WO1996039820A1

WO1996039820A1 - Methods of inactivating leukocytes and inhibiting cytokine production in blood products

Info

Publication number: WO1996039820A1
Application number: PCT/US1996/009836
Authority: WO
Inventors: Derek J. Hei; George D. Cimino; Joshua Grass; Laurence Corash
Original assignee: Cerus Corporation
Priority date: 1995-06-07
Filing date: 1996-06-06
Publication date: 1996-12-19
Also published as: AU6267496A

Abstract

The present invention provides new methods of inhibiting the proliferation of cells or inhibiting the production of cytokines in blood products by treating blood products with a psoralen compound, then photoactivating the compound by exposing the blood product to ultraviolet light. The present invention specifically provides methods of using new and known compounds to inactivate leukocytes in blood products to be used in vivo and in vitro without significantly effecting blood product function or exhibiting mutagenicity. The methods of the present invention also result in the inactivation of any pathogens in the blood products treated.

Description

METHODS OF INACTIVATING LEUKOCYTES AND INHIBITING CYTOKINE PRODUCTION IN BLOOD PRODUCTS

The present application is a continuation-in-part of U.S. Patent Application Serial No. 08/485,783, filed June 7, 1995, which is a continuation-in-part of U.S. Patent Application Serial No. 08/212,113, filed March 11, 1994, which is a continuation-in-part of U.S. Patent Application Serial No. 08/083,459, which issued on March 21, 1995 as U.S. Patent No. 5,399,719, all of which are hereby incorporated by reference.

FIELD OF THE INVENTION

The present invention provides new methods of inactivating T-cells and inhibiting cytokine production in blood products by treating blood products with a psoralen compound in the presence of ultraviolet light. The present invention specifically provides new methods of preventing graft versus host disease (GVHD).

BACKGROUND

Whole blood collected from volunteer donors for transfusion recipients is typically separated into its components: red blood cells, platelets, and plasma. Each of these fractions are individually stored and used to treat a multiplicity of specific conditions and disease states. For example, the red blood cell component is used to treat anemia; the concentrated platelet component is used to control bleeding; and the plasma component is used frequently as a source of Clotting Factor VIII for the treatment of coagulopathies or for plasma replacement of therapeutic apheresis in certain diseases.

Ideally, all blood cell preparations should be from freshly drawn blood and then immediately transfused to the recipient. However, the logistics of operating a blood donor center preclude this possibility in the vast majority of cases. Transfusions are needed day and night and it is difficult, if not impossible, to arrange for donor recruiting at unusual hours. Consequently, modern blood donor centers must use stored blood products. While it is a practical necessity to store blood for transfusion use, the storage can significantly effect the effectiveness and safety of the blood product. In the United States, blood storage procedures are subject to regulation by the government as a way of reducing potential ill effects of storage. The maximum storage periods for the blood components collected in these systems are specifically prescribed. For example, whole blood components collected in an "open" (i.e. non-sterile) system must, under governmental rules, be transfused within twenty-four hours and in most cases within six to eight hours. By contrast, when whole blood components are collected in a "closed" (i.e. sterile) system the red blood cells can be stored up to forty-two days (depending upon the type of anticoagulant and storage medium used) and plasma may be frozen and stored for even longer periods.

Murphy and Gardner, New Eng.J.Med. 280:1094 (1969), demonstrated that platelets stored in plasma at 22°C possessed a better in vivo half-life than those stored at 4°C. Thus, more acceptable platelet concentrates could be transfused after storage at room temperature. Until 1986, the rules allowed for platelet concentrate storage at room temperature for up to seven days (depending upon the type of storage container). However, it was recognized that the incidence of bacterial growth and subsequent transfusion reactions in the recipient increased to unacceptable levels with a seven day old platelet concentrate. Platelet concentrates may now be stored for no more than five days.

In many cases, several units of platelets will be pooled before they are transfused into a patient. "Pooled platelets" are herein defined as a mixture of platelets which originate from more than one donor. Most adults require the pooling of 6 to 8 units. Stack and Snyder, Blood Separation and Plasma Fractionation, pp 99-124, 1991, Wiley-Liss, Inc. Although sterile docking techniques for pooling the units exist, it is not an accepted practice to pool the units prior to storage. First, there is a risk of bacterial contamination every time the system is opened, despite sterile docking techniques. Second, there is a risk of mixed lymphocyte reactions (MLR), potentially resulting in the stimulation of white blood cell proliferation when platelets from more than one donor are pooled. Both the perceived risk of bacterial sepsis and the potential of MLR have made pooling platelets prior to storage unfeasible. A method of inhibiting proliferation of cells would make the pooling of platelets prior to storage possible in the blood bank setting.

Graft versus host disease (G VHD) and transfusion associated GVHD (TA- GVHD) present two distinct threats stemming from the action of white blood cells in cell transplants. GVHD is commonly observed after allogeneic bone marrow transplantation. TA-GVHD is an often fatal complication of the transfusion of blood components occurring in severely immunocompromised patients. The currently accepted treatment for blood products containing cellular components is treatment with gamma irradiation to inactivate T-cells. This treatment reduces the risk of graft-versus-host disease in immunocompromised patients. Anderson, K.C., Clinical indications for blood component irradiation. In: Irradiation of Blood Components, Baldwin, M.L. and Jeffries, L.C. ed.,

American Assoc. of Blood Banks, Bethesda, MD (1992) pp. 31. Pelszynski et al. studied several doses of gamma irradiation and found that a dose of 2500 Rads was sufficient to eliminate T-cell growth (>10^ reduction) in red blood cell units. Pelszynski, M.M., et al, "Effect of g-irradiation of red blood cell units on T-cell inactivation as assessed by limiting dilution analysis: implications for preventing transfusion-associated graft-versus-host disease," Blood 83: 1683-1689 (1994). At present, this is a standard treatment and dose for blood products destined for transfusion of a patient at risk for GVHD. Unfortunately, as highlighted by Pelszynski et al., there is a slim margin of safety for gamma irradiation. Treatments that fall even slightly below the 2500 Rad dosage exhibit a drastic increase in functioning leukocyte cells, thereby representing a risk of TA-GVHD. On the other hand, an increase in the 2500 Rad dosage is viewed as potentially damaging to the treated blood product's function. Further, there is no current method of monitoring the treated products to ensure the treatment was sufficient. Thus a method of inactivating T-cells that offers a broader safety margin and that can be monitored for effectiveness is needed.

Leukodepletion while once contemplated as an approach to prevent GVHD. However, there is evidence that leukodepletion in these products is not uniformly achieved. Anderson, KC "Leukodepleted cellular blood components for prevention of transfusion associated graft versus host disease," Abstract from

Workshop on Leukoreduced Products, March 22, 1995, National Institutes of Health, Bethesda, Maryland).

Alternative treatment methods have been used to inactivate leukocytes. Treatment with 8-methoxypsoralen plus UVA has previously been investigated as a method for inactivating white blood cells in several different model systems. Neuner et at. demonstrated that exposing peripheral blood mononuclear cells (PBMC) to UVA in the presence of 8-methoxypsoralen (8-MOP) resulted in significant reductions in levels of IL-6 and IL-8. Ullrich found that treating bone marrow with 8-MOP plus UVA prior to transplantation inactivated T-cells and partially suppressed both the incidence of graft-versus-host disease and the incidence of graft failure. Ullrich, S.E., "Photoinactivation of T-cell function with psoralen and UVA radiation suppresses the induction of experimental murine graft-versus-host disease across major histocompatability barriers," J. Invest. Dermatol. 96: 303-308 (1991).

PBMCs isolated from patients receiving 8-MOP PUVA (psoralen UVA) treatment for psoriasis were also shown to express lower levels of mRNA encoding for IL-lb, IL-6, IL-8, and TNF-a. The observed inhibition of cytokine synthesis in PBMCs from PUVA patients may contribute to the clinical effects of PUVA. Neuner, P., et al., "Cytokine release by peripheral blood mononuclear cells is affected by 8-methoxypsoralen plus UV-A," Photochemistry and Photobiology 59: 182-188 (1994). Ullrich found that treating donor marrow with 8-MOP plus UVA inactivated T-cells and suppressed both the incidence of graft-versus-host disease and the incidence of graft failure. Ullrich, S.E., "Photoinactivation of T-cell function with psoralen and UVA radiation suppresses the induction of experimental murine graft-versus-host disease across major histocompatability barriers," J. Invest. Dermatol. 96: 303-308 (1991).

Unfortunately, the compound used in these prior treatment methods, 8- MOP, is not ideal for several reasons. First, 8-MOP is not very soluble in aqueous solutions. Thus it is difficult to reach effective concentrations of 8-MOP without the use of a solvent, such as DMSO, which is not preferred for in vivo human use. Second, 8-MOP is not a particularly active nucleic acid binder. Higher light doses are required to achieve satisfactory inhibition of cytokines. These necessarily high light doses can be damaging to blood cells. Thus it is expected that methods using 8-MOP to inhibit cytokine production, inactivate T-cells and prevent GVHD or febrile nonhemolytic transfusion reactions (FNHTRs) would have no practical efficacy or utility.

The storage of blood products can also result in undesired production or elevation of cytokine levels. The complex interactions among immune response cells are mediated by this group of secreted low molecular-weight proteins that are collectively designated cytokines. Cytokines are hormone-like substances secreted by a wide variety of cells, including (but not limited to) lymphocytes (B and T), macrophages, fibroblasts, and endothelial cells. The existence of these very active biologic agents has been known for over 30 years. It is now known that the cytokines consist of a broad class of glycoproteins that have TABLE 1

NAME Abbr. TYPE SPECIFIC NAME

Interferons IFN alpha Leukocyte interferon beta Fibroblast interferon gamma Macrophage activation factor

Interleukins IL-1 1 alpha Endogenous pyrogen l beta Lymphocyte-activating factor

I ra IL-1 receptor antagonist

IL-2 T-cell growth factor

IL-3 Mast cell growth factor

IL-4 B-cell growth factor

IL-5 Eosinophil differentiation factor

IL-6 Hybridoma growth factor

IL-7 Lymphopoietin

IL-8 Granulocyte chemotactic protein

IL-9 Megakaryoblast growth factor

IL-10 Cytokine synthesis inhibitor factor

IL-11 Stromal cell-derived cytokine

IL-12 Natural killer cell stimulatory factor

Tumor necrosis factors TNF alpha Cachectin beta Lymphotoxin

Colony stimulating CSF GM-CSF Granulocyte-macrophage colony- factors stimulating factor

MpCSF Macrophage growth factor

G-CSF Granulocyte colony-stimulating factor

EPO Erythropoietin

Transforming growth TGF beta l Cartilage-inducing factor factors beta 2 Epstein-Barr virus-inducing factor beta 3 Tissue-derived growth factor other growth factors LIF Leukemia inhibitory factor

MIF Macrophage migration-inhibiting _ factor TABLE 1 (continued)

NAME Abbr. TYPE SPECIFIC NAME

MCP Monocyte chemoattractant protein

EGF Epidermal growth factor

PDGF Platelet-derived growth factor

FGF alpha Acidic fibroblast growth factor beta Basic fibroblast growth factor

ILGF Insulin-like growth factor

NGF Nerve growth factor

BCGF B-cell growth factor

the ability to regulate intercellular communication (i.e., cell-cell interaction) in both normal and pathologic situations. The cytokines generally contain from approximately 60 to 200 amino acid residues each, with a relative molecular weight of from 15 to 25 kilo Daltons. At least 35 distinct cytokines have been elucidated (Table 1). Blajchman, M.A., "Cytokines in Transfusion Medicine," 33:1 (1993).

Cytokine production may have significant ill effects on recipients of platelet transfusions. For example, febrile nonhemolytic transfusion reactions were previously believed to be caused by reactions between recipient anti- leukocyte alloantibodies and leukocytes from transfused platelet units. Decary, F. et al., "An investigation of nonhemolytic transfusion reactions," Vox Sang. 46: 277 (1984); Heinrich, D., Mueller-Eckhardt, C, Stier, W. "The specificity of leukocyte and platelet alloantibodies in sera of patients with nonhemolytic transfusion reactions," Vox Sang. 25: 442 (1973). Since then, cytokines generated in platelet units during storage have been implicated as mediators of FNHTRs. Several studies have demonstrated that levels of interleukin 8 (IL-8), interleukin lb (IL-lb), interleukin 6 (IL-6), and tumor necrosis factor a (TNF-a) can increase from nondetectable to physiologically significant levels during storage of platelet concentrate units. Heddle, N.M., et al. "The role of the plasma from platelet concentrates in transfusion reactions," New England J. Med. 331: 625 (1994). Stack, G., Snyder, E.L., "Cytokine generation in stored platelet concentrates," Transfusion 34: 20-25 (1994). Muylle, L., "Increased tumor necrosis factor a (TNF a), interleukin 1, and interleukin 6 (IL-6) levels in the plasma of stored platelet concentrates: relationship between TNFa and IL-6 levels and febrile transfusion reactions," Transfusion 33: 195-199 (1993). Muylle et al. showed that platelet concentrates which caused FNHTRs also had high levels of IL-6 and TNF-a.

Heddle et al. were further able to demonstrate that the plasma component of stored platelet units was more likely to cause transfusion reactions than was the cellular fraction. Once again a strong correlation between cytokine levels and incidence of FNHTRs was demonstrated. Levels of cytokine generated in platelet units during storage were demonstrated to be a strong function of white blood cell (WBC) concentration . See Stack and Snyder; Muylle. Elevated levels of IL-6, IL-lb, and TNF-a appear to be found predominantly in platelet units having white blood cell counts greater than 3.0 x lO^/mL. Muylle, L., et al., "Increased rumor necrosis factor a (TNF a), interleukin 1, and interleukin 6 (IL-6) levels in the plasma of stored platelet concentrates: relationship between TNFa and IL-6 levels and febrile transfusion reactions," Transfusion 33: 195-199 (1993). Levels of IL-8 appear to be a slightly more sensitive indicator of cytokine production since elevated levels can be detected at even lower white blood cell counts. Stack and Snyder, Transfusion 34: 20-25 (1994).

Inhibition of cytokine generation during the storage of platelet units may minimize the occurrence of FNHTRs. Thus, it is desirable to find an efficient method of inhibiting cytokine production. Blood products containing cellular components are routinely treated with gamma irradiation to inactivate T-cells thereby reducing the risk of graft-versus-host disease in immunocompromised patients. Anderson, K.C., Clinical indications for blood component irradiation. In: Irradiation of Blood Components. Baldwin, M.L. and Jeffries, L.C. ed., American Assoc. of Blood Banks, Bethesda, MD (1992) pp. 31. Pelszynski et al. studied several doses of gamma irradiation and found that a dose of 2500 Rads was required to eliminate T-cell growth (>10^ reduction) in red blood cell units. Pelszynski, M.M., et al., "Effect of g-irradiation of red blood cell units on T-cell inactivation as assessed by limiting dilution analysis: implications for preventing transfusion-associated graft-versus-host disease," Blood 83: 1683-1689 (1994). At present, this is a standard treatment and dose for blood products destined for transfusion of a patient at risk for GVHD. However, data presented here indicates that cytokine levels increased in the gamma irradiated platelet concentrates during storage. This suggests that cytokine synthesis is still able to occur even though the T-cells are no longer capable of replication.

A method is needed which can inactivate T-cells and inhibit cytokine synthesis in blood products during storage, while preserving the biological function of the blood product. Specifically, a method is needed which can inactivate T-cells and inhibit cytokine production in platelets during storage while preserving the biological function of the platelets.

DESCRIPTION OF THE FIGURES FIG. 1 is a perspective view of one embodiment of the device of the present invention.

FIG. 2 is a cross-sectional view of the device shown in FIG. 1 along the lines of 2—2.

FIG. 3 is a cross-sectional view of the device shown in FIG. 1 along the lines of 3—3.

FIG. 4 is a cross-sectional view of the device shown in FIG. 1 along the lines of 4—4.

FIG. 5 shows the relationship between white blood cell counts in single random donor platelet units (solid squares) and levels of IL-8 following seven days of storage. The single open triangle represents a single unit which was excluded from the linear regression. The linear regression for the seven remaining unpooled random donor platelet units had a linear correlation coefficient of 0.98. The white blood cell count and IL-8 level for the random donor platelet unit which was prepared by pooling the eight individual units is indicated by the open circle.

FIG. 6 is a graph comparing IL-8 generation during 7-day storage of untreated (solid squares) pooled random donor platelet units with identical units treated by gamma-irradiation (solid circles), photochemical treatment (PCT) with

8-MOP (open circles), PCT with AMT (open triangles), or PCT with Compound 2 (open squares).

FIG. 7 is a graph of controls demonstrating the requirement of UVA illumination in the presence of psoralen for complete elimination of cytokine synthesis. Untreated control = solid circles, UVA illumination only = solid squares, Compound 2 only = open squares, and PCT with Compound 2 = open circles. Controls were also performed by adding Compound 2 to either plasma (diamonds) or PAS (triangles) solutions and illuminating with UVA before adding to platelets.

FIG. 8 is a graph showing the levels of IL-lb, IL-6, and TNF-a for untreated random donor platelet units and units treated with Compound 2 and UVA and stored over a 7-day period. Untreated control levels of IL-lb = solid squares, solid line; photochemical decontamination unit levels of IL-lb = open squares. Levels of both IL-6 and TNF-a in the untreated control (solid circles, solid triangles) and the photochemically decontaminated sample (open circles, open triangles, dashed line).

FIG. 9 is a graph depicting the levels of IL-8 generated in platelet units enriched with white blood cells following 5-day storage. Platelets (pool of 5- random donor platelet concentrates) were enriched with white blood cells prepared by Ficoll gradient to a final level of 4.3 x IO⁶ WBC/mL. The "Not

Spiked" control is the pooled platelets without added white blood cell preparation. The remaining samples were enriched with white blood cells and treated as indicated. The samples containing 8-MOP, AMT and Compound 2 were all illuminated with 1.9 J/cm² UVA.

FIG. 10 summarizes the levels of modification of DNA by 8-MOP (circle),

AMT (triangle) and Compound 2 (squares) at several concentrations as determined by levels of radioactivity in DNA isolated from platelet units treated with ³H-labeled psoralens. Data were obtained from platelet units enriched with 4.3 x IO⁶ WBC/mL. Psoralen was added to each platelet unit to the indicated final concentration and illuminated to 1.9 J/cm².

FIG. 11 shows the correlation between levels of DNA modification and day-5 levels of IL-8 produced in platelet units treated with 8-MOP, AMT, and

Compound 2. Data were obtained from identical platelet units enriched with 4.3 x IO⁶ WBCs/mL. Data points from left to right are: no treatment, 80 μM 8-MOP,

10 μM Compound 2, 150 μM AMT, 100 μM Compound 2, and 150 μM Compound

2. All samples containing psoralens were illuminated to 1.0 J/cm². The horizontal dashed line represents the initial day-0 level of IL-8 in the samples prior to treatment. FIG. 12A schematically shows the standard blood product separation approach used presently in blood banks.

FIG. 12B schematically shows an embodiment of the present invention whereby synthetic media is introduced to platelet concentrate prepared as in FIG.

12A. FIG. 12C schematically shows one embodiment of the decontamination approach of the present invention applied specifically to platelet concentrate diluted with synthetic media as in FIG. 12B.

FIG. 13A is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 2 at 100 μM (PCD) on platelet function as measured by platelet count, "n" represents the number of experiments represented by the data point.

FIG. 13B is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 2 at 100 μM (PCD) on platelet function as measured by platelet aggregation, "n" represents the number of experiments represented by the data point.

FIG. 13C is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 2 at 100 μM (PCD) on platelet function as measured by GMP-140 expression, "n" represents the number of experiments represented by the data point.

FIG. 13D is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 2 at 100 μM (PCD) on platelet function as measured by pH. "n" represents the number of experiments represented by the data point.

FIG. 14A is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 6 at 100 μM (PCD) on platelet function as measured by platelet count, "n" represents the number of experiments represented by the data point. FIG. 14B is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 6 at 100 μM (PCD) on platelet function as measured by platelet aggregation, "n" represents the number of experiments represented by the data point.

FIG. 14C is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 6 at 100 μM (PCD) on platelet function as measured by GMP-140 expression, "n" represents the number of experiments represented by the data point.

FIG. 14D is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 6 at 100 μM (PCD) on platelet function as measured by pH. "n" represents the number of experiments represented by the data point.

FIG. 15A is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 17 at 100 μM (PCD) on platelet function as measured by platelet count, "n" represents the number of experiments represented by the data point.

FIG. 15B is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 17 at 100 μM (PCD) on platelet function as measured by platelet aggregation, "n" represents the number of experiments represented by the data point. FIG. 15C is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 17 at 100 μM (PCD) on platelet function as measured by GMP-140 expression, "n" represents the number of experiments represented by the data point. FIG. 15D is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 17 at 100 μM (PCD) on platelet function as measured by pH. "n" represents the number of experiments represented by the data point. FIG. 16A is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 18 at 100 μM (PCD) on platelet function as measured by platelet count, "n" represents the number of experiments represented by the data point.

FIG. 16B is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 18 at 100 μM (PCD) on platelet function as measured by platelet aggregation, "n" represents the number of experiments represented by the data point.

FIG. 16C is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 18 at 100 μM (PCD) on platelet function as measured by GMP-140 expression, "n" represents the number of experiments represented by the data point.

FIG. 16D is a graph comparing the effects of 5-day storage (D5), ultraviolet light (UV) and treatment with Compound 18 at 100 μM (PCD) on platelet function as measured by pH. "n" represents the number of experiments represented by the data point.

FIG. 17 is a graph showing the t-cell inactivation kinetics in platelet concentrate with AMT and Compound 2 plus 1 Joule /cm^ UVA

FIG. 18 is a graph showing Leukocyte DNA Adduct formation with the psoralens AMT, 8-MOP and Compound 2 plus 1.9 Joules /cm2 UVA in PC.

SUMMARY OF THE INVENTION

The present invention provides new methods of inhibiting the proliferation of cells or inhibiting the production of cytokines in blood products by treating blood products with a psoralen compound in the presence of ultraviolet light prior to storage and transfusion. The following is a list of contemplated embodiments of the present invention, which in no way is intended to limit the breadth of the invention, but is merely presented as guidance. The present invention contemplates a method of inactivating leukocytes or inhibiting cytokine production in blood preparations, comprising the steps of: providing, in any order, i) a psoralen; ii) photoactivating means for photoactivating said psoralen; and iii) said blood preparation; adding said psoralen to said blood preparation; photoactivating said psoralen under conditions such that the leukocytes are inactivated or production of the targeted cytokines are inhibited. The invention contemplates that the treated blood preparation may then be stored. In one embodiment, said blood preparation comprises either plasma or platelets, for example, pooled platelets, platelet rich plasma or buffy coat platelets. In one embodiment, treated pooled platelets are stored for more than 4 hours prior to in vivo use. In one embodiment, said platelets are in a synthetic media. In one embodiment, said synthetic media is added to said platelets such that said platelets are suspended in mixture having a residual plasma concentration between approximately 8 and 40% by volume. In one embodiment of the invention, a method is contemplated for inhibiting cytokine production in blood preparations suspected of containing cells capable of producing cytokines, comprising the steps of: a) providing, in any order, i) a psoralen; ii) photoactivating means for photoactivating said psoralen; and iii) said blood preparation; b) adding said psoralen to said blood preparation; c) photoactivating said psoralen under conditions such that the production of cytokines from said cells is inhibited, wherein said cells are inhibited from producing cytokines, so as to create a treated blood preparation; and d) storing said treated blood preparation. It is further contemplated that said blood preparation comprises platelets, or that said platelets comprise pooled platelets, which may or may not have been stored for at least 4 hours prior to in vivo use. The platelets may be in a synthetic media. In one embodiment, the synthetic, media may be added to said platelets such that said platelets are suspended in mixture having a residual plasma concentration between approximately 8 and 40% by volume. The photoactivating means is contemplated to comprise, in one embodiment, a photoactivation device capable of emitting a given intensity of a spectrum of electromagnetic radiation comprising wavelengths between 320 nm and 400 nm. In a specific embodiment, the intensity is between 1 and 30 mW/cm^, and the blood preparation is exposed to said intensity for between 1 second and thirty minutes. While the invention contemplates many options, it specifically contemplates that the psoralen may be added to the blood preparation at a concentration of between 1 and 500 μM, or specifically, between 10 and 150 μM. It is contemplated that the psoralen comprises a 4'-primaryamino-substituted psoralen. It is further contemplated that two or more psoralens be used together. In one embodiment the psoralen is in a solution comprising water, saline, or a synthetic media prior to adding said psoralen to said blood preparation. It is contemplated that the cells that may be inhibited by the present methods include lymphocytes, an in some cases, prior to step (b) the lymphocytes comprise white blood cells at a minimum concentration of IxlO⁶ cells/ml.

Another method is contemplated for inhibiting cytokine production in a platelet preparation suspected of containing cells capable of producing cytokines, comprising the steps of: a) providing, in any order, i) a psoralen in a phosphate buffered, aqueous salt solution; ii) photoactivating means for photoactivating said psoralen; and iii) a platelet preparation containing plasma; b)removing a portion of said plasma from said platelet preparation and adding said solution to said platelets such that said platelets are suspended in mixture having a residual plasma concentration between approximately 8 and 40% by volume; and c) activating said psoralen in said mixture with said photoactivating means under conditions such that the production of cytokines from said cells is inhibited so as to create a treated platelet preparation, wherein said cells are inhibited from producing cytokines; and d) storing said treated platelet preparation. It is contemplated that the solution may further comprise sodium acetate and sodium citrate. In one embodiment, the means for activating comprises a photoactivation device capable of emitting a given intensity of a spectrum of electromagnetic radiation comprising wavelengths between 320 nm and 400 nm. and the intensity may further be between .1 and 25 mW/cm^. In an embodiment of the present invention, the mixture is exposed to said intensity for between one and ten minutes.

In alternative embodiments, the psoralen may be 8-methoxypsoralen or 4'- (4-amino 2-oxa)butyl-4,5',8-trimethylpsoralen. The cells inhibited by methods of the present invention are contemplated to include lymphocytes, which may be present prior to step (b) at a concentration of 1x10^ cells/ml or greater in specific. The platelet preparation may comprise pooled platelets, which in one embodiment are stored for at least 4 hours in step (d).

Yet another method encompassed by the present invention for inhibiting cytokine production in pooled platelets suspected of containing cells capable of producing cytokines, comprises the steps of: providing, in any order, i) a psoralen in a phosphate buffered, aqueous salt solution; ii) photoactivating means for photoactivating said psoralen; and iii) pooled platelets containing plasma; removing a portion of said plasma from said pooled platelets and adding said solution to said pooled platelets such that said pooled platelets are suspended in mixture having a residual plasma concentration between approximately 8 and 40% by volume; and activating said psoralen in said mixture with said photoactivating means under conditions such that the production of cytokines from said cells is inhibited so as to create a treated pooled platelet preparation, wherein said cells are inhibited from producing cytokines; and storing said treated pooled platelet preparation. The solution may contain sodium acetate and sodium citrate. It is contemplated that the photoactivating means comprises a photoactivation device capable of emitting a given intensity of a spectrum of electromagnetic radiation comprising wavelengths between 320 nm and 400 nm. and in one embodiment, the intensity is between .1 and 25 mW/cm^. The mixture may specifically be exposed to said intensity for between one and ten minutes. In alternative embodiments, the psoralen is 8-methoxypsoralen or 4'-(4- amino-2-oxa)butyl-4,5',8-trimethylpsoralen. The cells inhibited by the present invention may comprise lymphocytes, which in turn may comprise white blood cells at a concentration greater than 1x10^ cells/ml.

In one embodiment, pooled platelets are stored for at least 4 hours after treatment.

The present invention contemplates a specific method of inhibiting cytokine production in platelet preparations for transfusion, suspected of containing lymphocytes capable of producing cytokines, comprising the steps of: providing, in any order, a phosphate buffered, aqueous salt solution comprising 4'-(4-amino-2-oxa)butyl-4,5',8-trimethylpsoralen at a concentration between approximately 1 μg/ml and 300 μg/ml; photoactivating means for photoactivating said 4'-(4-amino-2-oxa)butyl-4,5',8-trimethylpsoralen; and a platelet preparation comprising platelets and plasma; removing a portion of said plasma from said platelet preparation and adding said solution to said platelets such that said platelets are suspended in mixture having a residual plasma concentration between 8 and 25% by volume; and activating said 4'-(4-amino-2- oxa)butyl-4,5',8-trimethylpsoralen in said mixture with said photoactivating means, such that the production of cytokines from said lymphocytes is inhibited so as to create a treated platelet preparation, wherein said lymphocytes are inhibited from producing cytokines; and storing said treated platelet preparation. The solution may comprise sodium citrate and sodium acetate.

It is contemplated that the means for activating may comprise a photoactivation device capable of emitting a given intensity of a spectrum of electromagnetic radiation comprising wavelengths between 320 nm and 400 nm. It is further contemplated that the platelet preparation comprises pooled platelets, and that prior to step (b) said lymphocytes comprise white blood cells at a minimum concentration of 1x10^ cells/ml. In another embodiment, the present invention contemplates a method of inhibiting protein expression by leukocytes in a blood preparation, comprising the steps of: providing, in any order, i) a psoralen; ii) photoactivating means for photoactivating said psoralen; and iii) said blood preparation; adding said psoralen to said blood preparation; photoactivating said psoralen under conditions such that the protein expression from said leukocytes is inhibited, so as to create a treated blood preparation; and storing said treated blood preparation.

Additionally, the present invention contemplates a method of inactivating leukocytes in blood preparations, comprising the steps of: providing, in any order, i) a psoralen; ii) photoactivating means for photoactiva ing said psoralen; and iii) said blood preparation suspected of containing leukocytes; adding said psoralen to said blood preparation; and photoactivating said psoralen under conditions such that leukocytes in said blood preparation are inactivated. It is contemplated that the blood preparation comprises platelets, such as pooled platelets. In a specific embodiment, the platelets are selected from the group consisting of buffy coat platelets and platelet rich plasma. In some embodiments, the platelets are in a synthetic media, and the synthetic media is added to said platelets such that said platelets are suspended in mixture having a residual plasma concentration between approximately 8 and 40% by volume.

Yet another method of inactivating T-cells in platelet preparations is contemplated, comprising the steps of: providing, in any order, i) a phosphate buffered, aqueous salt solution and an aminopsoralen; ii) photoactivating means for photoactivating said aminopsoralen; and iii) a platelet preparation; removing said plasma from said platelet preparation and adding said solution to said platelets such that said platelets are suspended in mixture having a residual plasma concentration between approximately 8 and 40% by volume; and activating said aminopsoralen in said mixture with said photoactivating means under conditions such that the proliferation of T-cells is inhibited so as to create a treated blood preparation.

DESCRIPTION OF THE INVENTION

The present invention provides new methods of inhibiting cytokine production and inactivating T-cells in blood products by treating blood products with a psoralen compound, then photoactivating the compound by exposing the blood product to ultraviolet light. The present invention specifically provides methods of using new and known compounds to inhibit cytokine production and inactivate T-cells in blood products to be used in vivo and in vitro without significantly effecting blood product function or exhibiting mutagenicity, thereby preventing TA-GVHD and FNHTRs. The methods of the present invention also result in the inactivation of any pathogens in the blood products treated. The method of the present invention. utilizes psoralens as the photochemical agent to inactivate nucleic-acid-dependent entities such that their nucleic acid can not be replicated or transcribed. The agents contemplated are low molecular weight compounds that react with nucleic acid when activated by UVA light. The reaction between psoralens and nucleic acid results in either single covalent reactions (monoadducts) or crosslinking of the nucleic acid (di- adducts) which prevent the replication of nucleic acid-dependent entities. Psoralens have been shown to be effective at inactivating a variety of both single and double-stranded RNA and DNA viruses. Hanson, C, "Photochemical inactivation of viruses with psoralens: An overview," Blood Cells 18: 7-25 (1992). Moreover, photochemical decontamination with 8-MOP and 4'-aminomethyl- 4,5',8-trimethylpsoralen (AMT) have previously been investigated as potential methods for inactivating viruses in both plasma and platelet concentrates. Morel, P., et al, "Photochemical inactivation of viruses and bacteriophage in plasma and plasma fractions," Blood Cells 18: 27-42 (1992). Corash, L., "Use of 8- methoxypsoralen and long wavelength ultraviolet radiation for decontamination of platelet concentrates," Blood Cells 18: 57-47 (1992). Alter, H.J., "Photochemical decontamination of blood components containing Hepatitis B and non-A, non-B virus," The Lancet Dec 24/31: 1446-1450 (1992).

Psoralens target nucleic acid and react to form either covalent crosslinks or monoadditions to nucleic acid when activated by illumination with ultraviolet A light. Hanson, C, "Photochemical inactivation of viruses with psoralens: An overview," Blood Cells 18: 7-25 (1992). Psoralen-modified nucleic acid can not be processed by enzymes such as reverse transcriptase which suggests that complete blockage of the transcription process can be achieved. Diseases which are transmitted by viral and bacterial contaminants in transfused blood products can therefore be effectively eliminated by photochemical decontamination. The results discussed in the examples that follow support that in addition to inactivating viral and bacterial contaminants in platelet and plasma units, photochemical decontamination can prevent cytokine production and inactivate passenger leukocytes in blood products, thereby removing causes of febrile non¬ hemolytic transfusion reactions and graft-versus-host disease.

The description of the invention is divided into the following sections: I) Photoactivation Devices, II) Compound Synthesis, III) Binding of Compounds to Nucleic Acid, IV) Inactivation of Cytokine Production and Inactivation of T-cells, V) Preparation of Vaccines, VI) Preservation of Biochemical Properties of Material Treated and VII) Graft Versus Host Disease.

I. PHOTOACTIVATION DEVICES

The present invention contemplates devices and methods for photoactivation and specifically, for photoactivation of photoreactive nucleic acid binding compounds. The present invention contemplates devices having an inexpensive source of electromagnetic radiation that is integrated into a unit. In general, the present invention contemplates a photoactivation device for treating photoreactive compounds, comprising: a) means for providing appropriate wavelengths of electromagnetic radiation to cause photoactivation of at least one photoreactive compound; b) means for supporting a plurality of samples in a fixed relationship with the radiation providing means during photoactivation; and c) means for maintaining the temperature of the samples within a desired temperature range during photoactivation. The present invention also contemplates methods, comprising: a) supporting a plurality of sample containers, containing one or more photoreactive compounds, in a fixed relationship with a fluorescent source of electromagnetic radiation; b) irradiating the plurality of sample containers simultaneously with electromagnetic radiation to cause photoactivation of at least one photoreactive compound; and c) maintaining the temperature of the sample within a desired temperature range during photoactivation.

The major features of one embodiment of the device of the present invention involve: A) an inexpensive source of ultraviolet radiation in a fixed relationship with the means for supporting the sample containers, B) rapid photoactivation, C) large sample processing, D) temperature control of the irradiated samples, and E) inherent safety.

A. Electromagnetic Radiation Source

Many sources of ultraviolet radiation can be successfully used in decontamination protocols with psoralens. For example, some groups have irradiated sample from above and below by General Electric type F20T12-BLB fluorescent UVA bulbs with an electric fan blowing gently across the lights to cool the area. Alter, H. J., et al, The Lancet, 24:1446 (1988). Another group used

Type A405-TLGW/05 long wavelength ultraviolet lamp manufactured by P. W. Allen Co., London placed above the virus samples in direct contact with the covers of petri dishes containing the samples, and was run at room temperature. The total intensity delivered to the samples under these conditions was 1.3 x 10 5 photons /second cm² (or 0.7 mW/cm² or .0007 J/cm² sec) in the petri dish. Hearst, J. E., and Thiry, L., Nucleic Acids Research, 4:1339 (1977). However, without intending to be limited to any type of photoactivation device, the present invention contemplates several preferred arrangements for the photoactivation device, as follows.

A preferred photoactivation device of the present invention has an inexpensive source of ultraviolet radiation in a fixed relationship with the means for supporting the sample vessels. Ultraviolet radiation is a form of energy that occupies a portion of the electromagnetic radiation spectrum (the electromagnetic radiation spectrum ranges from cosmic rays to radio waves). Ultraviolet radiation can come from many natural and artificial sources. Depending on the source of ultraviolet radiation, it may be accompanied by other (non-ultraviolet) types of electromagnetic radiation (e.g. visible light). Particular types of ultraviolet radiation are herein described in terms of wavelength. Wavelength is herein described in terms of nanometers ("nm"; 10"9 meters). For purposes herein, ultraviolet radiation extends from approximately 180 nm to 400 nm. When a radiation source, by virtue of filters or other means, does not allow radiation below a particular wavelength (e.g. 320 nm), it is said to have a low end "cutoff" at that wavelength (e.g. "a wavelength cutoff at 300 nanometers"). Similarly, when a radiation source allows only radiation below a particular wavelength (e.g. 360 nm), it is said to have a high end "cutoff" at that wavelength (e.g. "a wavelength cutoff at 360 nanometers").

For any photochemical reaction it is desired to eliminate or least minimize any deleterious side reactions. Some of these side reactions can be caused by the excitation of endogenous chromophores that may be present during the photoactivation procedure. In a system where only nucleic acid and psoralen are present, the endogenous chromophores are the nucleic acid bases themselves. Restricting the photoactivation process to wavelengths greater than 320 nm minimizes direct nucleic acid damage since there is very little absorption by nucleic acids above 313 nm.

In human serum or plasma, for example, the nucleic acid is typically present together with additional biological constituents. If the biological fluid is just protein, the 320 nm cutoff will be adequate for minimizing side reactions (aromatic amino acids do not absorb above 320 nm). If the biological fluid includes other analytes, there may be constituents that are sensitive to particular wavelengths of light. In view of the presence of these endogenous constituents, it is intended that the device of the present invention be designed to allow for irradiation within a small range of specific and desirable

and thus avoid damage blood components. The preferred range of desirable wavelengths is between 320 and 350 nm.

Some selectivity can be achieved by choice of commercial irradiation sources. For example, while typical fluorescent tubes emit wavelengths ranging from 300 nm to above 400 nm (with a broad peak centered around 360 nm), BLB type fluorescent lamps are designed to remove wavelengths above 400 nm. This, however, only provides an upper end cutoff.

In a preferred embodiment, the device of the present invention comprises an additional filtering means. In one embodiment, the filtering means comprises a glass cut-off filter, such as a piece of Cobalt glass. In one embodiment, the filtering means is BK-7 glass, available from Shott Glass Technologies, Inc. Duryea, PA. In another embodiment, the filtering means comprises a liquid filter solution that transmits only a specific region of the electromagnetic spectrum, such as an aqueous solution of Co(Nθ3)2- This salt solution yields a transmission window of 320-400 nm. In a preferred embodiment, the aqueous solution of Co(Nθ3)2 is used in combination with NiSθ4 to remove the 365 nm component of the emission spectrum of the fluorescent or arc source employed. The Co-Ni solution preserves its initial transmission remarkably well even after tens of hours of exposure to the direct light of high energy sources.

It is not intended that the present invention be limited by the particular filter employed. Several inorganic salts and glasses satisfy the necessary requirements. For example, cupric sulfate is a most useful general filter for removing the infra-red, when only the ultraviolet is to be isolated. Its stability in intense sources is quite good. Other salts are known to one skilled in the art.

Aperture or reflector lamps may also be used to achieve specific wavelengths and intensities.

When ultraviolet radiation is herein described in terms of irradiation, it is expressed in terms of intensity flux (milliwatts per square centimeter or "mW cm- 2" or J/cm²sec). "Output" is herein defined to encompass both the emission of radiation (yes or no; on or off) as well as the level of irradiation. In a preferred embodiment, intensity is monitored at 4 locations: 2 for each side of the plane of irradiation.

A preferred source of ultraviolet radiation is a fluorescent source. Fluorescence is a special case of luminescence. Luminescence involves the absorption of electromagnetic radiation by a substance and the conversion of the energy into radiation of a different wavelength. With fluorescence, the substance that is excited by the electromagnetic radiation returns to its ground state by emitting a quantum of electromagnetic radiation. While fluorescent sources have heretofore been thought to be of too low intensity to be useful for photoactivation, in one embodiment the present invention employs fluorescent sources to achieve results thus far achievable on only expensive equipment. As used here, fixed relationship is defined as comprising a fixed distance and geometry between the sample and the light source during the sample irradiation. Distance relates to the distance between the source and the sample as it is supported. It is known that light intensity from a point source is inversely related to the square of the distance from the point source. Thus, small changes in the distance from the source can have a drastic impact on intensity. Since changes in intensity can impact photoactivation results, changes in distance are avoided in the devices of the present invention. This provides reproducibility and repeatability.

Geometry relates to the positioning of the light source. For example, it can be imagined that light sources could be placed around the sample holder in many ways (on the sides, on the bottom, in a circle, etc.). The geometry used in a preferred embodiment of the present invention allows for uniform light exposure of appropriate intensity for rapid photoactivation. The geometry of a preferred device of the present invention involves multiple sources of linear lamps as opposed to single point sources. In addition, there are several reflective surfaces and several absorptive surfaces. Because of this complicated geometry, changes in the location or number of the lamps relative to the position of the samples to be irradiated are to be avoided in that such changes will result in intensity changes.

B. Rapid Photoactivation

The light source of the preferred embodiment of the present invention allows for rapid photoactivation. The intensity characteristics of the irradiation device have been selected to be convenient with the anticipation that many sets of multiple samples may need to be processed. With this anticipation, a fifteen minute exposure time or less is a practical goal.

In designing the devices of the present invention, relative position of the elements of the preferred device have been optimized to allow for approximately fifteen minutes of irradiation time, so that, when measured for the wavelengths between 320 and 350 nanometers, an intensity flux greater than approximately 1 mW cm-2 (.001 J/cm² sec.) is provided to the sample vessels. C. Processing of Large Numbers of Samples

As noted, another important feature of the photoactivation devices of the present invention is that they provide for the processing of large numbers of samples. In this regard, one element of the devices of the present invention is a means for supporting one or a plurality of blood bags. In the preferred embodiment of the present invention the supporting means comprises a blood bag support placed between two banks of lights. By accepting commonly used commercially available bags, the device of the present invention allows for convenient processing of large numbers of samples.

D. Temperature Control

As noted, one of the important features of the photoactivation devices of the present invention is temperature control. Temperature control is important because the temperature of the sample in the sample at the time of exposure to light can dramatically impact the results. For example, conditions that promote secondary structure in nucleic acids also enhance the affinity constants of many psoralen derivatives for nucleic acids. Hyde and Hearst, Biochemistry, 17, 1251 (1978). These conditions are a mix of both solvent composition and temperature. With single stranded 5S ribosomal RNA, irradiation at low temperatures enhances the covalent addition of HMT to 5S rRNA by two fold at 4°C compared to 20°C. Thompson et al, J. Mol. Biol. 147:417 (1981). Even further temperature induced enhancements of psoralen binding have been reported with synthetic polynucleotides. Thompson et al, Biochemistry 21:1363 (1982).

E. Inherent Safety

Ultraviolet radiation can cause severe burns. Depending on the nature of the exposure, it may also be carcinogenic. The light source of a preferred embodiment of the present invention is shielded from the user. This is in contrast to the commercial hand-held ultraviolet sources as well as the large, high intensity sources. In a preferred embodiment, the irradiation source is contained within a housing made of material that obstructs the transmission of radiant energy (i.e. an opaque housing). No irradiation is allowed to pass to the user. This allows for inherent safety for the user.

F. Preservation of the Blood Products

A source of agitation may be provided either within or external to the photoactivation device for samples that require special handling. Platelet products, for example, generally require agitation to preserve the metabolic function of the cells.

II. COMPOUND SYNTHESIS A. Photoactivation Compounds in General

"Photoactivation compounds" (or "photoreactive compounds") defines a family of compounds that undergo chemical change in response to electromagnetic radiation. The following is a partial list of photoactivation compounds: Actinomycins

Anthracyclinones

Anthramycin

Benzodipyrones

Fluorenes and fluorenones Furocoumarins

Mitomycin

Monostral Fast Blue

Norphillin A

Many organic dyes not specifically listed Phenanthridines

Phenazathionium Salts

Phenazines

Phenothiazines

Phenylazides Quinolines

Thiaxanthenones

The preferred species of photoreactive compounds described herein is commonly referred to as the furocoumarins. In particular, the present invention contemplates those compounds described as psoralens: [7H-furo(3,2-g)-(l)- benzopyran-7-one, or b-lactone of 6-hydroxy-5-benzofuranacrylic acid], which are linear:

and in which the two oxygen residues appended to the central aromatic moiety have a 1, 3 orientation, and further in which the furan ring moiety is linked to the 6 position of the two ring coumarin system. Psoralen derivatives are derived from substitution of the linear furocoumarin at the 3, 4, 5, 8, 4', or 5' positions. 8-Methoxypsoralen (known in the literature under various named, e.g., xanthotoxin, methoxsalen, 8-MOP) is a naturally occurring psoralen with relatively low photoactivated binding to nucleic acids and low mutagenicity in the Ames assay, which is described in the following experimental section. 4'- Aminomethyl-4,5',8-trimethylpsoralen (AMT) is one of most reactive nucleic acid binding psoralen derivatives, providing up to 1 AMT adduct per 3.5 DNA base pairs. S.T. Isaacs, G. Wiesehahn and L.M. Hallick, NCI Monograph 66: 21 (1984). However, AMT also exhibits significant levels of mutagenicity. A new group of psoralens was desired which would have the best characteristics of both 8-MOP and AMT: low mutagenicity and high nucleic acid binding affinity, to ensure safe and thorough inactivation of pathogens. The compounds described here were designed to be such compounds.

"4'-primaryamino-substituted psoralens" are defined as psoralen compounds which have an NH2 group linked to the 4'-position of the psoralen by a hydrocarbon chain having a total length of 2 to 20 carbons, where 0 to 6 of those carbons are independently replaced by NH or O, and each point of replacement is separated from each other point of replacement by at least two carbons, and is separated from the psoralen by at least one carbon. 4'-primaryamino-substituted psoralens may have additional substitutions on the 4, 5', and 8 positions of the psoralen, said substitutions include, but are not limited to, the following groups: H and (CH2)_n H3, where n = 0-6.

"5'-primaryamino-substituted psoralens" are defined as psoralen compounds which have an NH2 group linked to the 5'-position of the psoralen by a hydrocarbon chain having a total length of 1 to 20 carbons, where 0 to 6 of those carbons are independently replaced by NH or O, and each point of replacement is separated from each other point of replacement by at least two carbons, and is separated from the psoralen by at least one carbon. 5'-primaryamino-substituted psoralens may have additional substitutions on the 4, 4', and 8 positions of the psoralen, said substitutions include, but are not limited to, the following groups: H and (CH2)_n H3, where n = 0-6. B. Synthesis of the Psoralens

The present invention contemplates synthesis methods for the novel compounds of the present invention, as well as new synthesis methods for known intermediates. Specifically, the novel compounds are mono, di or trialkylated 4'- or 5'-primaryamino-substituted psoralens. For ease of reference, TABLE 2 sets forth the nomenclature used for the psoralen derivatives discussed herein. Note that this section (entitled "B. Synthesis of the Psoralens") the roman numerals used to identify compounds correlate with Schematics 1-6 only, and do not correlate with the compound numbers listed in Table 2.

It is most logical to first describe the synthesis of intermediates useful in synthesizing many of the compounds of the present invention. While the invention is not limited to 4,5',8-trimethyl-4'- primaryamino-substituted psoralens or 4,4',8-trimethyl-5'-primaryamino-substituted psoralens, some important intermediates include tri- and tetramethyl psoralens, 4'-halomethyl-4,5',8- trimethylpsoralens and 5'-halomethyl-4,4',8-trimethylpsoralens. The preparation of these critical intermediates presents difficult challenges.

TABLE 2

# COMPOUND

4'-(4-amino-2-aza)butyl-4,5',8-trimethylpsoralen

4'-(4-amino-2-oxa)butyl4,5',8-trimethylpsoralen

4'-(2-aminoethyl)-4,5',8-trimethylpsoralen

4'-(5-amino-2-oxa)pentyl-4,5',8-trimethylpsoralen

4'-(5-amino-2-aza)pentyl-4,5',8-trimethylpsoralen

4'-(6-amino-2-aza)hexyl-4,5',8-trimethylpsoralen

4'-(7-amino-2,5-oxa)heptyl-4,5',8-trimethylpsoralen

4'-(12-amino-8-aza-2,5-dioxa)dodecyl-4,5',8- trimethylpsoralen

4'-(13-amino-2-aza-6,ll-dioxa)tridecyl-4,5',8- trimethylpsoralen

10 4'-(7-amino-2-aza)heptyl-4,5',8- trimethylpsoralen

11 4'-(7-amino-2-aza-5-oxa)heptyl-4,5',8-trimethylpsoralep

12 4'-(9-amino-2,6-diaza)nonyl-4,5',8-trimethylpsoralen

13 4'-(8-amino-5-aza-2-oxa)octyl-4,5',8-trimethylpsoraler|

14 4'-(9-amino-5-aza-2-oxa)nonyl-4,5',8-trimethylpsorale{

15 4'-(14-amino-2,6,ll-triaza)tetradecyl-4,5',8- trimethylpsoralen

16 5'-(4-amino-2-aza)butyl-4,4',8- trimethylpsoralen

17 5 '-(6-amino-2-aza)hexy 1-4,4 ' ,8-trimethy lpsor alen

18 5'-(4-amino-2-oxa)butyl-4,4',8-trimethylpsoralen Synthesis of Intermediates Previous syntheses of 4'-chloromethyl-4,5',8-trimethylpsoralen (4'-CMT) and 4'-bromomethyl-4,5',8-trimethylpsoralen (4'-BrMT) start from 4,5',8- trimethylpsoralen (5'-TMP) which is commercially available (Aldrich Chemical Co., Milwaukee, WI) or can be prepared in four steps as described below for other alkylated psoralens. 5 -TMP is converted to 4'-CMT using a large excess (20-50 equivalents) of highly carcinogenic, and volatile chloromethyl methyl ether. Halomethylation of the 4,5',8-trialkylpsoralens with chloromethyl methyl ether or bromomethyl methyl ether is described in US Patent No. 4,124,598, to Hearst. The bromo compound, 4'-BrMT, is likewise prepared using bromomethyl methyl ether which is somewhat less volatile. Yields of only 30-60% of the desired intermediate are obtained. The 5'-chloromethyl-4,4',8-trimethylpsoralen (5'-CMT) and 5'-bromomethyl-4,4',8-trimethylpsoralen (5'-BrMT) are prepared similarly, using the isomeric starting compound, 4,4',8-trimethylpsoralen (4'- TMP) [U.S. Patent No. 4,294,822, to Kaufman; McLeod, et al, "Synthesis of Benzofuranoid Systems. I. Furocoumarins, Benzofurans and Dibenzofurans," Tetrahedron Letters 237 (1972)]. Some of the figures referred to in the synthesis discussion that follows contain roman numerals used for labeling structures that embody more than one compound. This numbering system is distinct from, and not to be confused with, the numbering system of Table 2, above, which was used to identify several specific compounds.

Described herein is a much improved procedure which allows for the synthesis of either isomer of the bromomethyl-trialkylpsoralens from the same psoralen precursor by careful control of reaction conditions. See FIG. 1. In FIG. 1, Ai and A2 are independently selected from the group comprising H and an alkyl chain having 1-6 carbon atoms. Reaction of the 4,8-dialkyl-7- hydroxycoumarin with 2-chloro-3-butanone under typical basic conditions, provides 4,8-dialkyl-7-(l-methyl-2-oxo)propyloxycoumarin (I). This material is cyclized by heating in aqueous NaOH to provide 4,8-dialkyl-4',5'- dimethylpsoralen (II). Treatment of the tetrasubstituted psoralen and N- bromosuccinimide (NBS) in a solvent at room temperature up to 150°C leads to bromination at the 4'- or 5'- position, depending upon the conditions used. A catalyst such as dibenzoyl peroxide may be added, but is not necessary. If the solvent used is carbon tetrachloride at reflux, 4,8-dialkyl-5'-bromomethyl-4'- methylpsoralen (IV) is obtained in yields of 50% or greater. If methylene chloride is used at room temperature, only 4,8-dialkyl-4'-bromomethyl-5'-methylpsoralen (III) is obtained in >80% yield. Benzylic bromination in other solvents can also be done, generating one of the isomeric products alone or in a mixture. These solvents include, but are not limited to 1,2-dichloroethane, chloroform, bromotrichloromethane and benzene. General Scheme of Synthesis of 4'-Substiruted Psoralens

Turning now to the synthesis of a subclass of the linear psoralens, 4,5',8- trialkylpsoralens can be made as follows. The 4,8-dialkylcoumarins are prepared from 2-alkylresorcinols and a 3-oxoalkanoate ester by the Pechmann reaction (Organic Reactions Vol VII, Chap 1, ed. Adams et al, Wiley, NY, (1953)). The hydroxy group is treated with an allylating reagent, CH2=CHX-CH(R)-Y, where X is a halide or hydrogen, Y is a halide or sulfonate, and R is H or (CH2)vCH3, where v is a whole number from 0 to 4. Claisen rearrangement of the resultant allyl ether gives 4,8-dialkyl-6-allyl-7-hydroxycoumarin. The coumarins are converted to the 4,5',8-trialkylpsoralens using procedures similar to one of several previously described procedures (i.e., see, Bender et al, J. Org. Chem. 44:2176 (1979); Kaufman, US Patent Nos. 4,235,781 and 4,216,154, hereby incorporated by reference). 4,5',8-Trimethylpsoralen is a natural product and is commercially available (Aldrich Chemical Co., Milwaukee, WI).

General Scheme of Synthesis of 5'-Substituted Psoralens

The 4,4',8-trialkylpsoralens can be prepared in two steps also starting from the 4,8-dialkyl-7-hydroxy coumarins discussed above. The co marin is treated with an alpha-chloro ketone under basic conditions to give the 4,8-dialkyl-7-(2- oxoalkoxy)coumarin. Cyclization of this intermediate to the 4,4',8- trialkylcoumarin occurs by heating in aqueous base.

Longer chain 4'-(w-haloalkyl)trialkylpsoralens (herein referred to as longer chain 4'-HATP) where the alkyl groups are selected from the group (CH2)2 to (CH2)lO can be prepared under Freidel-Crafts conditions as discussed elsewhere (Olah and Kuhn, J. Org. Chem., 1964, 29, 2317; Freidel-Crafts and Related Reactions, Vol. π, Part 2, Olah, ed., Interscience, NY, 1964, p 749). While reactions of the halomethyl- intermediates with amines (e.g., Hearst et al., US patent 4,124,598), and alcohols (e.g., Kaufman, US Patent No. 4,269,852) have been described, there are only two original reports on the formation of extended chain primary amines. They describe the reaction of the 4'-chloromethyl-4,5',8- trimethyl psoralen with H2N-(CH2)n-NH2 (where n=2, 4, 6) (Lee, B., et al.

"Interaction of Psoralen-Derivatized Oligodeoxyribonucleoside Methylphosphonates with Single-Stranded DNA," Biochemistry 27:3197 (1988), and with H2NCH2CH2SSCH2CH2NH2 (Goldenberg, M., et a]., "Synthesis and Properties of Novel Psoralen Derivatives," Biochemistry 27:6971 (1988)). The utility of the resulting compounds for nucleic acid photoreaction has not previously been reported. The properties of these materials, such as decreased mutagenicity, are unexpected based on what is known about previously prepared compounds, such as AMT.

Several synthesis routes are shown in FIG 2. Starting from the 4'-HATP (where w is a number from 1-5; Al, A2 and A3 are independently selected from the group comprising H and (CH2)vCH3, where v is a number from 0 to 5; and where X = Br, Cl or I), reaction with an excess of a bis-hydroxy compound, HO- (B)-OH, where B is either: an alkyl chain (e.g., HO-(B)-OH is 1,3-propanediol), a monoether (e.g., diethylene glycol) or a polyether (e.g., tetraethylene glycol); which is less than or equal to 18 carbon atoms long, either neat or with a solvent such as acetone at 20-80°C, and a base for the carbon chains longer than halomethyl, gives a (w-hydroxy alkoxy) alkyl psoralen. The terminal hydroxy group can be transformed to an amino group under a variety of conditions (for example see Larock, 'Comprehensive Organic Transformations," VCH Publishers, NY, 1989). Particularly, the hydroxy group can be converted to the ester of methanesulfonic acid (structure VI) in the presence of methanesulphonyl chloride (CH3SO3CI). This can subsequently be converted to the azide in refluxing ethanol and the azide reduced to the final amine, structure VII

(examples are Compounds 2, 4 and 7). The method described herein utilizes triphenylphosphine and water in tetrahydrofuran (THF) for the reduction but other methods are contemplated.

A preferred method of preparation of structure VII uses the reaction of 4'- HATP with a primary linear alcohol containing a protected amine (e.g., a phthalimido group) at the terminal position in a suitable solvent such as DMF at 25 - 150°C to give V. The amine is then deprotected under standard conditions (e.g., hydrazine or aqueous MeNH2 to deprotect a phthalimido group [higher alkyl hydrazines, such as benzyl hydrazines, are also contemplated]) to give VII. Conversely, structure VI can be reacted with diamines, H2N-(B')-NH2 where B' is an alkyl chain (e.g., 1,4,-butanediamine), a monoether (e.g., 3-oxa-l,5- pentanediamine) or a polyether (e.g., 3,6-dioxa-l,8-octanediamine) to give the final product, compound VIII (examples of compounds in this structure group are Compounds 8, 13 and 14). This reaction is carried out with an excess of diamine in acetonitrile at reflux, but other solvents and temperatures are equally possible.

Some final compounds are desired in which the carbon chain is linked to the 4'- position of the psoralen ring by an aminoalkyl group [NH(CH2)w] rather than by an oxyalkyl group [0(CH2)w]- Synthesis pathways for these compounds are shown in FIG. 3. When the linkage between this nitrogen and the terminating nitrogen contains only CH2 subunits and oxygen but no other nitrogens

(structure X) (examples are Compounds 1, 5, 6, 9, 10 and 11), the product can conveniently be prepared from the 4'-HATP and the appropriate diamine of structure IX. This method is also applicable to final products that contain more than two nitrogens in the chain (structure XIII) (examples are Compounds 12 and 15) starting from polyamines of structure XII (e.g., norspermidine or spermine [commercially available from Aldrich, Milwaukee, WI]), however, in this case isomeric structures are also formed in considerable amounts. The preferred method for the preparation of structure XIII is reductive amination of the psoralen-4'-alkanal (XI) with a polyamine of structure XII and a reducing agent such as sodium cyanoborohydride. This reductive amination is applicable to the synthesis of compounds X as well. The carboxaldehydes (structure XI, w = 0) have been prepared previously by hydrolysis of the 4'-halomethyl compounds and subsequent oxidation of the resultant 4'-hydroxymethyl compound. (Isaacs et al, J. Labelled Cmpds. Radiopharm., 1982, 19, 345). These compounds can also be conveniently prepared by formylation of the 4'-hydrido compounds with a formamide and POCI3, or with hexamethylene tetraamine in acid. Longer chain alkanals can be prepared from the 4'-HATP compounds by conversion of the terminal halo group to an aldehyde functionality (for example, Durst, Adv. Org. Chem. 6:285 (1969)).

Other final products have a terminal amine linked to the psoralen by an alkyl chain. As shown in FIG. 4, these compounds (structures XIV) (an example is Compound 3) are prepared either 1) by reaction of the 4'-HATP with potassium phthalimide or azide and subsequent liberation of the desired amine as before, for example, with hydrazine, or 2) conversion of the 4'-HATP to the cyanide compound, followed by reduction, for example with NaBH4-CF3Cθ2H. The discussion of the conversion of 4,5',8-trialkylpsoralens to 4'- aminofunctionalized-4,5',8-trialkylpsoralens applies equally well when the 4- and/or 8-position is substituted with only a hydrogen, thus providing 4'- primaryamino-substituted-5', (4 or 8)- dialkylpsoralens and 4'-primaryamino- substituted-5'-alkylpsoralens. Synthesis of 5' Derivatives

Under identical conditions to those described above, the 4,4',8- trialkylpsoralens or the 4,4',8-trialkyl-5'-methylpsoralens can be converted to the 5'-(w-haloalkyl)-4,4',8-trialkylpsoralens, (herein called 5'-HATP), as detailed in Schematic 5, below. (See Kaufman, U.S. Patent No. 4,294,822 and 4,298,614 for modified version).

The discussion of the conversion of 4,4',8-trialkylpsoralens to 5'- primaryamino-substituted-4,4',8-trialkylpsoralens applies equally well when the 4-, 4'- and/or 8-positions are just substituted with a hydrogen, thus providing 5'- primaryamino-substituted- dialkylpsoralens and 5'-primaryamino-substituted- alkylpsoralens, with the alkyl group(s) at the 4-, 4'- and /or 8- positions.

The discussion above of the syntheses of 4'-primaryamino- and 5'- primaryamino-psoralens can be extended to the non-linear coumarins, specifically the isopsoralens or angelicins. Thus, the 4'-halomethylangelicins

(XIX) and the 5'-halomethylangelicins (XX) can be prepared in a similar manner to their linear counterparts. By analogy with the synthetic pathways

presented above one can envision the synthesis of 4'-(w-amino)alkylangelicins and 5'-(w-amino)alkylangelicins where the alkyl linkage can contain one or more oxygen or nitrogen atoms.

Several other psoralens are also contemplated as compounds effective in the present invention.

πi. BINDING OF COMPOUNDS TO NUCLEIC ACID

The present invention contemplates binding new and known compounds to nucleic acid, including (but not limited to) genomic nucleic acid, and specifically, nucleic acid encoding for various cytokines. One approach of the present invention to binding photoactivation compounds to nucleic acid is photobinding. Photobinding is defined as the binding of photobinding compounds in the presence of photoactivating wavelengths of light. Photobinding compounds are compounds that bind to nucleic acid in the presence of photoactivating wavelengths of light. The present invention contemplates methods of photobinding with compounds of the present invention.

One embodiment of the method of the present invention for photobinding involves the steps: a) providing a photobinding compound of the present invention; and b) mixing the photobinding compound with nucleic acid in the presence of photoactivation wavelengths of electromagnetic radiation.

The invention further contemplates a method for modifying nucleic acid, comprising the steps: a) providing photobinding compound of the present invention and nucleic acid; and b) photobinding the photobinding compound to the nucleic acid, so that a compound:nucleic acid complex is formed. Without intending to be limited to any method by which the compounds of the present invention prevent replication, it is believed that the structure of said compound:nucleic acid complex serves to prevent replication of the nucleic acid by preventing the necessary polymerase from acting in the region where the compound has bound.

IV. INHIBITION OF CYTOKINE PRODUCΗON AND INACTIVATION OF T- CELLS

The present invention contemplates treating a blood product with a photoactivation compound and illumination before storage. This procedure inhibits the proliferation of cells or the production of cytokines, during storage which occurs before using the blood product.

A. Inhibition In General

The term "inhibition" is here defined as a reduction in production. This is distinct from "total inhibition", where all production is halted, or "substantial inhibition," wherein the production is at background or baseline levels relative to the particular assay used. "Inhibition efficiency" of a compound is defined as the level of inhibition the compound can achieve at a given concentration of compound or dose of irradiation. For example, if 100 μM of a hypothetical compound X inhibits 90% of cytokine production whereas under the same experimental conditions, the same concentration of compound Y inhibits only 10% of cytokine production, then compound X would have a better "inhibition efficiency" than compound Y. B. Inhibition of Cytokine Production

The threshold below which the inhibition method is complete is taken to be the level of inhibition which is sufficient to prevent an adverse reaction from occurring due to contact with the material. It is recognized that in this practical scenario, it is not essential that the methods of the present invention result in "total inhibition". That is to say, "substantial inhibition" will be adequate as long as the fraction of cytokine produced is insufficient to cause adverse reaction in a transfusion recipient. Thus "substantially all" of the cytokine production is when the proliferation of cells is at background or baseline levels relative to the particular assay used for detecting cytokines. The inhibition method of the present invention renders cytokine production substantially inhibited. In one embodiment, the inhibition method renders cytokine production in stored platelet preparations substantially inhibited.

Without intending to be limited to any method by which the compounds of the present invention inhibit cytokine production, it is believed that inhibition results from light induced binding of psoralens to the nucleic acid (either DNA or mRNA) which encodes for cytokines. Several cell types produce cytokines or contribute to the stimulation of proliferation of cells, including, but not limited to, T cells, monocytes, macrophages, B cells, fibroblast cells, endothelial cells, bone marrow stromal cells and platelets. Lymphocytes are a major source of proliferation of cells in platelet preparations. Lymphocytes are herein defined as white blood cells and the sub-population, including B-cells, T-cells, and null cells.

The present invention further contemplates that methods of the present invention also act to inhibit the expression of protein synthesis by leukocytes in general. Leukocytes are defined as cells from the following classes: neutrophils, lymphocytes, monocytes, eosinophils and basophils. "Expression" of proteins is defined as the production of proteins by cells, including, but not limited to, transcription and translation. As the data in the below experiments show, the expression of several proteins (including IL-8 and IL-1B) have been shown to be inhibited by the methods of the present invention.

"Synthetic media" is herein defined as an aqueous synthetic blood or blood product storage media. In one embodiment, the present invention contemplates treating blood products in a synthetic media comprising a buffered saline solution. This method reduces harm to blood products and permits the use of much lower concentrations of photoactivation compounds.

Because of its nucleic acid binding activity, the psoralen photochemical reaction used in the present inhibition method has the potential to eliminate bacteria, protozoa, and viral contaminants as well. Had an effective decontamination method been available prior to the advent of the AIDS pandemic, no transfusion associated HTV transmission would have occurred. Psoralen-based decontamination h?s the potential to eliminate all infectious agents from the blood supply, regardless of the pathogen involved. Additionally, psoralen-based decontamination has the ability to sterilize blood products after collection and processing, which in the case of platelet concentrates could solve the problem of low level bacterial contamination and result in extended storage life. Morrow J.F., et al, JAMA 266: 555-558 (1991); Bertolini F., et al, Transfusion 32: 152-156 (1992).

C. Inactivation In General

The term "inactivation" is here defined as the altering of the nucleic acid of a cell or unit of pathogen so as to render the cell or unit of pathogen incapable of replication. This is distinct from "total inactivation", where all pathogen units present in a given sample are rendered incapable of replication, or "substantial inactivation," where most of the pathogen units present are rendered incapable of replication. "Inactivation efficiency" of a compound is defined as the level of inactivation the compound can achieve at a given concentration of compound or dose of irradiation. For example, if 100 μM of a hypothetical compound X inactivated 5 logs of T-cells whereas under the same experimental conditions, the same concentration of compound Y inactivated only 1 log, then compound X would have a better "inactivation efficiency" than compound Y.

To appreciate that an "inactivation" method may or may not achieve "total inactivation," it is useful to consider a specific example. A bacterial culture is said to be inactivated if an aliquot of the culture, when transferred to a fresh culture plate and permitted to grow, is undetectable after a certain time period. A minimal number of viable bacteria must be applied to the plate for a signal to be detectable. With the optimum detection method, this minimal number is 1 bacterial cell. With a sub optimal detection method, the minimal number of bacterial cells applied so that a signal is observed may be much greater than 1. The detection method determines a "threshold" below which the "inactivation method" appears to be completely effective (and above which "inactivation" is, in fact, only partially effective). In a similar example, a threshold amount of T-cells are required that are able to replicate to set off GVHD symptoms. D. Inactivation of Potential Pathogens or Undesired Cells

The same considerations of detection method and threshold exist when determining the sensitivity limit of an inactivation method for nucleic acid. Again, "inactivation" means that a unit of pathogen or a cell is rendered incapable of replication.

In the case of inactivation methods for material to be used by humans, whether in vivo or in vitro, the detection method can theoretically be taken to be the measurement of the level of infection with a disease as a result of exposure to the material. The threshold below which the inactivation method is complete is then taken to be the level of inactivation which is sufficient to prevent disease from occurring due to contact with the material. It is recognized that in this practical scenario, it is not essential that the methods of the present invention result in "total inactivation". That is to say, "substantial inactivation" will be adequate as long as the viable portion is insufficient to cause disease. Thus "substantially all" of a pathogen is inactivated when any viable portion of the pathogen which remains is insufficient to cause disease. The inactivation method of the present invention renders nucleic acid in pathogens substantially inactivated. In one embodiment, the inactivation method renders pathogen nucleic acid in blood preparations substantially inactivated.

Without intending to be limited to any method by which the compounds of the present invention inactivate pathogens or cells, it is believed that inactivation results from light induced binding of psoralens to nucleic acid. Further, while it is not intended that the inactivation method of the present invention be limited by the nature of the nucleic acid; it is contemplated that the inactivation method render all forms of nucleic acid (whether DNA, mRNA, etc.) substantially inactivated.

A list of viruses which have been photochemically inactivated by one or more psoralen derivatives appears in Table 3. (From Table 1 of Hanson, C.V., Blood Cells 18:7 (1992)). In the article, it was pointed out that picornaviruses were photoinactivated only if psoralens were present during virus growth. This list is not exhaustive, and is merely representative of the great variety of pathogens psoralens can inactivate. Beyond the inhibition of cytokine production, the present invention further contemplates the inactivation of these and other viruses by the compounds described herein. The compounds of the present invention are particularly well suited for inactivating envelope viruses, such as the HIV virus. TABLE 3

Viruses Photochemically Inactivated by Psoralens

Family Virus

Adeno Adenovirus 2

Canine hepatitis Arena Pichinde

Lassa Bunya Turlock

California encephalitis Herpes Herpes simplex 1 herpes simplex 2

Cytomegalovirus

Pseudorabies

Orothomyxo Influenza

Papova SV-40

Paramyxo Measles

Mumps

Parainfluenza 2 and 3

Picornal Poliovirus 1 and 2

Coxsackie A-9

Echo 11

Pox Vaccinia

Fowl Pox

Reo Reovirus 3

Blue tongue

Colorado tick fever

Retro HΓV

Avian sarcoma

Murine sarcoma

Murine leukemia

Rhabdo Vesticular stomatitis virus Toga Western equine encephalitis

Dengue 2

Dengue 4

St. Louis encephalitis

Hepadna hepatitis B Bacteriophage Lambda

T2

(Rickettsia) R. akari (rickettsialpox) E. Selecting Photoinactivation Compounds for Inhibition of Cytokines and inactivation of T-cells.

In order to evaluate a compound to decide if it would be useful in the cytokine inhibition and T-cell inactivation methods of the present invention, two important properties should be considered: 1) the compound's ability to inhibit cytokine production and inactivate T-cells and 2) its mutagenicity. The ability of a compound to inactivate T-cells and inhibit cytokine production may be determined by treating a platelet preparation with the compound and ultraviolet light. The increase in cytokines is measured after a storage period. The ability of T-cells to proliferate is measured in a proliferative assay. Screens of this type are described in detail in the examples below.

The second property that is important in testing a compound for use in methods of the present invention is mutagenicity. The most widely used mutagen /carcinogen screening assay is the Ames test. This assay is described by D.M. Maron and B.N. Ames in Mutation Research 113: 173 ( 1983) and a specific screen is described in detail in Example 17, below. The Ames test utilizes several unique strains of Salmonella typhimurium that are histidine- dependent for growth and that lack the usual DNA repair enzymes. The frequency of normal mutations that render the bacteria independent of histidine (i.e., the frequency of spontaneous revertants) is low. The test allows one to evaluate the impact of a compound on this revertant frequency.

Because some substances are not mutagenic by themselves, but are converted to a mutagen by metabolic action, the compound to be tested is mixed with the bacteria on agar plates along with the liver extract. The liver extract serves to mimic metabolic action in an animal. Control plates have only the bacteria and the extract.

The mixtures are allowed to incubate. Growth of bacteria (if any) is determined by counting colonies. A positive Ames test is one where the number of colonies on the plates with mixtures containing the compound significantly exceeds the number on the corresponding control plates.

When known carcinogens are screened in this manner with the Ames test, approximately ninety percent are positive. When known noncarcinogens are similarly tested, approximately ninety percent are negative. A new compound (X) can be evaluated as a potential blood photodecontamination compound as well as a potential compound for preventing transfusion complications such as GVHD, FNHTRs and MLR side effects, as shown in Table 4, below. X is initially evaluated in Step I. X is screened in the cytokine inhibition assay at several different concentrations between 1 and 500 μM, as represented in FIG 11. If the compound shows inhibition activity the compound is then screened in the Ames assay. Finally, if the compound shows low mutagenicity in the Ames assay, the new compound is identified as a useful agent for inactivation of pathogens.

TABLE 4

STEP SCREEN RESULT INTERPRETATION

1 cytokine inhibition detected potential compound, inhibition go to step 2 no inhibition detected compound is ineffective as a cytokine inhibiting agent

2 Ames low mutagenicity useful agent to inhibit cytokine production

By following these instructions, a person can quickly determine which compounds would be appropriate for use in methods of the present invention.

F. Delivery of Compounds for Inhibition

The present invention contemplates several different formulations and routes by which the compounds described herein can be delivered. This section is merely illustrative, and not intended to limit the invention to any form or method of introducing the compound.

The compounds of the present invention may be introduced in an inhibition method in several forms. The compounds may be introduced as an aqueous solution in water, saline, a synthetic media such as "SterilyteTM 3 0" (contents set forth at the beginning of the Experimental section, below) or a variety of other media. The compounds can further be provided as dry formulations, with or without adjuvants.

The new compounds may also be provided by many different routes. For example, the compound may be introduced to the reaction vessel, such as a blood bag, at the point of manufacture. Alternatively, the compound may be added to the material to be treated after the material has been placed in the reaction vessel.

Further, the compounds may be introduced alone, or in a "cocktail" or mixture of several different compounds. V. PREPARATION OF VACCINES

An invention which inactivates viruses as well as human T-cells has clear applications in the field of vaccine therapy and immunization. The preparation of viral vaccines is contemplated by methods of the present invention. The present invention contemplates producing vaccines to a wide variety of viruses, including human viruses and animal viruses, such as canine, feline, bovine, porcine, equine and bovine viruses. The contemplated method is suitable for inactivating double stranded DNA viruses, single stranded DNA viruses, double-stranded RNA viruses and single-stranded RNA viruses, including both enveloped and non-enveloped viruses. A contemplated method for producing a vaccine for inoculation of a mammalian host susceptible to infection by a virus comprises growing culture of virus, isolated from an infected host, in a suitable mammalian cell culture, exposing at least one of the seed viruses to a psoralen (at a concentration of between ) and ultraviolet light (at a wavelength between approximately 320 nm and 400 nm and an intensity between approximately 0.1 mW/cm² and 5 W/cm²), more specifically, such conditions as are sufficient to inactivate the virus to a non-infectious degree, under conditions which substantially preserve the antigenic characteristics of the inactivated viral particles, and combining said inactivated virus with a suitable adjuvant.

The inactivated virus may be formulated in a variety of ways for use as a vaccine. The concentration of the virus will generally be from about 10^ to lθ9 plaque forming units (pfu)/ml, as determined prior to inactivation, with a total dosage of at least 10^ plaque forming units per dose (pfu/dose), usually at least 10^ pfu/dose, preferably at least 10? pfu/dose. The total dosage will usually be at or near about 10^ pfu/dose, more usually being about 10^ pfu/dose. The vaccine may include cells or may be cell-free. It may be an inert physiologically acceptable medium, such as ionized water, phosphate-buffered saline, saline, or the like, or may be administered in combination with a physiologically acceptable immunologic adjuvant, including but not limited to mineral oils, vegetable oils, mineral salts, and immunopotentiators, such as muramyl dipeptide. The vaccine may be administered subcutaneously, intramuscularly, intraperitoneally, orally, or nasally. Usually, a specific dosage at a specific site will range from about 0.1 ml to 4 ml, where the total dosage will range from about 0.5 ml to 8 ml. The number of injections and their temporal spacing may be highly variable, but usually 1 to 3 injections at 1, 2 or 3 week intervals are effective. VI. PRESERVATION OF BIOCHEMICAL PROPERTIES OF MATERIAL TREATED

When treating blood products to be used in vivo, two factors are of paramount importance in developing methods and compounds to be used. First, one must ask whether the process or the compounds used alter the in vivo activity of the treated material. For example, platelet transfusion is a well established efficacious treatment for patients with thrombocytopenic bleeding. However, if the cytokine inhibition treatment used greatly reduces the platelets clotting activity, then the treatment has no practical value. Psoralens are useful in the procedures of the present invention, because the reaction can be carried out at temperatures compatible with retaining biochemical properties of blood and blood products. Hanson, C.V., Blood Cells 18:7 (1992). But not all psoralens or methods will have the desired effect without significantly lowering the biological activity of the decontaminated material. Previous protocols for inactivation of pathogens have necessitated the removal of molecular oxygen from the reaction before and during exposure to light, to prevent damage to blood products from oxygen radicals produced during irradiation. See L. Lin et al., Blood 74:517 (1989); US Patent No. 4,727,027, to Wiesehahn. The present invention may be used to inhibit cytokine production in blood products and inactivate pathogens, in the presence of oxygen, without destroying the activity for which the products are prepared. Further, with methods of the present invention, there is no need to reduce the concentration of molecular oxygen. The present invention contemplates that in vivo activity of a blood product is not destroyed or significantly lowered if a sample of blood product which is decontaminated by methods of the present invention tests as would a normally functioning sample of blood product in known assays for blood product function. For example, where platelets are concerned, in vivo activity is not destroyed or significantly lowered if pH of the platelets are substantially the same in platelets treated by the methods of the present invention and stored 5 days as they are in untreated samples stored for 5 days. "Substantially the same" pH means that the values fall within the range of error surrounding that particular data point.

The second factor is whether the compounds used are toxic or mutagenic to the patient treated. A "compound displaying low mutagenicity" is defined here as a compound which does not display positive results in in vivo mutagenicity tests. Where these test results are not available, "compound displaying low mutagenicity" is defined as a compound which does not display positive results in the Ames test. The compounds used in the present invention are especially useful because they display the unlinking of cytokine inhibition efficiency from mutagenicity. The compounds exhibit powerful increase in inhibitory effects without a concomitant rise in mutagenicity. While it is not intended that the present invention be limited to any theory by which inhibition efficiency is unlinked from mutagenicity, it is postulated that unlinking occurs as a result of the length of the groups substituted on the psoralen, and the location of charges on the compounds. It is postulated that positive charges on one or both ends of mutagenic compounds have non-covalent interactions with the phosphate backbone of DNA. These interactions are presumed to occur independent of the presence of light (called "dark binding"). In theory, the psoralen thereby sterically blocks polymerase from opening up the DNA, causing mutagenicity. In contrast, compounds of the present invention carry a positive or neutral charge on a long substitute group. These substituted groups form a steric barrier during dark binding that is much easier to free from the DNA, permitting polymerase to pass. Thus no mutagenicity results.

VII. GRAFT VERSUS HOST DISEASE

Graft versus host disease (GVHD) is caused by T lymphocytes contained in a donor graft, such as a bone marrow transplant, that recognize antigenic disparities between donor and recipient. Patients who are immunocompromised or immune susceptible are potentially at risk to experience GVHD. Individuals at risk include immunodeficient children, newborns, bone marrow transplant recipients, and to a lesser extent, patients receiving chemo-radiation therapy for solid tumors.

Transfusion associated graft versus host disease (TA-GVHD) is a subset of GVHD that can result when transfused lymphocytes in a donor blood product engraft and multiply in the recipient, causing the donor cells to react against the tissues of the recipient. In immunocompetent patients, TA-GVHD can occur when a transfusion recipient is heterozygous for human leukocyte antigen (HLA) alleles and shares one of these HLA haplotypes with an HLA homozygous transfusion donor. The greatest risk of TA-GVHD arises during blood donations between first and second degree relatives because the requirement for an HLA homozygous donor who shares a haplotype with a recipient is most likely to occur during blood transfusion between related individuals. It has been observed that the use of pooled platelet concentrates derived from multiple donors increases the possibility of encountering a matching haplotype at random. McMilin, K.D. and R.L. Johnson (1993) HLA homozygosity and the risk of related-donor transfusion-associated graft-versus-host disease. Trans Med Rev 7: 37-41.

In the absence of any effective therapy, current efforts are focused entirely on prevention of TA-GVHD through gamma irradiation of whole blood and blood products. The target of gamma irradiation is leukocytes and in particular T- lymphocytes in the blood. A limiting dilution assay (LDA) has been used to show the inactivation of > 5 logio of T-cells with 2500 cGy gamma radiation, Pelszynski, M., G. Moroff, N. Luban, B. Taylor and R. Quinones (1994) Effect of gamma irradiation of red blood cell units on T-cell inactivation as assessed by limiting dilution analysis: Implications for preventing transfusion-associated graft-versus-host disease, Blood 83: 1683-1689, although there is at least one case report in the literature of TA-GVHD resulting from transfusion of gamma irradiated blood products. Pelszynski, M., G. Moroff, N. Luban, B. Taylor and R. Quinones (1994) Effect of gamma irradiation of red blood cell units on T-cell inactivation as assessed by limiting dilution analysis: Implications for preventing transfusion-associated graft-versus-host disease, Blood 83: 1683-1689.

At present, this is a standard treatment and dose for blood products destined for transfusion of a patient at risk for GVHD. Unfortunately, as highlighted by Pelszynski et al., there is a slim margin of safety for gamma irradiation.

Treatments that fali even slightly below the 2500 Rad dosage exhibit a drastic increase in functioning leukocyte cells, thereby representing a risk of TA-GVHD. On the other hand, an increase in the 2500 Rad dosage is viewed as potentially damaging to the treated blood product's function. Further, there is no current method of monitoring the treated products to ensure the treatment was sufficient. Thus a method of inactivating T-cells that offers a broader safety margin and that can be monitored for effectiveness is needed.

In principle, any treatment which selectively inactivates leukocytes and leaves the function of the graft intact should suffice to prevent GVHD and TA GVHD. An effective technique for the inactivation of leukocytes, and thus the prevention of GVHD and TA GVHD is provided by the methods and compounds of the present invention.

EXPERIMENTAL

The following examples serve to illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof. In the experimental disclosure which follows, the following abbreviations apply: PCT (photochemical treatment); eq (equivalents); M (Molar); μM (micromolar); N (Normal); mol (moles); mmol (millimoles); μmol (micromoles); nmol (nanomoles); g (grams); mg (milligrams); μg (micrograms); Kg (kilograms); L (liters); mL (milliliters); μL(microliters); cm (centimeters); mm (millimeters); μm (micrometers); nm (nanometers); J (Joules, also watt second, note that in the figures, Joules or J refers to Joules /cm²); °C (degrees Centigrade); TLC (Thin Layer Chromatography); EAA (ethyl-acetoacetate); EtOH (ethanol); HOAc (acetic acid); W (watts); mW (milliwatts); NMR (Nuclear Magnetic Resonance; spectra obtained at room temperature on a Varian Gemini 200 MHz Fourier Transform Spectrometer); m.p. (melting point); UV (ultraviolet light); THF (tetrahydrofuran); DMEM (Dulbecco's Modified Eagles Medium); FBS (fetal bovine serum); LB (Luria Broth); EDTA (ethylene diamine tetraacetic acid); Phorbol Myristate Acetate (PMA); phosphate buffered saline (PBS); BSA (bovine serum albumin); PCR (polymerase chain reaction); . Further, in the examples describing synthesis of compounds of the present invention, yields presented are for the preceding step only, rather than for the entire synthesis.

For ease of reference, some compounds of the present invention have been assigned a number from 1 - 18. The reference numbers are assigned in TABLE 2. The reference numbers are used throughout the experimental section.

When isolating compounds of the present invention in the form of an acid addition salt, the acid is preferably selected so as to contain an anion which is non-toxic and pharmacologically acceptable, at least in usual therapeutic doses. Representative salts which are included in this preferred group are the hydrochlorides, hydrobromides, sulphates, acetates, phosphates, nitrates, methanesulphonates, ethanesulphonates, lactates, citrates, tartrates or bitartrates, and maleates. Other acids are likewise suitable and may be employed as desired. For example, fumaric, benzoic, ascorbic, succinic, salicylic, bismethylenesalicylic, propionic, gluconic, malic, malonic, mandelic, cinnamic, citraconic, stearic, palmitic, itaconic, gly colic, benzenesulphonic, and sulphamic acids may also be employed as acid addition salt-forming acids.

One of the examples below refers to HEPES buffer. This buffer contains 8.0 g of 137 mM NaCl, 0.2 g of 2.7 mM KCl, 0.203 g of 1 mM MgCl2(6H2θ), l.Og of 5.6 mM glucose, 1.0 g of 1 mg/ml Bovine Serum Albumin (BSA) (available from Sigma, St. Louis, MO), and 4.8 g of 20 mM HEPES (available from Sigma, St.

Louis, MO).

In one of the examples below, phosphate buffered synthetic media is formulated for platelet treatment. It may be used to replace some of the plasma present in platelet preparations during irradiation to provide better optical transmittance and to buffer the platelets during treatment. In one embodiment of the present invention, synthetic media comprises between 1 % and 60% of the platelet concentrate preparation. In a preferred embodiment, synthetic media comprises approximately 35% of the platelet concentrate preparation. This can be formulated in one step, resulting in a pH balanced solution (e.g. pH 7.2), by combining the following reagents in 2 liters of distilled water:

Preparation of Sterilyte™ 3.0

Formula W. mMolarity Grams /2Liters

NaAcetate*3H2θ 136.08 20 5.443

Glucose 180.16 2 0.721

D-mannitol 182.17 20 7.287

KCl 74.56 4 0.596

NaCl 58.44 100 11.688

Na3 Citrate 294.10 10 5.882

Na₂HPθ4*7H₂0 268.07 14.46 7.752

NaH₂P0 Η₂0 137.99 5.54 1.529

MgCl₂*6H₂0 203.3 2 0.813

The solution is then mixed, sterile filtered (0.2 micron filter) and refrigerated. Another synthetic media useful in the present invention contains the following reagents:

Preparation of synthetic media + phosphate

Formula W. mMolarity Grams /Liters

NaAcetate*3H₂0 136.08 30 4.08

NaCl 58.44 86 5.02

NaCitrate*2H₂0 294.10 10 2.94

Na₂HP0 142.07 19.8 2.81

NaH2P04*H₂0 137.99 6.2 0.858

The Polymerase Chain Reaction (PCR) is used in one of the examples to measure whether viral inactivation by some compounds was complete. PCR is a method for increasing the concentration of a segment of a target sequence in a mixture of genomic DNA without cloning or purification. See K.B. Mullis et al., US Patents Nos. 4,683,195 and 4,683,202, hereby incorporated by reference. This process for amplifying the target sequence consists of introducing a large excess of two oligonucleotide primers to the DNA mixture containing the desired target sequence, followed by a precise sequence of thermal cycling in the presence of a DNA polymerase. The two primers are complementary to their respective strands of the double stranded target sequence. To effect amplification, the mixture is denatured and the primers then to annealed to their complementary sequences within the target molecule. Following annealing, the primers are extended with a polymerase so as to form a new pair of complementary strands. The steps of denaturation, primer annealing, and polymerase extension can be repeated many times (i.e. denaturation, annealing and extension constitute one "cycle;" there can be numerous "cycles") to obtain a high concentration of an amplified segment of the desired target sequence. The length of the amplified segment of the desired target sequence is determined by the relative positions of the primers with respect to each other, and therefore, this length is a controllable parameter. By virtue of the repeating aspect of the process, the method is referred to by the inventors as the "Polymerase Chain Reaction". Because the desired amplified segments of the target sequence become the predominant sequences (in terms of concentration) in the mixture, they are said to be "PCR amplified". With PCR, it is possible to amplify a single copy of a specific target sequence in genomic DNA to a level detectable by several different methodologies (e.g. hybridization with a labeled probe; incorporation of biotinylated primers followed by avidin-enzyme conjugate detection; incorporation of ^ P labeled deoxynucleotide triphosphates, e.g. dCTP or dATP, into the amplified segment). In addition to genomic DNA, any oligonucleotide sequence can be amplified with the appropriate set of primer molecules.

The PCR amplification process is known to reach a plateau concentration of specific target sequences of approximately 10^"^ M. A typical reaction volume is 100 μl, which corresponds to a yield of 6 x 10^ double stranded product molecules.

PCR is a polynucleotide amplification protocol. The amplification factor that is observed is related to the number (n) of cycles of PCR that have occurred and the efficiency of replication at each cycle (E), which in turn is a function of the priming and extension efficiencies during each cycle. Amplification has been observed to follow the form Eⁿ, until high concentrations of PCR product are made. At these high concentrations (approximately 10^"8 M/l) the efficiency of replication falls off drastically. This is probably due to the displacement of the short oligonucleotide primers by the longer complementary strands of PCR product. At concentrations in excess of 10"8 M, the rate of the two complementary PCR amplified product strands finding each other during the priming reactions become sufficiently fast that this occurs before or concomitant with the extension step of the PCR procedure. This ultimately leads to a reduced priming efficiency, and therefore, a reduced cycle efficiency. Continued cycles of PCR lead to declining increases of PCR product molecules. PCR product eventually reaches a plateau concentration.

The sequences of the polynucleotide primers used in this experimental section are as follows: DCD03: 5' ACT AGA AAA CCT CGT GGA CT 3'

DCD05: 5'GGGAGAGGGGAGCCCGCACG3'

DCD06: 5'CAATTTCGGGAAGGGCACTC3'

DCD07: 5'GCTAGTATTCCCCCGAAGGT3'

With DCD03 as a common forward primer, the pairs generate amplicons of length 127, 327, and 1072 bp. These oligos were selected from regions that are absolutely conserved between 5 different dHBV isolates (DHBV1, DHBV3, DHBV16, DHBV22, and DHBV26) as well as from heron HBV (HHBV4).

The following examples serve to illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof.

EXAMPLE 1

As noted above, the present invention contemplates devices and methods for the photoactivation of photoreactive nucleic acid binding compounds. In this example, a photoactivation device is described for decontaminating blood products according to the method of the present invention. This device comprises: a) means for providing appropriate wavelengths of electromagnetic radiation to cause photoactivation of at least one photoreactive compound; b) means for supporting a plurality of blood products in a fixed relationship with the radiation providing means during photoactivation; and c) means for maintaining the temperature of the blood products within a desired temperature range during photoactivation.

FIG. 1 is a perspective view of one embodiment of the device integrating the above-named features. The figure shows an opaque housing (100) with a portion of it removed, containing an array of bulbs (101) above and below a plurality of representative blood product containing means (102) placed between plate assemblies (103, 104) which filter certain wavelengths of light. The plate assemblies (103, 104) are described more fully, subsequently.

The bulbs (101), which are connectable to a power source (not shown), serve as a source of electromagnetic radiation. While not limited to the particular bulb type, the embodiment is configured to accept an industry standard, dual bipin lamp.

The housing (100) can be opened via a latch (105) so that the blood product can be placed appropriately. As shown in FIG. 1, the housing (100), when closed, completely contains the irradiation from the bulbs (101). During irradiation, the user can confirm that the device is operating by looking through a safety viewport (106) which does not allow transmission of ultraviolet light to the user.

The housing (100) also serves as a mount for several electronic components on a control board (107), including, by way of example, a main power switch, a count down timer, and an hour meter. For convenience, the power switch can be wired to the count down timer which in turn is wired in parallel to an hour meter and to the source of the electromagnetic radiation. The count down timer permits a user to preset the irradiation time to a desired level of exposure. The hour meter maintains a record of the total number of radiation hours that are provided by the source of electromagnetic radiation. This feature permits the bulbs (101) to be monitored and changed before their output diminishes below a minimum level necessary for rapid photoactivation.

FIG. 2 is a cross-sectional view of the device shown in FIG. 1 along the lines of 2-.-2. FIG. 2 shows the arrangement of the bulbs (101) with the housing (100) opened. A reflector (108A, 108B) completely surrounds each array of bulbs (101). Blood product containing means (102) are placed between upper (103) and lower (104) plate assemblies (e.g. BK-7 glass, Shott Glass Technologies, Inc., Duryea, PA). Each plate assembly is comprised of an upper (103A, 104A) and lower (103B, 104B) plates. The plate assemblies (103, 104) are connected via a hinge (109) which is designed to accommodate the space created by the blood product containing means (102). The upper plate assembly (103) is brought to rest just above the top of the blood product containing means (102) supported by the lower plate (104B) of the lower plate assembly (104).

Detectors (110A, HOB, HOC, HOD) may be conveniently placed between the plates (103A, 103B, 104A, 104B) of the plate assemblies (103, 104). They can be wired to a printed circuit board (111) which in turn is wired to the control board (107).

FIG. 3 is a cross-sectional view of the device shown in FIG. 1 along the lines of 3—3. Six blood product containing means (102) (e.g. Teflon^M platelet unit bags) are placed in a fixed relationship above an array of bulbs (101). The temperature of the blood product can be controlled via a fan (112) alone or, more preferably, by employing a heat exchanger (113) having cooling inlet (114) and outlet (115) ports connected to a cooling source (not shown). FIG. 4 is a cross-sectional view of the device shown in FIG. 1 along the lines of 4—4. FIG. 4 more clearly shows the temperature control approach of a preferred embodiment of the device. Upper plate assembly plates (103A, 103B) and lower plate assembly plates (104A, 104B) each create a temperature control chamber (103C, 104C), respectively. The fan (112) can circulate air within and between the chambers (103C, 104C). When the heat exchanger (113) is employed, the circulating air is cooled and passed between the plates (103A, 103B, 104A, 104B).

EXAMPLE 2 Synthesis of 4'-Bromomethyl-4,5',8-trimethylpsoralen

In this example, the three step synthesis of 4'-Bromomethyl-4,5',8- trimethylpsoralen is described. This synthesis is performed without a bromomethylation step, making it safer than known methods of synthesis.

Step 1: 3-Chloro-2-butanone (29.2 mL, 0.289 mol) was added to a mechanically stirred suspension of 7-hydroxy-4,8-dimethylcoumarin (50.00 g, 0.263 mol) and powdered K2CO3 (54 g, 0.391 mol) in acetone (500 mL). The slurry was refluxed for 15 hours, after which the solvent was stripped off. To remove the salt, the solid was stirred in 1.2 L of water, filtered, and rinsed with water until the pH of the mother liquor was neutral (pH 5-7). The brown filtrate was dissolved in boiling methanol (150 mL), allowed to cool to room temperature to form a thick paste and rinsed with ice cold methanol to remove most of the brown impurity, giving 4,8-dimethyl-7-(l-methyl-2-oxo)propyloxy-coumarin (67.7 g, 99.0% yield) as an off-white solid, melting point 95-96°C. NMR: d 1.57 (d, J = 6.7 Hz, 3H), 2.19 (s, 3H), 2.39 (s, 6H), 4.73(q, J = 6.9 Hz, IH), 6.17 (s, IH), 6.63 (d, J = 8.8 Hz, IH), 7.38 (d, J = 8.9 Hz, lH).

Step 2: A suspension of 4,8-dimethyl-7-(l-methyl-2-oxo)propyloxy-coumarin (67.5g, 0.260 mol), 10% aqueous NaOH (114 mL, 0.286 mol) and water (900 mL) was heated for 2-4 hours at 70-85°C. The mixture was then allowed to cool to room temperature. The solid was filtered, and then rinsed with chilled water (1.5 L) until the mother liquor became colorless and pH was neutral (pH 5-7). The product was air and vacuum dried to give 4, 4',5',8-tetramethylpsoralen (56.3 g, 89.5%) as a white solid, mp 197-199°C. NMR: d 2.19 (s, 3H), 2.42 (s, 3H), 2.51 (s, 3H), 2.56 (s, 3H), 6.23 (s, IH), 7.40 (s, IH).

Step 3: Dry 4,4',5',8-tetramethylρsoralen (lO.OOg, 41.3mmol) was dissolved in methylene chloride (180 mL) at room temperature. N-Bromosuccinimide (8.09g, 45.3 mmol) was added and the reaction mixture and stirred 4.5 hours. The solvent was completely removed and the resulting solid was stirred with water (200mL) for 0.5-1 h, filtered and cold triturated with additional water (approximately 500 mL) to remove the succinimide by-product. The crude product (i.e. 4'-bromomethyl-4, 5',8-trimethylpsoralen) was dried in a vacuum desiccator with P2O5 then recrystallized in a minimum amount of boiling toluene (200-300 mL) to give 4'-bromomethyl-4, 5',8-trimethylpsoralen (10.2g), a pale yellow solid. The mother liquor was stripped and recrystallized again with toluene (60 mL) to give a second crop of product (1.08g, combined yield = 85.1%, > 99% purity by NMR), mp 206-207°C. NMR: d 2.50 (s, 3H), 2.54 (d, J =1.2 Hz, 3H), 2.58 (s, 3H), 4.63 (s, 2H), 6.28 (apparent q, J = 1.3 Hz, IH), 7.59 (s,lH).

EXAMPLE 3

Synthesis of 5'-bromomethyl-4, 4',8-trimethylpsoralen

In this example, a three step synthesis of 5'-bromomethyl-4, 4',8- trimethylpsoralen is described. Like the synthesis described in Example 2, this method is improved upon previously known synthesis schemes because it does not require bromomethylation. 4, 4',5',8-Tetramethylpsoralen (2.33 g, 9.59 mmol), (synthesis described in

Example 2, Steps 1 and 2), was refluxed in carbon tetrachloride (100 mL) until it dissolved. N-Bromosuccinimide (1.88 g, 10.5 mmol) and benzoyl peroxide (80 mg) were then added and the mixture was refluxed for 15 hours. Upon cooling to room temperature methylene chloride (100 mL) was added to dissolve the solid and the solution was washed with water (4 x 150 mL), then brine, and dried with anhydrous Na2Sθ4. The solvent was stripped off to give a mixture of 5'- bromomethyl-4, 4',8-trimethylpsoralen, 4'-bromomethyl-4, 5',8-trimethylpsoralen, and 4',5'-bis(bromomethyl)-4,8-dimethylpsoralen in a ratio of 55/25/20 respectively as determined by ^H NMR (3.0 g, crude product). ^H NMR of 5'- bromomethyl compound: d 2.29 (s, 3H), 2.52 (d, J = 1.2 Hz, 3H), 2.60 (s, 3H), 4.64 (s, 2H), 6.27 (apparent d, J = 1.2 Hz, 1 H), 7.51 (s,lH). H NMR of 4',5'- bis(bromomethyl) compound: d 2.54 (d, J =1.1 Hz, 3H), 2.60 (s, 3H), 4.65 (s, 4H), 6.30 (apparent q, J =1.1 Hz, IH), 7.67 (s, IH). EXAMPLE 4

Synthesis of 4'-(4-amino-2-oxa)butyl-4,5',8-trimethylpsoralen Hydrochloride (Compound 2) and Related Compounds (Compound 4)

In this example, two methods of synthesis of Compound 2 are described. The first method was performed as follows:

Step 1: 4'-Bromomethyl-4,5',8-trimethylpsoralen (3.09 g, 9.61 mmol), (synthesis described in Example 2), and N-(2-hydroxyethyl)phthalimide (4.05 g, 21.2 mmol) were stirred in dry dimethylformamide (65 mL). Dry N2 gas was bubbled gently into the reaction mixture. The reaction mixture was heated to 100 °C for 4.5 hours then allowed to cool to room temperature and put in the freezer for several hours. The crystalline product was filtered and washed with MeOH followed by H2O. The solid was further tritutrated with MeOH (100 mL) to remove the impurities. The crude product was air dried and dissolved in CHCI3 (150 mL). Activated carbon and silica gel were added to decolorize and the CHCI3 was completely removed. The resulting white product, 4'-[4-(N-phthalimido)-2-oxa]butyl-4,5',8- trimethylpsoralen (1.56 g ,yield 37.5 %) was >99% pure both by NMR and HPLC; mp 224-225 °C. NMR (CDCI3) d 2.37 (s,3H); 2.47 (s, 3H); 2.48 (s, 3H); 3.78 (s,4H);

4.59 (s,2H); 6.22 (s, 1H);7.42 (s,lH); 7.50 (m, 4H).

Step 2: 4'-[4-(N-phthalimido)-2-oxa]butyl-4,5',8-trimethylpsoralen (1.56 g, 3.61 mmol) was suspended in tetrahydrofuran (75 mL) at room temperature. Methylamine (40 % aqueous solution, 25 mL, 290 mmol) was added to the suspension and stirred overnight. The solvent and methylamine were completely removed. The resulting solid was taken up in 0.3 N HCl aqueous solution (25 mL). The acid suspension was rinsed three times with 40 mL CHCI3 then taken to pH 11 with 20 % aqueous NaOH. CHCI3 (3x60 mL) was used to extract the product (i.e. 4'-(4-amino-2-oxa)butyl-4,5',8-trimethylpsoralen) from the basified layer. The combined CHCI3 layers were washed with H2O (100 mL) followed by brine (100 mL) then dried over anhydrous Na2Sθ4 and concentrated to give 4'-(4- amino-2-oxa)butyl-4,5',8-trimethylpsoralen, mp 139-141 °C. Purity was greater than 99 % by NMR. NMR (CDCI3) d 2.50 (s, 6H); 2.58 (s,3H); 2.90 (t, J = 5.27 Hz, 2H); 3.53 (t, J = 5.17 Hz, 2H); 4.66 (s, 2H); 6.25 (s, IH); 7.61 (s, IH). The 4'-(4- amino-2-oxa)butyl-4,5',8-trimethylpsoralen was dissolved in absolute ethanol (150 mL), a 1.0 M solution of HCl in ether (10 mL) was added and the suspension was cooled in the freezer overnight. After filtration and washing with ether, the solid was vacuum dried to give pale yellow crystals (0.76 g, yield 62 %), mp 235- 236 °C.

Alternatively, Step 2 may be performed using either hydrazine or butylamine rather than methylamine. The method which uses butylamine is preferred for larger scale syntheses because, while an excess of methylamine is needed due to volatization, the same is not true for butylamine. The method using butylamine was carried out as follows: 28.3 g phthalimide has been de protected with n-butylamine in propanol. The crude reaction solution is then treated with HCl to precipitate out the product. Thus the reaction mixture in 285 mL of 1-propanol was treated with HCl gas to pH 2. The mixture was stirred at 5 °C for 0.5 hours, then filtered and washed with cold solvent (3 x 15 mL) to afford 20.5 g of crude 4'-(4-amino-2-oxa)butyl-4,5',8-trimethylpsoralen (92% yield).

The method using hydrazine was carried out as follows: The phthalimide precursor (6 mol) was deprotected with hydrazine and after concentration and acid-base extractions the crude amine was obtained in 30 L of ethylene dichloride. To this was added HCl gas (0.14Kg) via dispersion tube over 40 minutes maintaining the temperature at 15-25 °C. The resultant slurry was stirred an additional 1 hour. The solids were collected on a Buchner funnel. Upon drying in an air dryer at 80 °C for 2 hours, 0.945 kg of crude 4'-(4-amino-2-oxa)butyl- 4,5',8-trimethylpsoralen was obtained. 0.94 kg of product in a mixture of 7.5 kg of isopropanol and 1.88 kg of water was refluxed for 30 minutes then hot filtered. The solution was cooled to room temperature over 1 hour, then chilled to 15-20 °C for 0.5 hours. The solids were collected on a Buchner funnel, then washed with cold isopropanol (0.3 L). The wet solids were transferred to glass trays and dried under vacuum (>28 minutes) at approximately 75 °C for 11.5 hours.

Moisture content was 0.5%. Yield was 0.758 kg (81% yield). The 4'-(4-amino-2- oxa)buty 1-4,5 ',8-trimethylpsoralen was analytically pure. Residual isopropanol about 1700 ppm by NMR.

The first method is a preferred embodiment of the present invention because of its high yield and purity.

The second method starts with the preparation of 4'-chloromethyl-4,5',8- trimethylpsoralen from commercially available 4,5',8-trimethylpsoralen, as described above. The synthesis of 4'-(4-amino-2-oxa)butyl-4,5',8- trimethylpsoralen hydrochloride is achieved in four (4) steps:

STEP 1: 4'-Chloromethyl-4,5',8-trimethylpsoralen (550 mg, 1.99 mmol) and ethylene glycol (6.8 ml, 121.9 mmol) were heated in acetone (6 mL) to 50-60 °C for 3.5 hrs. After 2 hrs heating, the white suspension had turned to a clear light yellow solution. The acetone and ethylene glycol were removed on the rotoevaporator and water (50 mL) was added to the residue. The resultant suspension was filtered, washed with cold water then dried in the vacuum oven to give 574 mg (96%) of 4'-(4-hydroxy-2-oxa)butyl-4,5',8-trimethylpsoralen; NMR (CDCI3) d: 2.51 (s, 6H); 2.58 (s, 3H); 3.62 (t, J=4.5Hz, 2H); 3.78 (t, J=4.9 Hz, 2H); 4.70 (s, 2H); 6.26 (d, J= 1.1 Hz, IH); 7.61 (s, IH).

STEP 2: 4'-(4-Hydroxy-2-oxa)butyl-4,5',8-trimethylpsoralen (574 mg, 1.9 mmol) was dissolved in CH2CI2 (6 mL) under N2 at < 10 °C. Triethylamine (359 mg, 3.55 mmol) was added. Methanesulfonyl chloride (305 mg, 266 mmol) was dropped in slowly keeping the temperature below 10 °C. After addition was completed the mixture was stirred for 15 more minutes and then it was stirred at room temperature for 10 hours. To the reacted suspension CH2CI2 (45 mL) was added and the mixture was washed with water (3 x 20 mL), then dried over anhydrous Na2Sθ4. Concentration at < 30 °C followed by vacuum drying gave 4'-[(4-methanesulfonyloxy-2-oxa)butyl-4,5',8-trimethylpsoralen as a yellow solid (706 mg, 98 %), mp 138-140°C. NMR d 2.51 (s, 3H); 2.52 (d, 3H); 2.58 (s, 3H); 2.99 (s, 3H); 3.77 (m ,2H); 4.39 (m, 2H); 4.71 (s, 2H); 6.26(s, IH); 7.62 (s, IH).

STEP 3: 4'-[(4-Methanesulfonyloxy-2-oxa)butyl-4,5',8-trimethylpsoralen (706 mg, 1.86 mmol) and sodium azide (241 mg, 3.71 mmol) were refluxed in 95 % ethyl alcohol (5 mL) for 8 hours. The reaction solution was cooled and cold water (55 mL) was added. The off-white solid was filtered and washed with cold water. Upon vacuum drying, the azide (i.e. 4'-(4-Azido-2-oxa)butyl-4,5',8- trimethylpsoralen) was obtained as a light yellowish solid (575 mg, 95 %), mp

105-106°C. NMR: d 2.51 (s, 6H); 2.58 (s, 3H); 3.41 (t, J=4.9 Hz, 2H); 3.67 (apparent t, J=4.9 Hz, 2H); 4.70 (s, 2H); 6.26 (s, IH); 7.66 (s, IH).

STEP 4: The 4'-(4-Azido-2-oxa)butyl-4,5',8-trimethylpsoralen (1.65 g, 5.03 mmol) was dissolved in tetrahydrofuran (10 mL). Triphenylphosphine (1.59 g, 6.08 mmol) and six drops of water were added to the foregoing solution. After stirring at room temperature overnight, the light yellow solution was concentrated. The residue was dissolved in CHCI3 (90 mL) and extracted with 0.3 N aqueous HCl (30 mL, then 2x5 mL). Combined HCl layers was carefully treated with K2CO3 until saturated. The base solution was extracted with CHCI3 (3x60 mL).

Combined CHCI3 layers were washed with 60 mL of water, 60 mL of brine and dried over anhydrous Na2Sθ4. Upon concentration and vacuum drying the amine (i.e. was obtained as a yellow solid (1.25 g, 82 %), mp 139-141 °C; NMR d 2.48 (s, 6H); 2.55 (s, 3H); 2.89 (t, J=6 Hz, 2H); 3.52 (t, J=6 Hz, 2H); 4.64 (s, 2H); 6.22

(s, IH); 7.59 (s, IH).

The amine was dissolved in absolute ethanol (40 mL) and 20 mL of IN HCl in ethyl ether was added. After sitting at 5°C overnight, the precipitate was filtered and rinsed with ether to give 1.25 g of Compound 2, mp 236°C (decomp).

13c NMR: 8.54, 12.39, 19.18, 38.75, 62.26, 65.80, 108.01, 112.04, 112.42, 112.97,

116.12, 125.01, 148.76, 153.97, 154.37, 155.76, 160.34.

Anal. Calculated for C17H20CINO4: C, 60.45: H,5.97; N, 4.15. Found: C,

60.27; H, 5.88; N, 4.10. Similarly prepared, by reacting 4'-CMT with 1,3-propanediol comparably to Step 1 and proceeding analagously through Step 4, was 4'-(5-amino-2- oxa)pentyl-4,5',8-trimethylpsoralen, (Compound 4), m.p. 212-214 °C

(decomposed). NMR of the free base: d 1.73 (pent, J=6.4 Hz, 2H), 2.45(s, 6H), 2.51

(s, 3H), 2.78 (t,J=6.8 Hz, 2H), 3.54 (t, J=6.2 Hz, 2H), 4.59 (s,2H), 6.18 (s, IH), 7.54 (s, IH).

EXAMPLE 5

Synthesis of 5'-(4-Amino-2-oxa)butyl-4,4',8-trimethylpsoralen (Compound 18)

This example describes the synthesis of Compound 18. To a stirred solution of N-methylformanilide (16.0 mL, 0.134 mol) in acetonitrile (130 mL) was added phosphorus oxychloride (12.5 mL, 0.134 mol), then 4,4',8-trimethylpsoralen (5.0 g, 21.9 mmol) (described in McLeod, et al, Tetrahedron Letters No. 3:237 (1972)). The temperature was kept between 0-10 °C during addition of the psoralen by use of an ice/water bath. The slurry was stirred at 50°C for 2 days protected from moisture with a drierite drying tube. The reaction mix was allowed to cool to room temperature, then chilled in an ice/water bath. The acetonitrile was decanted off, then ice/water (150 mL) was added to the orange slurry and stirred for lh. The orange solid was filtered off and rinsed with chilled water, then chilled acetonitrile. The crude product was recrystallized and charcoal decolorized in dichloroethane (600 mL) to give 4,4',8-trimethyl-5'- psoralencarboxaldehyde (3.59g, 64.0%) as a pale yellow-orange solid, sublimes > 250°C, decomp. > 300°C. H NMR (CDCI3): 2.54 (d, J = 1 Hz, 3H), 2.64 (s, 3H), 2.68 (s, 3H), 6.32 (apparent d, J = 1 Hz, IH), 7.75 (s, IH), 10.07 (s, IH). 4,4',8-trimethyl-5-psoralencarboxaldehyde (7.50 g, 29.3 mmol) was stirred in 200 proof EtOH (250mL). Sodium borohydride was added and the slurry was stirred overnight. Ice water (150mL) and 10% aq NaCθ3 (50mL) were added to quench the reaction. After stirring for 45 min, the precipitate was filtered off and rinsed with water until the filtrate was neutral (pH 5-7). The product was dried in a vacuum desiccator with P2O5 to give 5'-hydroxymethyl-4,4',8- trimethylpsoralen (7.46 g, 98.5%) as a pale yellow solid, mp 244-245°C. !H NMR (CDCI3): 1.97 (t, J = 6 Hz, IH), 2.31 (s, 3H), 2.51 (d, J = 1 Hz, 3H), 2.58 (s, 3H), 4.79 (d, J = 6 Hz, 2H), 6.25 (apparent d, J = 1 Hz, IH), 7.49 (s, IH).

To a stirred, ice/water chilled slurry of 5'-hydroxymethyl-4,4',8- trimethylpsoralen (15.42 g, 59.7 mmol) in dichloroethane (50CmL) was added phosphorus tribromide (6.17 mL, 65.7 mmol) dropwise. The reaction was protected from moisture and allowed to stir overnight at room temperature. The mixture was then stirred with 300 mL ice/ water for lh. The solid was filtered off, dried, dissolved in hot toluene, filtered through fluted filter paper and stripped to give 5'-bromomethyl-4,4',8-trimethylpsoralen (3.43 g). The reaction solvents (dichloroethane and water) were separated and the aqueous layer was extracted three times with dichloroethane. The organic layers were combined, rinsed with brine then dried (anhyd Na2Sθ4) and stripped under vacuum to give the bulk of the product, 5'-bromomethyl-4,4',8-trimethylpsoralen, (13.13g, combined yield of 86.4%), as a pale yellow solid, mp 201-202 °C. H NMR (CDCI3): 2.29 (s, 3H), 2.52 (d, J = 1 Hz, 3H), 2.60 (s, 2H), 4.64 (s, 2H), 6.27(apparent d, J = 1Hz, IH), 7.51 (s, IH) N-Hydroxyethylphthalimide (3.00 g, 15.5 mmol) was dissolved in DMF (5 mL) at 60-64°C while N2 was bubbled into the solution. Sodium iodide (0.01 g, 0.067 mmol) and 5'-bromomethyl-4,4',8-trimethylpsoralen (1.00 g, 3.11 mmol) were added and the slurry was stirred under these conditions overnight. The thick yellow reaction mixture was allowed to cool to room temperature, chilled in an ice/ water bath, filtered and rinsed with ice cold MeOH to give crude product (1 g). The solid was recrystallized in dichloroethane (100 mL) to give 4,4',8- trimethyl-5'-[2-(N-phthalimido)-2-oxa]butylpsoralen (0.68 g, 50.8%), as an off- white solid, mp 225-228°C. iH NMR (CDCI3): 2.26 (s, 3H), 2.46 (s, 3H), 2.51 (d, J = 1 Hz, 3H), 3.87 (m, 4H), 4.64 (s, 2H), 6.26 (apparent d, J = 1 Hz, IH), 7.42 (s, IH), 7.64 (multiplet, 4H).

4,4',8-Trimethyl-5'-[4'-(N-phthalimido)-2-oxa]butylpsoralen (1.61 g, 3.73 mmol) was stirred with THF (40 mL) and 40 wt% aq methylamine (20 mL, 257 mmol) overnight. The solvent was stripped and the residue was partitioned between dilute aq HCl and dichloromethane. The aqueous layer was rinsed several more times with dichloromethane then made basic with K2CO3. The base layer was extracted three times with dichloromethane. The combined organic extracts from the base shaken with brine then dried (anhydrous Na2Sθ4) and stripped to give 5'-(4-amino-2-oxa)butyl-4,4',8-trimethylpsoralen (0.71 g, 63.4%), mp 126-129⁰C. iH NMR (CDCI3): 2.30 (s, 3H), 2.51 (s, 3H), 2.58 (s, 3H), 2.91 (t, J = 5 Hz, 2H), 3.59 (t, J = 5Hz, 2H), 4.64 (s, 2H), 6.25 (s, IH), 7.50 (s, IH).

The above amine (0.71 g, 2.36 mmol) was dissolved in hot ethanol, converted to the acid with IM HCl in diethylether (3 mL, 3 mmol), decolorized with charcoal, cooled and collected. The solid was decolorized again with charcoal and stripped to give 5'-(4-amino-2-oxa)butyl-4,4',8-trimethylpsoralen hydrochloride (0.39 g, 49.3% yield) as a white solid, mp 235-236 °C. (Note: Other preparations of this material have given a product with a significantly lower melting point, but identical NMR spectra ). iH NMR (d6-DMSO): 2.32 (s, 3H), 2.45 (s, 3H), 2.50 (s, 3H), 3.00 (m, 2H), 3.71 (t, J = 5 Hz, 2H), 4.71 (s, 2H), 6.33 (s, IH), 7.79 (s, IH), 8.15 (br). 13c NMR (d6-DMSO): 7.93, 8.57, 19.01, 38.74, 62.66, 66.28, 108.22, 112.42, 113.69, 115.34, 116.06, 125.60, 149.38, 150.95, 154.26 (tentatively 2 carbons), 160.26.

EXAMPLE 6

Synthesis of 4'-(7-amino-2,5-oxa)heptyl-4,5',8-trimethylpsoralen Hydrochloride

(Compound 7)

In this example, the synthesis of Compound 7 is described. The synthesis of 4'-(7- amino-2,5-oxa)heptyl-4,5',8-trimethylpsoralen hydrochloride proceeds in four (4) steps:

STEP 1: 4'-Chloromethyl-4,5',8-trimethylpsoralen (589 mg, 2.13 mmol), diethylene glycol (15.4 g, 145 mmol) and acetone (13 mL) were refluxed for 11.5 hours. The reaction solution was concentrated to remove acetone and part of the diethylene glycol. To the resulting light brown solution was added CHCI3 (40 mL), then washed with water several times. The CHCI3 layer was dried over anhydrous Na2Sθ4 and concentrated to give 781 mg of product, 4'-(7-Hydroxy- 2,5-oxa)heptyl-4,5',8-trimethylpsoralen, (-100 %). NMR d 2.46 (d, 3H), 2.47 (s, 3H ), 2.51 (s, 3H), 3.58-3.67 (m, 8H), 4.67 (s, 2H), 6.18 (s, IH), 7.57 (s, IH) .

STEP 2: 4'-(7-Hydroxy-2,5-oxa)heptyl-4,5',8-trimethylpsoralen (781 mg, 2.25 mmol) was dissolved in CH2CI2 (2.5 mL) under a N2 stream at <10 °C. Triethylamine (363 mg, 3.59 mmol) was added. Methanesulfonyl chloride (362 mg, 3.16 mmol) was slowly dropped in to keep the temperature below 10 °C. After addition was completed, the mixture was kept below 10 °C for 15 more minutes. The mixture was stirred at room temperature overnight then CH2CI2 (50 mL) was added. The solution was washed with water (3x60 mL), dried over anhydrous Na2Sθ and concentrated at <30 °C. Upon vacuum drying, a light brown syrup was obtained [4'-(7-Methanesulfonyloxy-2,5-oxa)heptyl-4,5',8- trimethylpsoralen]; 437 mg (76 %). NMR d 2.50 (s, 3H), 2.51 (s, 3H), 2.58 (s, 3H), 3.01 (s, 3H), 3.66 (m, 4H), 3.77 (t,J=4.6 Hz, 2H), 4.37 (t, J=6 Hz, 2H), 4.69 (s, 2H), 6.25 (s, IH), 7.61 (s, IH)

STEP 3: 4'-(7-Methanesulfonyloxy-2,5-oxa)heptyl-4,5',8-trimethylpsoralen (288 mg, 0.678 mmol) and sodium azide (88.2 mg, 1.36 mmol) were refluxed in 3 mL of 95% ethyl alcohol for 8 hours. The reaction solution was let cool and cold water (50 mL) was added. The water layer was poured away. The crude material was purified by chromatography on (Silica gel with chloroform eluent) a Chromatotron (Harrison Research, Inc., Palo Alto, CA) and vacuum dried to give a light yellow syrup, 4'-(7-Azido-2,5-oxa)heptyl-4,5',8-trimethylpsoralen, (123 mg, 49%). NMR d 2.50 (s, 6H), 2.57 (s, 3H), 3.39 (t, J=5.2 Hz, 2H), 3.68 (m, 6H), 4.70 (s, 2H), 6.24 (s, IH), 7.62 (s, IH)

STEP 4: 4'-(7-Azido-2,5-oxa)heptyl-4,5',8-trimethylpsoralen (122 mg, 0.33 mmol), triphenylphosphine (129 mg, 0.49 mmol) and several drops of water were dissolved in tetrahydrofuran (2 mL). The light yellow clear solution was stirred at room temperature over a weekend; no starting material was detected by TLC. The reaction solution was concentrated and the residue was dissolved in CHCI3 (20 mL). The solution was extracted with 0.15 N aqueous HCl solution (10 mL then 2x5 mL) and the HCl layers was taken to pH 13 by addition of 20% aqueous NaOH solution. The basic solution was extracted with CHCI3 (3x15 mL). The combined CHCI3 layers were washed with water, dried over anhydrous Na2Sθ4, concentrated, and vacuum dried to give 63.9 mg of product, 4'-(7-amino-2,5- oxa)heptyl-4,5',8-trimethylpsoralen, (56 %). TLC showed only one spot. NMR d 2.50 (s, 3H); 2.50 (s, 3H); 2.57 (s, 3H); 2.86 (t, J=5.3 Hz, 2H); 3.50 (t, J=5.3 Hz, 2H); 3.63 (s, 4H); 4.70 (s, 2H); 6.24 (s, IH); 7.62 (s, IH). m.p. 170-173 °C. The solid was dissolved in absolute ethanol, then IM HCl in ethyl ether was added, the suspension was filtered and the product rinsed with ether and dried. EXAMPLE 7

Synthesis of 4'-(12-amino-8-aza-2,5-dioxa)dodecyl-4,5',8-trimethylpsoralen

Dihydrochloride (Compound 8)

The synthesis of 4'-(12-amino-8-aza-2,5-dioxa)dodecyl-4,5',8- trimethylpsoralen dihydrochloride proceeds in one (1) step from the product of Example 5, method 2, step 2: A solution of 4'-(7-methanesulfonyloxy-2,5- oxa)heptyl-4,5',8-trimethylpsoralen (108 mg, 0.253 mmol) in 8 mL of acetonitrile was slowly added to a solution of 1, 4-diaminobutane (132 mg, 1.49 mmol) in 2.8 mL of acetonitrile. After refluxing for 8 hours, no starting material remained by TLC. The reaction mixture was cooled to room temperature and CHCI3 (25 mL) and 1 N aqueous NaOH (25 mL) solution were added. The layers were separated and CHCI3 (2x10 mL) was used to wash the aqueous layer. Aqueous HCl (0.3 N , 3x10 mL) was used to extract the product from the combined organics layers. The HCl layers was treated with 20 % aqueous NaOH solution until pH 13. The combined basic layers were then extracted with CHCI3 (3x20 mL). The CHCI3 layer was washed with saturated NaCl aqueous solution (10 mL) then dried over anhydrous Na2Sθ4. After concentration and vacuum drying, 63 mg of product, 4'-(12-amino-8-aza-2,5-dioxa)dodecyl-4,5',8-trimethylpsoralen dihydrochloride, was obtained (60%). NMR d 1.45 (m, 2H), 2.49 (s, 6H), 2.55 (s, 3H), 2.58 (t, 2H), 2.66 (t, J=5.6 Hz, 2H), 2.76 (m, 4H), 3.55 -3.61 (m, 6H), 4.68 (s, 2H), 6.22 (s, IH), 7.61 (s, IH).

EXAMPLE 8 Synthesis of 4'-(2-aminoethyl)-4,5',8-trimethylpsoralen Hydrochloride

(Compound 3)

The synthesis of 4'-(2-aminoethyl)-4,5',8-trimethylpsoralen proceeds in one (1) step: sodium trifluoroacetoxyborohydride was made by adding trifluoroacetic acid (296 mg, 2.60 mmol) in 2 mL of THF to a stirred suspension of sodium borohydride (175 mg, 4.63 mmol) in 2 mL of THF over a period of 10 minutes at room temperature. The resultant suspension was added to a suspension of 4'- cyanomethyl-4,5',8-trimethylpsoralen (Kaufman et al., J. Heterocyclic Chem. 19:1051 (1982)) (188 mg, 0.703 mmol) in 2 mL of THF. The mixture was stirred overnight at room temperature. Several drops of water were added to the reacted light yellow clear solution to decompose the excess reagent under 10 °C. The resulting mixture was concentrated and 1 N aqueous NaOH solution (30mL) was added. Chloroform (30 mL then 10 mL, 5 mL)) was used to extract the resultant amine. Combined CHCI3 layers were washed with saturated NaCl solution. The amine was then extracted into aqueous 0.3 N HCl (10, 5, 5 mL) and the acid layers were taken to pH 13 with 20 % aqueous NaOH. CHCI3 (3x10 mL) was used to extract the amine from the combined base layers then washed with water (2 mL) and dried over anhydrous Na2Sθ4. Upon concentration and vacuum drying the amine was obtained as a solid, >95% pure by NMR. NMR d 2.45 (s, 3H); 2.47 (s, 3H); 2.53 (s, 3H); 2.78 (t, J=6.6 Hz, 2H); 3.00 (t, J=6.5 Hz, 2H); 6.20 (s, IH); 7.44 (s, IH). The solid was dissolved in absolute ethanol. A solution of hydrogen chloride in diethyl ether (1 N, 1 mL) was added. The suspension was filtered to obtain compound 3, a light purple solid (32.7 mg, yield 15 %), m.p. > 237 °C (decomp.)

EXAMPLE 9

4'-(6- Amino -2-aza)hexyl-4,5',8- trimethylpsoralen Dihydrochloride (Compound 6)

The synthesis of 4'-(6-amino-2-aza)hexyl-4,5',8-trimethylpsoralen dihydrochloride proceeds in one (1) step, as follows: a solution of 4'- chloromethyl-4,5',8-trimethylpsoralen (188 mg, 0.68 mmol) in 30 mL of acetonitrile was added to a solution of 1,4-diaminobutane (120 mg, 1.4 mmol) in 7 mL of acetonitrile. After stirring overnight the solvent was removed under reduced pressure. Chloroform (10 mL) and IN NaOH (10 mL) were added to the residue and the mixture was shaken and separated. The aqueous solution was extracted with a further 2x10 mL of CHCI3 and the combined extracts were rinsed with water. The product was then extracted from the CHCI3 solution with 0.3 N aqueous HCl and the acidic layer was then taken to pH 12 with concentrated NaOH solution. The base suspension was extracted with CHCI3 which was then rinsed with water, dried over Na2Sθ4 and concentrated under reduced pressure to give the amine as the free base; NMR (CDC13); d 1.33 (m, 3H), 1.52 (m, 4H), 2.47 (s, 3H), 2.49 (d, J=l.l Hz, 3H), 2.54 (s, 3H), 2.68 (q, J=6.5 Hz, 4H), 3.86 (s, 2H), 6.21 (apparent d, J=l.l Hz, 1 H), 7.60 (s, IH).

The free base, dissolved in about 6 mL of absolute EtOH was treated with a solution of HCl in ether (1.0M, 3 mL). The resultant HCl salt was filtered, rinsed with absolute EtOH and dried under vacuum to yield 150 mg of compound 6, (55%), m.p. 290 "C (decomposed). Analysis calculated for

C19H26C12N2O3Η2O: C54.42; H, 6.73; N, 6.68. Found: C, 54.08; H, 6.45; N, 6.65.

The following compounds were prepared in a similar manner, with the differences in synthesis noted: a) 4'-(4-amino-2-aza)butyl-4,5',8-trimethylpsoralen dihydrochloride (Compound 1), mp 320-322°C (decomp). In this synthesis ethylene diamine was used as the diamine. b) 4'-(5-amino-2-aza)pentyl-4,5',8-trimethylpsoralen dihydrochloride (Compound 5), mp 288°C (decomp). NMR of free base: d 1.33 (br s, 3H), 1.66 (pent, J=6.8 Hz, 2H), 2.47 (s, 3H), 2.50 (d, J=l Hz, 3H), 2.55 (s, 3H), 2.6-2.85 (m, 4H), 3.89 (s, 2H), 6.22 (apparent d, J=l Hz, IH), 7.62 (s, IH). For this synthesis, 1,3-diaminopropane was used as the diamine. c) 4'-(7-amino-2-aza)heptyl-4,5',8-trimethylpsoralen dihydrochloride (Compound 10), mp 300°C (decomp). NMR of free base: d 1.22 (br s,), 1.3 - 1.6 (m) total 9 H, 2.44 (s), 2.50 (s), total 9H, 2.63 (m, 4H), 6.17 (s, IH), 7.56 (s, IH). Here, 1,5-diaminopentane was used as the diamine.

EXAMPLE 10 5'-(6-Amino-2-aza)hexyl-4,4',8-trimethylpsoralen

Dihydrochloride (Compound 17)

The synthesis of 5'-(6-amino-2-aza)hexyl-4,4',8-trimethylpsoralen dihydrochloride proceeds in one (1) step, as follows: a suspension of 5'-chloromethyl-4,4',8- trimethylpsoralen (190 mg, 0.68 mmol) in 30 mL of acetonitrile was added to a solution of 1,4-diaminobutane (120 mg, 1.4 mmol) in 7 mL of acetonitrile. After stirring at room temperature overnight, the solvent was removed under reduced pressure. Chloroform (10 mL) and IN NaOH (10 mL) were added to the residue and the mixture was shaken and separated. The aqueous layer was extracted with a further 2 x 10 mL of CHCI3 and the combined extracts were rinsed with water. The product was then extracted from the CHCI3 solution with 0.3 N aqueous HCl and the acidic layer was then taken to approximately pH 12 with concentrated NaOH solution. The base suspension was extracted with CHCI3 which was then rinsed with water, dried over Na2Sθ4 and concentrated under reduced pressure.

The residue was purified by column chromatography on silica gel with CHCI3 : EtOH : Et3N (9:1:0.25). The fractions containing the product were combined and stripped of the solvent to give the free amine. NMR (CDCI3): d 1.35 (m, 3H); 1.49 (m, 4H); 2.22 (s, 3H); 2.46 (d, J=l.l Hz, 3H); 2.51 (S, 3H); 2.65 (m, 4H); 3.88 (s, 2H); 6.17 (apparent d, 1Hz); 7.40 (s, IH).

The free base, dissolved in absolute EtOH (~6 mL) was treated with a solution of HCl in ether (1.0 M,~3 mL). The resultant HCl salt was filtered, rinsed with absolute EtOH and dried under vacuum to yield 100 mg (36.3%) of product, 5'-(6- Amino-2-aza)hexyl-4,4',8-trimethylpsoralen dihydrochloride, m.p. 288°C (decomposed).

5'-(4-Amino-2-aza)butyl-4,4',8-trimethylpsoralen dihydrochloride (Compound 16) was prepared in the same manner, except that ethylene diamine was used as the diamine. NMR of free base: d 1.83 (br s, 3H), 2.27 (s, 3H), 2.51 (s, 3H), 2.58 (s, 3H), 2.74 (m, 2H), 2. 87 (m, 2H), 3.95 (s, 2H), 6.24 (s, IH), 7.46 (s, IH).

EXAMPLE 11

4'-(14- Amino-2,6,ll-triaza)tetradecyl-4,5',8- trimethylpsoralen Tetrahydrochloride (Compound 15)

The synthesis of 4'-(14-amino-2,6,ll-triaza)tetradecyl-4,5',8- trimethylpsoralen tetrahydrochloride proceeds in one (1) step, as follows. To a solution of 0.5 g (2.5 mmol) of spermine (Aldrich, Milwaukee, WI) in 10 ml of methanol was added a 5N methanolic solution of HCl (concentrated HCl diluted with MeOH to 5N) to adjust to pH 5-6, followed by 0.128 g (0.5 mmol) of 4,5',8- trimethylpsoralen-4'carboxaldehyde, 20 mg (0.3 mmol) of NaBH3CN and 3 mL of MeOH. The reaction mixture was stirred at room temperature overnight. A solution of 5N methanolic HCl was added until pH<2 and methanol was removed under reduced pressure. The residue was taken up in about 100 mL of water and rinsed with three 25 mL portions of CHCI3. The aqueous solution was brought to pH>10 with concentrated NaOH and extracted with three 25 mL portions of CHCI3. These final extracts were combined and washed with water, dried (Na2Sθ4) and evaporated to give the free base of the amine, > 95% pure by NMR. NMR (CDCI3): d 1.31 (m, 5H), 1.45 (pent, J=3.41 Hz, 4H), 1.65 (m, 4 H),

2.46 (s, 3H), 2.49 (d, J=1.14 Hz, 3H), 2.66 (m, 15 H), 3.85 (s, 2H), 6.21 (s, lH)m 7.60 (s, IH).

The free amine was dissolved in absolute ethanol and HCl (anhydrous, IN in ethyl ether) was added. The hydrochloride salt was filtered and washed with absolute ethanol and dried under vacuum at room temperature giving 80.2 mg of product, 4^,-(14-amino-2,6,ll-triaza)tetradecyl-4,5',8-trimethylpsoralen tetrahydrochloride, as a light yellow solid.

EXAMPLE 12

In this example, pooled platelet units were stored and observed for the proliferation of cells. In parallel experiments (see examples below), samples from the same units were treated with psoralen and UVA to compare cytokine levels. Platelet Preparation

Fresh random donor platelet units were obtained from the Blood Bank of the Alameda-Contra Costa Medical Association (Oakland, CA). The units were sterile-docked using a Haemonetics SCD 312 sterile docker and were pooled in a single blood bag. The bag was centrifuged at 4000 x g for 6 minutes at room temperature in a Sorvall RC-3B centrifuge. The plasma supernatant was expressed from the centrifuged bag and diluted with PAS (platelet additive solution) to give a final composition of 35% plasma, 65% PAS. PAS is a synthetic media comprised of the following components, at the following concentrations: Na acetate«2H2θ (4.08 g/1); Na citrate*3H2θ (2.94 g/1); Na monobasic phosphate»H2θ (0.858 g/1); and Na dibasic phosphate (2.81 g/1). The platelet- rich pellet was resuspended in the 35% plasma, 65% PAS mixture. Aliquots (20 mL) of the platelet mixture were transferred to 30 mL PL2410 platelet storage bags (Baxter Healthcare Corp., Deerfield, IL) and stored in a Helmer platelet incubator (Helmer, Noblesville, IN) at 22 °C with agitation at 70 cycles /min. Platelet mixtures that were treated with gamma-irradiation and PCD were prepared as discussed in Example 13, below, prior to storage on the platelet incubator.

White Blood Cell Count

The white blood cells were counted using a procedure similar to that described by Kao and Scornik. Kao, KJ. and Scornik, J.C., "Accurate quantitation of the low number of white cells in white cell-depleted blood components," Transfusion 29: 77 .-777 (1989). A 1.0 mL aliquot of each sample was placed in 1.5 mL microcentrifuge tube and centrifuged in a microcentrifuge (IEC Micromax) at 3500 RPM (1000 x g) for 2.5 minutes. The supernatant was aspirated leaving the pellet undisturbed. The cell pellet which remained was resuspended in 1 mL of a stain solution containing 50 mg/mL propidium iodide, 1 mg/mL sodium citrate, and 0.03% mL/mL NP-40 (Sigma Chemical Co., St. Louis, MO). The pellet was gently resuspended by vortexing for 30 seconds before incubating at room temperature for 15 minutes. Manual counts (5 replicates) were performed using a 0.1 μL Improved Neubauer hemocytometer (Brightline Hemocytometer, Hauser Scientific). An Olympus BH2 microscope with a Mercury-100 W fluorescent light source (Chiu Technical Corp.) set at 450 nm excitation was used to count the stained white blood cells. Detection of Cytokine Production

IL-8 was chosen as an indicator of cytokine production. IL-8 is a low molecular weight inflammatory cytokine that activates neutrophils and serves as a chemotactic agent for neutrophils. It is produced by cells which are stimulated by cytokines such as TNF-a and IL-lb. Members of the IL-8 family can be synthesized and excreted by several different cellular sources including activated T-cells, activated mononuclear phagocytes, monocytes, and platelets. Abbas, A.K., et al., Cellular and Molecular Immunology, pp. 235-236, W.B Saunders Co. 1991. The primary cellular source for IL-8 in unpooled, single random donor units is likely to be monocytes. Yoshimura, T., et al., "Neutrophil chemotactic factor produced by lipopolysaccharide (LPS)-stimulated human blood mononuclear leukocytes: partial characterization and separation from interleukin 1 (IL 1)," J. Immunol. 139: 788-93 (1987).

Samples of plasma from each unit were stored for later ELISA analysis of cytokine levels. Samples (1.0 mL) were centrifuged in 1.5 mL Eppendorf tubes at 5000 rpm for 5 minutes at room temperature in an IEC Micromax bench-top centrifuge (IEC, Needham Heights, MA). The supernatant from each sample was divided into three separate aliquots and stored at - 70°C in 1.5 mL Eppendorf tubes. ELISA kits for IL-lb, IL-6, and TNF-a were purchased from Perceptive Diagnostics Inc. (Cambridge, MA). ELISA kits for IL-8 were purchased from R&D Systems (Minneapolis, MN). Plasma samples were thawed at room temperature and were centrifuged at 5000 rpm for 5 minutes at room temperature in an IEC Micromax bench-top centrifuge (IEC, Needham Heights, MA). Precipitates were not observed in any of the samples that were analyzed. ELISA assays were performed according to the protocol supplied by the manufacturer.

Plates were agitated on a Lab-Line Model 4625 Titer Plate Shaker (Lab-Line Instruments, Melrose Park IL) during incubation steps. Following completion of the assay, the ELISA plate was read using a Bio-Tek EL 312 Microplate reader (Bio-Tek Instruments Inc., Winooski, VT) at 450 nm with background subtraction at 650 nm and blanking relative to the 0 pg/mL standard. Results were evaluated by comparing absorbance measurements for each sample to a standard curve generated by cytokine standards which were supplied with each kit. Samples containing levels of IL-8 greater than the highest standard were diluted 50-fold in the standard serum diluent supplied with the ELISA and were reanalyzed. Note that in this example, random donor platelet units were pooled and divided so that cytokine generation in untreated platelet units could be compared to identical units that were treated with gamma-irradiation or photochemical decontamination. Measurements of pH, pθ2, and cell counts were also taken (data not shown) to confirm that neither gamma-irradiation nor photochemical decontamination had a significant effect on platelet quality. The pH drop was fairly consistent for all three samples indicating that no gross damage had occurred to the platelets. Platelet counts were very consistent for all samples. Samples of supernatant from each platelet concentrate were taken on alternating days and stored at -70 °C until the ELISAs for each of the cytokines were performed. Concentrations of IL-8 were found to increase to high levels in all of the untreated units with white blood cell counts greater than 1 x 10 /mL. Levels of IL-8 that were produced during 7 days of storage under standard conditions were found to be a function of the white blood cell count as indicated in FIG. 5. The linear regression (r = 0.98) for seven of the eight unpooled units (squares) is shown in the figure. Note that data for one of the eight unpooled units (triangle) were excluded from the linear regression because it appeared to deviate markedly from the observed trend. Pooling of the eight units resulted in a single unit with an intermediate white blood cell count. The datum point for the pooled unit (open circle) fell very near the regression for the unpooled units. Pooling of random donor platelet units results in the mixing of leukocytes from several donors, a situation which may be expected to result in a mixed lymphocyte reaction (MLR). The results shown in FIG. 9 did not detect a stimulation of synthesis of IL-8 as a result of pooling the platelet units. Previous studies have also failed to detect increased proliferation of cells using their particular screening method. Snyder et al. used antibodies against activated T- cell markers and H-thymidine uptake to study the response of passenger lymphocytes to pooling of platelet concentrates. Snyder, E.L., et al. "Storage of pooled platelet concentrates. In vitro and in vivo analysis," Transfusion 29: 390- 395(1989). In addition, Muylle and Peetermans reported that pooling did not effect the levels of IL-6 or TNF-a generated in buffy coats or platelet units during storage. Muylle, L. and Peetermans, M.E., "Effect of prestorage leukocyte removal on the cytokine levels in stored platelet concentrates," Vox Sang 66: 14-17 (1994). However, various indicators of cytokine production in pooled platelets remain to be tested. Although IL-8 does not appear to be enhanced by MLR, other cytokines may be. Until a more thourough study has been performed, the risk of MLR induced white blood cell proliferation can not be dismissed.

EXAMPLE 13

Two potential methods of leukocyte inactivation were looked at for their ability to reduce cytokine synthesis during platelet storage: gamma irradiation and photochemical treatment (PCD) using psoralen plus UVA light. The example also determines the time course for the generation of IL-8 in the treated and untreated samples of the random donor platelet units obtained from the pooled units, as shown in FIG. 5, which were treated with either gamma irradiation or photochemical treatment. Those units were treated with g-irradiation or PCD on day 1 to determine the effect on cytokine synthesis.

Gamma Irradiation

Platelet mixtures that were treated with gamma-irradiation were irradiated to 2500 Rads (approximately 6 minutes) using a Gamma Cell-1000 irradiation device (Nordion Inc.) located at the Blood Bank of the Alameda- Contra Costa Medical Association (Oakland, CA). 2500 Rads is the standard level of irradiation used to prevent graft versus host disease incident to platelet transfusions. Samples of the irradiated units were taken prior to irradiation and following irradiation to determine whether the treatment process resulted in any initial increase in the level of cytokines.

Photochemical Treatment

The samples for photochemical treatment were prepared as follows. A 15 mM stock solution of AMT was prepared by dissolving 50 mg of AMT powder in 10 mL of distilled water. The solution was mixed vigorously and filtered through a 0.2 μm syringe filter. The concentration of AMT in the filtered solution was determined by measuring the absorbance of the solution at 250 nm using a Shimadzu UV160U spectrophotometer. The AMT concentration was calculated using a value of 25000 M"lcm-1 for the extinction coefficient.

A 15 mM stock solution of Compound 2 was prepared by dissolving 152 mg of a powder of Compound 2 in 30 mL of distilled water. The solution was mixed vigorously and filtered through a 0.2 μm syringe filter. The concentration of Compound 2 in the filtered solution was determined by measuring the absorbance of the solution at 250 nm using a Shimadzu UV160U spectrophotometer. The Compound 2 concentration was calculated using a value of 25400 M"lcm^_l for the extinction coefficient.

The low solubility of 8-methoxypsoralen (8-MOP) in aqueous solutions made preparation of concentrated stock solutions impossible. Instead, platelet units that were treated with 8-MOP and ultraviolet light were prepared using PAS solution saturated with 8-MOP. The saturated solution was prepared by suspending 100 mg of 8-MOP in 100 mL of PAS. The solution was agitated for 16 hours at room temperature in a dark container. The resulting solution was filtered through a 0.2 μm filter to remove any undissolved 8-MOP. The final 8- MOP concentration was determined by measuring absorbance at 248 nm using a Shimadzu UV160U spectrophotometer. The 8-MOP concentration was calculated using a value of 22900 M^_lcm"l for the extinction coefficient. Units that were treated with PCD were enriched with psoralen to a final concentration of 150 μM for AMT and Compound 2. Units that were treated with 8-MOP were prepared by using PAS saturated with 8-MOP in the preparation procedure discussed above. The final 8-MOP concentration in the units was 75 μM. The random donor units were illuminated with UVA light to a final dose of 1.9 J/cm² in a light device with output and dimensions similar to that described in Example 1. The units were agitated at 70 cycles /min during illumination. Samples of the platelet units were taken prior to illumination and following illumination to determine whether any increase in the level of cytokines had occurred during illumination. Samples of the reconstituted units were taken for day 0 controls in addition to the pre- and post-treatment samples taken for the PCD and gamma- irradiated platelet units. The pH and blood gas concentrations were immediately measured using a Ciba Corning Model 238 Blood Gas Analyzer (Ciba Corning Diagnostics Corp., Medfield, MA). Platelet counts were determined using a Sysmex DD-100 sample diluter and a Sysmex F800 Microcell counter (TOA

Medical Electronics, Kobe, Japan). Samples were diluted 4X in saline and were counted in triplicate.

FIG. 6 compares the time course for generation of IL-8 in treated versus untreated samples. Note that in both the untreated control and the gamma- irradiated samples the level of IL-8 appears to increase with time suggesting that active synthesis and excretion of cytokine is occurring during storage. The initial level of IL-8 in the gamma-irradiated unit appeared to be only slightly elevated relative to the other units suggesting that "dumping" of cytokines from cell storage during treatment was minimal. Photochemical treatment with AMT and Compound 2 resulted in essentially complete inhibition of cytokine synthesis. Levels of IL-8 did not rise above the day 0 baseline level during 7-day storage. Inhibition of cytokine synthesis by 8-MOP was also apparent. The level of IL-8 rose slightly during the first day of storage but did not increases significantly beyond day 1. Samples of plasma were also assayed for levels of IL-lb, IL-6, and TNF-a.

Levels of IL-lb appeared slightly elevated (40-50 pg/mL) in the untreated random donor platelet units. The levels of IL-lb, IL-6, and TNF-a for the untreated unit and the unit that was treated with Compound 2 and UVA illumination are shown in FIG. 8. Note that the untreated control shows a steady increase in the level of IL-lb suggesting that synthesis of IL-lb is also occurring during storage. In comparison, the sample that was treated with Compound 2 + UVA showed a relatively insignificant increase in IL-lb during storage indicating that synthesis of IL-lb has been prevented. Levels of IL-6 and TNF-a were not significantly elevated in any of the samples tested.

The levels of cytokines that were detected in the untreated units during storage are similar to those that have been observed by other investigators. Muylle et. al found that elevated levels of cytokines (IL-lb, IL-6, TNF-a) could be detected only in platelet concentrate units which had white blood cell counts exceeding 3 x 10⁶/mL. Muylle, 1., et al., Transfusion; 33: 195-199 (1993). Stack and Snyder reported that elevated levels of IL-8 could be detected in PCs containing lower levels of white blood cells (1-2 x lO^/mL). Levels of IL-lb paralleled IL-8 levels but at much lower concentrations. Stack and Snyder also reported data for levels of passenger leukocytes in platelet concentrates that were prepared according to Red Cross protocols. They found that white blood cell levels ranged from 0.2 x IO⁶ to 15.9 x IO⁶ WBC/ mL (2.4 ± 3.2 x 10⁶/mL, mean + SD). In this study, the white blood cell count of the random donor platelet pool was slightly below average (1.7 x 10°/mL). The level of IL-8 in the untreated units rose much more quickly than was observed by Stack and Snyder for samples containing 1-2 x 10^ WBC/mL, but reached approximately the same final concentration. As indicated in FIG. 8, increases in levels of IL-lb paralleled increases in levels of IL-8, but at lower concentrations. Levels of IL-lb increased over the 7-day storage period in the untreated control (solid squares) but remained relatively constant in the random donor platelet unit that was treated with PCD (open squares). Levels of both IL-6 and TNF-a remained unchanged during storage in both the untreated control (solid circles, solid triangles) and the PCT sample (open circles, open triangles). The final concentration of IL-lb (40-50 pg/mL) was much lower than that observed for IL-8 (>1500 pg/mL).

EXAMPLE 14

The photoreaction between psoralen and nucleic acid requires the presence of both psoralen and UVA for the reaction to occur. This example evaluates the effect of psoralen (Compound 2) alone and UVA illumination alone on cytokine synthesis in random donor platelet units. Control samples in Example 13 were screened for IL-8 production, as described in that example. The results appear in FIG. 7. A platelet sample that was illuminated with UVA, but without Compound 2 (squares) appeared to have higher levels of IL-8 than the untreated control (solid circles). The unit that was treated with Compound 2 without illumination (open squares) showed a decrease in the levels of IL-8. It should be noted, however, that no effort was made to shield the non-illuminated unit from light during the storage period. The decreased level of IL-8 may therefore be a result of low levels of UVA that the sample was exposed to during handling and storage. Additional controls were performed in which Compound 2 was added to plasma (diamonds) or PAS (triangles) and illuminated before the solution was added to the platelets. Once again, the slight decreases in IL-8 levels may be related to UVA exposure during handling and storage. The combined effect of Compound 2 and illumination with UVA (open circles) is included in the figure for comparison, and shows complete inhibition of cytokine synthesis, as indicated in FIG. 7.

EXAMPLE 15

This example measures psoralen-DNA adduct formation resulting from treatment of platelet units by methods of the present invention. Platelet units were enriched with leukocytes prepared from buffy coats by Ficoll density gradient. Higher levels of white blood cells were obtained in these experiments (>4 x 10°7mL), but levels did not exceed white blood cell counts that have been observed in standard clinical platelet units. FIG. 9 indicates the levels of IL-8 in platelet units that were subjected to various treatments and stored for five days under standard conditions. The "Not Spiked" sample is the platelet unit without addition of white blood cells. The remaining samples were enriched with white blood cells to a final count of 4.3 x lO^/mL. The levels of IL-8 in the day-5 samples from untreated units were much higher than in previous experiments as would be expected for a higher white blood cell count. In addition to the standard 2500 cGy treatment, a sample was subjected to a double dose of g- irradiation (5000 cGy). Note that the level of IL-8 in the sample that was treated with 5000 cGy g-irradiation decreased only slightly relative to the untreated control. The platelet units that were treated with 100 μM and 150 μM Compound 2 were the only samples that did not show an increase in the level of IL-8 during storage. The sample that was treated with 150 μM AMT showed a slight increase in the level of IL-8 while the samples that were treated with 10 μM Compound 2 and 75 μM 8-MOP showed slightly higher levels.

Levels of psoralen-DNA adduct formation were determined for each of the samples that were treated with psoralen + UVA. Stock solutions of 3H-labeled psoralens were added to each platelet unit to the indicated concentration before illumination to 1.9 J/cm². The platelet unit containing 75 μM 8-MOP was prepared with PAS solution saturated with 8-MOP while the AMT and Compound 2 samples were prepared with 15 mM stock solutions. DNA was extracted from the cell pellet from each sample and the level of bound radioactivity was measured. Approximately 50 μg of DNA was obtained from a 4 mL sample of PC with an initial white blood cell count of 4.3 x lO^/mL. Figure 10 indicates the level of adduct formation which was calculated from measurements of bound radioactivity and concentration of DNA for each sample. Note that Compound 2 appears to be more active in DNA adduct formation than both AMT and 8-MOP under similar conditions. The correlation between DNA- adduct formation and inhibition of IL-8 generation during platelet storage is indicated in Figure 11. Generation of IL-8 during storage appears to be completely inhibited when greater than approximately 9 adducts are formed per 1000 base pairs, as is the case for 100 μM and 150 μM Compound 2 illuminated to 1.9 J/cm².

EXAMPLE 16

In this example the compounds of the present invention are tested for their dark mutagenicity using an Ames assay. The procedures used for the Salmonella mutagenicity test as described in detail by Maron and Ames were followed exactly. Maron, D.M. and B.N. Ames, Mutation Research 113: 173 (1983). A brief description for each procedure is given here. The tester strains TA97a, TA98, TA100, TA102, TA1537 and TA1538 were obtained from Dr. Ames. TA97a, TA98, TA1537 and TA1538 are frameshift tester strains. TA100 and TA102 are base- substitution tester strains. Upon receipt each strain was cultured under a variety of conditions to confirm the genotypes specific to the strains.

The standard Salmonella tester strains used in this study require histidine for growth since each tester strain contains a different type of mutation in the histidine operon. In addition to the histidine mutation, these tester strains contain other mutations, described below, that greatly increase their ability to detect mutagen.

Histidine Dependence: The requirement for histidine was tested by streaking each strain first on a minimal glucose plate supplemented only with biotin and then on a minimal glucose plate supplemented with biotin and histidine. All strains grew the lack of growth of the strains in the absence of histidine. rfa Mutation: A mutation which causes partial loss of the lipopolysaccharide barrier that coats the surface of the bacteria thus increasing permeability to large molecules was confirmed by exposing a streaked nutrient agar plate coated with the tester strain to crystal violet. First 100 μL of each culture was added to 2 mL of molten minimal top agar and poured onto a nutrient agar plate. Then a sterile filter paper disc saturated with crystal violet was placed at the center of each plate. After 16 hours of incubation at 37°C the plates were scored and a clear zone of no bacterial growth was found around the disc, confirming the rfa mutation. uvrB Mutation: Three strains used in this study contain a deficient UV repair system (TA97a, TA98, TA100, TA1537 and TA1538). This trait was tested for by streaking the strains on a nutrient agar plate, covering half of the plate, and irradiating the exposed side of the plate with germicidal lamps. After incubation growth was only seen on the side of the plate shielded from UV irradiation. R-factor: The tester strains (TA97a, TA98, TA100, and TA102) contain the pKMlOl plasmid that increases their sensitivity to mutagens. The plasmid also confers resistance to ampicillin to the bacteria. This was confirmed by growing the strains in the presence of ampicillin. pAQl: Strain TA102 also contains the pAQl plasmid that further enhances its sensitivity to mutagens. This plasmid also codes for tetracycline resistance. To test for the presence fo this plasmid TA102 was streaked on a minimal glucose plate containing histidine, biotin, and tetracycline. The plate was incubated for 16 hours at 37°C. The strain showed normal growth indicating the presence of the pAQl plasmid. The same cultures used for the genotype testing were again cultured and aliquots were frozen under controlled conditions. The cultures were again tested for genotype to confirm the fidelity of the genotype upon manipulation in preparing the frozen permanents.

The first tests done with the strains were to determine the range of spontaneous reversion for each of the strains. With each mutagenicity experiment the spontaneous reversion of the tester strains to histidine independence was measured and expressed as the number of spontaneous revertants per plate. This served as the background controls. A positive mutagenesis control was included for each tester strain by using a diagnostic mutagen suitable for that strain (2-aminofluorene at 5mg/plate for TA98 and sodium azide at 1.5 mg/plate for TA100).

For all experiments, the pre-incubation procedure was used. In this procedure one vial of each tester strain was thawed and 20 μL of this culture was added to 6 mL of Oxoid Nutrient Broth #2. This solution was allowed to shake for 10 hours at 37°C. In the pre-incubation procedure, 0.1 mL of this overnight culture was added to each of the required number of sterile test tubes. To half of the tubes 0.5 mL of a 10% S-9 solution containing Aroclor 1254 induced rat liver extract (Molecular Toxicology Inc., Annapolis, MD), and MgCl2, KCl, glucose-6- phosphate, NADP, and sodium phosphate buffer (Sigma, St. Louis, Missouri) were added. To the other half of the tubes 0.5 mL of 0.2M sodium phospate buffer, pH 7.4, was used in place of the S-9 mixture (the -S9 samples). Finally 0.1 mL of the test solution containing either 0, 0.1, 0.5, 1, 5, 10, 50, 100, 250, or 500 μg/mL of the test compound was added. The 0.7 mL mixture was vortexed and then pre-incubated while shaking for 20 minutes at 37°C. After shaking, 2 mL of molten top agar supplemented with histidine and biotin were added to the 0.7 mL mixture and immediately poured onto a minimal glucose agar plate (volume of base agar was 20 mL). The top agar was allowed 30 minutes to solidify and then the plates were inverted and incubated for 44 hours at 37°C. After incubation the number of revertant colonies on each plate were counted. The results appear in TABLES 12 (A) - 18 (B), below, ("n" represents the number of replicates performed for each data point.)

TABLE 12 (A)

TABLE 12 B)

AMT

TA10 TA102 TA1537 TA1537 TA153$ TA153$

STRAIN -S9 +S9 -S9 +S9 -S9 +S9

Dose μg/plafce

346 404 15 19 n=26 n=41 n=30 n=45 n=30 n=42

0.1 27 -20 n=3 n=6 n=3 n=6 n=3 n=6

0.5 47 13 n=3 n=6 n=9 n=12 n=9 n=12

88 -17 37 n=3 n=6 n=9 n=12 n=9 n=12

266 51 44 22 13 177 n=3 n=6 n=9 n=12 n=18 n=21

10 52 30 14 255 n=9 n=9 n=9 n=9

50 2688 94 n=9 n=9

100 2058 686 n=9 n=9

250 434 3738 n=9 n=12

lOOμg/ 3l lOμg/rflt 10μg/p 5μg/plate

Positiv« ; hydrog ?n 9-Amiήo 2-Aminb- 2- Amir o

Contro peroxide acridirie fluorerie fluorerie 660 284 73 1064 n=23 n=6 n=24 n=30 TABLE 13 (A)

8-MOP

TABLE 13 (B)

8-MOP

TABLE 14

Compound 1

TA100 TA100 TA1538 TA1538

STRAIN -S9 +S9 -S9 +S9

Dose μg/plate

0 126 123 15 19 n=41 n=56 n=30 n=42

5 292 -24 10 21 n=3 n=3 n=3 n=3

10 337 -22 12 22 n=3 n=3 n=3 n=3

Positive 1.5μg/plat 5μg/plate Control Sodium 2-Amino-

Azide fluorene

965 1064 n=38 n=30

TABLE 15 (A)

Compound 2

TA98 TA98 TA100 TA100

STRAIN -S9 +S9 -S9 +S9

Dose μg/plate

0 20 25 126 123 n=35 n=50 n=41 n=56

5 103 -18 n=3 n=3

10 28 24 46 1 n=3 n=3 n=6 n=6

50 52 35 182 115 n=3 n=3 n=3 n=3

100 39 53 121 96 n=6 n=6 n=3 n=3

250 29 69 n=3 n=3

500 6 63 n=3 n=3

10μg/pH lOμg/plt 5μg/plate

Positive 9- Amino 2-Amino- 2-Amino- Control acridine fluorene fluorene

284 73 1064 n=6 n=24 n=30

TABLE 15 (B)

Compound 2

TA1537 TA1537 TA1538 TA1538

STRAIN -S9 +S9 -S9 +S9

Dose μg/plate

0 9 9 15 19 n=30 n=45 n=30 n=42

5 -8 2 n=3 n=3

10 36 5 -13 4 n=3 n=3 n=3 n=3

50 282 40 n=3 n=3

100 258 88 n=3 n=3

250 176 744 n=3 n=3

500 114 395 n=3 n=3

lOμg/plt lOμg/plt 5μg/plate

Positive 9-Amino- 2-Amino- 2-Amino- Control acridine fluorene fluorene

284 73 1064 n=6 n=24 n=30

TABLE 16

TABLE 17

TABLE 18 (A)

TABLE 18 (B)

Compound 6

TA1537 TA1537 TA1538 TA1538

STRAIN -S9 +S9 -S9 +S9

Dose μg/plate

0 9 9 15 19 n=30 n=45 n=30 n=42

5 -5 0 n=3 n=3

10 141 -1 -2 8 n=6 n=6 n=3 n=3

50 2010 17 n=6 n=6

100 795 35 n=6 n=6

250 228 99 n=6 n=6

500 43 369 n=3 n=3

10μg/plat( ' 10μg/plat( . 5μg/plate

Positive 9-Amino- 2-Amino- 2-Amino- Control acridine fluorene fluorene

284 73 1064 n=6 n=24 n=30

TABLE 19 (A)

TABLE 19 (B)

Compound 18

TA1537 TA1537

STRAIN -S9 +S9

Dose μg/plate

0 8 7 n=3 n=3

5

10 21 8 n=3 n=3

50 303 6 n=3 n=3

100 390 26 n=3 n=3

200 225 42 n=3 n=3

500

100 μg/pla e 100 μg/pla :e AMT AMT

608 500 n=3 n=3

Maron and Ames (1983) describe the conflicting views with regard to the statistical treatment of data generated from the test. In light of this, this example adopts the simple model of mutagenicity being characterized by a two-fold or greater increase in the number of revertants above background (in bold in the tables), as well as dose dependent mutagenic response to drug. With regard to 8-MOP, the only mutagenic response detected was a weak base-substitution mutagen in TA102 at 500μg/plate (TABLE 13 (B)).

In sharp contrast, AMT (TABLE 12 (A) and 12 (B)) showed frameshift mutagenicity at between 5 and 10 μg/plate in TA97a and TA98, at 5μg/plate in TA1537 and at 1 μg/plate in TA1538. AMT showed no significant base- substitution mutations.

Looking at Compound 1, the only mutagenic response detected was a weak frameshift mutagen in TA1538 at 5 μg/plate in the presence of S9. Compound 1 also displayed mutation in the TA100 strain, but only in the absence of S9. Compound 2 also showed weak frameshift mutagenicity in the presence of S9 in TA98 and TA1537. Compounds 3 and 4 showed no mutagenicity. Compound 6 had no base substitution mutagenicity, but showed a frameshift response in TA98 in the presence of S9 at concentrations of 250μg/plate and above. It also showed a response at 50μg/plate in TA1537 in the presence of S9. Compound 18 showed only a weak response at high concentrations in the presence of S9 in strains TA 9o and TA 1537. The response was higher in the absence of S9, but still was significantly below that of AMT, which displayed mutagenicity at much lower concentrations (5 μg/plate).

From this data it is clear that the compounds of the present invention do not display significant mutagenic characteristics, and further show vast improvements over AMT, as defined by the Ames test.

EXAMPLE 17

This example describes methods by which synthetic media and compounds of the present invention may be introduced and used for inhibiting cytokine production and inactivating T-cells, as well as inactivating pathogens in blood. FIG. 12A schematically shows the standard blood product separation approach used presently in blood banks. Three bags are integrated by flexible tubing to create a blood transfer set (200) (e.g., commercially available from

Baxter, Deerfield, 111.). After blood is drawn into the first bag (201), the entire set is processed by centrifugation (e.g., Sorvall^ _swmg bucket centrifuge, Dupont), resulting in packed red cells and platelet rich plasma in the first bag (201). The plasma is expressed off of the first bag (201) (e.g., using a Fenwall^M device for plasma expression), through the tubing and into the second bag (202). The first bag (201) is then detached and the two bag set is centrifuged to create platelet concentrate and platelet-poor plasma; the latter is expressed off of the second bag (202) into the third bag (203). Figure 12B schematically shows an embodiment of the present invention by which synthetic media and photoactivation compound are introduced to platelet concentrate prepared as in Figure 12A. A two bag set (300) is sterile docked with the platelet concentrate bag (202) (indicated as "P.C"). Sterile docking is well-known to the art. See e.g., -US Patent No. 4,412,835 to D.W.C. Spencer, hereby incorporated by reference. See also US Patents Nos. 4,157,723 and 4,265,280, hereby incorporated by reference. Sterile docking devices are commercially available (e.g., Terumo, Japan).

One of the bags (301) of the two bag set (300) contains a synthetic media formulation of the present invention (indicated as "STERILYTE"). In the second step shown in Figure 12B, the platelet concentrate is mixed with the synthetic media by transferring the platelet concentrate to the synthetic media bag (301) by expressing the platelet concentrate from the first blood bag into the second blood bag via a sterile connection means. The photoactivation compound can be in the bag containing synthetic media (301), added at the point of manufacture. Alternatively, the compound can be mixed with the blood at the point of collection, if the compound is added to the blood collection bag (FIG. 12A, 201) at the point of manufacture. The compound may be either in dry form or in a solution compatable with the maintainance of blood. Figure 12C schematically shows one embodiment of the decontamination approach of the present invention applied specifically to platelet concentrate diluted with synthetic media as in Figure 12B. In this embodiment, platelets have been transferred to a synthetic media bag (301). The photoactivation compound either has already been introduced in the blood collection bag (201) or is present in the synthetic media bag (301). Either the platelets are then expressed into the synthetic media bag via a sterile connection means (as shown) or the synthetic media is expressed into the platelet bag. The bag containing the mixture of platelet concentrate and synthetic media (301), which has UV light transmission properties and other characteristics suited for the present invention, is then placed in a device (such as that described in Example 1, above) and illuminated. Following phototreatment, the treated platelets are transferred from the synthetic media bag (301) into the storage bag (302) of the two bag set (300). The storage bag can be a commercially available storage bag (e.g., CLX bag from Cutter). Figure 12D schematically shows an embodiment of the cytokine inhibition approach of the present invention, which includes a capture device to remove photoinactivation compound from the treated material after phototreatment. The present invention contemplates several adsorptive materials which may be used in a capture device to remove photoinactivation compounds, of which the following is a nonexclusive list: Amberlite XAD-4 (available from Rohm and Haas Ltd., Croydon, Surrey, UK) ("Resin hemoperfusion for Acute Drug Intoxication," Arch Intern Med 136:263 (1976)); Amberlite XAD-7 ("Albumin- Coated Amberlite XAD-7 Resin for Hemoperfusion in Acute Liver Failure,"

Artificial Organs, 3:20 (1979); Amberlite 200, Amberlite DP-1, Amberlite XAD-2, Amberlite XAD-16; activated charcoals, ("Charcoal haemoperfusion in Drug Intoxication," British J. Hospital Med. 49:493 (1993); silica ("In vitro Studies of the Efficacy of Reversed Phase Silica Gel as a Sorbent for Hemo- and Plasmaperfusion," Clinical Toxicology 30:69 (1992)). In one embodiment, the present invention contemplates an absorptive material operating in conjunction with a filtering means to remove compounds.

EXAMPLE 18

This example involves an assessment of the impact of the compounds and methods of the present invention on platelet function. Four indicators of platelet viability and function were employed: 1) GMP-140 expression; 2) maintenance of pH; 3) platelet aggregation, and 4) platelet count. To measure the effects of the present compounds and methods of decontamination on platelet function using these four indicators, four samples were prepared for each compound tested, two control samples and two containing compound. Three units of human platelets were obtained from the Sacramento Blood Center, Sacramento, CA. These were each transferred under sterile conditions to 50 ml centrifuge tubes, then aliquots of each unit were transferred into a second set of 50 ml sterile centrifuge tubes. To each centrifuge tube containing platelet concentrate (PC), an aliquot of compound stock was added to reach a final concentration of 100 μM of compound. The compounds tested in this experiment were Compound 2 ( 36 μL of 10 mM stock added to 4 ml PC), Compound 6 (173.5 μl of 9.8 mM stock added to 16.8 ml PC), Compound 17 (2.0 ml of ImM stock added to 18 ml PC) and Compound 18 (.842 ml of 2.0 mM stock to 16 ml PC). The samples were pipetted gently up and down to mix. Then aliquots (either 3 ml or 8 ml) of each sample was transferred to two sterile Teflon™ Medi-bags™ (American Fluoroseal Co., Silver Springs, MD) (presently owned by The West Company, Lionville, PA). Samples were treated in one of two different sized bags, having either 3 ml or 8 ml capacity. The bags both have approximately the same surface area to volume ratios, and previous experiments have shown that the two bags exhibit approximately equivalent properties during irradiation of samples. (Data not shown). For each compound tested, two control samples without compound were prepared by again removing aliquots of platelet concentrate (17 ml if using an 8 ml bag, 4 ml if using a 3 ml bag) from the same one of the first set of 50 ml centrifuge tubes from which the compound sample was drawn, and dividing into Medibags, as before. One of each pair of Medibags containing a compound, and one of each pair of control Medibags, were illuminated for 5 Joules /cm^ on the device described in Example 1, above. Then all experimental and control Medibags were placed on a platelet shaker for storage for 5 days. The same experiments were repeated several times to obtain more statistically meaningful data, as represented by "n", the number of data points represented, in the graphs of FIGS 13-16, discussed below. Also in FIGS 13-16, "Cl" represents an untreated control at day 1, "D5" represents an untreated control after a five day storage, "uv" represents a sample which was treated with ultraviolet light only, and "PCD" represents the test sample, treated with ultraviolet light and a compound of the present invention.

To obtain data for control samples at day one, approximately 3 ml were removed from the remaining volume of each of the three units and divided into two 1.5 ml tubes. These samples were tested for pH as described below. A platelet count was also taken, as described below, at a 1:3 dilution. The residual platelet concentrate from each unit was spun for 10 minutes at 3800 rpm (3000 g) in Sorval RC3B (DuPont Company, Wilmington, Delaware) to pellet platelets. Plasma was then decanted into 2 sterile 50 ml tubes (one for Day one, and the other stored at 4° C for Day 5) for use in the aggregation assay.

1) GMP-140 Expression

When platelets become activated, an alpha granule membrane glycoprotein called p-selectin (GMP140) becomes exposed on the platelet surface. Less than (5%) of fresh, normal unstimulated platelets express detectable GMP140 levels by flow cytometry. See generally M.J. Metzelaar, Studies on the Expression of Activation-Markers on Human Platelets (Thesis 1991).

To measure GMP140, a small aliquot of platelet rich plasma is placed in HEPES buffer containing a GMP140-binding antibody or an isotype control mouse IgG. CD62 is a commercially available monoclonal antibody which binds to GMP140 (available from Sanbio, Uden, the Netherlands; Caltag Labs, So. San Francisco, CA, and Becton Dickinson, Mountain View, CA). After a fifteen minute incubation at room temperature, Goat F(ab')2 Anti-Mouse IgG conjugated to FITC (Caltag Laboratories, So. San Francisco, CA) is added to the tube in saturating amounts and allowed to incubate at room temperature (RT) for 15 minutes. Finally, the cells are diluted in 1% paraformaldehyde in phosphate buffered saline and analyzed on a FACSCAN™ (Becton Dickinson, Mountain View, CA). The positive control is made by adding Phorbol Myristate Acetate (PMA) to the test system at a final concentration of 2 x 10"? M. In this example, CD62 was employed to measure the impact, if any, of irradiation in the presence of several compounds of the present invention on platelet activation. The antibody was mixed with HEPES buffer (10 μL antibody [0.1 mg/ml] : 2.49mL buffer) and stored in 50 μL aliquots at -40°C prior to use. A positive control consisted of: 10 μL CD62, 8 μL PMA and 2.482 mL Hepes buffer. A mouse IgGl control (0.05 mg/ml) (Becton Dickinson, Mountain View, CA

#9040) 5X concentrated was also employed. The antibody was diluted in HEPES buffer (20μL antibody : 2.48 ml buffer) and stored at -40°C. Phorbol Myristate Acetate (PMA) (Sigma, St. Louis, MO) was stored at -40°C. At time of use, this was dissolved in DMSO (working concentration was 10 μg/mL). 1% Paraformaldehyde (PFA) (Sigma, St. Louis, MO) was prepared by adding 10 grams paraformaldehyde to 1 liter PBS. This was heated to 70°C, whereupon 3 M NaOH was added dropwise until the solution was clear. The solution was cooled and the pH was adjusted to 7.4 with 1 N HCl. This was filtered and stored. Processing each of the samples of platelet concentrate after treatment involved adding 5 microliters of platelet concentrate, diluted 1:3 in Hepes buffer, to each microcentrifuge tube containing the antibody CD62, and appropriate reagents and mixing very gently by vortex. The samples were then incubated for 15 minutes at room temperature. The Goat anti-Mouse IgG-FITC (diluted 1:10 in HEPES buffer) was added

(5 microliters) to each tube and the solution was mixed by gentle vortex. The samples were incubated for an additional 15 minutes at room temperature. Next, 1 ml of 1% PFA in PBS was added to each tube and mixed gently. The platelets were analyzed on the FACSCAN™. The results are shown in FIGS 13C, 14C, 15C, and 16C. (FIGS 13 corresponds to Compound 2, FIGS 14 corresponds to Compound 6, FIGS 15 corresponds to Compound 17 and FIGS 16 correspond to Compound 18). Clearly, three of the four compounds tested, 2, 6, and 17, exhibited little or no difference between the day 5 untreated control (D5) and the sample treated with both light and psoralen compound (PCD). Only Compound 18 exhibited a notable increase above the control. But the value was still well below the positive control value. 2) Maintainance of pH:

Changes in pH of platelets in concentrate can alter their morphological characteristics and their survival post transfusion. Moroff, G., et aL, "Factors Influencing Changes in pH during Storage of Platelet Concentrates at 20-24° C," Vox Sang. 42:33 (1982). The range of pH at which platelets function normally is from approximately 6.0 - 6.5 to 7.6. Stack, G. and E.L. Snyder, "Storage of Platelet Concentrate," Blood Separation and Platelet Fractionation 99, at 107 (1991). To measure pH of the samples, a CIBA-CORNING 238 pH/Blood Gas analyzer was used (CIBA-CORNING, Norwood, MA). A small amount of platelet concentrate from each sample was introduced into the pH/Blood Gas analyzer.

Measurements of pH were taken at time zero and after 5 days of storage for all samples. FIGS 13D, 14D, 15D and 16D are bar graphs showing pH results for a dark control, a light control and an experimental light plus compound. These graphs indicate that the pH of platelet concentrate samples after illumination in the presence of any one of the compounds remains above a pH of 6.5. Thus platelets remain at a pH acceptable for stored platelets following photoinactivating treatment using compounds of the present invention.

3) Aggregation

Platelet aggregation is measured by the change in optical transmission that a platelet sample exhibits upon stimulation of aggregation. Platelet aggregation was measured using a Whole Blood Aggregometer (Chrono-Log Corp., Havertown, PA, model 560 VS). The number of platelets in each sample was controlled to be constant for every measurement. A Model F800 Sysmex cell counter (Toa Medical Electronics, Kobe, Japan) was used to measure platelet count in the platelet samples and autologous plasma was used to adjust platelet counts to 300,000/mL of platelet concentrate. For the procedure, all the samples were incubated in a capped plastic tube for 30 minutes at 37°C for activation. The aggregometer was warmed up to 37°C. The optical channel was used for platelet aggregation measurement. The magnetic speed of the aggregometer was set at 600 /min. Remaining platelet concentrate, from the units obtained which was not drawn as a sample for treatment, was centrifuged at high speed (14,000 g) with a micro-centrifuge for 5 minutes to obtain containers of platelet poor plasma autologous to the experimental samples. To begin, 0.45 ml of the autologous platelet poor plasma was added along with 0.5 ml of saline into a glass cuvette and placed in the PPP channel. Then 0.45 ml of the sample platelet concentrate and 0.50 ml of saline were added to a glass cuvette (containing a small magnet) into the sample channel. After one minute, ADP and collagen reagents (10 μl) each were added to the sample cuvette. The final concentration of ADP was 10 μM and the final concentration of collagen was 5 μg/ml. Platelet aggregation was recorded for about 8-10 minutes or until the maximum reading was reached.

The results appear in FIGS. 13B, 14B, 15B, and 16B. The 100 % aggregation line is the level at which the recorder was set to zero. The 0% aggregation line is where the platelets transmitted before the ADP and collagen were added. The aggregation value for the sample is determined by taking the maximum aggregation value as a percent of the total range. Three of the four compounds tested showed very little or no difference in aggregation levels between the samples treated with compound and the untreated samples which were stored for 5 days. Compound 2 exhibited a small reduction in aggregation, of approximately 8% from the day 1 control. The aggregation for the sample treated with compound and uv was the same as that for the uv only sample. This is supporting evidence that the decontamination compounds tested do not have a significant effect on platelet aggregation when used in the methods of the present invention.

4) Count

A Sysmex cell counter was used to measure platelet count in the platelet samples. Samples were diluted 1 : 3 in blood bank saline.

The results of the platelet count measurements appear in FIGS. 13A, 14A, 15A, and 16A. For each of the compounds, the samples show little or no drop in platelet count between the Day 5 control and the Day 5 treated sample. Interestingly, samples treated with Compounds 6, 17 and 18 all display a higher platelet count than samples treated with light alone. For example, samples treated with Compound 6 had counts equivalent to the 5 day control, but samples treated with only ultraviolet light showed approximately a 33% reduction in platelet count. Thus, not only is treatment with compounds of the present invention compatible with the maintenance of platelet count, but it actually appears to prevent the drop in count caused by ultraviolet light exposure. EXAMPLE 19

A preferred compound for treating blood products subsequently used in vivo should not be mutagenic to the recipient of the blood. In the first part of this experiment, some compounds were screened to determine their genotoxicity level in comparison to aminomethyltrimethylpsoralen. In the second part, the in vivo clastogenicity of some compounds of the present invention was measured by looking for micronucleus formation in mouse reticulocytes.

1) Genotoxicity

Mammalian cell cultures are valuable tools for assessing the clastogenic potential of chemicals. In such studies, cells are exposed to chemicals with and /or without rat S-9 metabolic activation system (S-9) and are later examined for either cell survival (for a genotoxicity screen) or for changes in chromosome structure (for a chromosome aberration assay).

Chinese hamster ovary (CHO; ATCC CCL 61 CHO-K1, proline-requiring) cells were used for the in vitro genotoxicity and chromosomal aberration tests. CHO cells are used extensively for cytogenic testing because they have a relatively low number of chromosomes (2n=20) and a rapid rate of multiplication (-12 to 14 hours, depending on culture conditions). The cells were grown in an atmosphere of 5% CO2 at approximately 37° C in McCoy's 5a medium with 15% fetal bovine serum (FBS), 2 mM L-glutamine, and 1% penicillin-streptomycin solution to maintain exponential growth. This medium was also used during exposure of the cells to the test compound when no S-9 was used. Cell cultures were maintained and cell exposures were performed in T-75 or T-25 flasks.

Each of the sample compounds were tested at seven dilutions, 1, 3, 10, 33, 100, 333, and 1000 μg/ml. The compound was added in complete McCoy's 5a medium. After the compound was added, cells were grown in the dark at approximately 37° C for approximately 3 hours. The medium containing the test compound was then aspirated, the cells were washed three times with phosphate-buffered saline (PBS) at approximately 37° C, and fresh complete McCoy's 5a medium was added. The positive control was methylmethane sulf onate. The solvent control was dimethylsulfoxide (DMSO) diluted in culture medium. For assays using metabolic activation (see below) the activation mixture was also added to the solvent control. The cultures were then incubated for an additional time of approximately 12 hours before they were harvested. Colchicine (final concentration, 0.4 μg/ml) was added approximately 2.5 hours prior to the harvest. After approximately 2.5 hours in colchicine, the cells were harvested. Cells were removed from the surface of the flasks using a cell scraper. The resulting cell suspension was centrifuged, the supernatant aspirated and 4 ml of a hypotonic solution of 0.075 M KCl added to the cells for 15 minutes at approximately 37°C. The cells were then centrifuged, the supernatant aspirated, and the cells suspended in a fixative of methanol: acetic acid (3:1). After three changes of fixative, air-dried slides were prepared using cells from all flasks. The cell density and metaphase quality on the initial slide from each flask was monitored using a phase-contrast microscope; at least two slides of appropriate cell density were prepared from each flask. The slides were stained in 3% Giemsa for 20 min, rinsed in deionized water, and passed through xylene. Coverslips were mounted with Permount. Slides are then examined to determine what concentration of each test compound represented a toxic dose.

An analysis of the results showed that AMT was genotoxic at 30 μg/ml. In contrast, Compounds 2 and 6 were only genotoxic at 100 μg/ml, more than three times the toxic dose of AMT.

A psoralen compound with a structure distinct from compounds of the present invention, 8-aminomethyl-4,4',5'-trimethylpsoralen, was also tested in this experiment and proved to be toxic at 10 μg/ml. While the 8- substituted aminomethyl compound and similar structures may not be suited for methods of the present invention, they may be useful for alternative purposes. In light of the ability of the compounds to prevent nucleic acid replication, in combination with their extreme toxicity, the compounds could be used, for example, to treat diseases characterized by uncontrolled cell growth, such as cancer. 2) Micronucleus Assay Protocol

Saline solutions were prepared for Compounds 2, 6, 17 and 18 at various concentrations. Male Balb/c mice were then injected with 0.1 ml of a compound solution via the tail vein. At least 3 mice were injected per dose level. Saline only was used as a negative control. For a positive control, cyclophosphamide (cycloPP) was administered at a dose of 30 mg/kg. In the experimental group, the injections were repeated once per day for four days. In the positive control group, the sample was administered only once, on day three. On day 5, several microliters of blood were withdrawn from each subject and smeared on a glass slide. Cells were fixed in absolute methanol and stored in a slide rack. For analysis, cells were stained with acridine orange and visualized under a fluorescence microscope by counting: (ϊ) the number of reticulocytes per 5000 erythrocytes; and (ii) the number of micronucleated reticulocytes per 1000 reticulocytes. Reticulocytes were distinguished by their red fluorescence due to the presence of RNA. Micronuclei were distinguished by their green fluorescence due to the presence of DNA. The percentage of reticulocytes (%PCE) was then calculated. A decrease in the frequency of erythrocytes, represented by an increase in the percentage of reticulocytes, is an indication of bone marrow toxicity. The percentage of reticulocytes with micronuclei (%PCE with MN) was also calculated. An increase in %PCE with MN is a measure of clastogenicity.

After initial results were determined, the experiment was repeated using increased dose levels, until: (i) Micronucleus formation was seen; or (ii) Bone marrow toxicity was observed; or (ii) The lethal dose was reached; or (iv) A dose of 5 g/kg was administered. For the assays with each of the compounds 2, 6, 17 and 18, the acutely lethal dose was reached before there were any signs of bone marrow toxicity or micronucleus formation. The results of the experiment appear in Table 20, below. As is clear from the table, no bone marrow toxicity was observed for any of the compounds at the doses tested. The percent reticulocyte value for treatment with each compound remained close to the negative control value. This is in contrast with a drop of approximately 2-2.5% PCE/RBC seen in the positive control, representing erythrocyte depletion due to bone marrow toxicity. Nor did any of the compounds display clastogenic action.

TABLE 20

COMPOUND DOSE (mg/kg) PCE/RBC (%) PCE + MN (%) # duplicates

2 40 3.08 ± 0.82 0.20 ± 0.14 4

2 25 3.46 ± 0.32 0.25 ± 0.11 6

CycloPP 30 1.65 ± 0.64 1.98 ± 0.40 6 saline 3.49 ± 0.55 0.18 ± 0.13 6

6 45 3.79 ± 0.41 0.36 ± 0.14 3

6 30 3.61 ± 0.12 0.27 ± 0.38 3

17 45 5.7 ± 2.14 0.31 ± 0.07 3

17 30 3.47 ± 0.83 0.30 ± 0.17 3

CycloPP 30 0.99 ± 0.33 1.76 ± 0.64 3 saline 3.47 ± 0.44 0.23 ± 0.15 3

18 20 3.48 ± 0.79 0.17 ± 0.06 3

18 7.5 3.59 ± 0.33 0.43 ± 0.12 3

18 3.75 3.61 ± 1.14 0.17 ± 0.12 3

CycloPP 30 1.39 ± 0.41 2.09 ± 0..17 3 saline 3.31 ± 0.63 0.36 ± 0.11 3 EXAMPLE 20

This example demonstrates how the methods of the present invention work not only to inhibit of cytokine production, but also to inactivate blood- borne pathogens. In this case cell-associated Hr is inactivated using methods and conditions appropriate to inhibit cytokine production.

H9 cells chronically infected with HIVHΓB were used. (H9/HTLV-III-B NIH 1983 Cat.#400). Cultures of these cells were maintained in high glucose Dulbecco Modified Eagle Medium supplemented with 2 mM L-glutamine, 200 u/mL penicillin, 200 μg/ml streptomycin, and 9% fetal bovine serum (Intergen Company, Purchase, N.Y.) For maintenence, the culture was split once a week, to a density of 3 x 10^ to 4 x 10^ cells/ml and about four days after splitting, 3.3% sodium bicarbonate was added as needed. For the inactivation procedure, the cells were used three days after they were split. They were pelleted from their culture medium at 400 g x 10 minutes, the supernatant was discarded, and the cells were resuspended in one to five day old human platelet concentrate (PC) (pH 7.5-6.5), to a concentration of 2 x 10^ cells /ml. Aliquots of the PC-infected cell suspension were made for psoralen free dark controls, for sporalen free UVA only controls, for psoralen dark controls, and for the psoralen plus UVA experimental sample. Concentrated filter-sterilized stock solutions of each psoralen in water were diluted into the appropriate aliquots to yield a final concentration of 150 μM. (A 10 mM stock of Compound 18 was diluted about 67- fold and a 2 mM stock of Compound 2 was diluted about 13-fold). After an equilibration period of thirty minutes at room temperature, 0.5 ml of each of the dark controls was placed in a cryovial and stored in the dark at -80° C. For UVA illumination, 8 ml of the psoralen free aliquot and 8 ml of each psoralen containing aliquot were introduced into a modified FI 20 Teflon^M bag (modified to be 92 cm2 total surface area, The West Co., Phoenixvill, PA) via a plastic disposable 10 ml syringe attached to one of the polypropylne ports on the bag. This gave an average path length of 0.17 cm. The bags were then illuminated for a total exposure of 3 Joules/cm^ in the device described in Example 1, above, attached to a circulating refrigerating waterbath set at 4° C, which maintains the temperature in the bag at approximately 22-25° C. During exposure, the device was shaken on a platelet shaker (Helmer Labs, Noblesville, IN). After exposure, the contents of the bags were withdrawn by a fresh syringe through the remaining unused port on the bag, and placed in cryovials for storage in the dark at -80° C until analysis. The stored samples were thawed at 37° C, then titrated in an HIV microplaque assay, as described in Hanson, C.V., Crawford-Miksza, L. and Sheppard, H.W., J. Clin. Micro 28:2030 (1990), and as described in EXAMPLE 13, above, with the following modifications. Clot removal from each sample was performed before plating. Because plating of a target volume of 4 ml after clot removal was desired, an excess of sample (6 ml) was transferred to a polypropylene tube and diluted to a final volume of 60 ml with Test and control samples from the inactivation procedure were diluted in 50% assay medium and 50% normal human pooled plasma. The samples were serially diluted directly in 96-well plates (Corning Glass Works, Corning, N.Y.). The plates were mixed on an oscillatory shaker for 30 seconds and incubated at 37°C in a 5% Cθ2 atmosphere for 1 to 18 hours. MT-2 cells (0.025 mL) [clone alpha-4, available (catalog number 237) from the National Institutes of Health AIDS Research and Reference Reagent Program, Rockville, Md.] were added to each well to give a concentration of 80,000 cells per well. After an additional 1 hour of incubation at 37°C in 5% CO2, 0.075 mL of assay medium containing 1.6% SeaPlaque agarose (FMC Bioproducts, Rockland, maine) and prewarmed to 38.5°C was added to each well. The plates were kept at 37°C for a few minutes until several plates had accumulated and then centrifuged in plate carriers at 600 x g for 20 minutes in a centrifuge precooled to 10°C. In the centrifuge, cell monolayers formed prior to gelling of the agarose layer. The plates were incubated for 5 days at 37°C in 5% CO2 and stained by the addition of 0.05 mL of 50 μg/mL propidium iodide (Sigma Chemical Co.) in phosphate-buffered saline (pH 7.4) to each well. After 24 to 48 hours, the red fluorescence-stained microplaques were visualized by placing the plates on an 8,000 μW/cm^ 304 nm UV light box (Fotodyne, Inc., New Berlin, Wis.). The plaques were counted at a magnification of x20 to x25 through a stereomicroscope.

The results were as follows: Compound 2 (150 μM) inactivated >6.7 logs of HIV after 3 Joules /cm^ irradiation (compared to dark and light controls of 0 log inactivation, starting log titer 6.1 plaque forming units/ml). At the same concentration and irradiation time, Compound 18 inactivated >7.2 logs of HIV (compared to a dark control of 0 logs and a light control of .1 logs, starting titer 6.6). This example supports that the compounds of the present invention are effective in inactivating cell associated virus.

EXAMPLE 21

This example involves an assessment of new synthetic media formulations for use in methods of the present invention, as measured by the following in vitro platelet function assays: 1) maintenance of pH; 2) platelet aggregation ("Agg") and 3) GMP140 expression. The assays for each of these tests have been described above.

TABLE 21*

S 2.19 S 2.22 S 3.0 S 4.0

Na gluconate 23 0 0 0

Na acetate 27 20 20 20 glucose 0 2 2 2 mannitol 30 20 0 20

KCl 5 4 4 4

NaCl 45 80 100 90

Na3 citrate 15 15 10 10

Na phosphatt 20 20 20 20

MgCl₂ 0 3 2 2 Amounts in mM

Four formulations were prepared: S 2.19, S 2.22, S 3.0 and SAO. The composition of these synthetic media formulations are shown in Table 21.

One unit of human platelet rich plasma (PRP) was obtained from the Sacramento Blood Bank. The unit was centrifuged at room temperature for 6 minutes at 4000 rpm and then transferred to a unit press. Using an attached transfer line, plasma was expressed from the unit, leaving approximately 9.4 mis of residual plasma.

The unit was allowed to rest for 1 hour, after which it was gently kneaded to resuspend the platelets. To 0.6 ml of the suspension, 2.4 ml of plasma was added back and the entire contents transferred to a Teflon^M minibag. The reconstituted unit was assayed for pH and other tests the next day, with the following results:

The remaining unit was then used to evaluate synthetic media for platelet storage with and without photodecontamination. Aliquots (0.8 ml) from the unit were added to each formulation (3.2 mis) in tubes. 3 mis of each mixture was transferred to a Teflon^M minibag (final plasma concentration of 20%). Five days later, platelet function was assessed using the battery of tests described above. The results for each of the synthetic media formulations are shown in Table 22 below.

TABLE 22

It appeared that the synthetic media containing 2 mM glucose (i.e., S 2.22) maintained platelet function, as measured by GMP140 and Aggregation, better than the synthetic media that did not contain glucose (i.e., S 2.19).

To confirm the above finding, experiments were repeated ("n" being the number of replicate experiments) with these formulations as well as additional glucose-free formations (3.0 and 4.0). Platelet function was evaluated both before and after storage, and in conjunction with photodecontamination. A summary of the results is provided in Tables 4, 5 and 6 below.

TABLE 23

No UVA; Day 1 of Storage

TABLE 24

No UVA; Day 5 of Storage TABLE 25

3 Joules UVA; Day 5 of Storage

EXAMPLE 22

T-cells in platelet concentrates have been reported to cause tranfusion associated graft versus host disease (GVHD) in transfusion recipients. In this study we compared the relative efficacy of three psoralens to inactivate T- cells in a limiting dilution assay, bind to DNA, and inhibit amplification by the polymerase chain reaction (PCR).

To demonstrate the efficacy of photochemical treatment (PCT) to inactivate T-cells, this study was designed to define the dose /response kinetics of T-cell inactivation with PCT. Three experiments were carried out with pooled ABO matched random donor platelet concentrates (PC). The PC was adjusted to 35% plasma /65% synthetic media + phosphate (composition set forth at the beginning of the Experimental section). Thirty (30) ml samples were aliquoted into modified mini PL2410 (Baxter Healthcare Corp., Deerfield, IL) bags for photochemical treatment (PCT) with Compound 2, AMT and 8- MOP. UVA only, Compound 2 only, and untreated samples were also included in this study. Peripheral blood mononuclear cells (PBMCs) were re-isolated from the platelet concentrate samples using density gradient centrifugation methods using an IEC GP8R centrifuge (IEC, Needham Heights, MA). The frequency of clonable T-cells (viable T-cell/PBMC plated) in the PBMC sample was measured by limiting dilution analysis (LDA). These frequencies were used to calculate T-cell logio reduction after photochemical treatment. The logio reduction was plotted against the dose of psoralen for each experiment. In addition, experiments were carried out under similar conditions with tritiated AMT, 8-MOP and Compound 2. After PCT total leukocyte DNA was purified. The number of Compound 2 adducts /lOOObp was determined and polymerase chain reaction (PCR) inhibition was measured.

Platelet Concentrate Preparation:

Five freshly drawn ABO matched random donor platelet concentrates obtained from Sacramento Blood Center (Sacramento CA) were pooled into a sterile polystyrene flask. The platelet concentrate was transferred to sterile 50 ml centrifuge tubes in 30 ml aliquots and was centrifuged on a Sorvall RC-3B centrifuge (DuPont Instruments, Newtown, CT) at 3000g for 6 min. The plasma concentration was adjusted to 35%/ 65% synthetic media + phosphate by removing 65% of the total volume and replacing it with synthetic media and then resuspending the pelleted material.

Preparation and Addition of Psoralen Stock Solutions:

AMT (HRI Associates, Concord, CA), 8-MOP (Sigma, St. Louis, MO), and Compound 2 powder was dissolved in water and optically measured with a Shimadzu UV160U spectrophotmeter (Shimadzu Scientific Instruments, Pleasonton, CA). The concentration was calculated using the absorbance at 250 nm. and the extinction coefficient of 25000 M^cm-! for AMT, 22900 M" icm"¹ for 8-MOP, and 25400 M^cm^"1 for Compound 2. For the LDA experiments four 1: 10 serial dilutions of a 3.0 mM solution were made so that 50 -100 μl of the appropriate dilution could be added to 30 ml of the PC for a final concentration range of .0001-1.0 μM. Compound 2 was added to a sample at 1.0 μM but was not illuminated, for the "Compound 2 only" control in the first experiment. For the second experiment the "Compound 2 only" control had a final Compound 2 concentration of 0.05 μM. Additional samples were illuminated with 1.0 and 4.0 Joules/cm^ UVA but had no Compound 2, for the "UVA only" controls. For the PCR and nucleic acid binding experiments AMT, and Compound 2 were prepared as described above, but the low solubility of 8-MOP required it to be dissolved in DMSO to reach the desired concentrations.

UVA Illumination:

The platelet unit was illuminated in an illumination device with output and dimensions approximately equivalent to the device described in Example 1, while being mixed on a Helmer shaker (Helmer, Noblesville, IN) at 70 cycles/min.. The illumination device was air-cooled and capable of maintaining the temperature rise of the platelet concentrate to less than 1°C per Joule /cm^ during the course of the illumination. Each treated unit was irradiated separately for 1.0 Joule /cm^ for LDA experiments and 1.9 Joules /cm^ for PCR and DNA binding experiments.

Limiting Dilution Analysis (LDA)

This assay was performed using 96-well cell culture microtiter plates (VWR Scientific, Foster City, CA). Whole blood was drawn into two 10 ml ACD collection tubes (Rutheford, NJ) from 10 volunteers. The PBMCs were isolated by Ficoll (Sigma, St Louis, MO) density gradient, pooled, and stored in liquid nitrogen with 10% DMSO and 20% FBS.

On the day of each assay the allostimulators were thawed and washed with 0.2 μm sterile filtered "RPMI/20% FBS" which consisted of: RPMI 1640 (Mediatech, Herndon, VA) supplemented with 2.0 mM L-glutamine (Sigma, St Louis MO), 50 μg/ml Penecillin, 50 U/ml Streptomycin (Gibco Life Technologies, Baltimore, MD), 20% FBS. This was accomplished by diluting the contents of each 1.5 ml ampule into 10 ml of "RPMI/20% FBS", centrifuging the cells 10 min at 250 g on an IEC GP8R centrifuge (IEC,

Needham Heights, MA) and then resuspending all of the pellets in 10-15 ml of "RPMI/20% FBS". The cells were gamma-irradiated for 5000 cGy at the Alameda /Contra Costa Blood Bank using a Nordion Gamma Cell-1000 (Nordion Inc., Kanata, Ontario). Cells were transported on ice. After gamma-irradiation, the allostimulators were centrifuged and resuspended in

2X "T-cell medium" which was composed of: 80% "RPMI/20% FBS", 20% T- cell growth factor (TCGF, available from Cellular Products Inc., Buffalo NY), 100 U/ml recombinant IL-2 (Cellular Products Inc., Buffalo, NY), and 16 ug/ml Phytohemagglutanin-M (Sigma, St Louis, MO). The cells were then counted with the automated Sysmex F800 counter (Baxter, McGaw Park, IL) and 1.0 x 10^ cells in 100 μL of 2X "T-cell medium" per well were plated. For each dilution of each condition, 10 wells were plated. The plates were placed in a humidified 5% Cθ2 incubator Forma (Forma Scientific, Marietta, OH) at approximately 37 °C Control PBMCs (Untreated, "UVA only", and "Compound 2 only") were re-isolated from the platelet concentrate by density gradient centrifugation methods. In all experiments the untreated samples were diluted in "RPMI/20% FBS" and plated in the following concentrations: (300, 100, 33, 11, and 3.7 cells/well). Aliquots of 100 μL of each dilution were plated in ten replicates into wells containing 1.0 x 10^ allostimulators for quantifying the initial viable T-cell frequency. One row (10 wells) of allostimulators without any additional PBMCs was also plated to serve as allostimulator only controls. These wells received 100 μl of "RPMI/20% FBS." The 1.0 Joule/cm² and 4.0 Joules/cm² UVA only controls, were diluted in RPMI/20% FBS and 100 μl were plated in the following concentrations: (1000, 100, 10, cells/ well). The 1.0 μM and 0.05 μM "Compound 2 only" controls were plated in the following concentrations: (1000, 100, 10, cells/ well). Aliquots of 100 μL of each dilution were plated in ten replicates into wells containing 1.0 x 10^ allostimulators.

PBMCs were isolated from the 30.0 mL aliquots of platelet sample taken after 1.0 Joule /cm² UVA illumination. They were diluted with RPMI/20% FBS and aliquots of 100 μl were plated into 10 wells containing 1.0 x 10^s allostimulators in the following concentrations: (10^s, IO⁴, IO³, IO², 10¹, 100 cells/well).

Each plate was incubated in a Forma (Forma Scientific, Marietta, OH) humidified 5% CO2 incubator at approximately 37°C for 3 weeks. After three days, 1 week and 2 weeks, each well was fed with 25 μl of feed media consisting of the following ingredients: 50% FBS, 50% TCGF, 500 U/ml rIL-2, 80 μg/ml PHA-M.

Psoralen-DNA Adducts:

The extent of DNA modification following PCT was determined using

psoralens (HRI Associates, Concord C A). The specific radioactivity of the samples was approximately 5 mCi/mmol. WBCs prepared from Ficoll separation of a buffy coat were added to platelet concentrates to achieve elevated levels of WBCs. Psoralen stock solution was added to the platelet concentrates. Then the platelet concentrates were illuminated with 1.9 Joules/cm² UVA. The platelets and WBCs were separated from the plasma by centrifuging the samples at 10,000 rpm for 5 minutes at room temperature. The resulting pellet was suspended in extraction buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 0.01 mg/mL Proteinase K, 1.0 mg/ml RNAse) and incubated at room temperature overnight. DNA was isolated from the digest using phenol-chloroform extractions (2x), followed by a chloroform extraction, an ether extraction, and three ethanol precipitations. The ethanol precipitate was redissolved in 10 mM Tris pH 8.0, 100 mM NaCl, 1 mM EDTA between precipitation steps. The DNA content of each sample was determined by measurement of absorbency at 260 nm (1 O.D. unit = 50mg/mL). The level of psoralen adducts (shown in FIG. 18) were calculated from levels of residual radioactivity in the DNA samples determined by liquid scintillation counting.

PCR Inhibition:

PC samples with elevated levels of WBCs were treated with 1.9 Joules/cm² UVA plus one of the following compounds and concentrations: 10 μM, 100 μM, or 150 μM Compound 2; 150 μM AMT; or 75 or 150 μM 8- MOP. Other samples were treated with 2500 cGy gamma radiation as described above. DNA was extracted from the cellular material as previously described. 1.0 μg DNA samples were amplified with the following reaction conditions for HLA-DQa and B-globin sequences: 1.0 μg DNA in 10 ul H2O for each reaction; lx Taq Buffer (Perkin

Elmer, San Francisco, CA); 200 μM dNTP (Perkin Elmer, San Francisco, Ca); 2.5 U Taq Polymerase (Perkin Elmer, San Francisco, CA); Primers 0.5 μM (GH26, GH 27 for HLA-Dqa ; PC03, RS42 for B-globin, Midland, Midland, TX); Profile - 95 °c 30 seconds, 55°C 30 seconds, 72°C 1 minute; cycles - HLA- DQa 30 and 35 cycles, B-globin 27 and 31 cycles

All samples were amplified on a Perkin Elmer Cetus DNA thermal cycler (Perkin Elmer, San Francisco, CA) in 50 ul reaction volumes. 12 μl of each sample was mixed with 6 μ of 3x bromophenol blue (Sigma, St. Louis) running dye in 25% glycerol and run on a 2.5% NuSieve agarose gel (FMC bioproducts, Rockland, ME) in TBE with 0.5 ug/ml ethidium bromide at 100 volts. The gels were then photographed with an IS 1000 image analysis system (Alpha Innotech, Santa Clara, CA).

Results LDA Plates were scored visually after 3 weeks with an inverted compound microscope. Wells with at least one T-cell clone were scored positive. Wells without a T-cell clone were scored negative. The remaining T-cell frequencies were calculated by minimum chi-square analysis based on a Poisson distribution. The logio reduction for each of the conditions was calculated with the following formula and are shown in table 26, below: logio T-cell reduction = -[logio (treated / ^control)] Table 26

Exp. Psoralen Dose (μM) **Frequency Logio

# Reduction

Compound 2 Untreated 1/34 0.0

0.001 1/88 0.4

0.01 1/280367 3.9

0.1 0 4.5

1.0 0 4.5

0.0 (1 Joule/cm² ) 1/214 0.8

1.0 (Compound 2 only) 1/169 0.7

Compound 2 Untreated 1/81 0.0

0.0005 1/33 -0.4

0.001 1/88 0.0

0.005 1/44814 2.7

0.01 1/949124 4.1

0.05 0 4.1

0.0 (1 Joule/cm² ) 1/50 -0.2

0.0 (4 Joule/cm² ) 1/32 -0.4

.05 (Compound 2 only) 1/62 -0.1

AMT Untreated 1/21 0.0

0.001 μM 1/50 0.37

0.01 μM 1/67 0.5

0.1 μM 1/10913 2.7

1.0 μM 1/944124 4.65 8-MOP Untreated 1/19 0.0

0.01 μM 1/6 -.50

0.1 μM 1/1 -1.28

1.0 μM 1/1605 2.0

10.0 μM 0 4.3 viable T-cells /PBMC plated

In the four experiments performed, the viable T-cell frequencies of the untreated controls were 1/34, 1/88, 1/27 and 1/19. The UVA only and compound only controls reflected very minimal or no reduction in the number of viable T-cells.

The kinetic effect of T-cell viability as a function of Compound 2 concentration appears in Figure 17. In the first experiment 0.10 μM Compound 2 with 1.0 Joules /cm² left no detected viable T-cells, representing a logio reduction of >4.5. In the second experiment 0.05 μM Compound 2 with 1.0 Joules /cm² resulted in complete inactivation of T-cells, representing a reduction of >4.1 logs. AMT was approximately 10 times less effective in the inactivation of T-cells in platelet concentrates, requiring 1.0 μM with 1 Joule/cm² UVA to reduce the T-cell frequency to the limit of detection (4.65 logio)-

The psoralen-DNA adduct formation correlated with the T-cell inactivation data. (See Figure 18). Under equivalent conditions Compound 2>AMT>8-MOP in binding to leukocyte DNA. At 150 μM psoralen plus 1.9 Joules /cm² the number of adducts achieved were as follows: Compound 2 - 15/1000 bp; AMT - 7/1000 bp; and 8-MOP approximately 1/1000 bp.

PCR inhibition of HLA-DQa and B-globin also supported the T-cell inactivation data. With 35 cycles of amplification of HLA-DQa 150 μM Compound 2 plus 1.9 Joules/cm² resulted in > 3 logio inhibition while 150 μM AMT plus 1.9 Joules/cm² showed < 2 logio of PCR inhibition. None of the 8-MOP PCT treated samples showed greater than 1 logio inhibition. The larger B-globin amplicon resulted in greater inhibition overall, and comparable relative PCR inhibition among psoralens. 2500 cGy gamma radiation did not inhibit PCR amplification in any of the conditions tested, highlighting the benefits of PCT treatment compared to gamma irradiation as a method of inactivating T-cells.

All of the parameters in this study (LDA, psoralen-DNA adduct, and PCR inhibition) are in agreement with respect to level of relative biological and molecular inactivation achieved with AMT, 8-MOP and Compound 2 photochemical treatment under equivalent conditions. Compound 2 proved to be the most potent psoralen tested. The results suggest a preferred range of concentrations for the inactivation of T-cells of between .OOlμM of the psoralen compound and the psoralen's maximum solubility in an aqueous solution. Additionally, this study demonstrates that T-cells are inactivated with very low concentrations of psoralen. In light of the low mutagenicity and low psoralen concentrations necessary, PCT has a large safety margin compared to gamma irradiation with respect to its use for the prevention of transfusion associated graft versus host disease.

EXAMPLE 23

The last example offered in vitro evidence that T-cells are no longer capable of replicating after treatment by methods of the present invention. This example proposes an in vivo method of confirming the above described in vitro evidence that the methods of the present invention prevent TA GVHD and GVHD.

This is a prophetic example. While it is believed that the methods of the present invention will be effective to prevent GVHD and TA GVHD, this is a proposed experiment that has not yet been completed. This study will evaluate the ability of spleen cells treated by methods of the present invention to prevent TA GVHD in vivo. The immunological basis for this model relies on the recognition of donor homozygous major histocompatability complex antigens (MHC) H-2K^a as self by the recipient, but donor cell recognition of recipient cells which are MHC heterozygous H-2K^a/b as foreign. The approach to establish an in vivo model of TA-GVHD will focus on the use of immunocompetent mice. Strain A spleen cells will be infused into B6AF1 hybrid recipients.

This model will also be used to investigate the minimum psoralen and illumination dose required to achieve prevention of TA-GVHD for the purpose of defining the margin of safety for transfusion of blood products such as platelet concentrates. Spleen cells from Strain A mice will be harvested and pooled.

Approximately 1.0 x 10^ spleen cells in PBS (phosphate buffered saline) will be injected into the tail vein of B6AF1 recipients. Injection of B6AF1 cells into B6AF1 recipients will serve as negative controls. The cells will be treated with 150 μM of a psoralen compound plus 1.1 J/cm² UVA in 3 mL experimental blood bags. The cells will then be pelleted resuspended in PBS and injected into the B6AF1 recipients. The following assays will be performed on the spleen cells from recipients of treated and untreated spleen cells.

SlChromium Lysis Assay The spleens from recipient mice (Effector cells) will be harvested and tested for their ability to lyse 5lQ- radiolabeled EL4 cells (Target Cells). 51Q- radiolabeled EL4 cells will be incubated with effector cells in 200 μl in 96-well plates with the following Effector/Target cell ratios; 150:1, 75:1, 37.5:1, 18.75:1. The amount of SlCr released into the culture supernatant has been correlated with the severity of GVHD. After 4 hours of incubation at 37°C 5% CO2 100 μl will be removed from each sample and counted with a gamma counter. The amount of chromium lysis mediated by spleen cells of recipient mice will be compared to the negative control (amount released spontaneously) and the positive control (maximum amount released by adding 2M HCl to EL4 cells.)

Monitoring Engraf tment of Donor T-cells

The engraftment of donor spleen cells in the recipients will be monitored using fluorescence labeled antibodies (commercially available from Pharmingen, San Diego, CA, catalogue numbers AF6-88.5, AF3 12.1) specific for leukocytes of each strain, and a flow cytometer. Recipient spleens will be harvested at one, two and four weeks after injection of donor spleen cells. FITC conjugated antibodies specific to each strain will be incubated with 1.0 x 10°^" of the spleen cells followed by washing. The cells will then be analyzed with a flow cytometer. If engraftment has occurred two distinct populations of fluorescing cells will be present. If engraftment has not occurred only one population will be present.

Mitogen Stimulated Cytokine Release Spleen cells from mice that have GVHD have been demonstrated to secrete abnormally high levels of cytokines. IFN-g and IL-2 are potent cytokines that are an integral factor in the GVH reaction. Spleen cells from recipient mice will be tested for their ability to secrete IF-N-g and IL-2 upon mitogen stimulation. Recipient spleen cells will be harvested and 1.25 x 106/mL will be stimulated with 5 μg/mL Con A overnight. The presence of elevated levels of IFN-g and IL-

2 will be assessed by ELISA.

Clinical Symptoms of GVHD

Clinical symptoms of runting, cutaneous lesions and ruffled fur will be noted. Weekly whole blood samples will be collected by retro-orbital venipuncture to monitor complete blood counts. Because weight loss has been reported to be a sensitive measurement of GVHD in vivo mice will be weighed weekly. Upon sacrifice of animals for subsequent biochemical analysis of spleen cells, any internal pathology will also be noted. In the case that death of an infused animal occurs before spleen cells are harvested an animal autopsy will be performed to determine if death was due to GVHD. All of these parameters will be used to evaluate the efficacy of PCT to prevent GVHD. It is to be understood that the invention is not to be limited to the exact details of operation or exact compounds, composition, methods, or procedures shown and described, as modifications and equivalents will be apparent to one skilled in the art. All patents and references described are hereby incorporated by reference.

Particularly, the entirety of U.S. Patent No. 5,399,719, to Wollowitz, is hereby incorporated by reference.

Claims

CLAIMSWe claim:

1. A method of inhibiting cytokine production in blood preparations suspected of containing cells capable of producing cytokines, comprising the steps of: a) providing, in any order, i) a psoralen; ii) photoactivating means for photoactivating said psoralen; and iii) said blood preparation; b) adding said psoralen to said blood preparation; c) photoactivating said psoralen under conditions such that the production of cytokines from said cells is inhibited, wherein said cells are inhibited from producing cytokines, so as to create a treated blood preparation; and d) storing said treated blood preparation.

2. The method of Claim 1, wherein said blood preparation comprises platelets.

3. The method of Claim 2, wherein said platelets comprise pooled platelets.

4. The method of Claim 3, wherein said pooled platelets are stored for at least 4 hours prior to in vivo use.

5. The method of Claim 2, wherein said platelets are in a synthetic media.

6. The method of Claim 5, wherein said synthetic media is added to said platelets such that said platelets are suspended in mixture having a residual plasma concentration between approximately 8 and 40% by volume.

7. The method of Claim 1, wherein said photoactivating means comprises a photoactivation device capable of emitting a given intensity of a spectrum of electromagnetic radiation comprising wavelengths between 320 nm and 400 nm.

8. The method of Claim 7, wherein said intensity is between 1 and 30 mW/cm².

9. The method of Claim 8, wherein said blood preparation is exposed to said intensity for between 1 second and thirty minutes.

10. The method of Claim 1, wherein said psoralen is added to said blood preparation at a concentration of between 1 and 500 μM.

11. The method of Claim 10, wherein said psoralen is added to said blood preparation at a concentration of between 10 and 150 μM.

12. The method of Claim 1, wherein said psoralen comprises a 4'- primaryamino-substituted psoralen.

13. The method of Claim 1, wherein at least two of said psoralens are present.

14. The method of Claim 1, wherein said psoralen is in a solution comprising water, saline, or a synthetic media prior to adding said psoralen to said blood preparation.

15. The method of Claim 1, wherein said cells comprise lymphocytes.

16. The method of Claim 15, wherein prior to step (b) said lymphocytes comprise white blood cells at a minimum concentration of 1x10^ cells/ml.

17. A method of inhibiting cytokine production in a platelet preparation suspected of containing cells capable of producing cytokines, comprising the steps of: a) providing, in any order, i) a psoralen in a phosphate buffered, aqueous salt solution; ii) photoactivating means for photoactivating said psoralen; and iii) a platelet preparation containing plasma; b) removing a portion of said plasma from said platelet preparation and adding said solution to said platelets such that said platelets are suspended in mixture having a residual plasma concentration between approximately 8 and 40% by volume; c) activating said psoralen in said mixture with said photoactivating means under conditions such that the production of cytokines from said cells is inhibited so as to create a treated platelet preparation, wherein said cells are inhibited from producing cytokines; and d) storing said treated platelet preparation.

18. The method of Claim 17, wherein said solution further comprises sodium acetate and sodium citrate.

19. The method of Claim 17, wherein said means for activating comprises a photoactivation device capable of emitting a given intensity of a spectrum of electromagnetic radiation comprising wavelengths between 320 nm and 400 nm.

20. The method of Claim 19, wherein said intensity is between .1 and 25 mW/cm².

21. The method of Claim 20, wherein said mixture is exposed to said intensity for between one and ten minutes.

22. The method of Claim 17, wherein said psoralen is 8- methoxypsoralen.

23. The method of Claim 17, wherein said psoralen is 4'-(4-amino-2- oxa)butyl-4,5',8-trimethylpsoralen.

24. The method of Claim 17, wherein said cells comprise lymphocytes.

25. The method of Claim 24, wherein prior to step (b) said lymphocytes comprise white blood cells at a minimum concentration of 1x10^ cells /ml.

26. The method of Claim 17, wherein said platelet preparation comprises pooled platelets.

27. The method of Claim 26, wherein said pooled platelets are stored for at least 4 hours in step (d).

28. A method of inhibiting cytokine production in pooled platelets suspected of containing cells capable of producing cytokines, comprising the steps of: a) providing, in any order, i) a psoralen in a phosphate buffered, aqueous salt solution; ii) photoactivating means for photoactivating said psoralen; and iii) pooled platelets containing plasma; b) removing a portion of said plasma from said pooled platelets and adding said solution to said pooled platelets such that said pooled platelets are suspended in mixture having a residual plasma concentration between approximately 8 and 40% by volume; and c) activating said psoralen in said mixture with said photoactivating means under conditions such that the production of cytokines from said cells is inhibited so as to create a treated pooled platelet preparation, wherein said cells are inhibited from producing cytokines; and d) storing said treated pooled platelet preparation.

29. The method of Claim 28, wherein said solution further comprises sodium acetate and sodium citrate.

30. The method of Claim 28, wherein said photoactivating means comprises a photoactivation device capable of emitting a given intensity of a spectrum of electromagnetic radiation comprising wavelengths between 320 nm and 400 nm.

31. The method of Claim 30, wherein said intensity is between .1 and 25 mW/cm².

32. The method of Claim 31, wherein said mixture is exposed to said intensity for between one and ten minutes.

33. The method of Claim 28, wherein said psoralen is 8- methoxypsoralen.

34. The method of Claim 28, wherein said psoralen is 4'-(4-amino-2- oxa)butyl-4,5',8-trimethylpsoralen.

35. The method of Claim 28, wherein said cells comprise lymphocytes.

36. The method of Claim 35, wherein prior to step (b) said lymphocytes comprise white blood cells at a concentration greater than 1x10^ cells /ml.

37. The method of Claim 28, wherein said pooled platelets are stored for at least 4 hours in step (d).

38. A method of inhibiting cytokine production in platelet preparations for transfusion, suspected of containing lymphocytes capable of producing cytokines, comprising the steps of: a) providing, in any order, i) a phosphate buffered, aqueous salt solution comprising 4'-(4-amino-2-oxa)butyl-4,5',8-trimethylpsoralen at a concentration between approximately 1 μg/ml and 300 μg/ml; ii) photoactivating means for photoactivating said 4'-(4- amino-2-oxa)butyl-4,5',8-trimethylpsoralen; and iii) a platelet preparation comprising platelets and plasma; b) removing a portion of said plasma from said platelet preparation and adding said solution to said platelets such that said platelets are suspended in mixture having a residual plasma concentration between 8 and 25% by volume; and c) activating said 4'-(4-amino-2-oxa)butyl-4,5',8-trimethylpsoralen in said mixture with said photoactivating means, such that the production of cytokines from said lymphocytes is inhibited so as to create a treated platelet preparation, wherein said lymphocytes are inhibited from producing cytokines; and d) storing said treated platelet preparation.

39. The method of Claim 38, wherein said solution further comprises sodium citrate and sodium acetate.

40. The method of Claim 38, wherein said means for activating comprises a photoactivation device capable of emitting a given intensity of a spectrum of electromagnetic radiation comprising wavelengths between 320 nm and 400 nm.

41. The method of Claim 38, wherein said platelet preparation comprises pooled platelets.

42. The method of Claim 38, wherein prior to step (b) said lymphocytes comprise white blood cells at a minimum concentration of 1x10^ cells/ml.

43. A method of inhibiting protein expression by leukocytes in a blood preparation, comprising the steps of: a) providing, in any order, i) a psoralen; ii) photoactivating means for photoactivating said psoralen; and iii) said blood preparation; b) adding said psoralen to said blood preparation; c) photoactivating said psoralen under conditions such that the protein expression from said leukocytes is inhibited, so as to create a treated blood preparation; and d) storing said treated blood preparation.

44. A method of inactivating leukocytes in blood preparations, comprising the steps of: a) providing, in any order, i) a psoralen; ii) photoactivating means for photoactivating said psoralen; and iii) said blood preparation suspected of containing leukocytes; b) adding said psoralen to said blood preparation; c) photoactivating said psoralen under conditions such that leukocytes in said blood preparation are inactivated.

45. The method of Claim 44, wherein said blood preparation comprises platelets.

46. The method of Claim 45, wherein said platelets comprise pooled platelets.

47. The method of Claim 45, wherein said platelets are selected from the group consisting of buffy coat platelets and platelet rich plasma.

48. The method of Claim 45, wherein said platelets are in a synthetic media.

49. The method of Claim 48, wherein said synthetic media is added to said platelets such that said platelets are suspended in mixture having a residual plasma concentration between approximately 8 and 40% by volume.

50. The method of Claim 44, wherein said photoactivating means comprises a photoactivation device capable of emitting a given intensity of a -ill- spectrum of electromagnetic radiation comprising wavelengths between 320 nm and 400 nm.

51. The method of Claim 50, wherein said intensity is between 1 and 30 mW/cm².

52. The method of Claim 51, wherein said blood preparation is exposed to said intensity for between 1 second and thirty minutes.

53. The method of Claim 44, wherein said psoralen is added to said blood preparation at a concentration of between .01 and 500 μM.

54. The method of Claim 53, wherein said psoralen is added to said blood preparation at a concentration of between 1 and 150 μM.

55. The method of Claim 44, wherein said psoralen comprises a 4'- primaryamino-substituted psoralen.

56. The method of Claim 44, wherein at least two of said psoralens are present.

57. The method of Claim 44, further comprising, following step c), infusing an immunocompromised patient with said blood preparation.

58. The method of Claim 44, wherein said lymphocytes comprise T- cells.

59. The method of Claim 58, wherein, prior to step b), said T-cells are present at a concentration greater than 1x10^ cells /ml.

60. A method of inactivating T-cells in platelet preparations, comprising the steps of: a) providing, in any order, i) a phosphate buffered, aqueous salt solution and an aminopsoralen; ii) photoactivating means for photoactivating said aminopsoralen; and iii) a platelet preparation; b) removing said plasma from said platelet preparation and adding said solution to said platelets such that said platelets are suspended in mixture having a residual plasma concentration between approximately 8 and 40% by volume; and c) activating said aminopsoralen in said mixture with said photoactivating means under conditions such that the proliferation of T-cells is inhibited so as to create a treated blood preparation.

61. The method of Claim 60, wherein said solution further comprises sodium acetate and sodium citrate.

62. The method of Claim 60, wherein said means for activating comprises a photoactivation device capable of emitting a given intensity of a spectrum of electromagnetic radiation comprising wavelengths between 320 nm and 400 nm.

63. The method of Claim 62, wherein said intensity is less than 25 mW/cm².

64. The method of Claim 63, wherein said mixture is exposed to said intensity for between one and ten minutes.

65. The method of Claim 60, wherein said aminopsoralen is 4'-(4- amino-2-oxa)butyl-4,5',8-trimethylpsoralen.

66. The method of Claim 60, wherein after step c) said T-cells are inhibited from replicating.

67. The method of Claim 60, wherein said T-cells are inhibited from producing proteins.

68. The method of Claim 67, wherein said T-cells are present at a concentration greater than 1x10^ cells/ml.

69. The method of Claim 60, wherein said platelet preparation comprises pooled platelets.

70. The method of Claim 69, wherein said pooled platelets are stored for at least 4 hours.