-Ni solution preserves its initial transmission remarkably well even after tens of hours of exposure to the direct light of high energy sources.
  • cupric sulfate is a most useful general filter for removing the infra-red, when only the ultraviolet is to be isolated. Its stability in intense sources is quite good.
  • Other salts are known to one skilled in the art.
  • Aperture or reflector lamps may also be used to achieve specific wavelengths and intensities.
  • UV radiation When ultraviolet radiation is herein described in terms of irradiation, it is expressed in terms of intensity flux (milliwatts per square centimeter or “mW cm- 2" or J/cm 2 sec). "Output" is herein defined to encompass both the emission of radiation (yes or no; on or off) as well as the level of irradiation. In a preferred embodiment, intensity is monitored at 4 locations: 2 for each side of the plane of irradiation.
  • a preferred source of ultraviolet radiation is a fluorescent source.
  • Fluorescence is a special case of luminescence. Luminescence involves the absorption of electromagnetic radiation by a substance and the conversion of the energy into radiation of a different wavelength. With fluorescence, the substance that is excited by the electromagnetic radiation returns to its ground state by emitting a quantum of electromagnetic radiation. While fluorescent sources have heretofore been thought to be of too low intensity to be useful for photoactivation, in one embodiment the present invention employs fluorescent sources to achieve results thus far achievable on only expensive equipment.
  • fixed relationship is defined as comprising a fixed distance and geometry between the sample and the light source during the sample irradiation. Distance relates to the distance between the source and the sample as it is supported.
  • Geometry relates to the positioning of the light source. For example, it can be imagined that light sources could be placed around the sample holder in many ways (on the sides, on the bottom, in a circle, etc.).
  • the geometry used in a preferred embodiment of the present invention allows for uniform light exposure of appropriate intensity for rapid photoactivation.
  • the geometry of a preferred device of the present invention involves multiple sources of linear lamps as opposed to single point sources. In addition, there are several reflective surfaces and several absorptive surfaces. Because of this complicated geometry, changes in the location or number of the lamps relative to the position of the samples to be irradiated are to be avoided in that such changes will result in intensity changes.
  • the light source of the preferred embodiment of the present invention allows for rapid photoactivation.
  • the intensity characteristics of the irradiation device have been selected to be convenient with the anticipation that many sets of multiple samples may need to be processed. With this anticipation, a fifteen minute exposure time or less is a practical goal.
  • one element of the devices of the present invention is a means for supporting one or a plurality of blood bags.
  • the supporting means comprises a blood bag support placed between two banks of lights.
  • Temperature control is important because the temperature of the sample in the sample at the time of exposure to light can dramatically impact the results.
  • conditions that promote secondary structure in nucleic acids also enhance the affinity constants of many psoralen derivatives for nucleic acids.
  • Hyde and Hearst Biochemistry, 17, 1251 (1978). These conditions are a mix of both solvent composition and temperature.
  • irradiation at low temperatures enhances the covalent addition of HMT to 5S rRNA by two fold at 4°C compared to 20°C.
  • Thompson et al J. Mol. Biol. 147:417 (1981).
  • Even further temperature induced enhancements of psoralen binding have been reported with synthetic polynucleotides. Thompson et al, Biochemistry 21:1363 (1982).
  • Ultraviolet radiation can cause severe burns. Depending on the nature of the exposure, it may also be carcinogenic.
  • the light source of a preferred embodiment of the present invention is shielded from the user. This is in contrast to the commercial hand-held ultraviolet sources as well as the large, high intensity sources.
  • the irradiation source is contained within a housing made of material that obstructs the transmission of radiant energy (i.e. an opaque housing). No irradiation is allowed to pass to the user. This allows for inherent safety for the user.
  • a source of agitation may be provided either within or external to the photoactivation device for samples that require special handling.
  • Platelet products for example, generally require agitation to preserve the metabolic function of the cells.
  • Photoactivation compounds (or “photoreactive compounds”) defines a family of compounds that undergo chemical change in response to electromagnetic radiation. The following is a partial list of photoactivation compounds: Actinomycins
  • the preferred species of photoreactive compounds described herein is commonly referred to as the furocoumarins.
  • the present invention contemplates those compounds described as psoralens: [7H-furo(3,2-g)-(l)- benzopyran-7-one, or b-lactone of 6-hydroxy-5-benzofuranacrylic acid], which are linear:
  • AMT 4'- Aminomethyl-4,5',8-trimethylpsoralen
  • AMT also exhibits significant levels of mutagenicity.
  • a new group of psoralens was desired which would have the best characteristics of both 8-MOP and AMT: low mutagenicity and high nucleic acid binding affinity, to ensure safe and thorough inactivation of pathogens.
  • the compounds described here were designed to be such compounds.
  • 4'-primaryamino-substituted psoralens are defined as psoralen compounds which have an NH2 group linked to the 4'-position of the psoralen by a hydrocarbon chain having a total length of 2 to 20 carbons, where 0 to 6 of those carbons are independently replaced by NH or O, and each point of replacement is separated from each other point of replacement by at least two carbons, and is separated from the psoralen by at least one carbon.
  • 5'-primaryamino-substituted psoralens are defined as psoralen compounds which have an NH2 group linked to the 5'-position of the psoralen by a hydrocarbon chain having a total length of 1 to 20 carbons, where 0 to 6 of those carbons are independently replaced by NH or O, and each point of replacement is separated from each other point of replacement by at least two carbons, and is separated from the psoralen by at least one carbon.
  • the present invention contemplates synthesis methods for the novel compounds of the present invention, as well as new synthesis methods for known intermediates.
  • the novel compounds are mono, di or trialkylated 4'- or 5'-primaryamino-substituted psoralens.
  • TABLE 2 sets forth the nomenclature used for the psoralen derivatives discussed herein. Note that this section (entitled “B. Synthesis of the Psoralens”) the roman numerals used to identify compounds correlate with Schematics 1-6 only, and do not correlate with the compound numbers listed in Table 2.
  • 5 -TMP is converted to 4'-CMT using a large excess (20-50 equivalents) of highly carcinogenic, and volatile chloromethyl methyl ether.
  • Halomethylation of the 4,5',8-trialkylpsoralens with chloromethyl methyl ether or bromomethyl methyl ether is described in US Patent No. 4,124,598, to Hearst.
  • the bromo compound, 4'-BrMT is likewise prepared using bromomethyl methyl ether which is somewhat less volatile. Yields of only 30-60% of the desired intermediate are obtained.
  • the 5'-chloromethyl-4,4',8-trimethylpsoralen (5'-CMT) and 5'-bromomethyl-4,4',8-trimethylpsoralen (5'-BrMT) are prepared similarly, using the isomeric starting compound, 4,4',8-trimethylpsoralen (4'- TMP) [U.S. Patent No. 4,294,822, to Kaufman; McLeod, et al, "Synthesis of Benzofuranoid Systems. I. Furocoumarins, Benzofurans and Dibenzofurans," Tetrahedron Letters 237 (1972)].
  • Some of the figures referred to in the synthesis discussion that follows contain roman numerals used for labeling structures that embody more than one compound. This numbering system is distinct from, and not to be confused with, the numbering system of Table 2, above, which was used to identify several specific compounds.
  • Ai and A2 are independently selected from the group comprising H and an alkyl chain having 1-6 carbon atoms. Reaction of the 4,8-dialkyl-7- hydroxycoumarin with 2-chloro-3-butanone under typical basic conditions, provides 4,8-dialkyl-7-(l-methyl-2-oxo)propyloxycoumarin (I). This material is cyclized by heating in aqueous NaOH to provide 4,8-dialkyl-4',5'- dimethylpsoralen (II).
  • N- bromosuccinimide Treatment of the tetrasubstituted psoralen and N- bromosuccinimide (NBS) in a solvent at room temperature up to 150°C leads to bromination at the 4'- or 5'- position, depending upon the conditions used.
  • a catalyst such as dibenzoyl peroxide may be added, but is not necessary. If the solvent used is carbon tetrachloride at reflux, 4,8-dialkyl-5'-bromomethyl-4'- methylpsoralen (IV) is obtained in yields of 50% or greater. If methylene chloride is used at room temperature, only 4,8-dialkyl-4'-bromomethyl-5'-methylpsoralen (III) is obtained in >80% yield.
  • Benzylic bromination in other solvents can also be done, generating one of the isomeric products alone or in a mixture.
  • solvents include, but are not limited to 1,2-dichloroethane, chloroform, bromotrichloromethane and benzene.
  • 4,5',8- trialkylpsoralens can be made as follows.
  • the 4,8-dialkylcoumarins are prepared from 2-alkylresorcinols and a 3-oxoalkanoate ester by the Pechmann reaction (Organic Reactions Vol VII, Chap 1, ed. Adams et al, Wiley, NY, (1953)).
  • Claisen rearrangement of the resultant allyl ether gives 4,8-dialkyl-6-allyl-7-hydroxycoumarin.
  • the coumarins are converted to the 4,5',8-trialkylpsoralens using procedures similar to one of several previously described procedures (i.e., see, Bender et al, J. Org. Chem. 44:2176 (1979); Kaufman, US Patent Nos. 4,235,781 and 4,216,154, hereby incorporated by reference).
  • 4,5',8-Trimethylpsoralen is a natural product and is commercially available (Aldrich Chemical Co., Milwaukee, WI).
  • the 4,4',8-trialkylpsoralens can be prepared in two steps also starting from the 4,8-dialkyl-7-hydroxy coumarins discussed above.
  • the co marin is treated with an alpha-chloro ketone under basic conditions to give the 4,8-dialkyl-7-(2- oxoalkoxy)coumarin. Cyclization of this intermediate to the 4,4',8- trialkylcoumarin occurs by heating in aqueous base.
  • Longer chain 4'-(w-haloalkyl)trialkylpsoralens (herein referred to as longer chain 4'-HATP) where the alkyl groups are selected from the group (CH2)2 to (CH2)lO can be prepared under Freidel-Crafts conditions as discussed elsewhere (Olah and Kuhn, J. Org. Chem., 1964, 29, 2317; Freidel-Crafts and Related Reactions, Vol. ⁇ , Part 2, Olah, ed., Interscience, NY, 1964, p 749).
  • the terminal hydroxy group can be transformed to an amino group under a variety of conditions (for example see Larock, 'Comprehensive Organic Transformations," VCH Publishers, NY, 1989). Particularly, the hydroxy group can be converted to the ester of methanesulfonic acid (structure VI) in the presence of methanesulphonyl chloride (CH3SO3CI). This can subsequently be converted to the azide in refluxing ethanol and the azide reduced to the final amine, structure VII
  • a preferred method of preparation of structure VII uses the reaction of 4'- HATP with a primary linear alcohol containing a protected amine (e.g., a phthalimido group) at the terminal position in a suitable solvent such as DMF at 25 - 150°C to give V.
  • the amine is then deprotected under standard conditions (e.g., hydrazine or aqueous MeNH2 to deprotect a phthalimido group [higher alkyl hydrazines, such as benzyl hydrazines, are also contemplated]) to give VII.
  • structure VI can be reacted with diamines, H2N-(B')-NH2 where B' is an alkyl chain (e.g., 1,4,-butanediamine), a monoether (e.g., 3-oxa-l,5- pentanediamine) or a polyether (e.g., 3,6-dioxa-l,8-octanediamine) to give the final product, compound VIII (examples of compounds in this structure group are Compounds 8, 13 and 14).
  • B' is an alkyl chain
  • a monoether e.g., 3-oxa-l,5- pentanediamine
  • a polyether e.g., 3,6-dioxa-l,8-octanediamine
  • structure X (examples are Compounds 1, 5, 6, 9, 10 and 11), the product can conveniently be prepared from the 4'-HATP and the appropriate diamine of structure IX.
  • This method is also applicable to final products that contain more than two nitrogens in the chain (structure XIII) (examples are Compounds 12 and 15) starting from polyamines of structure XII (e.g., norspermidine or spermine [commercially available from Aldrich, Milwaukee, WI]), however, in this case isomeric structures are also formed in considerable amounts.
  • the preferred method for the preparation of structure XIII is reductive amination of the psoralen-4'-alkanal (XI) with a polyamine of structure XII and a reducing agent such as sodium cyanoborohydride.
  • This reductive amination is applicable to the synthesis of compounds X as well.
  • These compounds can also be conveniently prepared by formylation of the 4'-hydrido compounds with a formamide and POCI3, or with hexamethylene tetraamine in acid.
  • Longer chain alkanals can be prepared from the 4'-HATP compounds by conversion of the terminal halo group to an aldehyde functionality (for example, Durst, Adv. Org. Chem. 6:285 (1969)).
  • these compounds (structures XIV) (an example is Compound 3) are prepared either 1) by reaction of the 4'-HATP with potassium phthalimide or azide and subsequent liberation of the desired amine as before, for example, with hydrazine, or 2) conversion of the 4'-HATP to the cyanide compound, followed by reduction, for example with NaBH4-CF3C ⁇ 2H.
  • the 4,4',8- trialkylpsoralens or the 4,4',8-trialkyl-5'-methylpsoralens can be converted to the 5'-(w-haloalkyl)-4,4',8-trialkylpsoralens, (herein called 5'-HATP), as detailed in Schematic 5, below. (See Kaufman, U.S. Patent No. 4,294,822 and 4,298,614 for modified version).
  • the present invention contemplates binding new and known compounds to nucleic acid, including (but not limited to) genomic nucleic acid, and specifically, nucleic acid encoding for various cytokines.
  • One approach of the present invention to binding photoactivation compounds to nucleic acid is photobinding.
  • Photobinding is defined as the binding of photobinding compounds in the presence of photoactivating wavelengths of light.
  • Photobinding compounds are compounds that bind to nucleic acid in the presence of photoactivating wavelengths of light.
  • the present invention contemplates methods of photobinding with compounds of the present invention.
  • One embodiment of the method of the present invention for photobinding involves the steps: a) providing a photobinding compound of the present invention; and b) mixing the photobinding compound with nucleic acid in the presence of photoactivation wavelengths of electromagnetic radiation.
  • the invention further contemplates a method for modifying nucleic acid, comprising the steps: a) providing photobinding compound of the present invention and nucleic acid; and b) photobinding the photobinding compound to the nucleic acid, so that a compound:nucleic acid complex is formed.
  • a method for modifying nucleic acid comprising the steps: a) providing photobinding compound of the present invention and nucleic acid; and b) photobinding the photobinding compound to the nucleic acid, so that a compound:nucleic acid complex is formed.
  • the present invention contemplates treating a blood product with a photoactivation compound and illumination before storage. This procedure inhibits the proliferation of cells or the production of cytokines, during storage which occurs before using the blood product.
  • inhibitor is here defined as a reduction in production. This is distinct from “total inhibition”, where all production is halted, or “substantial inhibition,” wherein the production is at background or baseline levels relative to the particular assay used.
  • “Inhibition efficiency" of a compound is defined as the level of inhibition the compound can achieve at a given concentration of compound or dose of irradiation. For example, if 100 ⁇ M of a hypothetical compound X inhibits 90% of cytokine production whereas under the same experimental conditions, the same concentration of compound Y inhibits only 10% of cytokine production, then compound X would have a better "inhibition efficiency" than compound Y.
  • the threshold below which the inhibition method is complete is taken to be the level of inhibition which is sufficient to prevent an adverse reaction from occurring due to contact with the material. It is recognized that in this practical scenario, it is not essential that the methods of the present invention result in “total inhibition”. That is to say, “substantial inhibition” will be adequate as long as the fraction of cytokine produced is insufficient to cause adverse reaction in a transfusion recipient. Thus “substantially all” of the cytokine production is when the proliferation of cells is at background or baseline levels relative to the particular assay used for detecting cytokines.
  • the inhibition method of the present invention renders cytokine production substantially inhibited. In one embodiment, the inhibition method renders cytokine production in stored platelet preparations substantially inhibited.
  • cytokine production results from light induced binding of psoralens to the nucleic acid (either DNA or mRNA) which encodes for cytokines.
  • nucleic acid either DNA or mRNA
  • cytokines Several cell types produce cytokines or contribute to the stimulation of proliferation of cells, including, but not limited to, T cells, monocytes, macrophages, B cells, fibroblast cells, endothelial cells, bone marrow stromal cells and platelets.
  • Lymphocytes are a major source of proliferation of cells in platelet preparations. Lymphocytes are herein defined as white blood cells and the sub-population, including B-cells, T-cells, and null cells.
  • the present invention further contemplates that methods of the present invention also act to inhibit the expression of protein synthesis by leukocytes in general.
  • Leukocytes are defined as cells from the following classes: neutrophils, lymphocytes, monocytes, eosinophils and basophils.
  • "Expression" of proteins is defined as the production of proteins by cells, including, but not limited to, transcription and translation. As the data in the below experiments show, the expression of several proteins (including IL-8 and IL-1B) have been shown to be inhibited by the methods of the present invention.
  • Synthetic media is herein defined as an aqueous synthetic blood or blood product storage media.
  • the present invention contemplates treating blood products in a synthetic media comprising a buffered saline solution. This method reduces harm to blood products and permits the use of much lower concentrations of photoactivation compounds.
  • the psoralen photochemical reaction used in the present inhibition method has the potential to eliminate bacteria, protozoa, and viral contaminants as well.
  • Psoralen-based decontamination h the potential to eliminate all infectious agents from the blood supply, regardless of the pathogen involved.
  • psoralen-based decontamination has the ability to sterilize blood products after collection and processing, which in the case of platelet concentrates could solve the problem of low level bacterial contamination and result in extended storage life. Morrow J.F., et al, JAMA 266: 555-558 (1991); Bertolini F., et al, Transfusion 32: 152-156 (1992).
  • activation is here defined as the altering of the nucleic acid of a cell or unit of pathogen so as to render the cell or unit of pathogen incapable of replication. This is distinct from “total inactivation”, where all pathogen units present in a given sample are rendered incapable of replication, or “substantial inactivation,” where most of the pathogen units present are rendered incapable of replication. "Inactivation efficiency" of a compound is defined as the level of inactivation the compound can achieve at a given concentration of compound or dose of irradiation.
  • an "inactivation” method may or may not achieve “total inactivation,” it is useful to consider a specific example.
  • a bacterial culture is said to be inactivated if an aliquot of the culture, when transferred to a fresh culture plate and permitted to grow, is undetectable after a certain time period.
  • a minimal number of viable bacteria must be applied to the plate for a signal to be detectable. With the optimum detection method, this minimal number is 1 bacterial cell. With a sub optimal detection method, the minimal number of bacterial cells applied so that a signal is observed may be much greater than 1.
  • the detection method determines a "threshold" below which the "inactivation method” appears to be completely effective (and above which "inactivation” is, in fact, only partially effective). In a similar example, a threshold amount of T-cells are required that are able to replicate to set off GVHD symptoms.
  • inactivation means that a unit of pathogen or a cell is rendered incapable of replication.
  • the detection method can theoretically be taken to be the measurement of the level of infection with a disease as a result of exposure to the material.
  • the threshold below which the inactivation method is complete is then taken to be the level of inactivation which is sufficient to prevent disease from occurring due to contact with the material. It is recognized that in this practical scenario, it is not essential that the methods of the present invention result in “total inactivation”. That is to say, “substantial inactivation” will be adequate as long as the viable portion is insufficient to cause disease. Thus “substantially all" of a pathogen is inactivated when any viable portion of the pathogen which remains is insufficient to cause disease.
  • the inactivation method of the present invention renders nucleic acid in pathogens substantially inactivated. In one embodiment, the inactivation method renders pathogen nucleic acid in blood preparations substantially inactivated.
  • inactivation results from light induced binding of psoralens to nucleic acid.
  • inactivation method of the present invention be limited by the nature of the nucleic acid; it is contemplated that the inactivation method render all forms of nucleic acid (whether DNA, mRNA, etc.) substantially inactivated.
  • the compound's ability to inhibit cytokine production and inactivate T-cells may be determined by treating a platelet preparation with the compound and ultraviolet light. The increase in cytokines is measured after a storage period. The ability of T-cells to proliferate is measured in a proliferative assay. Screens of this type are described in detail in the examples below.
  • the second property that is important in testing a compound for use in methods of the present invention is mutagenicity.
  • the most widely used mutagen /carcinogen screening assay is the Ames test. This assay is described by D.M. Maron and B.N. Ames in Mutation Research 113: 173 ( 1983) and a specific screen is described in detail in Example 17, below.
  • the Ames test utilizes several unique strains of Salmonella typhimurium that are histidine- dependent for growth and that lack the usual DNA repair enzymes. The frequency of normal mutations that render the bacteria independent of histidine (i.e., the frequency of spontaneous revertants) is low. The test allows one to evaluate the impact of a compound on this revertant frequency.
  • the compound to be tested is mixed with the bacteria on agar plates along with the liver extract.
  • the liver extract serves to mimic metabolic action in an animal. Control plates have only the bacteria and the extract.
  • the mixtures are allowed to incubate. Growth of bacteria (if any) is determined by counting colonies. A positive Ames test is one where the number of colonies on the plates with mixtures containing the compound significantly exceeds the number on the corresponding control plates.
  • a new compound (X) can be evaluated as a potential blood photodecontamination compound as well as a potential compound for preventing transfusion complications such as GVHD, FNHTRs and MLR side effects, as shown in Table 4, below.
  • X is initially evaluated in Step I.
  • X is screened in the cytokine inhibition assay at several different concentrations between 1 and 500 ⁇ M, as represented in FIG 11. If the compound shows inhibition activity the compound is then screened in the Ames assay. Finally, if the compound shows low mutagenicity in the Ames assay, the new compound is identified as a useful agent for inactivation of pathogens.
  • the present invention contemplates several different formulations and routes by which the compounds described herein can be delivered. This section is merely illustrative, and not intended to limit the invention to any form or method of introducing the compound.
  • the compounds of the present invention may be introduced in an inhibition method in several forms.
  • the compounds may be introduced as an aqueous solution in water, saline, a synthetic media such as "SterilyteTM 3 0" (contents set forth at the beginning of the Experimental section, below) or a variety of other media.
  • the compounds can further be provided as dry formulations, with or without adjuvants.
  • the new compounds may also be provided by many different routes.
  • the compound may be introduced to the reaction vessel, such as a blood bag, at the point of manufacture.
  • the compound may be added to the material to be treated after the material has been placed in the reaction vessel.
  • An invention which inactivates viruses as well as human T-cells has clear applications in the field of vaccine therapy and immunization.
  • the preparation of viral vaccines is contemplated by methods of the present invention.
  • the present invention contemplates producing vaccines to a wide variety of viruses, including human viruses and animal viruses, such as canine, feline, bovine, porcine, equine and bovine viruses.
  • the contemplated method is suitable for inactivating double stranded DNA viruses, single stranded DNA viruses, double-stranded RNA viruses and single-stranded RNA viruses, including both enveloped and non-enveloped viruses.
  • a contemplated method for producing a vaccine for inoculation of a mammalian host susceptible to infection by a virus comprises growing culture of virus, isolated from an infected host, in a suitable mammalian cell culture, exposing at least one of the seed viruses to a psoralen (at a concentration of between ) and ultraviolet light (at a wavelength between approximately 320 nm and 400 nm and an intensity between approximately 0.1 mW/cm 2 and 5 W/cm 2 ), more specifically, such conditions as are sufficient to inactivate the virus to a non-infectious degree, under conditions which substantially preserve the antigenic characteristics of the inactivated viral particles, and combining said inactivated virus with a suitable adjuvant.
  • a psoralen at a concentration of between
  • ultraviolet light at a wavelength between approximately 320 nm and 400 nm and an intensity between approximately 0.1 mW/cm 2 and 5 W/cm 2
  • the inactivated virus may be formulated in a variety of ways for use as a vaccine.
  • concentration of the virus will generally be from about 10 ⁇ to l ⁇ 9 plaque forming units (pfu)/ml, as determined prior to inactivation, with a total dosage of at least 10 ⁇ plaque forming units per dose (pfu/dose), usually at least 10 ⁇ pfu/dose, preferably at least 10? pfu/dose.
  • the total dosage will usually be at or near about 10 ⁇ pfu/dose, more usually being about 10 ⁇ pfu/dose.
  • the vaccine may include cells or may be cell-free.
  • the vaccine may be administered subcutaneously, intramuscularly, intraperitoneally, orally, or nasally.
  • a specific dosage at a specific site will range from about 0.1 ml to 4 ml, where the total dosage will range from about 0.5 ml to 8 ml.
  • the number of injections and their temporal spacing may be highly variable, but usually 1 to 3 injections at 1, 2 or 3 week intervals are effective.
  • the present invention contemplates that in vivo activity of a blood product is not destroyed or significantly lowered if a sample of blood product which is decontaminated by methods of the present invention tests as would a normally functioning sample of blood product in known assays for blood product function.
  • in vivo activity is not destroyed or significantly lowered if pH of the platelets are substantially the same in platelets treated by the methods of the present invention and stored 5 days as they are in untreated samples stored for 5 days.
  • “Substantially the same" pH means that the values fall within the range of error surrounding that particular data point.
  • the second factor is whether the compounds used are toxic or mutagenic to the patient treated.
  • a "compound displaying low mutagenicity” is defined here as a compound which does not display positive results in in vivo mutagenicity tests. Where these test results are not available, “compound displaying low mutagenicity” is defined as a compound which does not display positive results in the Ames test.
  • the compounds used in the present invention are especially useful because they display the unlinking of cytokine inhibition efficiency from mutagenicity. The compounds exhibit powerful increase in inhibitory effects without a concomitant rise in mutagenicity.
  • graft versus host disease is caused by T lymphocytes contained in a donor graft, such as a bone marrow transplant, that recognize antigenic disparities between donor and recipient.
  • a donor graft such as a bone marrow transplant
  • Patients who are immunocompromised or immune susceptible are potentially at risk to experience GVHD.
  • Individuals at risk include immunodeficient children, newborns, bone marrow transplant recipients, and to a lesser extent, patients receiving chemo-radiation therapy for solid tumors.
  • Transfusion associated graft versus host disease is a subset of GVHD that can result when transfused lymphocytes in a donor blood product engraft and multiply in the recipient, causing the donor cells to react against the tissues of the recipient.
  • TA-GVHD can occur when a transfusion recipient is heterozygous for human leukocyte antigen (HLA) alleles and shares one of these HLA haplotypes with an HLA homozygous transfusion donor.
  • HLA human leukocyte antigen
  • LDA limiting dilution assay
  • an increase in the 2500 Rad dosage is viewed as potentially damaging to the treated blood product's function.
  • a method of inactivating T-cells that offers a broader safety margin and that can be monitored for effectiveness is needed.
  • any treatment which selectively inactivates leukocytes and leaves the function of the graft intact should suffice to prevent GVHD and TA GVHD.
  • An effective technique for the inactivation of leukocytes, and thus the prevention of GVHD and TA GVHD is provided by the methods and compounds of the present invention.
  • the acid is preferably selected so as to contain an anion which is non-toxic and pharmacologically acceptable, at least in usual therapeutic doses.
  • Representative salts which are included in this preferred group are the hydrochlorides, hydrobromides, sulphates, acetates, phosphates, nitrates, methanesulphonates, ethanesulphonates, lactates, citrates, tartrates or bitartrates, and maleates.
  • Other acids are likewise suitable and may be employed as desired.
  • fumaric, benzoic, ascorbic, succinic, salicylic, bismethylenesalicylic, propionic, gluconic, malic, malonic, mandelic, cinnamic, citraconic, stearic, palmitic, itaconic, gly colic, benzenesulphonic, and sulphamic acids may also be employed as acid addition salt-forming acids.
  • HEPES buffer contains 8.0 g of 137 mM NaCl, 0.2 g of 2.7 mM KCl, 0.203 g of 1 mM MgCl2(6H2 ⁇ ), l.Og of 5.6 mM glucose, 1.0 g of 1 mg/ml Bovine Serum Albumin (BSA) (available from Sigma, St. Louis, MO), and 4.8 g of 20 mM HEPES (available from Sigma, St.
  • BSA Bovine Serum Albumin
  • phosphate buffered synthetic media is formulated for platelet treatment. It may be used to replace some of the plasma present in platelet preparations during irradiation to provide better optical transmittance and to buffer the platelets during treatment.
  • synthetic media comprises between 1 % and 60% of the platelet concentrate preparation. In a preferred embodiment, synthetic media comprises approximately 35% of the platelet concentrate preparation. This can be formulated in one step, resulting in a pH balanced solution (e.g. pH 7.2), by combining the following reagents in 2 liters of distilled water:
  • Another synthetic media useful in the present invention contains the following reagents:
  • PCR Polymerase Chain Reaction
  • PCR is a method for increasing the concentration of a segment of a target sequence in a mixture of genomic DNA without cloning or purification. See K.B. Mullis et al., US Patents Nos. 4,683,195 and 4,683,202, hereby incorporated by reference.
  • This process for amplifying the target sequence consists of introducing a large excess of two oligonucleotide primers to the DNA mixture containing the desired target sequence, followed by a precise sequence of thermal cycling in the presence of a DNA polymerase.
  • the two primers are complementary to their respective strands of the double stranded target sequence.
  • the mixture is denatured and the primers then to annealed to their complementary sequences within the target molecule.
  • the primers are extended with a polymerase so as to form a new pair of complementary strands.
  • the steps of denaturation, primer annealing, and polymerase extension can be repeated many times (i.e. denaturation, annealing and extension constitute one "cycle;” there can be numerous "cycles") to obtain a high concentration of an amplified segment of the desired target sequence.
  • the length of the amplified segment of the desired target sequence is determined by the relative positions of the primers with respect to each other, and therefore, this length is a controllable parameter.
  • the method is referred to by the inventors as the "Polymerase Chain Reaction”. Because the desired amplified segments of the target sequence become the predominant sequences (in terms of concentration) in the mixture, they are said to be "PCR amplified”. With PCR, it is possible to amplify a single copy of a specific target sequence in genomic DNA to a level detectable by several different methodologies (e.g. hybridization with a labeled probe; incorporation of biotinylated primers followed by avidin-enzyme conjugate detection; incorporation of ⁇ P labeled deoxynucleotide triphosphates, e.g. dCTP or dATP, into the amplified segment). In addition to genomic DNA, any oligonucleotide sequence can be amplified with the appropriate set of primer molecules.
  • the PCR amplification process is known to reach a plateau concentration of specific target sequences of approximately 10 " ⁇ M.
  • a typical reaction volume is 100 ⁇ l, which corresponds to a yield of 6 x 10 ⁇ double stranded product molecules.
  • PCR is a polynucleotide amplification protocol.
  • the amplification factor that is observed is related to the number (n) of cycles of PCR that have occurred and the efficiency of replication at each cycle (E), which in turn is a function of the priming and extension efficiencies during each cycle.
  • E the efficiency of replication at each cycle.
  • Amplification has been observed to follow the form E n , until high concentrations of PCR product are made. At these high concentrations (approximately 10 " 8 M/l) the efficiency of replication falls off drastically. This is probably due to the displacement of the short oligonucleotide primers by the longer complementary strands of PCR product.
  • sequences of the polynucleotide primers used in this experimental section are as follows: DCD03: 5' ACT AGA AAA CCT CGT GGA CT 3'
  • DCD05 5'GGGAGAGGGGAGCCCGCACG3'
  • DCD06 5'CAATTTCGGGAAGGGCACTC3'
  • DCD07 5'GCTAGTATTCCCCCGAAGGT3'
  • DCD03 as a common forward primer, the pairs generate amplicons of length 127, 327, and 1072 bp. These oligos were selected from regions that are absolutely conserved between 5 different dHBV isolates (DHBV1, DHBV3, DHBV16, DHBV22, and DHBV26) as well as from heron HBV (HHBV4).
  • a photoactivation device for decontaminating blood products according to the method of the present invention.
  • This device comprises: a) means for providing appropriate wavelengths of electromagnetic radiation to cause photoactivation of at least one photoreactive compound; b) means for supporting a plurality of blood products in a fixed relationship with the radiation providing means during photoactivation; and c) means for maintaining the temperature of the blood products within a desired temperature range during photoactivation.
  • FIG. 1 is a perspective view of one embodiment of the device integrating the above-named features.
  • the figure shows an opaque housing (100) with a portion of it removed, containing an array of bulbs (101) above and below a plurality of representative blood product containing means (102) placed between plate assemblies (103, 104) which filter certain wavelengths of light.
  • the plate assemblies (103, 104) are described more fully, subsequently.
  • the housing (100) can be opened via a latch (105) so that the blood product can be placed appropriately. As shown in FIG. 1, the housing (100), when closed, completely contains the irradiation from the bulbs (101). During irradiation, the user can confirm that the device is operating by looking through a safety viewport (106) which does not allow transmission of ultraviolet light to the user.
  • the housing (100) also serves as a mount for several electronic components on a control board (107), including, by way of example, a main power switch, a count down timer, and an hour meter.
  • the power switch can be wired to the count down timer which in turn is wired in parallel to an hour meter and to the source of the electromagnetic radiation.
  • the count down timer permits a user to preset the irradiation time to a desired level of exposure.
  • the hour meter maintains a record of the total number of radiation hours that are provided by the source of electromagnetic radiation. This feature permits the bulbs (101) to be monitored and changed before their output diminishes below a minimum level necessary for rapid photoactivation.
  • FIG. 2 is a cross-sectional view of the device shown in FIG. 1 along the lines of 2-.-2.
  • FIG. 2 shows the arrangement of the bulbs (101) with the housing (100) opened.
  • a reflector (108A, 108B) completely surrounds each array of bulbs (101).
  • Blood product containing means (102) are placed between upper (103) and lower (104) plate assemblies (e.g. BK-7 glass, Shott Glass Technologies, Inc., Duryea, PA).
  • Each plate assembly is comprised of an upper (103A, 104A) and lower (103B, 104B) plates.
  • the plate assemblies (103, 104) are connected via a hinge (109) which is designed to accommodate the space created by the blood product containing means (102).
  • the upper plate assembly (103) is brought to rest just above the top of the blood product containing means (102) supported by the lower plate (104B) of the lower plate assembly (104).
  • Detectors may be conveniently placed between the plates (103A, 103B, 104A, 104B) of the plate assemblies (103, 104). They can be wired to a printed circuit board (111) which in turn is wired to the control board (107).
  • FIG. 3 is a cross-sectional view of the device shown in FIG. 1 along the lines of 3—3.
  • Six blood product containing means (102) e.g. Teflon ⁇ M platelet unit bags
  • the temperature of the blood product can be controlled via a fan (112) alone or, more preferably, by employing a heat exchanger (113) having cooling inlet (114) and outlet (115) ports connected to a cooling source (not shown).
  • FIG. 4 is a cross-sectional view of the device shown in FIG. 1 along the lines of 4—4. FIG. 4 more clearly shows the temperature control approach of a preferred embodiment of the device.
  • Upper plate assembly plates (103A, 103B) and lower plate assembly plates (104A, 104B) each create a temperature control chamber (103C, 104C), respectively.
  • the fan (112) can circulate air within and between the chambers (103C, 104C).
  • the heat exchanger (113) is employed, the circulating air is cooled and passed between the plates (103A, 103B, 104A, 104B).
  • Step 1 3-Chloro-2-butanone (29.2 mL, 0.289 mol) was added to a mechanically stirred suspension of 7-hydroxy-4,8-dimethylcoumarin (50.00 g, 0.263 mol) and powdered K2CO3 (54 g, 0.391 mol) in acetone (500 mL). The slurry was refluxed for 15 hours, after which the solvent was stripped off. To remove the salt, the solid was stirred in 1.2 L of water, filtered, and rinsed with water until the pH of the mother liquor was neutral (pH 5-7).
  • the brown filtrate was dissolved in boiling methanol (150 mL), allowed to cool to room temperature to form a thick paste and rinsed with ice cold methanol to remove most of the brown impurity, giving 4,8-dimethyl-7-(l-methyl-2-oxo)propyloxy-coumarin (67.7 g, 99.0% yield) as an off-white solid, melting point 95-96°C.
  • Step 2 A suspension of 4,8-dimethyl-7-(l-methyl-2-oxo)propyloxy-coumarin (67.5g, 0.260 mol), 10% aqueous NaOH (114 mL, 0.286 mol) and water (900 mL) was heated for 2-4 hours at 70-85°C. The mixture was then allowed to cool to room temperature. The solid was filtered, and then rinsed with chilled water (1.5 L) until the mother liquor became colorless and pH was neutral (pH 5-7). The product was air and vacuum dried to give 4, 4',5',8-tetramethylpsoralen (56.3 g, 89.5%) as a white solid, mp 197-199°C. NMR: d 2.19 (s, 3H), 2.42 (s, 3H), 2.51 (s, 3H), 2.56 (s, 3H), 6.23 (s, IH), 7.40 (s, IH).
  • Step 3 Dry 4,4',5',8-tetramethyl ⁇ soralen (lO.OOg, 41.3mmol) was dissolved in methylene chloride (180 mL) at room temperature. N-Bromosuccinimide (8.09g, 45.3 mmol) was added and the reaction mixture and stirred 4.5 hours. The solvent was completely removed and the resulting solid was stirred with water (200mL) for 0.5-1 h, filtered and cold triturated with additional water (approximately 500 mL) to remove the succinimide by-product. The crude product (i.e.
  • 4'-bromomethyl-4, 5',8-trimethylpsoralen was dried in a vacuum desiccator with P2O5 then recrystallized in a minimum amount of boiling toluene (200-300 mL) to give 4'-bromomethyl-4, 5',8-trimethylpsoralen (10.2g), a pale yellow solid.
  • Example 2 was refluxed in carbon tetrachloride (100 mL) until it dissolved. N-Bromosuccinimide (1.88 g, 10.5 mmol) and benzoyl peroxide (80 mg) were then added and the mixture was refluxed for 15 hours. Upon cooling to room temperature methylene chloride (100 mL) was added to dissolve the solid and the solution was washed with water (4 x 150 mL), then brine, and dried with anhydrous Na2S ⁇ 4.
  • Step 1 4'-Bromomethyl-4,5',8-trimethylpsoralen (3.09 g, 9.61 mmol), (synthesis described in Example 2), and N-(2-hydroxyethyl)phthalimide (4.05 g, 21.2 mmol) were stirred in dry dimethylformamide (65 mL). Dry N2 gas was bubbled gently into the reaction mixture. The reaction mixture was heated to 100 °C for 4.5 hours then allowed to cool to room temperature and put in the freezer for several hours. The crystalline product was filtered and washed with MeOH followed by H2O. The solid was further tritutrated with MeOH (100 mL) to remove the impurities. The crude product was air dried and dissolved in CHCI3 (150 mL).
  • Step 2 4'-[4-(N-phthalimido)-2-oxa]butyl-4,5',8-trimethylpsoralen (1.56 g, 3.61 mmol) was suspended in tetrahydrofuran (75 mL) at room temperature. Methylamine (40 % aqueous solution, 25 mL, 290 mmol) was added to the suspension and stirred overnight. The solvent and methylamine were completely removed. The resulting solid was taken up in 0.3 N HCl aqueous solution (25 mL). The acid suspension was rinsed three times with 40 mL CHCI3 then taken to pH 11 with 20 % aqueous NaOH.
  • CHCI3 (3x60 mL) was used to extract the product (i.e. 4'-(4-amino-2-oxa)butyl-4,5',8-trimethylpsoralen) from the basified layer.
  • the combined CHCI3 layers were washed with H2O (100 mL) followed by brine (100 mL) then dried over anhydrous Na2S ⁇ 4 and concentrated to give 4'-(4- amino-2-oxa)butyl-4,5',8-trimethylpsoralen, mp 139-141 °C. Purity was greater than 99 % by NMR.
  • Step 2 may be performed using either hydrazine or butylamine rather than methylamine.
  • the method which uses butylamine is preferred for larger scale syntheses because, while an excess of methylamine is needed due to volatization, the same is not true for butylamine.
  • the method using butylamine was carried out as follows: 28.3 g phthalimide has been de protected with n-butylamine in propanol. The crude reaction solution is then treated with HCl to precipitate out the product. Thus the reaction mixture in 285 mL of 1-propanol was treated with HCl gas to pH 2.
  • the method using hydrazine was carried out as follows: The phthalimide precursor (6 mol) was deprotected with hydrazine and after concentration and acid-base extractions the crude amine was obtained in 30 L of ethylene dichloride. To this was added HCl gas (0.14Kg) via dispersion tube over 40 minutes maintaining the temperature at 15-25 °C. The resultant slurry was stirred an additional 1 hour. The solids were collected on a Buchner funnel. Upon drying in an air dryer at 80 °C for 2 hours, 0.945 kg of crude 4'-(4-amino-2-oxa)butyl- 4,5',8-trimethylpsoralen was obtained.
  • the first method is a preferred embodiment of the present invention because of its high yield and purity.
  • the second method starts with the preparation of 4'-chloromethyl-4,5',8- trimethylpsoralen from commercially available 4,5',8-trimethylpsoralen, as described above.
  • the synthesis of 4'-(4-amino-2-oxa)butyl-4,5',8- trimethylpsoralen hydrochloride is achieved in four (4) steps:
  • STEP 1 4'-Chloromethyl-4,5',8-trimethylpsoralen (550 mg, 1.99 mmol) and ethylene glycol (6.8 ml, 121.9 mmol) were heated in acetone (6 mL) to 50-60 °C for 3.5 hrs. After 2 hrs heating, the white suspension had turned to a clear light yellow solution. The acetone and ethylene glycol were removed on the rotoevaporator and water (50 mL) was added to the residue.
  • STEP 4 The 4'-(4-Azido-2-oxa)butyl-4,5',8-trimethylpsoralen (1.65 g, 5.03 mmol) was dissolved in tetrahydrofuran (10 mL). Triphenylphosphine (1.59 g, 6.08 mmol) and six drops of water were added to the foregoing solution. After stirring at room temperature overnight, the light yellow solution was concentrated. The residue was dissolved in CHCI3 (90 mL) and extracted with 0.3 N aqueous HCl (30 mL, then 2x5 mL). Combined HCl layers was carefully treated with K2CO3 until saturated. The base solution was extracted with CHCI3 (3x60 mL).
  • This example describes the synthesis of Compound 18.
  • N-methylformanilide (16.0 mL, 0.134 mol) in acetonitrile (130 mL) was added phosphorus oxychloride (12.5 mL, 0.134 mol), then 4,4',8-trimethylpsoralen (5.0 g, 21.9 mmol) (described in McLeod, et al, Tetrahedron Letters No. 3:237 (1972)).
  • the temperature was kept between 0-10 °C during addition of the psoralen by use of an ice/water bath.
  • the slurry was stirred at 50°C for 2 days protected from moisture with a drierite drying tube.
  • the reaction mix was allowed to cool to room temperature, then chilled in an ice/water bath.
  • the acetonitrile was decanted off, then ice/water (150 mL) was added to the orange slurry and stirred for lh.
  • the orange solid was filtered off and rinsed with chilled water, then chilled acetonitrile.
  • the crude product was recrystallized and charcoal decolorized in dichloroethane (600 mL) to give 4,4',8-trimethyl-5'- psoralencarboxaldehyde (3.59g, 64.0%) as a pale yellow-orange solid, sublimes > 250°C, decomp. > 300°C.
  • reaction solvents dichloroethane and water
  • dichloroethane aqueous layer was extracted three times with dichloroethane.
  • the organic layers were combined, rinsed with brine then dried (anhyd Na2S ⁇ 4) and stripped under vacuum to give the bulk of the product, 5'-bromomethyl-4,4',8-trimethylpsoralen, (13.13g, combined yield of 86.4%), as a pale yellow solid, mp 201-202 °C.
  • N-Hydroxyethylphthalimide (3.00 g, 15.5 mmol) was dissolved in DMF (5 mL) at 60-64°C while N2 was bubbled into the solution.
  • Sodium iodide (0.01 g, 0.067 mmol) and 5'-bromomethyl-4,4',8-trimethylpsoralen (1.00 g, 3.11 mmol) were added and the slurry was stirred under these conditions overnight.
  • STEP 2 4'-(7-Hydroxy-2,5-oxa)heptyl-4,5',8-trimethylpsoralen (781 mg, 2.25 mmol) was dissolved in CH2CI2 (2.5 mL) under a N2 stream at ⁇ 10 °C. Triethylamine (363 mg, 3.59 mmol) was added. Methanesulfonyl chloride (362 mg, 3.16 mmol) was slowly dropped in to keep the temperature below 10 °C. After addition was completed, the mixture was kept below 10 °C for 15 more minutes. The mixture was stirred at room temperature overnight then CH2CI2 (50 mL) was added.
  • STEP 3 4'-(7-Methanesulfonyloxy-2,5-oxa)heptyl-4,5',8-trimethylpsoralen (288 mg, 0.678 mmol) and sodium azide (88.2 mg, 1.36 mmol) were refluxed in 3 mL of 95% ethyl alcohol for 8 hours. The reaction solution was let cool and cold water (50 mL) was added. The water layer was poured away.
  • STEP 4 4'-(7-Azido-2,5-oxa)heptyl-4,5',8-trimethylpsoralen (122 mg, 0.33 mmol), triphenylphosphine (129 mg, 0.49 mmol) and several drops of water were dissolved in tetrahydrofuran (2 mL). The light yellow clear solution was stirred at room temperature over a weekend; no starting material was detected by TLC. The reaction solution was concentrated and the residue was dissolved in CHCI3 (20 mL). The solution was extracted with 0.15 N aqueous HCl solution (10 mL then 2x5 mL) and the HCl layers was taken to pH 13 by addition of 20% aqueous NaOH solution.
  • step 2 A solution of 4'-(7-methanesulfonyloxy-2,5- oxa)heptyl-4,5',8-trimethylpsoralen (108 mg, 0.253 mmol) in 8 mL of acetonitrile was slowly added to a solution of 1, 4-diaminobutane (132 mg, 1.49 mmol) in 2.8 mL of acetonitrile. After refluxing for 8 hours, no starting material remained by TLC.
  • the reaction mixture was cooled to room temperature and CHCI3 (25 mL) and 1 N aqueous NaOH (25 mL) solution were added. The layers were separated and CHCI3 (2x10 mL) was used to wash the aqueous layer. Aqueous HCl (0.3 N , 3x10 mL) was used to extract the product from the combined organics layers. The HCl layers was treated with 20 % aqueous NaOH solution until pH 13. The combined basic layers were then extracted with CHCI3 (3x20 mL). The CHCI3 layer was washed with saturated NaCl aqueous solution (10 mL) then dried over anhydrous Na2S ⁇ 4.
  • the aqueous solution was extracted with a further 2x10 mL of CHCI3 and the combined extracts were rinsed with water.
  • the product was then extracted from the CHCI3 solution with 0.3 N aqueous HCl and the acidic layer was then taken to pH 12 with concentrated NaOH solution.
  • the aqueous layer was extracted with a further 2 x 10 mL of CHCI3 and the combined extracts were rinsed with water.
  • the product was then extracted from the CHCI3 solution with 0.3 N aqueous HCl and the acidic layer was then taken to approximately pH 12 with concentrated NaOH solution.
  • the base suspension was extracted with CHCI3 which was then rinsed with water, dried over Na2S ⁇ 4 and concentrated under reduced pressure.
  • pooled platelet units were stored and observed for the proliferation of cells.
  • samples from the same units were treated with psoralen and UVA to compare cytokine levels.
  • Fresh random donor platelet units were obtained from the Blood Bank of the Alameda-Contra Costa Medical Association (Oakland, CA). The units were sterile-docked using a Haemonetics SCD 312 sterile docker and were pooled in a single blood bag. The bag was centrifuged at 4000 x g for 6 minutes at room temperature in a Sorvall RC-3B centrifuge. The plasma supernatant was expressed from the centrifuged bag and diluted with PAS (platelet additive solution) to give a final composition of 35% plasma, 65% PAS.
  • PAS platelet additive solution
  • PAS is a synthetic media comprised of the following components, at the following concentrations: Na acetate «2H2 ⁇ (4.08 g/1); Na citrate*3H2 ⁇ (2.94 g/1); Na monobasic phosphate»H2 ⁇ (0.858 g/1); and Na dibasic phosphate (2.81 g/1).
  • the platelet- rich pellet was resuspended in the 35% plasma, 65% PAS mixture.
  • Aliquots (20 mL) of the platelet mixture were transferred to 30 mL PL2410 platelet storage bags (Baxter Healthcare Corp., Deerfield, IL) and stored in a Helmer platelet incubator (Helmer, Noblesville, IN) at 22 °C with agitation at 70 cycles /min. Platelet mixtures that were treated with gamma-irradiation and PCD were prepared as discussed in Example 13, below, prior to storage on the platelet incubator.
  • the white blood cells were counted using a procedure similar to that described by Kao and Scornik. Kao, KJ. and Scornik, J.C., "Accurate quantitation of the low number of white cells in white cell-depleted blood components," Transfusion 29: 77 .-777 (1989).
  • a 1.0 mL aliquot of each sample was placed in 1.5 mL microcentrifuge tube and centrifuged in a microcentrifuge (IEC Micromax) at 3500 RPM (1000 x g) for 2.5 minutes. The supernatant was aspirated leaving the pellet undisturbed.
  • the cell pellet which remained was resuspended in 1 mL of a stain solution containing 50 mg/mL propidium iodide, 1 mg/mL sodium citrate, and 0.03% mL/mL NP-40 (Sigma Chemical Co., St. Louis, MO).
  • the pellet was gently resuspended by vortexing for 30 seconds before incubating at room temperature for 15 minutes. Manual counts (5 replicates) were performed using a 0.1 ⁇ L Improved Neubauer hemocytometer (Brightline Hemocytometer, Hauser Scientific).
  • An Olympus BH2 microscope with a Mercury-100 W fluorescent light source (Chiu Technical Corp.) set at 450 nm excitation was used to count the stained white blood cells. Detection of Cytokine Production
  • IL-8 was chosen as an indicator of cytokine production.
  • IL-8 is a low molecular weight inflammatory cytokine that activates neutrophils and serves as a chemotactic agent for neutrophils. It is produced by cells which are stimulated by cytokines such as TNF-a and IL-lb.
  • cytokines such as TNF-a and IL-lb.
  • Members of the IL-8 family can be synthesized and excreted by several different cellular sources including activated T-cells, activated mononuclear phagocytes, monocytes, and platelets.
  • activated T-cells activated mononuclear phagocytes
  • monocytes monocytes
  • platelets Abbas, A.K., et al., Cellular and Molecular Immunology, pp. 235-236, W.B Saunders Co. 1991.
  • the primary cellular source for IL-8 in unpooled, single random donor units is likely to be monocytes.
  • Yoshimura, T., et al. "Neutrophil chemotactic factor produced by lipopolysaccharide (LPS)-stimulated human blood mononuclear leukocytes: partial characterization and separation from interleukin 1 (IL 1)," J. Immunol. 139: 788-93 (1987).
  • Samples of plasma from each unit were stored for later ELISA analysis of cytokine levels.
  • Samples (1.0 mL) were centrifuged in 1.5 mL Eppendorf tubes at 5000 rpm for 5 minutes at room temperature in an IEC Micromax bench-top centrifuge (IEC, Needham Heights, MA). The supernatant from each sample was divided into three separate aliquots and stored at - 70°C in 1.5 mL Eppendorf tubes.
  • ELISA kits for IL-lb, IL-6, and TNF-a were purchased from Perceptive Diagnostics Inc. (Cambridge, MA).
  • ELISA kits for IL-8 were purchased from R&D Systems (Minneapolis, MN).
  • Plasma samples were thawed at room temperature and were centrifuged at 5000 rpm for 5 minutes at room temperature in an IEC Micromax bench-top centrifuge (IEC, Needham Heights, MA). Precipitates were not observed in any of the samples that were analyzed. ELISA assays were performed according to the protocol supplied by the manufacturer.
  • Concentrations of IL-8 were found to increase to high levels in all of the untreated units with white blood cell counts greater than 1 x 10 /mL. Levels of IL-8 that were produced during 7 days of storage under standard conditions were found to be a function of the white blood cell count as indicated in FIG. 5.
  • gamma irradiation and photochemical treatment using psoralen plus UVA light.
  • PCD photochemical treatment
  • the example also determines the time course for the generation of IL-8 in the treated and untreated samples of the random donor platelet units obtained from the pooled units, as shown in FIG. 5, which were treated with either gamma irradiation or photochemical treatment. Those units were treated with g-irradiation or PCD on day 1 to determine the effect on cytokine synthesis.
  • Platelet mixtures that were treated with gamma-irradiation were irradiated to 2500 Rads (approximately 6 minutes) using a Gamma Cell-1000 irradiation device (Nordion Inc.) located at the Blood Bank of the Alameda- Contra Costa Medical Association (Oakland, CA).
  • 2500 Rads is the standard level of irradiation used to prevent graft versus host disease incident to platelet transfusions. Samples of the irradiated units were taken prior to irradiation and following irradiation to determine whether the treatment process resulted in any initial increase in the level of cytokines.
  • the samples for photochemical treatment were prepared as follows.
  • a 15 mM stock solution of AMT was prepared by dissolving 50 mg of AMT powder in 10 mL of distilled water. The solution was mixed vigorously and filtered through a 0.2 ⁇ m syringe filter. The concentration of AMT in the filtered solution was determined by measuring the absorbance of the solution at 250 nm using a Shimadzu UV160U spectrophotometer. The AMT concentration was calculated using a value of 25000 M"lcm-1 for the extinction coefficient.
  • a 15 mM stock solution of Compound 2 was prepared by dissolving 152 mg of a powder of Compound 2 in 30 mL of distilled water. The solution was mixed vigorously and filtered through a 0.2 ⁇ m syringe filter. The concentration of Compound 2 in the filtered solution was determined by measuring the absorbance of the solution at 250 nm using a Shimadzu UV160U spectrophotometer. The Compound 2 concentration was calculated using a value of 25400 M"lcm _ l for the extinction coefficient.
  • the low solubility of 8-methoxypsoralen (8-MOP) in aqueous solutions made preparation of concentrated stock solutions impossible. Instead, platelet units that were treated with 8-MOP and ultraviolet light were prepared using PAS solution saturated with 8-MOP.
  • the saturated solution was prepared by suspending 100 mg of 8-MOP in 100 mL of PAS. The solution was agitated for 16 hours at room temperature in a dark container. The resulting solution was filtered through a 0.2 ⁇ m filter to remove any undissolved 8-MOP.
  • the final 8- MOP concentration was determined by measuring absorbance at 248 nm using a Shimadzu UV160U spectrophotometer.
  • the 8-MOP concentration was calculated using a value of 22900 M _ lcm"l for the extinction coefficient.
  • Units that were treated with PCD were enriched with psoralen to a final concentration of 150 ⁇ M for AMT and Compound 2.
  • Units that were treated with 8-MOP were prepared by using PAS saturated with 8-MOP in the preparation procedure discussed above.
  • the final 8-MOP concentration in the units was 75 ⁇ M.
  • the random donor units were illuminated with UVA light to a final dose of 1.9 J/cm 2 in a light device with output and dimensions similar to that described in Example 1. The units were agitated at 70 cycles /min during illumination.
  • FIG. 6 compares the time course for generation of IL-8 in treated versus untreated samples. Note that in both the untreated control and the gamma- irradiated samples the level of IL-8 appears to increase with time suggesting that active synthesis and excretion of cytokine is occurring during storage. The initial level of IL-8 in the gamma-irradiated unit appeared to be only slightly elevated relative to the other units suggesting that "dumping" of cytokines from cell storage during treatment was minimal. Photochemical treatment with AMT and Compound 2 resulted in essentially complete inhibition of cytokine synthesis. Levels of IL-8 did not rise above the day 0 baseline level during 7-day storage. Inhibition of cytokine synthesis by 8-MOP was also apparent. The level of IL-8 rose slightly during the first day of storage but did not increases significantly beyond day 1. Samples of plasma were also assayed for levels of IL-lb, IL-6, and TNF-a.
  • Levels of IL-lb appeared slightly elevated (40-50 pg/mL) in the untreated random donor platelet units.
  • the levels of IL-lb, IL-6, and TNF-a for the untreated unit and the unit that was treated with Compound 2 and UVA illumination are shown in FIG. 8.
  • the untreated control shows a steady increase in the level of IL-lb suggesting that synthesis of IL-lb is also occurring during storage.
  • the sample that was treated with Compound 2 + UVA showed a relatively insignificant increase in IL-lb during storage indicating that synthesis of IL-lb has been prevented.
  • Levels of IL-6 and TNF-a were not significantly elevated in any of the samples tested.
  • cytokines that were detected in the untreated units during storage are similar to those that have been observed by other investigators. Muylle et. al found that elevated levels of cytokines (IL-lb, IL-6, TNF-a) could be detected only in platelet concentrate units which had white blood cell counts exceeding 3 x 10 6 /mL. Muylle, 1., et al., Transfusion; 33: 195-199 (1993). Stack and Snyder reported that elevated levels of IL-8 could be detected in PCs containing lower levels of white blood cells (1-2 x lO ⁇ /mL). Levels of IL-lb paralleled IL-8 levels but at much lower concentrations.
  • Stack and Snyder also reported data for levels of passenger leukocytes in platelet concentrates that were prepared according to Red Cross protocols. They found that white blood cell levels ranged from 0.2 x IO 6 to 15.9 x IO 6 WBC/ mL (2.4 ⁇ 3.2 x 10 6 /mL, mean + SD). In this study, the white blood cell count of the random donor platelet pool was slightly below average (1.7 x 10°/mL). The level of IL-8 in the untreated units rose much more quickly than was observed by Stack and Snyder for samples containing 1-2 x 10 ⁇ WBC/mL, but reached approximately the same final concentration. As indicated in FIG. 8, increases in levels of IL-lb paralleled increases in levels of IL-8, but at lower concentrations.
  • the decreased level of IL-8 may therefore be a result of low levels of UVA that the sample was exposed to during handling and storage. Additional controls were performed in which Compound 2 was added to plasma (diamonds) or PAS (triangles) and illuminated before the solution was added to the platelets. Once again, the slight decreases in IL-8 levels may be related to UVA exposure during handling and storage. The combined effect of Compound 2 and illumination with UVA (open circles) is included in the figure for comparison, and shows complete inhibition of cytokine synthesis, as indicated in FIG. 7.
  • This example measures psoralen-DNA adduct formation resulting from treatment of platelet units by methods of the present invention.
  • Platelet units were enriched with leukocytes prepared from buffy coats by Ficoll density gradient. Higher levels of white blood cells were obtained in these experiments (>4 x 10°7mL), but levels did not exceed white blood cell counts that have been observed in standard clinical platelet units.
  • FIG. 9 indicates the levels of IL-8 in platelet units that were subjected to various treatments and stored for five days under standard conditions.
  • the "Not Spiked" sample is the platelet unit without addition of white blood cells. The remaining samples were enriched with white blood cells to a final count of 4.3 x lO ⁇ /mL.
  • the levels of IL-8 in the day-5 samples from untreated units were much higher than in previous experiments as would be expected for a higher white blood cell count.
  • a sample was subjected to a double dose of g- irradiation (5000 cGy). Note that the level of IL-8 in the sample that was treated with 5000 cGy g-irradiation decreased only slightly relative to the untreated control.
  • the platelet units that were treated with 100 ⁇ M and 150 ⁇ M Compound 2 were the only samples that did not show an increase in the level of IL-8 during storage.
  • the sample that was treated with 150 ⁇ M AMT showed a slight increase in the level of IL-8 while the samples that were treated with 10 ⁇ M Compound 2 and 75 ⁇ M 8-MOP showed slightly higher levels.
  • Levels of psoralen-DNA adduct formation were determined for each of the samples that were treated with psoralen + UVA.
  • Stock solutions of 3H-labeled psoralens were added to each platelet unit to the indicated concentration before illumination to 1.9 J/cm 2 .
  • the platelet unit containing 75 ⁇ M 8-MOP was prepared with PAS solution saturated with 8-MOP while the AMT and Compound 2 samples were prepared with 15 mM stock solutions.
  • DNA was extracted from the cell pellet from each sample and the level of bound radioactivity was measured. Approximately 50 ⁇ g of DNA was obtained from a 4 mL sample of PC with an initial white blood cell count of 4.3 x lO ⁇ /mL.
  • Figure 10 indicates the level of adduct formation which was calculated from measurements of bound radioactivity and concentration of DNA for each sample. Note that Compound 2 appears to be more active in DNA adduct formation than both AMT and 8-MOP under similar conditions. The correlation between DNA- adduct formation and inhibition of IL-8 generation during platelet storage is indicated in Figure 11. Generation of IL-8 during storage appears to be completely inhibited when greater than approximately 9 adducts are formed per 1000 base pairs, as is the case for 100 ⁇ M and 150 ⁇ M Compound 2 illuminated to 1.9 J/cm 2 .
  • the compounds of the present invention are tested for their dark mutagenicity using an Ames assay.
  • the procedures used for the Salmonella mutagenicity test as described in detail by Maron and Ames were followed exactly. Maron, D.M. and B.N. Ames, Mutation Research 113: 173 (1983). A brief description for each procedure is given here.
  • the tester strains TA97a, TA98, TA100, TA102, TA1537 and TA1538 were obtained from Dr. Ames.
  • TA97a, TA98, TA1537 and TA1538 are frameshift tester strains.
  • TA100 and TA102 are base- substitution tester strains. Upon receipt each strain was cultured under a variety of conditions to confirm the genotypes specific to the strains.
  • the standard Salmonella tester strains used in this study require histidine for growth since each tester strain contains a different type of mutation in the histidine operon. In addition to the histidine mutation, these tester strains contain other mutations, described below, that greatly increase their ability to detect mutagen.
  • Histidine Dependence The requirement for histidine was tested by streaking each strain first on a minimal glucose plate supplemented only with biotin and then on a minimal glucose plate supplemented with biotin and histidine. All strains grew the lack of growth of the strains in the absence of histidine.
  • rfa Mutation A mutation which causes partial loss of the lipopolysaccharide barrier that coats the surface of the bacteria thus increasing permeability to large molecules was confirmed by exposing a streaked nutrient agar plate coated with the tester strain to crystal violet. First 100 ⁇ L of each culture was added to 2 mL of molten minimal top agar and poured onto a nutrient agar plate.
  • a sterile filter paper disc saturated with crystal violet was placed at the center of each plate. After 16 hours of incubation at 37°C the plates were scored and a clear zone of no bacterial growth was found around the disc, confirming the rfa mutation.
  • uvrB Mutation Three strains used in this study contain a deficient UV repair system (TA97a, TA98, TA100, TA1537 and TA1538). This trait was tested for by streaking the strains on a nutrient agar plate, covering half of the plate, and irradiating the exposed side of the plate with germicidal lamps. After incubation growth was only seen on the side of the plate shielded from UV irradiation.
  • R-factor The tester strains (TA97a, TA98, TA100, and TA102) contain the pKMlOl plasmid that increases their sensitivity to mutagens. The plasmid also confers resistance to ampicillin to the bacteria. This was confirmed by growing the strains in the presence of ampicillin.
  • pAQl Strain TA102 also contains the pAQl plasmid that further enhances its sensitivity to mutagens. This plasmid also codes for tetracycline resistance. To test for the presence fo this plasmid TA102 was streaked on a minimal glucose plate containing histidine, biotin, and tetracycline. The plate was incubated for 16 hours at 37°C.
  • the strain showed normal growth indicating the presence of the pAQl plasmid.
  • the same cultures used for the genotype testing were again cultured and aliquots were frozen under controlled conditions. The cultures were again tested for genotype to confirm the fidelity of the genotype upon manipulation in preparing the frozen permanents.
  • the first tests done with the strains were to determine the range of spontaneous reversion for each of the strains. With each mutagenicity experiment the spontaneous reversion of the tester strains to histidine independence was measured and expressed as the number of spontaneous revertants per plate. This served as the background controls. A positive mutagenesis control was included for each tester strain by using a diagnostic mutagen suitable for that strain (2-aminofluorene at 5mg/plate for TA98 and sodium azide at 1.5 mg/plate for TA100).
  • Maron and Ames (1983) describe the conflicting views with regard to the statistical treatment of data generated from the test.
  • this example adopts the simple model of mutagenicity being characterized by a two-fold or greater increase in the number of revertants above background (in bold in the tables), as well as dose dependent mutagenic response to drug.
  • 8-MOP the only mutagenic response detected was a weak base-substitution mutagen in TA102 at 500 ⁇ g/plate (TABLE 13 (B)).
  • AMT (TABLE 12 (A) and 12 (B)) showed frameshift mutagenicity at between 5 and 10 ⁇ g/plate in TA97a and TA98, at 5 ⁇ g/plate in TA1537 and at 1 ⁇ g/plate in TA1538. AMT showed no significant base- substitution mutations.
  • Compound 1 the only mutagenic response detected was a weak frameshift mutagen in TA1538 at 5 ⁇ g/plate in the presence of S9.
  • Compound 1 also displayed mutation in the TA100 strain, but only in the absence of S9.
  • Compound 2 also showed weak frameshift mutagenicity in the presence of S9 in TA98 and TA1537.
  • Compounds 3 and 4 showed no mutagenicity.
  • Compound 6 had no base substitution mutagenicity, but showed a frameshift response in TA98 in the presence of S9 at concentrations of 250 ⁇ g/plate and above. It also showed a response at 50 ⁇ g/plate in TA1537 in the presence of S9.
  • Compound 18 showed only a weak response at high concentrations in the presence of S9 in strains TA 9o and TA 1537. The response was higher in the absence of S9, but still was significantly below that of AMT, which displayed mutagenicity at much lower concentrations (5 ⁇ g/plate).
  • FIG. 12A schematically shows the standard blood product separation approach used presently in blood banks.
  • Three bags are integrated by flexible tubing to create a blood transfer set (200) (e.g., commercially available from
  • the entire set is processed by centrifugation (e.g., Sorvall ⁇ swm g bucket centrifuge, Dupont), resulting in packed red cells and platelet rich plasma in the first bag (201).
  • the plasma is expressed off of the first bag (201) (e.g., using a Fenwall ⁇ M device for plasma expression), through the tubing and into the second bag (202).
  • the first bag (201) is then detached and the two bag set is centrifuged to create platelet concentrate and platelet-poor plasma; the latter is expressed off of the second bag (202) into the third bag (203).
  • FIG 12B schematically shows an embodiment of the present invention by which synthetic media and photoactivation compound are introduced to platelet concentrate prepared as in Figure 12A.
  • a two bag set (300) is sterile docked with the platelet concentrate bag (202) (indicated as "P.C”).
  • P.C platelet concentrate bag
  • Sterile docking is well-known to the art. See e.g., -US Patent No. 4,412,835 to D.W.C. Spencer, hereby incorporated by reference. See also US Patents Nos. 4,157,723 and 4,265,280, hereby incorporated by reference.
  • Sterile docking devices are commercially available (e.g., Terumo, Japan).
  • One of the bags (301) of the two bag set (300) contains a synthetic media formulation of the present invention (indicated as "STERILYTE").
  • the platelet concentrate is mixed with the synthetic media by transferring the platelet concentrate to the synthetic media bag (301) by expressing the platelet concentrate from the first blood bag into the second blood bag via a sterile connection means.
  • the photoactivation compound can be in the bag containing synthetic media (301), added at the point of manufacture.
  • the compound can be mixed with the blood at the point of collection, if the compound is added to the blood collection bag (FIG. 12A, 201) at the point of manufacture.
  • the compound may be either in dry form or in a solution compatable with the maintainance of blood.
  • FIG 12C schematically shows one embodiment of the decontamination approach of the present invention applied specifically to platelet concentrate diluted with synthetic media as in Figure 12B.
  • platelets have been transferred to a synthetic media bag (301).
  • the photoactivation compound either has already been introduced in the blood collection bag (201) or is present in the synthetic media bag (301). Either the platelets are then expressed into the synthetic media bag via a sterile connection means (as shown) or the synthetic media is expressed into the platelet bag.
  • the bag containing the mixture of platelet concentrate and synthetic media (301), which has UV light transmission properties and other characteristics suited for the present invention, is then placed in a device (such as that described in Example 1, above) and illuminated.
  • FIG. 12D schematically shows an embodiment of the cytokine inhibition approach of the present invention, which includes a capture device to remove photoinactivation compound from the treated material after phototreatment.
  • the present invention contemplates several adsorptive materials which may be used in a capture device to remove photoinactivation compounds, of which the following is a nonexclusive list: Amberlite XAD-4 (available from Rohm and Haas Ltd., Croydon, Surrey, UK) ("Resin hemoperfusion for Acute Drug Intoxication," Arch Intern Med 136:263 (1976)); Amberlite XAD-7 ("Albumin- Coated Amberlite XAD-7 Resin for Hemoperfusion in Acute Liver Failure,"
  • the present invention contemplates an absorptive material operating in conjunction with a filtering means to remove compounds.
  • This example involves an assessment of the impact of the compounds and methods of the present invention on platelet function.
  • Four indicators of platelet viability and function were employed: 1) GMP-140 expression; 2) maintenance of pH; 3) platelet aggregation, and 4) platelet count.
  • To measure the effects of the present compounds and methods of decontamination on platelet function using these four indicators four samples were prepared for each compound tested, two control samples and two containing compound. Three units of human platelets were obtained from the Sacramento Blood Center, Sacramento, CA. These were each transferred under sterile conditions to 50 ml centrifuge tubes, then aliquots of each unit were transferred into a second set of 50 ml sterile centrifuge tubes.
  • GMP140 alpha granule membrane glycoprotein
  • p-selectin an alpha granule membrane glycoprotein called p-selectin
  • GMP140 a small aliquot of platelet rich plasma is placed in HEPES buffer containing a GMP140-binding antibody or an isotype control mouse IgG.
  • CD62 is a commercially available monoclonal antibody which binds to GMP140 (available from Sanbio, Uden, the Netherlands; Caltag Labs, So. San Francisco, CA, and Becton Dickinson, Mountain View, CA).
  • Goat F(ab')2 Anti-Mouse IgG conjugated to FITC (Caltag Laboratories, So. San Francisco, CA) is added to the tube in saturating amounts and allowed to incubate at room temperature (RT) for 15 minutes.
  • the cells are diluted in 1% paraformaldehyde in phosphate buffered saline and analyzed on a FACSCANTM (Becton Dickinson, Mountain View, CA).
  • the positive control is made by adding Phorbol Myristate Acetate (PMA) to the test system at a final concentration of 2 x 10"? M.
  • PMA Phorbol Myristate Acetate
  • CD62 was employed to measure the impact, if any, of irradiation in the presence of several compounds of the present invention on platelet activation.
  • the antibody was mixed with HEPES buffer (10 ⁇ L antibody [0.1 mg/ml] : 2.49mL buffer) and stored in 50 ⁇ L aliquots at -40°C prior to use.
  • a positive control consisted of: 10 ⁇ L CD62, 8 ⁇ L PMA and 2.482 mL Hepes buffer.
  • a mouse IgGl control (0.05 mg/ml) (Becton Dickinson, Mountain View, CA
  • FIGS 13C, 14C, 15C, and 16C The results are shown in FIGS 13C, 14C, 15C, and 16C.
  • FIGS 13 corresponds to Compound 2
  • FIGS 14 corresponds to Compound 6
  • FIGS 15 corresponds to Compound 17
  • FIGS 16 correspond to Compound 18
  • FIGS 13D, 14D, 15D and 16D are bar graphs showing pH results for a dark control, a light control and an experimental light plus compound. These graphs indicate that the pH of platelet concentrate samples after illumination in the presence of any one of the compounds remains above a pH of 6.5. Thus platelets remain at a pH acceptable for stored platelets following photoinactivating treatment using compounds of the present invention.
  • Platelet aggregation is measured by the change in optical transmission that a platelet sample exhibits upon stimulation of aggregation. Platelet aggregation was measured using a Whole Blood Aggregometer (Chrono-Log Corp., Havertown, PA, model 560 VS). The number of platelets in each sample was controlled to be constant for every measurement. A Model F800 Sysmex cell counter (Toa Medical Electronics, Kobe, Japan) was used to measure platelet count in the platelet samples and autologous plasma was used to adjust platelet counts to 300,000/mL of platelet concentrate. For the procedure, all the samples were incubated in a capped plastic tube for 30 minutes at 37°C for activation. The aggregometer was warmed up to 37°C.
  • the optical channel was used for platelet aggregation measurement.
  • the magnetic speed of the aggregometer was set at 600 /min.
  • Remaining platelet concentrate from the units obtained which was not drawn as a sample for treatment, was centrifuged at high speed (14,000 g) with a micro-centrifuge for 5 minutes to obtain containers of platelet poor plasma autologous to the experimental samples.
  • 0.45 ml of the autologous platelet poor plasma was added along with 0.5 ml of saline into a glass cuvette and placed in the PPP channel.
  • 0.45 ml of the sample platelet concentrate and 0.50 ml of saline were added to a glass cuvette (containing a small magnet) into the sample channel.
  • ADP and collagen reagents (10 ⁇ l) each were added to the sample cuvette.
  • the final concentration of ADP was 10 ⁇ M and the final concentration of collagen was 5 ⁇ g/ml. Platelet aggregation was recorded for about 8-10 minutes or until the maximum reading was reached.
  • the 100 % aggregation line is the level at which the recorder was set to zero.
  • the 0% aggregation line is where the platelets transmitted before the ADP and collagen were added.
  • the aggregation value for the sample is determined by taking the maximum aggregation value as a percent of the total range.
  • Three of the four compounds tested showed very little or no difference in aggregation levels between the samples treated with compound and the untreated samples which were stored for 5 days.
  • Compound 2 exhibited a small reduction in aggregation, of approximately 8% from the day 1 control.
  • the aggregation for the sample treated with compound and uv was the same as that for the uv only sample. This is supporting evidence that the decontamination compounds tested do not have a significant effect on platelet aggregation when used in the methods of the present invention.
  • a Sysmex cell counter was used to measure platelet count in the platelet samples. Samples were diluted 1 : 3 in blood bank saline.
  • FIGS. 13A, 14A, 15A, and 16A The results of the platelet count measurements appear in FIGS. 13A, 14A, 15A, and 16A.
  • the samples show little or no drop in platelet count between the Day 5 control and the Day 5 treated sample.
  • samples treated with Compounds 6, 17 and 18 all display a higher platelet count than samples treated with light alone.
  • samples treated with Compound 6 had counts equivalent to the 5 day control, but samples treated with only ultraviolet light showed approximately a 33% reduction in platelet count.
  • EXAMPLE 19 EXAMPLE 19
  • a preferred compound for treating blood products subsequently used in vivo should not be mutagenic to the recipient of the blood.
  • some compounds were screened to determine their genotoxicity level in comparison to aminomethyltrimethylpsoralen.
  • the in vivo clastogenicity of some compounds of the present invention was measured by looking for micronucleus formation in mouse reticulocytes.
  • Mammalian cell cultures are valuable tools for assessing the clastogenic potential of chemicals.
  • cells are exposed to chemicals with and /or without rat S-9 metabolic activation system (S-9) and are later examined for either cell survival (for a genotoxicity screen) or for changes in chromosome structure (for a chromosome aberration assay).
  • S-9 metabolic activation system S-9
  • CHO cells Chinese hamster ovary (CHO; ATCC CCL 61 CHO-K1, proline-requiring) cells were used for the in vitro genotoxicity and chromosomal aberration tests.
  • the cells were grown in an atmosphere of 5% CO2 at approximately 37° C in McCoy's 5a medium with 15% fetal bovine serum (FBS), 2 mM L-glutamine, and 1% penicillin-streptomycin solution to maintain exponential growth. This medium was also used during exposure of the cells to the test compound when no S-9 was used. Cell cultures were maintained and cell exposures were performed in T-75 or T-25 flasks.
  • Each of the sample compounds were tested at seven dilutions, 1, 3, 10, 33, 100, 333, and 1000 ⁇ g/ml.
  • the compound was added in complete McCoy's 5a medium. After the compound was added, cells were grown in the dark at approximately 37° C for approximately 3 hours. The medium containing the test compound was then aspirated, the cells were washed three times with phosphate-buffered saline (PBS) at approximately 37° C, and fresh complete McCoy's 5a medium was added.
  • PBS phosphate-buffered saline
  • the positive control was methylmethane sulf onate.
  • the solvent control was dimethylsulfoxide (DMSO) diluted in culture medium. For assays using metabolic activation (see below) the activation mixture was also added to the solvent control.
  • DMSO dimethylsulfoxide
  • a psoralen compound with a structure distinct from compounds of the present invention 8-aminomethyl-4,4',5'-trimethylpsoralen, was also tested in this experiment and proved to be toxic at 10 ⁇ g/ml. While the 8- substituted aminomethyl compound and similar structures may not be suited for methods of the present invention, they may be useful for alternative purposes. In light of the ability of the compounds to prevent nucleic acid replication, in combination with their extreme toxicity, the compounds could be used, for example, to treat diseases characterized by uncontrolled cell growth, such as cancer. 2) Micronucleus Assay Protocol
  • Saline solutions were prepared for Compounds 2, 6, 17 and 18 at various concentrations. Male Balb/c mice were then injected with 0.1 ml of a compound solution via the tail vein. At least 3 mice were injected per dose level. Saline only was used as a negative control. For a positive control, cyclophosphamide (cycloPP) was administered at a dose of 30 mg/kg. In the experimental group, the injections were repeated once per day for four days. In the positive control group, the sample was administered only once, on day three. On day 5, several microliters of blood were withdrawn from each subject and smeared on a glass slide. Cells were fixed in absolute methanol and stored in a slide rack.
  • cyclophosphamide cyclophosphamide
  • %PCE percentage of reticulocytes
  • This example demonstrates how the methods of the present invention work not only to inhibit of cytokine production, but also to inactivate blood- borne pathogens.
  • cell-associated Hr is inactivated using methods and conditions appropriate to inhibit cytokine production.
  • H9 cells chronically infected with HIVH ⁇ B were used. (H9/HTLV-III-B NIH 1983 Cat.#400). Cultures of these cells were maintained in high glucose Dulbecco Modified Eagle Medium supplemented with 2 mM L-glutamine, 200 u/mL penicillin, 200 ⁇ g/ml streptomycin, and 9% fetal bovine serum (Intergen Company, Purchase, N.Y.) For maintenence, the culture was split once a week, to a density of 3 x 10 ⁇ to 4 x 10 ⁇ cells/ml and about four days after splitting, 3.3% sodium bicarbonate was added as needed. For the inactivation procedure, the cells were used three days after they were split.
  • PC human platelet concentrate
  • the samples were serially diluted directly in 96-well plates (Corning Glass Works, Corning, N.Y.). The plates were mixed on an oscillatory shaker for 30 seconds and incubated at 37°C in a 5% C ⁇ 2 atmosphere for 1 to 18 hours.
  • MT-2 cells 0.025 mL [clone alpha-4, available (catalog number 237) from the National Institutes of Health AIDS Research and Reference Reagent Program, Rockville, Md.] were added to each well to give a concentration of 80,000 cells per well.
  • the plates were incubated for 5 days at 37°C in 5% CO2 and stained by the addition of 0.05 mL of 50 ⁇ g/mL propidium iodide (Sigma Chemical Co.) in phosphate-buffered saline (pH 7.4) to each well. After 24 to 48 hours, the red fluorescence-stained microplaques were visualized by placing the plates on an 8,000 ⁇ W/cm ⁇ 304 nm UV light box (Fotodyne, Inc., New Berlin, Wis.). The plaques were counted at a magnification of x20 to x25 through a stereomicroscope.
  • This example involves an assessment of new synthetic media formulations for use in methods of the present invention, as measured by the following in vitro platelet function assays: 1) maintenance of pH; 2) platelet aggregation ("Agg") and 3) GMP140 expression.
  • the assays for each of these tests have been described above.
  • PRP human platelet rich plasma
  • the unit was allowed to rest for 1 hour, after which it was gently kneaded to resuspend the platelets.
  • the reconstituted unit was assayed for pH and other tests the next day, with the following results:
  • T-cells in platelet concentrates have been reported to cause tranfusion associated graft versus host disease (GVHD) in transfusion recipients.
  • GVHD tranfusion associated graft versus host disease
  • PCR polymerase chain reaction
  • PCT photochemical treatment
  • PBMCs Peripheral blood mononuclear cells
  • IEC GP8R centrifuge IEC, Needham Heights, MA
  • LDA limiting dilution analysis
  • ABO matched random donor platelet concentrates obtained from Sacramento Blood Center (Sacramento CA) were pooled into a sterile polystyrene flask.
  • the platelet concentrate was transferred to sterile 50 ml centrifuge tubes in 30 ml aliquots and was centrifuged on a Sorvall RC-3B centrifuge (DuPont Instruments, Newtown, CT) at 3000g for 6 min.
  • the plasma concentration was adjusted to 35%/ 65% synthetic media + phosphate by removing 65% of the total volume and replacing it with synthetic media and then resuspending the pelleted material.
  • AMT HRI Associates, Concord, CA
  • 8-MOP Sigma, St. Louis, MO
  • Compound 2 powder was dissolved in water and optically measured with a Shimadzu UV160U spectrophotmeter (Shimadzu Scientific Instruments, Pleasonton, CA). The concentration was calculated using the absorbance at 250 nm. and the extinction coefficient of 25000 M ⁇ cm-! for AMT, 22900 M" icm" 1 for 8-MOP, and 25400 M ⁇ cm "1 for Compound 2.
  • the platelet unit was illuminated in an illumination device with output and dimensions approximately equivalent to the device described in Example 1, while being mixed on a Helmer shaker (Helmer, Noblesville, IN) at 70 cycles/min..
  • the illumination device was air-cooled and capable of maintaining the temperature rise of the platelet concentrate to less than 1°C per Joule /cm ⁇ during the course of the illumination.
  • Each treated unit was irradiated separately for 1.0 Joule /cm ⁇ for LDA experiments and 1.9 Joules /cm ⁇ for PCR and DNA binding experiments.
  • This assay was performed using 96-well cell culture microtiter plates (VWR Scientific, Foster City, CA). Whole blood was drawn into two 10 ml ACD collection tubes (Rutheford, NJ) from 10 volunteers. The PBMCs were isolated by Ficoll (Sigma, St Louis, MO) density gradient, pooled, and stored in liquid nitrogen with 10% DMSO and 20% FBS.
  • RPMI/20% FBS fetal bovine serum
  • RPMI 1640 Mediatech, Herndon, VA
  • 2.0 mM L-glutamine Sigma, St Louis MO
  • 50 ⁇ g/ml Penecillin 50 U/ml Streptomycin (Gibco Life Technologies, Baltimore, MD)
  • 20% FBS FBS
  • the cells were gamma-irradiated for 5000 cGy at the Alameda /Contra Costa Blood Bank using a Nordion Gamma Cell-1000 (Nordion Inc., Kanata, Ontario). Cells were transported on ice. After gamma-irradiation, the allostimulators were centrifuged and resuspended in
  • T-cell medium which was composed of: 80% "RPMI/20% FBS", 20% T- cell growth factor (TCGF, available from Cellular Products Inc., Buffalo NY), 100 U/ml recombinant IL-2 (Cellular Products Inc., Buffalo, NY), and 16 ug/ml Phytohemagglutanin-M (Sigma, St Louis, MO).
  • TCGF T- cell growth factor
  • IL-2 Cellular Products Inc., Buffalo, NY
  • 16 ug/ml Phytohemagglutanin-M Sigma, St Louis, MO
  • the plates were placed in a humidified 5% C ⁇ 2 incubator Forma (Forma Scientific, Marietta, OH) at approximately 37 °C Control PBMCs (Untreated, "UVA only", and “Compound 2 only”) were re-isolated from the platelet concentrate by density gradient centrifugation methods.
  • untreated samples were diluted in "RPMI/20% FBS” and plated in the following concentrations: (300, 100, 33, 11, and 3.7 cells/well). Aliquots of 100 ⁇ L of each dilution were plated in ten replicates into wells containing 1.0 x 10 ⁇ allostimulators for quantifying the initial viable T-cell frequency.
  • PBMCs peripheral blood mononuclear cells
  • Each plate was incubated in a Forma (Forma Scientific, Marietta, OH) humidified 5% CO2 incubator at approximately 37°C for 3 weeks. After three days, 1 week and 2 weeks, each well was fed with 25 ⁇ l of feed media consisting of the following ingredients: 50% FBS, 50% TCGF, 500 U/ml rIL-2, 80 ⁇ g/ml PHA-M.
  • feed media consisting of the following ingredients: 50% FBS, 50% TCGF, 500 U/ml rIL-2, 80 ⁇ g/ml PHA-M.
  • the extent of DNA modification following PCT was determined using psoralens (HRI Associates, Concord C A). The specific radioactivity of the samples was approximately 5 mCi/mmol.
  • WBCs prepared from Ficoll separation of a buffy coat were added to platelet concentrates to achieve elevated levels of WBCs.
  • Psoralen stock solution was added to the platelet concentrates. Then the platelet concentrates were illuminated with 1.9 Joules/cm 2 UVA. The platelets and WBCs were separated from the plasma by centrifuging the samples at 10,000 rpm for 5 minutes at room temperature.
  • the resulting pellet was suspended in extraction buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 0.01 mg/mL Proteinase K, 1.0 mg/ml RNAse) and incubated at room temperature overnight.
  • DNA was isolated from the digest using phenol-chloroform extractions (2x), followed by a chloroform extraction, an ether extraction, and three ethanol precipitations.
  • the ethanol precipitate was redissolved in 10 mM Tris pH 8.0, 100 mM NaCl, 1 mM EDTA between precipitation steps.
  • the level of psoralen adducts (shown in FIG. 18) were calculated from levels of residual radioactivity in the DNA samples determined by liquid scintillation counting.
  • PC samples with elevated levels of WBCs were treated with 1.9 Joules/cm 2 UVA plus one of the following compounds and concentrations: 10 ⁇ M, 100 ⁇ M, or 150 ⁇ M Compound 2; 150 ⁇ M AMT; or 75 or 150 ⁇ M 8- MOP.
  • Other samples were treated with 2500 cGy gamma radiation as described above.
  • DNA was extracted from the cellular material as previously described. 1.0 ⁇ g DNA samples were amplified with the following reaction conditions for HLA-DQa and B-globin sequences: 1.0 ⁇ g DNA in 10 ul H2O for each reaction; lx Taq Buffer (Perkina).
  • the viable T-cell frequencies of the untreated controls were 1/34, 1/88, 1/27 and 1/19.
  • the UVA only and compound only controls reflected very minimal or no reduction in the number of viable T-cells.
  • the psoralen-DNA adduct formation correlated with the T-cell inactivation data. (See Figure 18). Under equivalent conditions Compound 2>AMT>8-MOP in binding to leukocyte DNA. At 150 ⁇ M psoralen plus 1.9 Joules /cm 2 the number of adducts achieved were as follows: Compound 2 - 15/1000 bp; AMT - 7/1000 bp; and 8-MOP approximately 1/1000 bp.
  • PCR inhibition of HLA-DQa and B-globin also supported the T-cell inactivation data.
  • 150 ⁇ M Compound 2 plus 1.9 Joules/cm 2 resulted in > 3 logio inhibition while 150 ⁇ M AMT plus 1.9 Joules/cm 2 showed ⁇ 2 logio of PCR inhibition.
  • None of the 8-MOP PCT treated samples showed greater than 1 logio inhibition.
  • the larger B-globin amplicon resulted in greater inhibition overall, and comparable relative PCR inhibition among psoralens. 2500 cGy gamma radiation did not inhibit PCR amplification in any of the conditions tested, highlighting the benefits of PCT treatment compared to gamma irradiation as a method of inactivating T-cells.
  • This model will also be used to investigate the minimum psoralen and illumination dose required to achieve prevention of TA-GVHD for the purpose of defining the margin of safety for transfusion of blood products such as platelet concentrates.
  • Spleen cells from Strain A mice will be harvested and pooled.
  • Approximately 1.0 x 10 ⁇ spleen cells in PBS will be injected into the tail vein of B6AF1 recipients. Injection of B6AF1 cells into B6AF1 recipients will serve as negative controls.
  • the cells will be treated with 150 ⁇ M of a psoralen compound plus 1.1 J/cm 2 UVA in 3 mL experimental blood bags. The cells will then be pelleted resuspended in PBS and injected into the B6AF1 recipients. The following assays will be performed on the spleen cells from recipients of treated and untreated spleen cells.
  • SlChromium Lysis Assay The spleens from recipient mice (Effector cells) will be harvested and tested for their ability to lyse 5lQ- radiolabeled EL4 cells (Target Cells). 51Q- radiolabeled EL4 cells will be incubated with effector cells in 200 ⁇ l in 96-well plates with the following Effector/Target cell ratios; 150:1, 75:1, 37.5:1, 18.75:1. The amount of SlCr released into the culture supernatant has been correlated with the severity of GVHD. After 4 hours of incubation at 37°C 5% CO2 100 ⁇ l will be removed from each sample and counted with a gamma counter. The amount of chromium lysis mediated by spleen cells of recipient mice will be compared to the negative control (amount released spontaneously) and the positive control (maximum amount released by adding 2M HCl to EL4 cells.)
  • the engraftment of donor spleen cells in the recipients will be monitored using fluorescence labeled antibodies (commercially available from Pharmingen, San Diego, CA, catalogue numbers AF6-88.5, AF3 12.1) specific for leukocytes of each strain, and a flow cytometer.
  • Recipient spleens will be harvested at one, two and four weeks after injection of donor spleen cells.
  • FITC conjugated antibodies specific to each strain will be incubated with 1.0 x 10° " of the spleen cells followed by washing. The cells will then be analyzed with a flow cytometer. If engraftment has occurred two distinct populations of fluorescing cells will be present. If engraftment has not occurred only one population will be present.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

La présente invention concerne de nouveaux procédés d'inhibition de la prolifération cellulaire ou de la production de cytokines dans des produits sanguins, ces procédés consistant à traiter lesdits produits à l'aide d'un composé de psoralène, puis à photosensibiliser ce composé en exposant le produit sanguin à la lumière ultraviolette. La présente invention concerne notamment des procédés d'utilisation de composés nouveaux et connus, lesquels sont destinés à inactiver des leucocytes dans des produits sanguins à utiliser in vivo et in vitro, sans exercer une action importante sur la fonction de ces produits ou sans présenter de pouvoir mutagène. Les procédés de l'invention ont également pour effet d'inactiver tout germe pathogène présent dans les produits sanguins traités.
PCT/US1996/009836 1995-06-07 1996-06-06 Procedes d'inactivation de leucocytes et d'inhibition de la production de cytokines dans des produits sanguins WO1996039820A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU62674/96A AU6267496A (en) 1995-06-07 1996-06-06 Methods of inactivating leukocytes and inhibiting cytokine p roduction in blood products

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US48578395A 1995-06-07 1995-06-07
US08/485,783 1995-06-07
US55934495A 1995-11-15 1995-11-15
US08/559,344 1995-11-15

Publications (1)

Publication Number Publication Date
WO1996039820A1 true WO1996039820A1 (fr) 1996-12-19

Family

ID=27048476

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1996/009836 WO1996039820A1 (fr) 1995-06-07 1996-06-06 Procedes d'inactivation de leucocytes et d'inhibition de la production de cytokines dans des produits sanguins

Country Status (2)

Country Link
AU (1) AU6267496A (fr)
WO (1) WO1996039820A1 (fr)

Cited By (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998046073A1 (fr) * 1997-04-16 1998-10-22 Sigma-Tau Industrie Farmaceutiche Riunite S.P.A. Amelioration du stockage et de la conservation de produits sanguins
WO1999003976A2 (fr) * 1997-07-21 1999-01-28 Cerus Corporation Traitement des leucocytes, compositions leucocytaires, et leur procede d'utilisation
US6617101B1 (en) 1999-01-25 2003-09-09 V. I. TECHNOLOGIES, Inc. Lipophilic quenching of viral inactivating agents
US6617157B1 (en) 1997-10-03 2003-09-09 V.I. Technologies, Inc. Methods and compositions for the selective modification of nucleic acids
US6720136B2 (en) 1998-09-25 2004-04-13 V. I Technologies, Inc. Solid phase quenching systems
US6774123B1 (en) 1998-01-12 2004-08-10 V.I. Technologies, Inc. Methods and compositions for inactivating viruses
US8124408B2 (en) 2006-10-04 2012-02-28 Janssen Pharmaceutica N.V. Preparation of inactivated artificial antigen presenting cells and their use in cell therapies
WO2016014854A1 (fr) 2014-07-23 2016-01-28 Cerus Corporation Procédés de préparation de produits contenant des plaquettes
WO2016057965A1 (fr) 2014-10-10 2016-04-14 Cerus Corporation Compositions et méthodes de traitement de la fièvre hémorragique virale
WO2016210374A1 (fr) 2015-06-26 2016-12-29 Cerus Corporation Compositions de cryoprécipités et leurs procédés de préparation
WO2017070619A1 (fr) 2015-10-23 2017-04-27 Cerus Corporation Compositions de plasma et leurs procédés d'utilisation
US9675720B2 (en) 2012-12-19 2017-06-13 PurpleSun, Inc. Sterilization units, systems, and methods
WO2017120545A2 (fr) 2016-01-07 2017-07-13 Cerus Corporation Systèmes et méthodes pour la préparation de plaquettes
EP3215139A4 (fr) * 2014-11-03 2018-07-18 Cerus Corporation Compositions et procédés pour thérapies par cellules car-t améliorées
WO2018161020A1 (fr) 2017-03-03 2018-09-07 Cerus Corporation Kits et méthodes de préparation de compositions de plaquettes inactivées par des agents pathogènes
WO2019060610A1 (fr) 2017-09-20 2019-03-28 Cerus Corporation Compositions et méthodes d'inactivation de pathogènes de plaquettes
WO2019133929A1 (fr) 2017-12-29 2019-07-04 Cerus Corporation Systèmes et procédés pour traiter de fluides biologiques
US11511012B2 (en) 2018-01-16 2022-11-29 Leviant, Inc. Adaptive multivector illumination delivery system
US11524086B2 (en) 2019-12-06 2022-12-13 Leviant, Inc. Proportionality of distributed illumination with adaptive multivector delivery system
US11883544B2 (en) 2019-06-28 2024-01-30 Cerus Corporation System and methods for implementing a biological fluid treatment device
US12011510B2 (en) 2019-06-22 2024-06-18 Cerus Corporation Biological fluid treatment systems

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5376524A (en) * 1991-04-01 1994-12-27 Thomas Jefferson University Platelet storage medium containing acetate and phosphate
US5399719A (en) * 1993-06-28 1995-03-21 Steritech, Inc. Compounds for the photodecontamination of pathogens in blood
US5459030A (en) * 1992-03-02 1995-10-17 Steritech, Inc. Synthetic media compositions for inactivating bacteria and viruses in blood preparations with 8-methoxypsoralen

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5376524A (en) * 1991-04-01 1994-12-27 Thomas Jefferson University Platelet storage medium containing acetate and phosphate
US5459030A (en) * 1992-03-02 1995-10-17 Steritech, Inc. Synthetic media compositions for inactivating bacteria and viruses in blood preparations with 8-methoxypsoralen
US5399719A (en) * 1993-06-28 1995-03-21 Steritech, Inc. Compounds for the photodecontamination of pathogens in blood

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
ARCH. DERM. RES., 12 December 1992, Vol. 260(2), WULF et al., "Toxic Effects of 8-Methoxypsoralen on Lymphocyte Devision", pages 87-92. *
JOURNAL NAT. CANCER INST., July 1982, Vol. 69(1), KRAEMER et al., "In Vitro Assay of the Effects of Psoralens Plus Ultraviolet Radiation on Human Lymphoid Cells", pages 219-227. *
LIN et al., "Use of 8-Methoxysporalen and Long-Wavelength Ultraviolet Radiation for Decontamination of Platelet Concentrates", July 1989, Vol. 74(1), pages 517-525. *
PHOTOCHEMISTRY AND PHOTOBIOLOGY, 1994, Vol. 59(2), NEUNER et al., "Cytokine Release by Peripheral Blood Mononuclear Cells is Affected by 8-Methoxypsoralen plus UV-A", pages 182-188. *
THROMB. HAEMOSTAS., 1991, Vol. 65, MARGOLIS-NUNNO H. et al., "Photochemical Virus Sterilization in Platelet Concentrates with Psoralen Derivatives", page 1102, Abstract 1680. *
TRANSFUSION, 1991, Vol. 31, Number 6, DODD et al., "Inactivation of Viruses in Platelet Suspensions that Retain their in Vitro Characteristics: Comparison of Psoralen-Ultraviolet A and Merocyanine 540 Visible Light Methods", pages 483-490. *
TRANSFUSION, 1993, Vol. 33(3), MUYELLE et al., "Increased Tumor Necrosis Factor (TNF), Interleukin 1 and Interleukin 6 (IL-6) Levels in the Plasma of Stored Platelet Concentrates: Relationship Between TNF and IL-6 Levels and Febrile Transfusion Reactions", pages 195-199. *
TRANSFUSION, 1994, Vol. 34(1), STACK et al., "Cytokine Generation in Stored Platelet Concentrates", pages 20-25. *

Cited By (35)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998046073A1 (fr) * 1997-04-16 1998-10-22 Sigma-Tau Industrie Farmaceutiche Riunite S.P.A. Amelioration du stockage et de la conservation de produits sanguins
WO1999003976A2 (fr) * 1997-07-21 1999-01-28 Cerus Corporation Traitement des leucocytes, compositions leucocytaires, et leur procede d'utilisation
WO1999003976A3 (fr) * 1997-07-21 1999-05-27 Cerus Corp Traitement des leucocytes, compositions leucocytaires, et leur procede d'utilisation
AU748074B2 (en) * 1997-07-21 2002-05-30 Cerus Corporation Method of treating leukocytes, leukocyte compositions and methods of use thereof
US6617157B1 (en) 1997-10-03 2003-09-09 V.I. Technologies, Inc. Methods and compositions for the selective modification of nucleic acids
US6774123B1 (en) 1998-01-12 2004-08-10 V.I. Technologies, Inc. Methods and compositions for inactivating viruses
US6720136B2 (en) 1998-09-25 2004-04-13 V. I Technologies, Inc. Solid phase quenching systems
US6617101B1 (en) 1999-01-25 2003-09-09 V. I. TECHNOLOGIES, Inc. Lipophilic quenching of viral inactivating agents
US8124408B2 (en) 2006-10-04 2012-02-28 Janssen Pharmaceutica N.V. Preparation of inactivated artificial antigen presenting cells and their use in cell therapies
US8357533B2 (en) 2006-10-04 2013-01-22 Janssen Pharmaceutica, N.V. Preparation of inactivated artificial antigen presenting cells and their use in cell therapies
US10894102B2 (en) 2012-12-19 2021-01-19 Purplesun Inc. Sterilization units, systems, and methods
US10376604B2 (en) 2012-12-19 2019-08-13 Purplesun Inc. Sterilization units, systems, and methods
US11813370B2 (en) 2012-12-19 2023-11-14 Leviant, Inc. Sterilization units, systems, and methods
US9675720B2 (en) 2012-12-19 2017-06-13 PurpleSun, Inc. Sterilization units, systems, and methods
WO2016014854A1 (fr) 2014-07-23 2016-01-28 Cerus Corporation Procédés de préparation de produits contenant des plaquettes
US10842818B2 (en) 2014-07-23 2020-11-24 Cerus Corporation Methods for preparing platelet products
WO2016057965A1 (fr) 2014-10-10 2016-04-14 Cerus Corporation Compositions et méthodes de traitement de la fièvre hémorragique virale
EP3215139A4 (fr) * 2014-11-03 2018-07-18 Cerus Corporation Compositions et procédés pour thérapies par cellules car-t améliorées
US10688166B2 (en) 2014-11-03 2020-06-23 Cerus Corporation Compositions and methods for improved car-T cell therapies
WO2016210374A1 (fr) 2015-06-26 2016-12-29 Cerus Corporation Compositions de cryoprécipités et leurs procédés de préparation
US11096963B2 (en) 2015-06-26 2021-08-24 Cerus Corporation Cryoprecipitate compositions and methods of preparation thereof
WO2017070619A1 (fr) 2015-10-23 2017-04-27 Cerus Corporation Compositions de plasma et leurs procédés d'utilisation
US10799533B2 (en) 2015-10-23 2020-10-13 Cerus Corporation Plasma compositions and methods of use thereof
WO2017120545A2 (fr) 2016-01-07 2017-07-13 Cerus Corporation Systèmes et méthodes pour la préparation de plaquettes
WO2018161020A1 (fr) 2017-03-03 2018-09-07 Cerus Corporation Kits et méthodes de préparation de compositions de plaquettes inactivées par des agents pathogènes
US11235090B2 (en) 2017-03-03 2022-02-01 Cerus Corporation Kits and methods for preparing pathogen-inactivated platelet compositions
WO2019060610A1 (fr) 2017-09-20 2019-03-28 Cerus Corporation Compositions et méthodes d'inactivation de pathogènes de plaquettes
WO2019133929A1 (fr) 2017-12-29 2019-07-04 Cerus Corporation Systèmes et procédés pour traiter de fluides biologiques
US11554185B2 (en) 2017-12-29 2023-01-17 Cerus Corporation Systems and methods for treating biological fluids
US11511012B2 (en) 2018-01-16 2022-11-29 Leviant, Inc. Adaptive multivector illumination delivery system
US11839704B2 (en) 2018-01-16 2023-12-12 Leviant, Inc. Adaptive multivector illumination delivery system
US12011510B2 (en) 2019-06-22 2024-06-18 Cerus Corporation Biological fluid treatment systems
US11883544B2 (en) 2019-06-28 2024-01-30 Cerus Corporation System and methods for implementing a biological fluid treatment device
US11524086B2 (en) 2019-12-06 2022-12-13 Leviant, Inc. Proportionality of distributed illumination with adaptive multivector delivery system
US11534511B2 (en) 2019-12-06 2022-12-27 Leviant, Inc. Proportionality of distributed illumination with adaptive multivector delivery system

Also Published As

Publication number Publication date
AU6267496A (en) 1996-12-30

Similar Documents

Publication Publication Date Title
US6469052B2 (en) Compounds for the photodecontamination of pathogens in blood
US5593823A (en) Method for inactivating pathogens in blood using photoactivation of 4'-primary amino-substituted psoralens
EP0707476B1 (fr) Composes de photodecontamination de pathogenes contenus dans le sang
US5871900A (en) Method of inactivating pathogens in biological fluids using photoactivated 5-primaryamino psoralens
WO1996039820A1 (fr) Procedes d'inactivation de leucocytes et d'inhibition de la production de cytokines dans des produits sanguins
US6686480B2 (en) Compounds for the photodecontamination of pathogens in blood
US6544727B1 (en) Methods and devices for the removal of psoralens from blood products
EP0840781B1 (fr) Procedes et dispositif pour l'extraction des psoralenes des produits sanguins
US6004741A (en) Method for the photoactivation of 4' and 5' primary aminoalkyl psoralens in platelet preparations
US20020192632A1 (en) Method and devices for the removal of psoralens from blood products
US20030082510A1 (en) Psoralens for pathogen inactivation
US6004742A (en) Method for inactivation of pathogens in platelets using 4' and 5' primary amino-substituted psoralens
WO1997021346A1 (fr) Inactivation des virus non enveloppes
US20020115585A1 (en) Method and devices for the removal of psoralens from blood products
US8017110B1 (en) Induction of and maintenance of nucleic acid damage in pathogens using riboflavin and light
AU4899100A (en) Method and devices for the removal of psoralens from blood products

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AM AT AU BB BG BR BY CA CH CN CZ DE DK EE ES FI GB GE HU IS JP KE KG KP KR KZ LK LR LT LU LV MD MG MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TT UA UG US UZ VN AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase