WO1996038483A1 - Monoclonal and polyclonal antibodies against recombinant human xanthine oxidase, method for their use and a kit containing same - Google Patents

Monoclonal and polyclonal antibodies against recombinant human xanthine oxidase, method for their use and a kit containing same Download PDF

Info

Publication number
WO1996038483A1
WO1996038483A1 PCT/US1996/008173 US9608173W WO9638483A1 WO 1996038483 A1 WO1996038483 A1 WO 1996038483A1 US 9608173 W US9608173 W US 9608173W WO 9638483 A1 WO9638483 A1 WO 9638483A1
Authority
WO
WIPO (PCT)
Prior art keywords
oxidase
xanthine
antibody
xanthine dehydrogenase
human
Prior art date
Application number
PCT/US1996/008173
Other languages
French (fr)
Inventor
Dale Allen Parks
Henry Bradford Skinner
Kelly Ann Skinner
Original Assignee
The University Of Alabama At Birmingham Research Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The University Of Alabama At Birmingham Research Foundation filed Critical The University Of Alabama At Birmingham Research Foundation
Priority to AU64757/96A priority Critical patent/AU6475796A/en
Publication of WO1996038483A1 publication Critical patent/WO1996038483A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/40—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/573—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/902—Oxidoreductases (1.)
    • G01N2333/904—Oxidoreductases (1.) acting on CHOH groups as donors, e.g. glucose oxidase, lactate dehydrogenase (1.1)

Definitions

  • the present invention relates generally to the fields of enzymology and protein chemistry. More specifically, the present invention relates to the development of monoclonal and polyclonal antibodies to localize and quantify xanthine oxidase in tissues and biological fluids and uses thereof.
  • Noncatalytic plasma antioxidants such as urate, ascorbate, a-tocopherol, bilirubin and protein sulfhydryls are also crucial in minimizing oxidant-induced tissue injury.
  • the oxidant scavenging capacity of non-catalytic antioxidants has been examined using lipid hydroperoxides, H2 O 2 an d hypochlorous acid. Exposure of human plasma to oxidants, such as generated during a number of pathologic processes, results in the temporal disappearance of essential plasma antioxidants, decreasing the total radical antioxidant potential of tissues, thereby rendering the tissues more susceptible to oxidant-induced injury.
  • oxidation products of uric acid, ascorbate, a- tocopherol are also excellent indices of excess tissue production of oxidants. Since most tissue oxidant production is intracellular or at the cell surface, it may be beneficial to target antioxidant interventions at or near the site of production of oxidants. It is critical to scavenge oxidants in close apposition to sites of production, because their high reactivity limits its diffusional distance.
  • Xanthine dehydrogenase (xanthine dehydrogenase, XDH, xanthine:NAD+ oxidoreductase, EC 1.1.1.204) is a complex molybdenum hydroxylase that catalyzes the hydroxylation of hypoxanthine and xanthine to uric acid with the concomitant reduction of NAD+ to NADH.
  • the enzyme is a dimer comprised of two identical and independent subunits, each with a molecular radius (Mr) of approximately 150,000 daltons (150 kDa). Each subunit contains one molybdopterin, two non-identical iron sulfur centers, and a flavin adenine dinucleotide.
  • xanthine dehydrogenase can be converted to oxygen-dependent form, xanthine oxidase (xanthine oxidase, XO, xanthineroxygen oxidoreductase, EC 1.1.3.22). Oxidation of essential thiol groups of xanthine dehydrogenase results in conversion xanthine oxidase by a mechanism which is both rapid, and reversible. Xanthine dehydrogenase can also be converted into xanthine oxidase more slowly, and irreversibly, through limited proteolysis.
  • the xanthine oxidase form produces reactive oxygen metabolites, including superoxide (02") and hydrogen peroxide (H2O2) which have been demonstrated to be responsible for much of the tissue injury associated with ischemia-reperfusion injury, hemmorrhage, inflammation, acute viral infections, thermal injury numerous hepatic disorders and the acute lung injury associated with adult respiratory distress syndrome.
  • superoxide 02
  • hydrogen peroxide H2O2
  • the significance of xanthine oxidase as a mediator of tissue damage has often been minimized since many human tissues, including human heart and lung, have very low endogenous xanthine dehydrogenase or xanthine oxidase activity.
  • xanthine dehyrogenase is relatively slow in tissues, often of longer duration than the ischemic episode.
  • xanthine oxidase is currently under reevaluation since the observation that xanthine oxidase activity is markedly increased in the plasma of patients after a number of pathologic processes (i.e., ischemia-reperfusion injury, sepsis, burns, acute viral infection, hemorrhagic shock and a number of pathologies which result in hepatocellular damage) and certain surgical procedures (i.e., liver transplantation and thoracic aorta occlusion).
  • pathologic processes i.e., ischemia-reperfusion injury, sepsis, burns, acute viral infection, hemorrhagic shock and a number of pathologies which result in hepatocellular damage
  • certain surgical procedures i.e., liver transplantation and thoracic aorta occlusion.
  • Tissues or cell types rich in this enzyme activity e.g., liver and intestine, appear to be significant sources of the circulating xanthine dehydrogenase + oxidase activity.
  • the circulating xanthine oxidase is associated with damage to tissues thoughout the body, including the lungs and heart. The damage may either be a result of the generation of cytotoxic oxygen metabolites or indirectly due to activation of inflammatory cells and other inflammatory mediators (e.g., cytokines).
  • xanthine degydrogenase Once xanthine degydrogenase appears in the circulation, it is rapidly and reversibly converted to xanthine oxidase, such that xanthine dehydrogenase is almost completely converted to xanthine oxidase within 1 minute of ischemia or hypoxia.
  • the rapidity and reversibility of the conversion of xanthine dehydrogenase to xanthine oxidase in plasma means that the potential for formation of oxidants would be best approximated by the combination of both xanthine dehydrogenase and xanthine oxidase forms (XDH+XO). Therefore, methods for detection of oxygen radical producing potential from xanthine oxidase should recognize both XDH and XO.
  • the 130 kDa product exhibits xanthine oxidase activity, has altered NAD + binding or function which is NAD+ independent, and a 70% reduction in the number of reactive sulfhydryl groups. It is suggested that the NAD+ binding site exists in the amino terminal end of the enzyme and that NA D + binding can be altered by either thiol oxidation or limited proteolysis to produce xanthine oxidase..
  • antibodies must be produced that recognize the carboxy-terminal portion of the polypeptide which is common to both xanthine dehydrogenase and xanthine oxidase in order to measure both xanthine dehydrogenase and xanthine oxidase in biological samples.
  • Literature regarding the localization and relative quantification of xanthine dehydrogenase/oxidase using xanthine dehydrogenase/oxidase antibodies is being re-evaluated in light of some recent observations. It is generally accepted that the liver and intestine have the greatest xanthine dehydrogenase/oxidase specific activity. Vascular endothelium throughout the body is also reported to be enriched in xanthine dehydrogenase/oxidase relative to other tissues. Epithelial cells, including that of the liver and intestine, have minimal xanthine dehydrogenase/oxidase using anti-xanthine dehydrogenase/oxidase antibodies.
  • the antiserum raised against the putatively pure xanthine dehydrogenase/oxidase also cross reacts with IgG, IgA and IgM, making quantification and localization of xanthine dehydrogenase/oxidase imprecise and unreliable.
  • Preparation of a antibody against a recombinant human xanthine dehydrogenase/oxidase circumvents these limitations and represents a significant advance in the art.
  • kits for immunodection comprising: a container means; a first monoclonal antibody that specifically binds to human xanthine dehydrogenase/oxidase; and an immunodetection reagent.
  • kits for immunodection comprising: a container means; a first monoclonal antibody that specifically binds to human xanthine oxidase; a second monoclonal antibody that specifically binds to human xanthine oxidase; and an immunodetection reagent.
  • the immunodetection reagent is a detectable label linked to said second antibody.
  • a method of preparing a monoclonal antibody to human xanthine oxidase comprising the steps of:
  • identifying a monoclonal antibody from said hybridoma that recognizes human xanthine dehydrogenase and human xanthine oxidase identifying a monoclonal antibody from said hybridoma that recognizes human xanthine dehydrogenase and human xanthine oxidase.
  • a method of determining the amount of xanthine dehydrogenase/oxidase in a biological sample comprising: contacting said sample with a first monoclonal or polyclonal antibody that specifically binds to human xanthine dehydrogenase/oxidase under conditions to allow the formation of immune complexes; and detecting the immune complexes formed.
  • Figure 1 shows xanthine dehydrogenase+oxidase is increased in radial artery samples in human liver transplant patients with 24 hr post-transplant AST>1000, compared to group with AST lOOO, p ⁇ 0.05.
  • Figure 2 shows that xanthine dehydrogenase+oxidase is increased in artery samples in aortic occlusion compared to shams, p ⁇ 0.05.
  • Tungstate diet results in abolition of xanthine dehydrogenase+oxidase, difference from sham, p ⁇ 0.05.
  • Figure 3 shows that the massive release of xanthine dehydrogenase+oxidase into effluent from liver following ischemia- reperfusion.
  • Allopurinol an inhibitor of xanthine dehydrogenase+oxidase, resulted in significantly less release of enzyme, p ⁇ 0.05.
  • Figure 4 shows the bronchoalveolar lavage (BAL) xanthine dehydrogenase+oxidase increases following aortic occlusion compared to sham, p ⁇ 0.05.
  • Tungstate an inactivator of xanthine dehydrogenase+oxidase pre-Rx prevents this increase in the BAL.
  • Figure 5 shows that tissue xanthine dehydrogenase+oxidase decreases in liver but increases in non- ischemic lung after liver ischemia-reperfusion. Allopurinol pre-Rx abolished the changes.
  • Figure 6 shows that increasing xanthine dehydrogenase+oxidase with increasing hypoxia in isolated hepatocytes, p ⁇ 0.05. At 4h+2h H/R, trend towards increased release.
  • Figure 7 shows that ischemia associated with hemorrhagic shock does not result in detectable circulating xanthine dehydrogenase/ oxidase unless rats pre-treated with heparin.
  • Figure 8 shows the purification and elution of xanthine dehydrogenase.
  • Figure 8A depicts the molecular weight standards.
  • Figure 8B represents the total protein from the cell lysate.
  • Figure 8C depicts 1 microliter of the dialysate pelletable fraction containing purified xanthine dehydrogenase/oxidase.
  • Figure 9 shows that the recombinant xanthine dehydrogenase/oxidase fusion protein was resolved by SDS-PAGE, transferred to nitrocellulose membrane and probed with mouse anti- xanthine dehydrogenase/oxidase sera at dilutions of 1 :66, 1 :200, 1:500, and 1:1000 (lanes A-D respectively).
  • a 1:66 dilution of mouse sera prepared prior to injection of the recombinant xanthine dehydrogenase/oxidase antigen was used to probe an identical blot (lane E).
  • the present invention is encompasses the development of monoclonal and polyclonal antibodies that specifically bind to human xanthine oxidase.
  • the antibody is linked to a detectable label.
  • hybridomas that produce monoclonal antibodies that specifically bind to human xanthine oxidase.
  • the present invention is also directed to a kit for immunodetection, comprising: a container means; a first monoclonal antibody that specifically binds to human xanthine oxidase; and an immunodetection reagent.
  • the present invention provides a kit for immunodection, comprising: a container means; a first monoclonal antibody that specifically binds to human xanthine oxidase; a second monoclonal antibody that specifically binds to human xanthine oxidase; and an immunodetection reagent.
  • the immunodetection reagent is a detectable label linked to said second antibody.
  • the present invention is also directed to a method of preparing a monoclonal antibody to human xanthine oxidase, comprising the steps of: (a) expressing specific portions of human xanthine dehydrogenase/oxidase in E.coli; (b) purifying recombinant fragments; (c) introducing recombinant fragments as antigen; (d) fusing splenocytes to a myelenoma cell to form a hybridoma; and (e) identifying a monoclonal antibody from said hybridoma that recognizes human xanthine dehydrogenase and human xanthine oxidase.
  • the portion of the carboxy terminus of human xanthine dehydrogenase/oxidase enzyme used is from about the first 30 codons to about the first 400 codons. Most preferably, the portion of the carboxy terminus of human xanthine dehydrogenase/oxidase enzyme is about the first 358 codons.
  • the vector is E. coli. Representative host animals include rabbit and mouse.
  • the present invention is also directed to a method of determining the amount of xanthine oxidase in a biological sample, comprising: contacting said sample with a first monoclonal antibody that specifically binds to human xanthine oxidase under conditions to allow the formation of immune complexes; and detecting the immune complexes formed.
  • the biological sample is a blood sample but could include any biologic sample such as blood, plasma, serum and urine.
  • an antibody is linked to a detectable label and the immune complexes are detected by detecting the presence of said label.
  • the present invention is also directed to providing a method to use monoclonal antibodies to specifically bind to human xanthine dehydrogenase/oxidase and thereby decrease the specific activity of the enzyme in tissues and biologic fluids.
  • the present invention is also includes a method of using monoclonal or polyclonal antibodies to immunolocalize, at light and electron microscopic levels, xanthine dehydrogenase/oxidase in cells or tissues.
  • Further uses of the novel monoclonal antibody of the present invention include addition of the antibody to the preservation fluid used to preserve organs after extirpation prior to transplantation. Further uses of the antibody would include administration to the donor of the transplanted organ is also contemplated.
  • a region of the human xanthine dehydrogenase/oxidase coding sequence from a cDNA library was amplified by polymerase chain reaction (PCR) using oligodeoxynucleotides specific for xanthine dehydrogenase/oxidase.
  • the xanthine dehydrogenase/oxidase region amplified corresponds to the 358 carboxy-terminal codons that are common to both xanthine dehydrogenase and xanthine oxidase.
  • the xanthine dehydrogenase/oxidase PCR product was cloned into the E. coli expression vector pQE32 and the recombinant construct named pDP4. DNA sequence analysis demonstrated that the xanthine dehydrogenase/oxidase PCR product cloned into pQE32 matched exactly the reported human xanthine dehydrogenase/oxidase sequence.
  • the xanthine dehydrogenase/oxidase fusion protein was purified from E. coli lysates to near homogeneity by affinity chromatography on NiNTA-agarose under denaturing conditions, precipitated, lyophilized and stored at -80°C. The purified xanthine dehydrogenase/oxidase was injected into mice and rabbits for production of both monoclonal and polyclonal antibodies.
  • Immunoreactive species were identified by colorimetric development following incubation with horseradish peroxidase- conjugated goat anti-mouse IgG. A unique specific signal was observed for all dilutions of the anti-xanthine dehydrogenase/oxidase sera that corresponds to the recombinant xanthine dehydrogenase/oxidase fusion product as identified by staining of total protein. Pre-immune serum failed to recognize xanthine dehydrogenase/oxidase.
  • Antibodies were raised to a recombinant polypeptide expressed in the bacterium E. coli composed of the carboxy-terminal 358 amino acids of the human xanthine dehydrogenase fused to a short leader peptide that contains a hexahistidine motif.
  • the hexahistidine motif allows for the rapid purification of the recombinant polypeptide from E. coli that express this protein.
  • Using the purified recombinant xanthine dehydrogenase protein as antigen antibodies have been raised in mice and rabbits that specifically recognize human xanthine dehydrogenase.
  • Anti-xanthine dehydrogenase monoclonal antibodies were isolated that recognize native xanthine dehydrogenase, denatured xanthine dehydrogenase or both.
  • the first oligo- deoxynucleotide designated xanthine oxidase-5 -Bcl I, (TGGTGATCATGGCCATGTCTTCCTACTCCTTGAGG) was specific for nucleotides 2,936 through 2,961 of the human xanthine dehydrogenase mRNA and contained the recognition sequence for the restriction endonuclease Bel I (bold).
  • the second oligo- deoxynucleotide named xanthine oxidase-3 -Sal I, (TAAGTCGACGATGGGTACATTCCAAGGAACGTAGG) was specific for nucleotides 4,008 through 3,983 of the human xanthine dehydrogenase mRNA and contained the recognition sequence for the restriction endonuclease Sal I (bold).
  • restriction endonuclease sequences were included to facilitate the cloning of the xanthine oxidase amplified sequence.
  • Amplification of the xanthine dehydrogenase sequence was performed with 100 ng of each oligo-deoxynucleotide, 1x10? lambda phage containing clones of human liver cDNAs, buffer and the thermal-stable DNA polymerase Taq.
  • the PCR reaction conditions were: 94°C for 1 minute followed by 52°C for 45 seconds followed by 72°C for 1 minute, these conditions were repeated 27 times and terminated with a 10 minute incubation at 72°C.
  • a fraction of the PCR reaction was analyzed by agarose gel electrophoresis, stained with ethidium bromide and visualized under ultraviolet light. A single DNA band was observed that was estimated to be 1,100 nucleotides long as judged by migration through the agarose gel relative to DNA of known size.
  • the DNA generated by the PCR reaction was digested with the restriction endonucleases Bel I and Sal I, electrophoresed through an agarose gel, stained with ethidium bromide and visualized with ultraviolet light.
  • the 1,100 base pair DNA fragment was purified from the agarose gel.
  • the purified digested DNA was cloned into the E. coli vectors pTZ18U and pQE32 that had been digested with the restriction endonucleases Bam HI and Sal I.
  • the nucleotide sequence of the DNA cloned into the pTZ18U vector was determined.
  • the plasmid containing the human xanthine dehydrogenase sequences cloned into the pQE32 vector was named pDP4.
  • E. coli, strain KK2186, carrying the pDP4 plasmid were cultured in 1 liter of rich media containing 100 mg/liter ampicillin for several hours until the optical density measured at 595 nanometers reached 0.7.
  • the E. coli were induced to express the recombinant xanthine oxidase/xanthine dehydrogenase by the addition of isopropylthiogalactoside (IPTG) to the growth media at a final concentration of 1 mM.
  • IPTG isopropylthiogalactoside
  • the E. coli were then cultured for an additional 12 to 16 hours to maximize the production of the recombinant xanthine oxidase.
  • E. coli induced to express the recombinant xanthine oxidase were collected from the culture media by centrifugation and washed in sterile water. The washed cells were solubilized for 1 hour at 25 °C in 6 M Guanidine hydrochloride buffered to pH 8.0 with 100 mM sodium phosphate and 10 mM Tris hydrochloride. The solubilized cellular lysate was centrifuged to remove particulate and insoluble material and the supernatant collected.
  • Nickel chelated nitrilo-tri-acetic acid coupled to Sepharose beads (NiNTA-sepharose) was added to the solubilized lysate and incubated at 25°C for 1 hour. Proteins containing repeated histidine residues (e.g. recombinant xanthine dehydrogenase/oxidase) bind to the NiNTA matrix. The lysate and NiNTA-beads were poured into a sintered glass column that trapped the recombinant xanthine dehydrogenase/oxidase bound to the NiNTA-beads. The solubilized lysate was discarded.
  • NiNTA-sepharose Nickel chelated nitrilo-tri-acetic acid coupled to Sepharose beads
  • NiNTA-beads were washed sequentially with; 6 M Guanidine hydrochloride buffered to pH 8.0 with 100 mM sodium phosphate and 10 mM Tris hydrochloride, 8 M Urea buffered to pH 8.0 with 100 mM sodium phosphate and 10 mM Tris hydrochloride, and 8 M Urea buffered to pH 6.3 with 100 mM sodium phosphate and 10 mM Tris hydrochloride.
  • Figure 8 shows the purification and elution of xanthine dehydrogenase.
  • Figure 8A depicts the molecular weight standards.
  • Figure 8B represents the total protein from the cell lysate.
  • Figure 8C depicts 1 microliter of the dialysate pelletable fraction containing purified xanthine dehydrogenase/oxidase.
  • Recombinant xanthine dehydrogenase/oxidase was eluted from the NiNTA-beads in 8 M Urea buffered to pH 6.3 with 100 mM sodium phosphate and 10 mM Tris hydrochloride containing 250 mM imidazole. Imidazole is structurally very similar to histidine and serves to compete for the NiNTA binding sites thus releasing the recombinant xanthine dehydrogenase/oxidase protein.
  • Purified xanthine dehydrogenase/oxidase was dialyzed extensively against 8 M Urea buffered to pH 8.0 with 100 mM sodium phosphate and 10 mM Tris hydrochloride in order to remove the imidazole (See Figure 9). The dialyzed sample was concentrated by precipitation with chloroform and methanol. Purified recombinant xanthine oxidase/xanthine dehydrogenase was found to be insoluble in water but soluble in 8 M Urea.
  • Recombinant xanthine dehydrogenase/oxidase was suspended in sterile phosphate buffered saline, mixed with an equal volume of incomplete Freund's adjuvant and injected into mice and rabbits. Mice were injected intraperitoneally with approximately 100 microgram of protein and the rabbits were injected subcutaneously with approximately 1,000 microgram of protein at 4 and 6 week intervals, respectively. Blood was collected from both the mice and rabbits, sera isolated and tested for the presence of anti-xanthine dehydrogenase/oxidase antibodies by ELISA and Western blot analysis.
  • mice were also used to generate monoclonal antibodies (see below) or were injected intraperitoneally with SP2 myeloma cells for the induction of antibody rich ascitic fluid. Sera from both mice and rabbits was found to contain antibodies that recognize and bind; human xanthine oxidase, bovine xanthine oxidase and the recombinant xanthine dehydrogenase/oxidase.
  • mice that had received 3 injections of the recombinant xanthine dehydrogenase/oxidase antigen were tested by ELISA and Western blot analysis for the presence of anti-xanthine oxidase antibodies.
  • hybridoma cells were tested for antibodies that recognize and bind xanthine oxidase by ELISA assay. Many hundreds of hybridoma cells were identified that secrete antibodies that recognize either denatured recombinant xanthine dehydrogenase/oxidase, native bovine xanthine oxidase, or both. Hybridoma cells were found to secrete antibodies of IgG and IgM classes.
  • ELISA analysis was utilized to test for and characterize antibodies that recognize xanthine dehydrogenase/oxidase from rabbit and mouse sera, mouse ascitic fluid and tissue culture supernatants.
  • the ELISA assay employed is a very sensitive assay for the presence of specific antibodies that recognize xanthine dehydrogenase/oxidase.
  • the ELISA assay was performed as follows. Purified xanthine oxidase, isolated from bovine milk, or purified recombinant xanthine dehydrogenase/oxidase was bound to the wells of a 96 well microtiter plate.
  • Samples to be tested for the presence of xanthine dehydrogenase/oxidase specific antibodies were added to the microtiter wells.
  • Antibodies that recognize xanthine dehydrogenase/oxidase bind to the immobilized xanthine dehydrogenase/oxidase and remain after extensive washing.
  • Goat anti-mouse or Goat anti-rabbit antibodies that have been conjugated to horseradish peroxidase were added. These antibodies recognize and bind to the mouse or rabbit antibodies that have remained bound to the immobilized xanthine dehydrogenase/oxidase and remain after extensive washing.
  • a developing solution was added after washing the wells that yields a yellow product in the presence of horseradish peroxidase.
  • the quantity of horseradish peroxidase was determined by the quantity of the yellow dye produced as measured spectrophotometrically.
  • the degree of color change was directly correlated to the quantity of mouse or rabbit antibodies that were bound to the immobilized xanthine oxidase.
  • Western blot analysis was utilized to test for and ch aracterize antibodie s that rec og nize xanthine dehydrogenase/oxidase from rabbit and mouse sera, mouse ascitic fluid and tissue culture supernatants.
  • Western blot analysis is a very sensitive assay for the specificity of an antibody. Denaturing polyacrylamide gel electrophoresis was employed to separate complex mixtures of proteins based on their molecular weight. The separated proteins were transferred onto a membrane to which antibodies to be tested were added. Antibodies that can recognize and bind to the separated proteins (e.g. xanthine oxidase) will bind and remained bound after the membrane was washed.
  • Isotype switching of monoclonal anti-xanthine oxidase antibodies Antibodies of different isotype class or subclass possess different properties that may make some classes preferable for different applications.
  • Hybridoma cell lines producing anti-xanthine oxidase antibodies of the IgG class were isolated from IgM producing hybridomas.
  • IgM producing hybridomas infrequently (1x10" 7 per generation) spontaneously mutate to produce antibodies of the IgG class. These rare events are screened for by ELISA assay of tissue culture supernatants utilizing goat anti-mouse IgG specific antibodies conjugated to alkaline phosphatase.
  • IgG secreting cells are clonally isolated and used to produce anti-xanthine oxidase IgG antibody.
  • Xanthine dehydrogenase+oxidase also increased in the bronchoalveolar lavage (BAL) fluid from 4 ⁇ 1 to 95 ⁇ 55 following perfusion with post- ischemic hepatic effluent.
  • BAL bronchoalveolar lavage
  • the increase in BAL xanthine dehydrogenase+oxidase was markedly reduced by administration of allopurinol (0.2-0.8) and tungstate (0.1-0.1).
  • the source of the xanthine dehydrogenase+oxidase was the hepatocyte, the ischemia-induced release of xanthine dehydrogenase+oxidase was modeled in freshly isolated hepatocytes cultured in T25 flasks.
  • Hepatocytes were exposed to 0, 2, 4 or 6 hours hypoxia and some plates reoxygenated for an additional 2 hours in the presence of phenol red-free Hanks Buffered Salt Solution (HBSS).
  • HBSS Hanks Buffered Salt Solution
  • HBSS was removed for determination of LDH and xanthine dehydrogenase+oxidase.
  • Hepatocytes were removed from the flasks, resuspended in HBSS, and LDH, xanthine dehydrogenase and xanthine oxidase activity determined.
  • Pulmonary damage mediated by xanthine oxidase release from ischemic liver K c an estimate of capillary permeability, increased from 0.2(0.1 to 0.9(0.1 ml min ' 1 c mH 2 0 _ 1 100g _ 1 following reperfusion with post-ischemic liver effluent. Allopurinol, a xanthine dehydrogenase+oxidase inhibitor, dramatically attenuated (0.2-0.4) the ischemia-induced increase in pulmonary permeability. A similar protective effect was observed with regard to the ischemia induced increase in lung wet/dry ratio and appearance of proteins in BAL fluid.
  • alveolar-capillary permeability in a non-ischemic lung was increased upon reperfusion with post-ischemic effluent and that a significant portion of the lung injury can be attributed to the xanthine dehydrogenase+oxidase released from ischemic liver.
  • Hemorrhagic shock induced in rats by reducing mean arterial pressure to 30 mm Hg for 120 minutes, increased circulating xanthine dehydrogenase+oxidase activity up to 8.3 mU/ml blood in heparin-treated animals versus 3.2 mU/ml in the heparin-treated, non-ischemic control animals (Figure 7). Ischemia did not result in release of detectable xanthine dehydrogenase+oxidase into the circulation in the absence of heparin.
  • xanthine dehydrogenase/ oxidase This suggests an interaction of xanthine dehydrogenase/ oxidase with the glycocalyx of vascular endothelium.
  • cytoplasmic proteins AST, ALT, and LDH
  • the release and circulating levels of these hepatocellular proteins was not influenced by heparin indicating specific binding of xanthine dehydrogenase/oxidase to the glycocalyx of vascular lining cells. This is consistent with the observation that purified xanthine oxidase binds with high affinity and in a heparin dissociable manner to cultured vascular endothelial cells.
  • ATTORNEY/AGENT INFORMATION (A) NAME: Adler, Dr. Benjamin A. (B) REGISTRATION NUMBER: 35,423 (C) REFERENCE/DOCKET NUMBER: D5748

Abstract

The present invention provides a monoclonal or polyclonal antibody that specifically binds to human xanthine dehydrogenase and human xanthine oxidase. Also provided are various methods of preparing and using a monoclonal antibody that specifically binds to human xanthine dehydrogenase/oxidase.

Description

MONOCLONAL AND POLYCLONAL ANTIBODIES AGAINST
RECOMBINANT HUMAN XANTHINE OXIDASE, METHOD
FOR THEIR USE AND A KIT CONTAINING SAME
BACKGROUND OF THE INVENTION
Field of the Invention
The present invention relates generally to the fields of enzymology and protein chemistry. More specifically, the present invention relates to the development of monoclonal and polyclonal antibodies to localize and quantify xanthine oxidase in tissues and biological fluids and uses thereof.
Description of the Related Art Excess production and toxic target molecule reactions with reactive oxygen radicals contribute to diverse pathologic processes, including ischemia-reperfusion, sepsis, thermal injury and hemorrhagic shock. Aerobiosis is a double-edged sword: permitting efficient cell energy metabolism while simultaneously permitting formation of highly reactive and potentially toxic oxygen byproducts (oxidants). During normal cellular aerobic metabolism, the vast majority of molecular oxygen is fully reduced to water while only ~2% of 02 consumption includes univalent or divalent reduction to O2" and H2O2. Partially reduced oxygen species can directly oxidize biomolecules or be converted into more reactive species such as •OH . Normally, endogenous tissue antioxidant defenses maintain intracellular concentrations of oxidants in the nM range or less. In spite of this, there are pathological conditions that overwhelm tissue antioxidant capabilities and impair essential biochemical processes. Ischemia-reperfusion, acute trauma, hemorrhage, sepsis, and inflammatory processes are examples of pathologic states where oxidants play a role. In many of these conditions, epithelial and vascular endothelial cells are both key sources and targets of reactive oxygen species. Human plasma is normally endowed with a myriad of antioxidant defense mechanisms including catalytic antioxidants such as extracellular CuZn superoxide dismutase (EC-SOD), and selenium- dependent glutathione peroxidase. Noncatalytic plasma antioxidants such as urate, ascorbate, a-tocopherol, bilirubin and protein sulfhydryls are also crucial in minimizing oxidant-induced tissue injury. The oxidant scavenging capacity of non-catalytic antioxidants has been examined using lipid hydroperoxides, H2 O 2 and hypochlorous acid. Exposure of human plasma to oxidants, such as generated during a number of pathologic processes, results in the temporal disappearance of essential plasma antioxidants, decreasing the total radical antioxidant potential of tissues, thereby rendering the tissues more susceptible to oxidant-induced injury. The measurement of oxidation products of uric acid, ascorbate, a- tocopherol are also excellent indices of excess tissue production of oxidants. Since most tissue oxidant production is intracellular or at the cell surface, it may be beneficial to target antioxidant interventions at or near the site of production of oxidants. It is critical to scavenge oxidants in close apposition to sites of production, because their high reactivity limits its diffusional distance.
Xanthine dehydrogenase (xanthine dehydrogenase, XDH, xanthine:NAD+ oxidoreductase, EC 1.1.1.204) is a complex molybdenum hydroxylase that catalyzes the hydroxylation of hypoxanthine and xanthine to uric acid with the concomitant reduction of NAD+ to NADH. The enzyme is a dimer comprised of two identical and independent subunits, each with a molecular radius (Mr) of approximately 150,000 daltons (150 kDa). Each subunit contains one molybdopterin, two non-identical iron sulfur centers, and a flavin adenine dinucleotide. In mammalian species, xanthine dehydrogenase can be converted to oxygen-dependent form, xanthine oxidase (xanthine oxidase, XO, xanthineroxygen oxidoreductase, EC 1.1.3.22). Oxidation of essential thiol groups of xanthine dehydrogenase results in conversion xanthine oxidase by a mechanism which is both rapid, and reversible. Xanthine dehydrogenase can also be converted into xanthine oxidase more slowly, and irreversibly, through limited proteolysis. The xanthine oxidase form produces reactive oxygen metabolites, including superoxide (02") and hydrogen peroxide (H2O2) which have been demonstrated to be responsible for much of the tissue injury associated with ischemia-reperfusion injury, hemmorrhage, inflammation, acute viral infections, thermal injury numerous hepatic disorders and the acute lung injury associated with adult respiratory distress syndrome. The significance of xanthine oxidase as a mediator of tissue damage has often been minimized since many human tissues, including human heart and lung, have very low endogenous xanthine dehydrogenase or xanthine oxidase activity. Furthermore, the rate of conversion of xanthine dehyrogenase to oxidase is relatively slow in tissues, often of longer duration than the ischemic episode. However, the importance of xanthine oxidase is currently under reevaluation since the observation that xanthine oxidase activity is markedly increased in the plasma of patients after a number of pathologic processes (i.e., ischemia-reperfusion injury, sepsis, burns, acute viral infection, hemorrhagic shock and a number of pathologies which result in hepatocellular damage) and certain surgical procedures (i.e., liver transplantation and thoracic aorta occlusion). Tissues or cell types rich in this enzyme activity, e.g., liver and intestine, appear to be significant sources of the circulating xanthine dehydrogenase + oxidase activity. The circulating xanthine oxidase is associated with damage to tissues thoughout the body, including the lungs and heart. The damage may either be a result of the generation of cytotoxic oxygen metabolites or indirectly due to activation of inflammatory cells and other inflammatory mediators (e.g., cytokines).
Once xanthine degydrogenase appears in the circulation, it is rapidly and reversibly converted to xanthine oxidase, such that xanthine dehydrogenase is almost completely converted to xanthine oxidase within 1 minute of ischemia or hypoxia. The rapidity and reversibility of the conversion of xanthine dehydrogenase to xanthine oxidase in plasma means that the potential for formation of oxidants would be best approximated by the combination of both xanthine dehydrogenase and xanthine oxidase forms (XDH+XO). Therefore, methods for detection of oxygen radical producing potential from xanthine oxidase should recognize both XDH and XO.
In marked contrast to the XDH to XO conversion mediated by thiol oxidation, the irreversible conversion of xanthine dehydrogenase to xanthine oxidase is by limited proteolysis and results in cleavage of a 20 kDa fragment from the amino terminal end of xanthine dehydrogenase. The also appears to be some species specificity since the cleavage sites, and therefore the products, observed in rat, mouse and Drosophila are not the same as in cleavage of human xanthine dehydrogenase. The 130 kDa product exhibits xanthine oxidase activity, has altered NAD+ binding or function which is NAD+ independent, and a 70% reduction in the number of reactive sulfhydryl groups. It is suggested that the NAD+ binding site exists in the amino terminal end of the enzyme and that NA D + binding can be altered by either thiol oxidation or limited proteolysis to produce xanthine oxidase..
The unique irreversible conversion of xanthine dehydrogenase to xanthine oxidase by proteolytic cleavage of the amino-terminus of the xanthine dehydrogenase and the necessity to measure both xanthine dehydrogenase and xanthine oxidase to capture the reversible xanthine oxidase requires an unconventional approach when producing antibodies to quantity xanthine dehydrogenase and xanthine oxidase in human biological samples. Antibodies that recognize the amino-terminal portion of the protein would be ineffective since this portion of the xanthine dehydrogenase is cleaved and degraded, thus leaving no polypeptide to be recognized. Therefore, antibodies must be produced that recognize the carboxy-terminal portion of the polypeptide which is common to both xanthine dehydrogenase and xanthine oxidase in order to measure both xanthine dehydrogenase and xanthine oxidase in biological samples.
Literature regarding the localization and relative quantification of xanthine dehydrogenase/oxidase using xanthine dehydrogenase/oxidase antibodies is being re-evaluated in light of some recent observations. It is generally accepted that the liver and intestine have the greatest xanthine dehydrogenase/oxidase specific activity. Vascular endothelium throughout the body is also reported to be enriched in xanthine dehydrogenase/oxidase relative to other tissues. Epithelial cells, including that of the liver and intestine, have minimal xanthine dehydrogenase/oxidase using anti-xanthine dehydrogenase/oxidase antibodies. However, these studies utilized a xanthine dehydrogenase/oxidase antibody that was directed against xanthine oxidase purified from bovine or human milk. During the purification process, xanthine dehydrogenase is proteolytically modified to form irreversible xanthine oxidase. Therefore, antibodies raised against this protein may not recognize xanthine dehydrogenase , the form of xanthine dehydrogenase/oxidase which predominants under normal conditions. Furthermore, it has recently been demonstrated that IgG and IgA copurify with xanthine dehydrogenase/oxidase. The antiserum raised against the putatively pure xanthine dehydrogenase/oxidase also cross reacts with IgG, IgA and IgM, making quantification and localization of xanthine dehydrogenase/oxidase imprecise and unreliable. Preparation of a antibody against a recombinant human xanthine dehydrogenase/oxidase circumvents these limitations and represents a significant advance in the art.
Although several attempts have been made to produce antibodies which recognize human xanthine dehydrogenase and oxidase, the prior art was deficient in the lack of effective means of producing monoclonal and polyclonal antibodies capable of measuring biological concentrations of xanthine oxidase. The present invention fulfills this longstanding need and desire in the art.
SUMMARY OF THE INVENTION
In one embodiment of the present invention, there is provided a series of monoclonal and polyclonal antibodies that specifically bind to human xanthine dehydrogenase/oxidase.
In another embodiment of the present invention, there is provided a series of hybridomas that produce monoclonal antibodies that specifically bind to human xanthine dehydrogenase/oxidase.
In yet another embodiment of the present invention, there is provided a kit for immunodection, comprising: a container means; a first monoclonal antibody that specifically binds to human xanthine dehydrogenase/oxidase; and an immunodetection reagent.
In another embodiment of the present invention, there is provided a kit for immunodection, comprising: a container means; a first monoclonal antibody that specifically binds to human xanthine oxidase; a second monoclonal antibody that specifically binds to human xanthine oxidase; and an immunodetection reagent. Preferably, the immunodetection reagent is a detectable label linked to said second antibody. In still yet another embodiment of the present invention, there is provided a method of preparing a monoclonal antibody to human xanthine oxidase, comprising the steps of:
(a) expressing a portion of the carboxy terminus of human xanthine dehydrogenase/oxidase enzyme in a vector; (b) purifying recombinant fragments expressed by said vector;
(c) introducing recombinant fragments as antigen into a host animal; and (d) fusing splenocytes to a myeloma cell to form a hybridoma;
(e) identifying a monoclonal antibody from said hybridoma that recognizes human xanthine dehydrogenase and human xanthine oxidase. In still yet another embodiment of the present invention, there is provided a method of determining the amount of xanthine dehydrogenase/oxidase in a biological sample, comprising: contacting said sample with a first monoclonal or polyclonal antibody that specifically binds to human xanthine dehydrogenase/oxidase under conditions to allow the formation of immune complexes; and detecting the immune complexes formed.
In still yet another embodiment of the present invention, there is provided a method to using monoclonal antibodies to specifically bind to human xanthine dehydrogenase/oxidase and thereby decrease the specific activity of the enzyme in tissues and biologic fluids.
In still yet another embodiment of the present invention, there is provided a method of using monoclonal or polyclonal antibodies to immunolocalize, at light and electron microscopic levels, xanthine dehydrogenase/oxidase in cells or tissues.
Other and further aspects, features, and advantages of the present invention will be apparent from the following description of the presently preferred embodiments of the invention given for the purpose of disclosure.
BRIEF DESCRIPTION OF THE DRAWINGS
So that the matter in which the above-recited features, advantages and objects of the invention, as well as others which will become clear, are attained and can be understood in detail, more particular descriptions of the invention briefly summarized above may be had by reference to certain embodiments thereof which are illustrated in the appended drawings. These drawings form a part of the specification. It is to be noted, however, that the appended drawings illustrate preferred embodiments of the invention and therefore are not to be considered limiting in their scope. In this application, xanthine dehydrogenase+oxidase (XDH+XO) is used to designate the combination of both xanthine dehydrogenase and xanthine oxidase forms. When no distiction is to be made between the oxidase and dehydrogenase forms , xanthine dehydrogenase/oxidase (XDH/XO) will be used.
Figure 1 shows xanthine dehydrogenase+oxidase is increased in radial artery samples in human liver transplant patients with 24 hr post-transplant AST>1000, compared to group with AST lOOO, p<0.05.
Figure 2 shows that xanthine dehydrogenase+oxidase is increased in artery samples in aortic occlusion compared to shams, p<0.05. Tungstate diet results in abolition of xanthine dehydrogenase+oxidase, difference from sham, p<0.05.
Figure 3 shows that the massive release of xanthine dehydrogenase+oxidase into effluent from liver following ischemia- reperfusion. Allopurinol (Allo), an inhibitor of xanthine dehydrogenase+oxidase, resulted in significantly less release of enzyme, p<0.05.
Figure 4 shows the bronchoalveolar lavage (BAL) xanthine dehydrogenase+oxidase increases following aortic occlusion compared to sham, p<0.05. Tungstate (an inactivator of xanthine dehydrogenase+oxidase) pre-Rx prevents this increase in the BAL. Figure 5 shows that tissue xanthine dehydrogenase+oxidase decreases in liver but increases in non- ischemic lung after liver ischemia-reperfusion. Allopurinol pre-Rx abolished the changes.
Figure 6 shows that increasing xanthine dehydrogenase+oxidase with increasing hypoxia in isolated hepatocytes, p<0.05. At 4h+2h H/R, trend towards increased release.
Figure 7 shows that ischemia associated with hemorrhagic shock does not result in detectable circulating xanthine dehydrogenase/ oxidase unless rats pre-treated with heparin. Figure 8 shows the purification and elution of xanthine dehydrogenase. Figure 8A depicts the molecular weight standards. Figure 8B represents the total protein from the cell lysate. Figure 8C depicts 1 microliter of the dialysate pelletable fraction containing purified xanthine dehydrogenase/oxidase. Figure 9 shows that the recombinant xanthine dehydrogenase/oxidase fusion protein was resolved by SDS-PAGE, transferred to nitrocellulose membrane and probed with mouse anti- xanthine dehydrogenase/oxidase sera at dilutions of 1 :66, 1 :200, 1:500, and 1:1000 (lanes A-D respectively). As a control, a 1:66 dilution of mouse sera prepared prior to injection of the recombinant xanthine dehydrogenase/oxidase antigen was used to probe an identical blot (lane E).
DETAILED DESCRIPTION OF THE INVENTION
The present invention is encompasses the development of monoclonal and polyclonal antibodies that specifically bind to human xanthine oxidase. In one embodiment, the antibody is linked to a detectable label. Also provided are hybridomas that produce monoclonal antibodies that specifically bind to human xanthine oxidase.
The present invention is also directed to a kit for immunodetection, comprising: a container means; a first monoclonal antibody that specifically binds to human xanthine oxidase; and an immunodetection reagent. Alternatively, the present invention provides a kit for immunodection, comprising: a container means; a first monoclonal antibody that specifically binds to human xanthine oxidase; a second monoclonal antibody that specifically binds to human xanthine oxidase; and an immunodetection reagent. Preferably, the immunodetection reagent is a detectable label linked to said second antibody.
The present invention is also directed to a method of preparing a monoclonal antibody to human xanthine oxidase, comprising the steps of: (a) expressing specific portions of human xanthine dehydrogenase/oxidase in E.coli; (b) purifying recombinant fragments; (c) introducing recombinant fragments as antigen; (d) fusing splenocytes to a myelenoma cell to form a hybridoma; and (e) identifying a monoclonal antibody from said hybridoma that recognizes human xanthine dehydrogenase and human xanthine oxidase. Preferably, the portion of the carboxy terminus of human xanthine dehydrogenase/oxidase enzyme used is from about the first 30 codons to about the first 400 codons. Most preferably, the portion of the carboxy terminus of human xanthine dehydrogenase/oxidase enzyme is about the first 358 codons. Although various vector are known and routine in this art, preferably the vector is E. coli. Representative host animals include rabbit and mouse.
The present invention is also directed to a method of determining the amount of xanthine oxidase in a biological sample, comprising: contacting said sample with a first monoclonal antibody that specifically binds to human xanthine oxidase under conditions to allow the formation of immune complexes; and detecting the immune complexes formed. Preferably, the biological sample is a blood sample but could include any biologic sample such as blood, plasma, serum and urine. In one embodiment, an antibody is linked to a detectable label and the immune complexes are detected by detecting the presence of said label.
The present invention is also directed to providing a method to use monoclonal antibodies to specifically bind to human xanthine dehydrogenase/oxidase and thereby decrease the specific activity of the enzyme in tissues and biologic fluids.
The present invention is also includes a method of using monoclonal or polyclonal antibodies to immunolocalize, at light and electron microscopic levels, xanthine dehydrogenase/oxidase in cells or tissues. Further uses of the novel monoclonal antibody of the present invention include addition of the antibody to the preservation fluid used to preserve organs after extirpation prior to transplantation. Further uses of the antibody would include administration to the donor of the transplanted organ is also contemplated.
The following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion.
EXAMPLE 1
Development of xanthine dehydrogenase/oxidase antibody
A region of the human xanthine dehydrogenase/oxidase coding sequence from a cDNA library was amplified by polymerase chain reaction (PCR) using oligodeoxynucleotides specific for xanthine dehydrogenase/oxidase. The xanthine dehydrogenase/oxidase region amplified corresponds to the 358 carboxy-terminal codons that are common to both xanthine dehydrogenase and xanthine oxidase. The xanthine dehydrogenase/oxidase PCR product was cloned into the E. coli expression vector pQE32 and the recombinant construct named pDP4. DNA sequence analysis demonstrated that the xanthine dehydrogenase/oxidase PCR product cloned into pQE32 matched exactly the reported human xanthine dehydrogenase/oxidase sequence.
Induc ed expre s sion of the x anth ine dehydrogenase/oxidase fusion product resulted in the efficient production of a 42 kD polypeptide not present in uninduced controls. The xanthine dehydrogenase/oxidase fusion protein was purified from E. coli lysates to near homogeneity by affinity chromatography on NiNTA-agarose under denaturing conditions, precipitated, lyophilized and stored at -80°C. The purified xanthine dehydrogenase/oxidase was injected into mice and rabbits for production of both monoclonal and polyclonal antibodies. Immunoreactive species were identified by colorimetric development following incubation with horseradish peroxidase- conjugated goat anti-mouse IgG. A unique specific signal was observed for all dilutions of the anti-xanthine dehydrogenase/oxidase sera that corresponds to the recombinant xanthine dehydrogenase/oxidase fusion product as identified by staining of total protein. Pre-immune serum failed to recognize xanthine dehydrogenase/oxidase.
Antibodies were raised to a recombinant polypeptide expressed in the bacterium E. coli composed of the carboxy-terminal 358 amino acids of the human xanthine dehydrogenase fused to a short leader peptide that contains a hexahistidine motif. The hexahistidine motif allows for the rapid purification of the recombinant polypeptide from E. coli that express this protein. Using the purified recombinant xanthine dehydrogenase protein as antigen antibodies have been raised in mice and rabbits that specifically recognize human xanthine dehydrogenase. Anti-xanthine dehydrogenase monoclonal antibodies were isolated that recognize native xanthine dehydrogenase, denatured xanthine dehydrogenase or both. EXAMPLE I
Construction of recombinant xanthine o x i d a s e /x a n th i n e dehydrogenase expression vector A portion of the human xanthine dehydrogenase sequence was isolated from a human liver cDNA library by means of the polymerase chain reaction utilizing two human xanthine dehydrogenase specific oligo-deoxynucleotides. The first oligo- deoxynucleotide, designated xanthine oxidase-5 -Bcl I, (TGGTGATCATGGCCATGTCTTCCTACTCCTTGAGG) was specific for nucleotides 2,936 through 2,961 of the human xanthine dehydrogenase mRNA and contained the recognition sequence for the restriction endonuclease Bel I (bold). The second oligo- deoxynucleotide, named xanthine oxidase-3 -Sal I, (TAAGTCGACGATGGGTACATTCCAAGGAACGTAGG) was specific for nucleotides 4,008 through 3,983 of the human xanthine dehydrogenase mRNA and contained the recognition sequence for the restriction endonuclease Sal I (bold).
The restriction endonuclease sequences were included to facilitate the cloning of the xanthine oxidase amplified sequence. Amplification of the xanthine dehydrogenase sequence was performed with 100 ng of each oligo-deoxynucleotide, 1x10? lambda phage containing clones of human liver cDNAs, buffer and the thermal-stable DNA polymerase Taq. The PCR reaction conditions were: 94°C for 1 minute followed by 52°C for 45 seconds followed by 72°C for 1 minute, these conditions were repeated 27 times and terminated with a 10 minute incubation at 72°C. A fraction of the PCR reaction was analyzed by agarose gel electrophoresis, stained with ethidium bromide and visualized under ultraviolet light. A single DNA band was observed that was estimated to be 1,100 nucleotides long as judged by migration through the agarose gel relative to DNA of known size.
The DNA generated by the PCR reaction was digested with the restriction endonucleases Bel I and Sal I, electrophoresed through an agarose gel, stained with ethidium bromide and visualized with ultraviolet light. The 1,100 base pair DNA fragment was purified from the agarose gel. The purified digested DNA was cloned into the E. coli vectors pTZ18U and pQE32 that had been digested with the restriction endonucleases Bam HI and Sal I. The nucleotide sequence of the DNA cloned into the pTZ18U vector was determined. A comparison of this sequence was observed to exactly match the published human xanthine dehydrogenase nucleotide sequence from nucleotides 2,936-4,008. The plasmid containing the human xanthine dehydrogenase sequences cloned into the pQE32 vector was named pDP4.
EXAMPLE a
Expression of recombinant xanthine oxidase/xanthine dehydrogenase
E. coli, strain KK2186, carrying the pDP4 plasmid were cultured in 1 liter of rich media containing 100 mg/liter ampicillin for several hours until the optical density measured at 595 nanometers reached 0.7. The E. coli were induced to express the recombinant xanthine oxidase/xanthine dehydrogenase by the addition of isopropylthiogalactoside (IPTG) to the growth media at a final concentration of 1 mM. The E. coli were then cultured for an additional 12 to 16 hours to maximize the production of the recombinant xanthine oxidase.
EXAMPLE 4
Purification of recombinant xanthine oxid ase/xanthine dehydrogenase E. coli induced to express the recombinant xanthine oxidase were collected from the culture media by centrifugation and washed in sterile water. The washed cells were solubilized for 1 hour at 25 °C in 6 M Guanidine hydrochloride buffered to pH 8.0 with 100 mM sodium phosphate and 10 mM Tris hydrochloride. The solubilized cellular lysate was centrifuged to remove particulate and insoluble material and the supernatant collected. Nickel chelated nitrilo-tri-acetic acid coupled to Sepharose beads (NiNTA-sepharose) was added to the solubilized lysate and incubated at 25°C for 1 hour. Proteins containing repeated histidine residues (e.g. recombinant xanthine dehydrogenase/oxidase) bind to the NiNTA matrix. The lysate and NiNTA-beads were poured into a sintered glass column that trapped the recombinant xanthine dehydrogenase/oxidase bound to the NiNTA-beads. The solubilized lysate was discarded. The NiNTA-beads were washed sequentially with; 6 M Guanidine hydrochloride buffered to pH 8.0 with 100 mM sodium phosphate and 10 mM Tris hydrochloride, 8 M Urea buffered to pH 8.0 with 100 mM sodium phosphate and 10 mM Tris hydrochloride, and 8 M Urea buffered to pH 6.3 with 100 mM sodium phosphate and 10 mM Tris hydrochloride. These washes remove proteins loosely associated with the NiNTA matrix leaving the recombinant xanthine oxidase protein bound. Figure 8 shows the purification and elution of xanthine dehydrogenase. Figure 8A depicts the molecular weight standards. Figure 8B represents the total protein from the cell lysate. Figure 8C depicts 1 microliter of the dialysate pelletable fraction containing purified xanthine dehydrogenase/oxidase.
EXAMPLE
Elution of xanthine dehydrogenase/oxidase
Recombinant xanthine dehydrogenase/oxidase was eluted from the NiNTA-beads in 8 M Urea buffered to pH 6.3 with 100 mM sodium phosphate and 10 mM Tris hydrochloride containing 250 mM imidazole. Imidazole is structurally very similar to histidine and serves to compete for the NiNTA binding sites thus releasing the recombinant xanthine dehydrogenase/oxidase protein. Purified xanthine dehydrogenase/oxidase was dialyzed extensively against 8 M Urea buffered to pH 8.0 with 100 mM sodium phosphate and 10 mM Tris hydrochloride in order to remove the imidazole (See Figure 9). The dialyzed sample was concentrated by precipitation with chloroform and methanol. Purified recombinant xanthine oxidase/xanthine dehydrogenase was found to be insoluble in water but soluble in 8 M Urea.
EXAMPLE 6
Generation of anti-xanthine dehydrogenase antibodies
Recombinant xanthine dehydrogenase/oxidase was suspended in sterile phosphate buffered saline, mixed with an equal volume of incomplete Freund's adjuvant and injected into mice and rabbits. Mice were injected intraperitoneally with approximately 100 microgram of protein and the rabbits were injected subcutaneously with approximately 1,000 microgram of protein at 4 and 6 week intervals, respectively. Blood was collected from both the mice and rabbits, sera isolated and tested for the presence of anti-xanthine dehydrogenase/oxidase antibodies by ELISA and Western blot analysis. Mice were also used to generate monoclonal antibodies (see below) or were injected intraperitoneally with SP2 myeloma cells for the induction of antibody rich ascitic fluid. Sera from both mice and rabbits was found to contain antibodies that recognize and bind; human xanthine oxidase, bovine xanthine oxidase and the recombinant xanthine dehydrogenase/oxidase.
EXAMPLE 7
Generation of monoclonal anti-xanthine dehydrogenase antibodies
Sera from mice that had received 3 injections of the recombinant xanthine dehydrogenase/oxidase antigen were tested by ELISA and Western blot analysis for the presence of anti-xanthine oxidase antibodies. The mice demonstrated a high titer of anti- xanthine dehydrogenase/oxidase antibodies. Mice were then injected with the recombinant xanthine dehydrogenase/oxidase and the spleens were removed four days later. Lymphocytes isolated from the dissected spleens were fused to myeloma cells using standard techniques. The resultant hybridoma cells were tested for antibodies that recognize and bind xanthine oxidase by ELISA assay. Many hundreds of hybridoma cells were identified that secrete antibodies that recognize either denatured recombinant xanthine dehydrogenase/oxidase, native bovine xanthine oxidase, or both. Hybridoma cells were found to secrete antibodies of IgG and IgM classes.
EXAMPLE 8
Analysis of anti-xanthine dehvdro enase/oxidase antibodies bv ELISA Analysis
ELISA analysis was utilized to test for and characterize antibodies that recognize xanthine dehydrogenase/oxidase from rabbit and mouse sera, mouse ascitic fluid and tissue culture supernatants. The ELISA assay employed is a very sensitive assay for the presence of specific antibodies that recognize xanthine dehydrogenase/oxidase. The ELISA assay was performed as follows. Purified xanthine oxidase, isolated from bovine milk, or purified recombinant xanthine dehydrogenase/oxidase was bound to the wells of a 96 well microtiter plate. Samples to be tested for the presence of xanthine dehydrogenase/oxidase specific antibodies were added to the microtiter wells. Antibodies that recognize xanthine dehydrogenase/oxidase bind to the immobilized xanthine dehydrogenase/oxidase and remain after extensive washing. Goat anti-mouse or Goat anti-rabbit antibodies that have been conjugated to horseradish peroxidase were added. These antibodies recognize and bind to the mouse or rabbit antibodies that have remained bound to the immobilized xanthine dehydrogenase/oxidase and remain after extensive washing. A developing solution was added after washing the wells that yields a yellow product in the presence of horseradish peroxidase. The quantity of horseradish peroxidase was determined by the quantity of the yellow dye produced as measured spectrophotometrically. The degree of color change was directly correlated to the quantity of mouse or rabbit antibodies that were bound to the immobilized xanthine oxidase.
EXAMPLE 9
Analysis of anti-xanthine dehvdrogenase/oxidase an ti bodie s bvWestern blot analysis
Western blot analysis was utilized to test for and ch aracterize antibodie s that rec og nize xanthine dehydrogenase/oxidase from rabbit and mouse sera, mouse ascitic fluid and tissue culture supernatants. Western blot analysis is a very sensitive assay for the specificity of an antibody. Denaturing polyacrylamide gel electrophoresis was employed to separate complex mixtures of proteins based on their molecular weight. The separated proteins were transferred onto a membrane to which antibodies to be tested were added. Antibodies that can recognize and bind to the separated proteins (e.g. xanthine oxidase) will bind and remained bound after the membrane was washed. These antibodies were detected by incubation with Goat anti-mouse or Goat anti-rabbit antibodies that have been conjugated to horseradish peroxidase. After washing unbound antibodies away a developing solution was added that resulted in a colored precipitate where the antibodies have bound. This indicated the presence of antibodies that have recognized specific proteins on the membrane. EXAMPLE 10
Isotype switching of monoclonal anti-xanthine oxidase antibodies Antibodies of different isotype class or subclass possess different properties that may make some classes preferable for different applications. Hybridoma cell lines producing anti-xanthine oxidase antibodies of the IgG class were isolated from IgM producing hybridomas. IgM producing hybridomas infrequently (1x10" 7 per generation) spontaneously mutate to produce antibodies of the IgG class. These rare events are screened for by ELISA assay of tissue culture supernatants utilizing goat anti-mouse IgG specific antibodies conjugated to alkaline phosphatase. IgG secreting cells are clonally isolated and used to produce anti-xanthine oxidase IgG antibody.
EXAMPLE 1 1
Release of xanthine oxidase following reperfusion of the transplanted human liver and after human thoracic aorta occlusion Xanthine dehydrogenase+oxidase activity in the plasma of
12 patients undergoing liver transplantation was determined (Figure 1. Xanthine dehydrogenase+xanthine oxidase activity was significantly greater in patients with AST >1000 than in patients with AST <1000 U/L (p<0.05). Detailed analysis demonstrated that the outcome variable, 24 hours AST, was significantly associated with increased xanthine oxidase activity even when ischemic time was taken into account (p<0.05). This is the first evidence that ischemic human liver release xanthine dehydrogenase+oxidase into the systemic circulation upon reperfusion and is associated with increased tissue damage. It also demonstrates that the xanthine oxidase plasma half-life is hours, not minutes as previously reported. Interestingly, there appears to be a conversion of endogenous circulating xanthine dehydrogenase to oxygen radical-producing xanthine oxidase during reperfusion. In a separate series of studies, arterial blood was obtained from a patient undergoing aortic aneurysm repair requiring crossclamping above the 10th intercostal artery, a procedure that renders liver, intestine and all distal tissues ischemic. This patient had 78 mU/ml xanthine dehydrogenase + oxidase prior to cross-clamping which increased to 153 mU/ml after reperfusion of the ischemic liver. Subsequent reperfusion of tissues below the right renal artery did not markedly increase circulating xanthine dehydrogenase+oxidase. Xanthine dehydrogenase+ oxidase activity remained elevated for at least 2 hours following reperfusion of the ischemic intestine and liver. Data in two additional patients support these observations.
EXAMPLE 12
Release of xanthine oxidase following thoracic aortic occlusion in the rabbit
Rabbits were subjected to 40 minute thoracic aortic occlusion with 2 hour reperfusion. Circulating xanthine dehydrogenase+oxidase increased dramatically following reperfusion and remained significantly elevated throughout the entire reperfusion period (Figure 2). Lavage of the lungs at termination of the experiment revealed that there was a dramatic increase in large molecular weight proteins, including albumin, LDH, and xanthine dehydrogenase+oxidase. The dramatic increase in total protein in the brochoalveolar lavage fluid (BAL) is consistent with a severely compromised alveolar-capillary barrier following thoracic aorta occlusion. Administration of sodium tungstate decreased the xanthine dehydrogenase+oxidase in the plasma following ischemia- reperfusion and as well as total protein and xanthine dehydrogenase+oxidase activity in the BAL (Figure 3). These observations indicate that tissue damage associated with thoracic aortic occlusion involves the production of reactive species during both ischemia and reperfusion periods. In addition, the increased pulmonary alveolar permeability suggests that tissues remote to the ischemic tissue are damaged upon reperfusion. Inhibition of xanthine dehydrogenase+oxidase activity attenuates these changes, consistent with involvement of circulating xanthine dehydrogenase + oxidase in ischemia-induced damage. EXAMPLE 13
Release of xanthine oxidase from isolated perfused rat liver and hepatocvtes The isolated perfused rat liver was rendered ischemic for 2 hours and then reperfused for 15 minutes. During the 15 minute reperfusion period, the perfusate was directed into the pulmonary circuit and the non-ischemic lung exposed to the post- ischemic hepatic effluent. Xanthine dehydrogenase+oxidase was released into the perfusate immediately upon reperfusion and remained elevated throughout the reperfusion period (Figure 4). A significant portion of the xanthine dehydrogenase+oxidase released during reperfusion of the ischemic liver was found to bind to the vascular endothelium or epithelium of the lung and increase lung tissue xanthine dehydrogenase+oxidase to 380 (134 compared to 28 (2 mU/g tissue wet wt following perfusion with effluent from non- ischemic liver. Administration of either allopurinol or tungstate prevented the increase in the specific activity of xanthine dehydrogenase+oxidase in the lung perfusate and lung tissue associated with hepatic ischemia-reperfusion (Figure 5). Xanthine dehydrogenase+oxidase also increased in the bronchoalveolar lavage (BAL) fluid from 4± 1 to 95±55 following perfusion with post- ischemic hepatic effluent. The increase in BAL xanthine dehydrogenase+oxidase was markedly reduced by administration of allopurinol (0.2-0.8) and tungstate (0.1-0.1). To determine if the source of the xanthine dehydrogenase+oxidase was the hepatocyte, the ischemia-induced release of xanthine dehydrogenase+oxidase was modeled in freshly isolated hepatocytes cultured in T25 flasks. Hepatocytes were exposed to 0, 2, 4 or 6 hours hypoxia and some plates reoxygenated for an additional 2 hours in the presence of phenol red-free Hanks Buffered Salt Solution (HBSS). HBSS was removed for determination of LDH and xanthine dehydrogenase+oxidase. Hepatocytes were removed from the flasks, resuspended in HBSS, and LDH, xanthine dehydrogenase and xanthine oxidase activity determined. These studies demonstrate that isolated hepatocytes contain significant xanthine dehydrogenase+oxidase and that hypoxia causes the release of xanthine dehydrogenase+oxidase into the media (Figure 6). EXAMPLE 14
Pulmonary damage mediated by xanthine oxidase release from ischemic liver K c, an estimate of capillary permeability, increased from 0.2(0.1 to 0.9(0.1 ml min' 1 c mH 20 _ 1 100g _ 1 following reperfusion with post-ischemic liver effluent. Allopurinol, a xanthine dehydrogenase+oxidase inhibitor, dramatically attenuated (0.2-0.4) the ischemia-induced increase in pulmonary permeability. A similar protective effect was observed with regard to the ischemia induced increase in lung wet/dry ratio and appearance of proteins in BAL fluid. Thus, alveolar-capillary permeability in a non-ischemic lung was increased upon reperfusion with post-ischemic effluent and that a significant portion of the lung injury can be attributed to the xanthine dehydrogenase+oxidase released from ischemic liver.
EXAMPLE IS
Recirculation of XO results in amplification of cellular injury Infusion of 0, 2.5, 5.0 or 10 mU/ml xanthine oxidase into the portal vein of a normal rat liver resulted in a dose-dependent release of AST, ALT and LDH. Interestingly, the xanthine dehydrogenase+oxidase activity in the effluent exceeded that infused into the liver by 0.5, 2.1 and 4.6 mU/ml for the 2.5, 5 and 10 mU/ml infusions, respectively. The infusion of the equivalent of 10 mU/ml inactive xanthine oxidase did not result in a significant release of hepatocellular enzymes, including xanthine dehydrogenase+oxidase, indicating that the effect is a result of the enzymatic production of oxidants. The appearance of xanthine oxidase in the circulation may amplify tissue injury as the circulating xanthine oxidase causes the release of additional xanthine dehydrogenase+oxidase from the liver and small intestine. The ability of cells to bind xanthine dehydrogenase/oxidase may markedly increase the cytotoxicity of this generator of reactive oxygen metabolites. EXAMPLE 16
Release of xanthine oxidase and subsequent binding to vasculature after hemorrhagic shock Hemorrhagic shock, induced in rats by reducing mean arterial pressure to 30 mm Hg for 120 minutes, increased circulating xanthine dehydrogenase+oxidase activity up to 8.3 mU/ml blood in heparin-treated animals versus 3.2 mU/ml in the heparin-treated, non-ischemic control animals (Figure 7). Ischemia did not result in release of detectable xanthine dehydrogenase+oxidase into the circulation in the absence of heparin. This suggests an interaction of xanthine dehydrogenase/ oxidase with the glycocalyx of vascular endothelium. Concomitantly, cytoplasmic proteins (AST, ALT, and LDH) were markedly increased in the circulation upon reperfusion, indicative of cellular injury. The release and circulating levels of these hepatocellular proteins was not influenced by heparin indicating specific binding of xanthine dehydrogenase/oxidase to the glycocalyx of vascular lining cells. This is consistent with the observation that purified xanthine oxidase binds with high affinity and in a heparin dissociable manner to cultured vascular endothelial cells.
Any patents or publications mentioned in this specification are indicative of the levels of those skilled in the art to which the invention pertains. These patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.
One skilled in the art will readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The present examples along with the methods, procedures, treatments, molecules, and specific compounds described herein are presently representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention as defined by the scope of the claims.
WHAT IS CLAIMED IS: SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANTS: Parks, D. A., Skinner, K.A. and Skinner, H.
(ii) TITLE OF INVENTION: Monoclonal And Polyclonal Antibodies Against Recombinant Human Xanthine Oxidase, Method For Their Use And A Kit Containing Same
(iii) NUMBER OF SEQUENCES: 2
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Dr. Benjamin A. Adler, GILBRETH & ADLER, P.C. (B) STREET: 8011 Candle Lane
(C) CITY: Houston
(D) STATE: Texas (E) COUNTRY: USA
(F) ZIP: 77071
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: Apple Macintosh (C) OPERATING SYSTEM: Macintosh (D) SOFTWARE: Microsoft Word for Macintosh
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: (C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION: (A) NAME: Adler, Dr. Benjamin A. (B) REGISTRATION NUMBER: 35,423 (C) REFERENCE/DOCKET NUMBER: D5748
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 713-777-2321
(B) TELEFAX: 713-777-6908 (2) INFORMATION FOR SEQ ID N0:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 (B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: (A) Description: other nucleic acid
(iii) HYPOTHETICAL: No (iv) ANTISENSE: No (vi) ORIGINAL SOURCE:
(B) STRAIN: (C) INDIVIDUAL ISOLATE:
(D) DEVELOPMENTAL STAGE:
(F) TISSUE TYPE:
(G) CELL TYPE: (H) CELL LINE:
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l :
TGGTGATCAT GGCCATGTCT TCCTACTCCT TGAGG 35
(3) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35
(B) TYPE: nucleic acid (C) STRANDEDNESS: single
(D) TOPOLOGY: linear (ii) MOLECULE TYPE:
(A) Description: other nucleic acid (iii) HYPOTHETICAL: No (iv) ANTISENSE: No
(vi) ORIGINAL SOURCE:
(B) STRAIN:
(C) INDIVIDUAL ISOLATE: (D) DEVELOPMENTAL STAGE: (F) ΗSSUE TYPE:
(G) CELL TYPE: (H) CELL LINE:
(xi) SEQUENCE DESCRIPΗON: SEQ ID NO:2:
TAAGTCGACG ATGGGTACAT TCCAAGGAAC GTAGG 35

Claims

1. An antibody that specifically binds to human xanthine dehydrogenase and human xanthine oxidase.
2. The antibody of claim 1, wherein said antibody is a monoclonal antibody.
3. The antibody of claim 1, wherein said antibody is a polyclonal antibody.
4. The antibody of claim 1, wherein said antibody is linked to a detectable label.
5. A hybridoma that produces the antibody of claim 2.
6. A hybridoma that produces the antibody of claim 3.
7. A kit for immunodection, comprising: a container means; a first monoclonal antibody that specifically binds to human xanthine dehydrogenase and human xanthine oxidase; and an immunodetection reagent.
8. The kit of claim 7, wherein said immunodetection reagent is a detectable label linked to said first antibody.
9. A kit for immunodection, comprising: a container means; a first monoclonal antibody that specifically binds to human xanthine dehydrogenase and human xanthine oxidase; a second monoclonal antibody that specifically binds to human xanthine dehydrogenase and human xanthine oxidase; and an immunodetection reagent.
10. The kit of claim 9, wherein said immunodetection reagent is a detectable label linked to said second antibody.
1 1. A method of preparing a monoclonal antibody to human xanthine dehydrogenase and human xanthine oxidase, comprising the steps of: (a) expressing a portion of the carboxy terminus of human xanthine dehydrogenase/oxidase enzyme in a vector;
(b) purifying recombinant fragments expressed by said vector; (c) introducing recombinant fragments as antigen into a host animal;
(d) fusing splenocytes to a myeloma cell to form a hybridoma; and
(e) identifying a monoclonal antibody from said hybridoma that recognizes human xanthine dehydrogenase and human xanthine oxidase.
12. The method of claim 11, wherein said portion of the carboxy terminus of human xanthine dehydrogenase/oxidase enzyme is from about the first 30 codons to about the first 400 codons.
13. The method of claim 12, wherein said portion of the carboxy terminus of human xanthine dehydrogenase/oxidase enzyme is about the first 358 codons.
14. The method of claim 11, wherein said vector is E . coli.
15. The method of claim 11 , wherein said animal is selected from the group consisting of rabbit and mouse.
16. A method of determining the amount of human xanthine dehydrogenase and human xanthine oxidase in a biological sample, comprising contacting said sample with a first monoclonal antibody that specifically binds to human xanthine dehydrogenase and human xanthine oxidase under conditions to allow the formation of immune complexes; and detecting said immune complexes formed.
17. The method of claim 16, wherein said biological sample is selected from the group consisting of blood, plasma, serum and urine.
18. The method of claim 16, wherein said first antibody is linked to a detectable label and the immune complexes are detected by detecting the presence of said label.
19. A method of decreasing the specific activity of human xanthine dehydrogenase and human xanthine oxidase in an individual in need of such treatment, comprising the step of administering to said individual a therapeutically effective dose of the monoclonal antibody of claim 2.
20. A pharmaceutical composition, comprising the monoclonal antibody of claim 2 and a pharmaceutically acceptable carrier.
PCT/US1996/008173 1995-05-31 1996-05-31 Monoclonal and polyclonal antibodies against recombinant human xanthine oxidase, method for their use and a kit containing same WO1996038483A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU64757/96A AU6475796A (en) 1995-05-31 1996-05-31 Monoclonal and polyclonal antibodies against recombinant hum an xanthine oxidase, method for their use and a kit containi ng same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US45514895A 1995-05-31 1995-05-31
US08/455,148 1995-05-31

Publications (1)

Publication Number Publication Date
WO1996038483A1 true WO1996038483A1 (en) 1996-12-05

Family

ID=23807601

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1996/008173 WO1996038483A1 (en) 1995-05-31 1996-05-31 Monoclonal and polyclonal antibodies against recombinant human xanthine oxidase, method for their use and a kit containing same

Country Status (2)

Country Link
AU (1) AU6475796A (en)
WO (1) WO1996038483A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011022757A1 (en) * 2009-08-24 2011-03-03 Queensland University Of Technology Purine-targeted diagnosis and therapy of wounds
CN110079505A (en) * 2018-01-26 2019-08-02 中国药科大学 The monoclonal antibody and its preparation method and application of anti-yellowing purine oxidase

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5286718A (en) * 1991-12-31 1994-02-15 Ribi Immunochem Research, Inc. Method and composition for ameliorating tissue damage due to ischemia and reperfusion

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5286718A (en) * 1991-12-31 1994-02-15 Ribi Immunochem Research, Inc. Method and composition for ameliorating tissue damage due to ischemia and reperfusion

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BIOCHEM. J., 1980, Vol. 188, MATHER et al., "Preparation of Monoclonal Antibodies to Xanthine Oxidase and Other Proteins of Bovine Milk-Fat-Globule Membrane", pages 925-928. *
BIOCHEM. J., 1984, Vol. 219, KAETZEL et al., "Characterization of a Monoclonal Antibody to Bovine Xanthine Oxidase", pages 917-925. *
BIOCHEM. SOC. TRANS., 1990, Vol. 18, BENBOUBETRA et al., "Human Monoclonal Antibodies to Xanthine Oxidase", pages 1008-1009. *
J. CLIN. INVEST., September 1984, Vol. 74, BRUDER et al., "High Concentrations of Antibodies to Xanthine Oxidase in Human and Animal Sera, Molecular Characterization", pages 783-794. *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011022757A1 (en) * 2009-08-24 2011-03-03 Queensland University Of Technology Purine-targeted diagnosis and therapy of wounds
CN110079505A (en) * 2018-01-26 2019-08-02 中国药科大学 The monoclonal antibody and its preparation method and application of anti-yellowing purine oxidase

Also Published As

Publication number Publication date
AU6475796A (en) 1996-12-18

Similar Documents

Publication Publication Date Title
Marklund Properties of extracellular superoxide dismutase from human lung
Markland et al. Purification and properties of a thrombin-like enzyme from the venom of Crotalus adamanteus (Eastern diamondback rattlesnake)
Haile et al. Cellular regulation of the iron-responsive element binding protein: disassembly of the cubane iron-sulfur cluster results in high-affinity RNA binding.
Adachi et al. Binding of human xanthine oxidase to sulphated glycosaminoglycans on the endothelial-cell surface
Jung et al. S-glutathiolated hepatocyte proteins and insulin disulfides as substrates for reduction by glutaredoxin, thioredoxin, protein disulfide isomerase, and glutathione
Sternweis et al. Characterization of the purified membrane attachment (δ) subunit of the proton translocating adenosine triphosphatase from Escherichia coli
Sato et al. Monkey 3-deoxyglucosone reductase: tissue distribution and purification of three multiple forms of the kidney enzyme that are identical with dihydrodiol dehydrogenase, aldehyde reductase, and aldose reductase
US4980279A (en) Cellular fibronectin: polypeptides, anti-polypeptide antibodies and assay methods
JPS61239889A (en) Part specific activation of substance and its use
Paolicchi et al. Localization of a GSH-dependent dehydroascorbate reductase in rat tissues and subcellular fractions
LOHRER et al. Purification and characterization of lipoamide dehydrogenase from Trypanosoma cruzi
Kitajima et al. Purification and properties of human erythrocyte membrane NADH-cytochrome b5 reductase
JPH03117484A (en) Plasminogen activator complex of pure pro-urokinase combining with human serum albumin
EP0805690B1 (en) Method for selective methionine starvation of malignant cells in mammals
Singh et al. Purification and characterization of unique glutathione S-transferases from human muscle
Kimura et al. A new tactic for the treatment of jaundice: an injectable polymer-conjugated bilirubin oxidase
Moenner et al. Ribonuclease inhibitor protein of human erythrocytes: characterization, loss of activity in response to oxidative stress, and association with Heinz bodies
JP4824581B2 (en) Stabilized ornithine transcarbamylase and immunoassay for ornithine transcarbamylase using the same
Bitar et al. Histidinol dehydrogenase from Salmonella typhimurium and Escherichia coli: Purification, some characteristics and the amino acid sequence around a reactive thiol group
WO1996038483A1 (en) Monoclonal and polyclonal antibodies against recombinant human xanthine oxidase, method for their use and a kit containing same
RU2183214C2 (en) Natural and recombinant thrombin inhibitors, their preparing and use
Murakami et al. The NH2-Terminal Structures of Human and Rat Liver Microsomal NADH-Cytochrome b 5 Reductases
Podlasek et al. Streptokinase binds to lactate dehydrogenase subunit-M, which shares an epitope with plasminogen.
Furuta et al. Purification and properties of 3-hydroxyacyl coenzyme A dehydrogenase-binding protein from rat liver mitochondria
Chang et al. Characterization of two enzyme proteins catalyzing NADP+ NADPH-dependent oxidoreduction of prostaglandins at C-9 and C-15 from swine kidney

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase