WO1996036707A1

WO1996036707A1 - CANDIDA HEAT SHOCK PROTEIN, cDNA AND USES THEREOF

Info

Publication number: WO1996036707A1
Application number: PCT/IT1996/000097
Authority: WO
Inventors: Antonio Cassone; Roberto La Valle; Carla Bromuro; Andrea Crisanti; Hans Michael MÜLLER
Original assignee: Universita' Degli Studi Di Roma 'la Sapienza'; Istituto Superiore Di Sanita
Priority date: 1995-05-16
Filing date: 1996-05-15
Publication date: 1996-11-21
Also published as: ITRM950314A1; EP0826040A1; IT1282287B1; AU5777696A; ITRM950314A0

Abstract

A nucleotide sequence and related protein from Candida homologous to 70 kd heat shock protein, for uses in diagnosis and therapy.

Description

CANDIDA HEAT SHOCK PROTEIN, CDNA AND USES THEREOF

The invention concerns the cDNA and the corresponding protein of a heat shock protein isolated from C. albicans, and fragments thereof to develop methods to identify C. albicans in biological and/or environment samples, and/or preparations either for therapeutic, prophylaxis or vaccine purpose.

Pathogenic yeasts are the major agents of opportunistic infections in immunosuppressed patients, in particular AIDS, tumor, neutropenia patients or bone marrow transplanted subjects (1) . HIV^* subject susceptibility to C. albicans is related to the strong decrease of cell-mediated immunity because of the numerical and functional decrease of CD4⁺ helper-inducer lymphocytes (2) .

C. albicans cell wall mannoproteins and heatshock proteins of other microorganisms as well, are major antigens and immunomodulators, and play a relevant role during host invasion and infection (3,4). By using a rabbit immune serum obtained against heat-inactivated C. albicans ATCC 20955 strain cells, the authors of the instant invention isolated the caRLV130 clone from an expression library in the λgtll phage obtained by cDNA isolated from C. albicans at the yeast growth stage. Said clone contains a DNA insert of 2325 base pairs which codes in the 5'-3' direction from +105 to +2072 for a 656 aminoacid protein having a strong homology with a S. cerevisiae heat shock protein 70.

HSPs are induced by different stresses, either chemical or physical, normally by heating. Many HSPs are present and active also in non stressed cells, where they play important functions of cell physiology

("chaperonins") . They may be grouped in families of different molecular weights, very conserved even among phylogenesis distant organisms (5) . Therefore it should not be surprising either that HSPs are involved in the immune response, or that they represent major antigens of different pathogenic agents, or that they may give autoimmune responses, given to the fact that the infection itself represents an extreme form of stress, both for the infectious agent and for the host (4) .

It is therefore an object of the invention a nucleic acid comprising a nucleotide sequence coding the protein having the amino acid sequence of SEQ ID No.2 or parts thereof. Preferably the nucleic acid comprises a nucleotide sequence with at least a 65% homology with the nucleotide sequence of SEQ ID No.l or parts thereof. More preferably the nucleic acid comprises the nucleotide sequence of SEQ ID No.l or parts thereof.

Further object of the invention is a composition comprising a nucleic acid comprising a nucleotide sequence coding the protein having the amino acid sequence of SEQ ID No.l or parts thereof. Preferably the composition comprises a nucleic acid having a nucleotide sequence with at least a 65% homology with the nucleotide sequence of SEQ ID No.l or parts thereof. More preferably the composition comprises a nucleic acid having the nucleotide sequence of SEQ ID No.l or parts thereof.

Further object of the invention is the use of the nucleic acid comprising a nucleotide sequence coding the protein having the amino acid sequence of SEQ ID No.2 or parts thereof for oligonucleotide probes to be used in diagnosis and typing of Candida related pathologies. The use of a nucleic acid having at least a 65% homology with the nucleotide sequence of SEQ ID No.l or parts thereof is preferred. The use of a nucleic acid having the nucleotide sequence of SEQ ID No.l or parts thereof is most preferred.

The oligonucleotides of the invention are advantageously used for PCR (polymerase chain reaction) to detect the presence in biological and/or environment samples either of C. albicans or of other Candida species or of yeast-like related microorganisms comprising said gene; in a labeled form (radionuclides, biotin, enzymes, etc.) to detect the presence in biological and/or environment samples either of C. albicans or of other related; for the C. albicans or related species typing and/or diagnosis; as potential antibiotic and/or chemiotherapic targets, or antisense RNA active for Candida species and/or, yeast-like related microorganisms coding an homologous sequence.

Another object of the invention is a polypeptide having the aminoacid sequence comprised in the SEQ ID No.2, or having at least a 50% homology with SEQ ID No. 2 or fragments, and/or functional and immunologic homologous thereof.

Further object of the invention is a composition comprising a polypeptide having an amino acid sequence comprised in SEQ ID No.2 or having at least a 50% homology with SEQ ID No. 2 or fragments, and/or functional and immunologic homologous thereof.

Further object of the invention is the use of a polypeptide having the amino acid sequence comprised in SEQ ID No.2 or having at least a 50% homology with SEQ ID No. 2 or of fragments, and/or functional and/or immunologic homologous thereof to make polyclonal or monoclonal antibodies against the 70 kd heat shock protein (HSP70) of C. albicans or related species.

Further object of the invention is the use of a polypeptide having the amino acid sequence comprised in SEQ ID No.2 or having at least a 50% homology with SEQ ID No. 2 or of fragments, and/or functional and/or immunologic homologous thereof to detect C. albicans and related species HSP70 in a biological sample having a human, animal or environmental origin.

Further object of the invention is the use of a polypeptide having the amino acid sequence comprised in SEQ ID No.2 or having at least a 50% homology with SEQ ID No. 2 or of fragments, and/or functional and/or immunologic homologous thereof for the preparation of a composition to be used for prophylaxis and/or therapy of C. albicans or related microorganisms (pathogenic yeasts) diseases.

Further object of the invention is the use of a polypeptide having the amino acid sequence comprised in SEQ ID No.2 or having at least a 50% homology with SEQ ID No. 2 or of fragments, and/or as potential antibiotic and/or chemiotherapic targets active for Candida species and/or yeast-like related microorganisms coding an homologous sequence.

The invention will be described in different embodiments for clarifying but not limiting purposes.

Figure 1 represents the 1971 base pair DNA sequence (small letters) corresponding to the open reading frame of λgtll- (caRLAl30) clone insert and deduced aminoacid sequence (capital letters one-letter code) .

Figure 2 represents the nucleotide sequence of the coding insert of caRLV130 clone (small letter) and comparison with S. cerevisiae YSCSSA1 gene (capital letter) .

Figure 3 represents the 656 aminoacid sequence deduced from the coding insert of caRLV130 clone (small letter) and comparison with the S. cerevisiae YSCSSA1 gene (capital letter) . The aminoacid code utilized is the one letter code.

Figure 4 represents in panel A. Southern blot analysis of C. albicans strain ATCC 20955 chromosomes, obtained by pulse field electrophoresis (TAFE) . The caRLV130 probe labeling refers to the highest molecular weight chromosome (3.5 Mbp) . In panel B. Electrophoretic separation of C. albicans strain ATCC 20955 chromosomes. Figure 5 represents on the left side: Northern blot analysis by hybridization of total RNA extracted from C. albicans cells grown at 22°C and transferred at 37°C for the time indicated with radiolabeled caRLV130 (cahsp70) and actin probes. The actin probe hybridization was performed to control the RNA amount on filters (see ref. 8) . On the right side: immunoblotting reactivity of anti- CAHSP70 mouse serum with C. albicans extracts, at different times further to inducing a heat shock response as previously described.

Figure 6 represents in panel A. SDS-PAGE analysis: a) expression products of E. coli M15 containing the pDS5β/RBS-E^"-6his caRLV130/l plas id; b) expression products of E. coli M15 containing the pDS56/RBS-E^"-6his caRLV130/2 plasmid; c) expression products of E. coli M15 containing the pDS56/RBS-E^"-6his caRLV130/3 plasmid; d) expression products of E. coli M15 containing the pDS56/RBS-E^"-6his caRLV130/4 plasmid. N.I.: Non induced E. coli culture extracts. I.: 1 mM IPTG induced E. coli culture extracts. P.: Purified fraction on histidine affinity nickel column from 1 mM IPTG induced E. coli culture extracts. In panel B. Schematic representation of caRLV130 coding sequence portions cloned into recombinant plas ids used in panel A. Right side: molecular weight in kDa. Left side: denomination of the expression product of recombinant plasmid. For further details, see table I. Figure 7 represents the reactivity after immunoblotting on nitrocellulose filters of mouse sera as shown in the figure obtained against CAHSP70 fragments; a) expression products of nickel column purified pDS56/RBSII-E^"-6his caRLV130/l plasmid in 1 mM IPTG induced E. coli; b) expression products of nickel column purified pDS56/RBSII-E^"-6his caRLV130/2 plasmid in 1 mM IPTG induced M15 E. coli; c) expression products of nickel column purified pDS56/RBSII-E^"-6his caRLV130/3 plasmid in 1 mM IPTG induced M15 E. coli; d) expression products of nickel column purified pDS56/RBSII-E^"-6his caRLV130/4 plasmid in 1 mM IPTG induced M15 E. coli (see also Fig. 6 and table I for a definition of polypeptide fragments) . Left side: molecular weight of purified fragments.

Figure 8 represents the reactivity after immunoblotting on nitrocellulose filters of wealthy human sera obtained against CAHSP70 and fragments thereof; a) expression products of nickel column purified pDS56/RBSII-E^"-6his caRLV130/l plasmid in 1 mM IPTG induced M15 E. coli; b) expression products of nickel column purified pDS56/RBSII-E^"-6his caRLV130/2 plasmid in 1 mM IPTG induced M15 E. coli; c) expression products of nickel column purified pDS56/RBSII-E^"-6his caRLV130/3 plasmid in 1 mM IPTG induced M15 E. coli; d) expression products of nickel column purified pDS5β/RBSII-E^"-6his caRLV130/4 plasmid in 1 mM IPTG induced M15 E. coli. Left side: molecular weight of purified fragments. Right side: denomination of purified protein fragments. For further details see also table I.

Figure 9 represents in panel A. PCR experiment performed using oligonucleotide combination CA2-CA3 in the presence of C. albicans, C. parapsilosis (2) , C. glabrata (3), C. guillermondii (4) , C. krusei (5), C_;_ tropicalis (6), Mus muris (7), E. coli (8), S. cerevisiae (9) DNAs. Control with no DNA is as (10). At the right side the molecular weight of the amplified fragment is indicated. In panel B. PCR experiment using the combination of CA1-CA4 oligonucleotides in the presence of C. albicans cDNA: DNA amplified from C. albicans DNA: 10 ng (2); 1 ng (3); 100 pg (4); 10 pg (5); 1 pg (6). Control: reaction with no DNA (1). PCR reaction conditions are as follows: 90 sec. 94°C denaturation; 90 sec. 60°C annealing; 120 sec. 72°C extension; 25 cycles. Figure 1 shows the 1971 bp coding region of the isolated gene.

The caRLV130 sequence was filed with EMBL data base (No. Z30210) . No intron can be found in the intronic sequence, as shown by PCR product analysis and by ^λSouthern-blot". By comparing the caRLV130 insert sequence with sequences present in the 6.7 version "GENE BANK" data base, some homologies can be detected. The insert shows the most high homology with the S^ cerevisiae gene SSAl (one of the nine heatshock yeast gene family) . The overall nucleotide sequence homology is of 78.8% in the coding region (figg. 2 and 3).

The gene corresponding to the caRLV130 sequence was mapped on the C. albicans chromosome showing the highest molecular weight (3.5 Mpb) by pulse field electrophoresis (transverse-alternate: TAFE) utilizing the caRLV130 labeled cDNA insert as hybridization probe with C. albicans chromosomes blotted on nitrocellulose filters (fig. 4A an 4B) . Gene transcription is activated by exposing cells to a temperature higher than room temperature (thermal shift from 22°C to 37°C) . Such finding was demonstrated by hybridization experiments using C. albicans total RNA (from cells grown either at 22°C or at 37°C, fractionated according to molecular weight on formaldehyde agarose gel and blotted on nitrocellulose -filters) and the caRLV130 DNA insert as radioactive probe. The induction of transcription is coupled also to an increase of protein expression, 2, 6 and 24 hours further to the 22°C to 37°C temperature shift (see fig. 5) .

Different portions of the caRLV130 insert sequence were cloned in the expression plasmid pDS5β/RBSII-E^"-6his

(6), and coded polypeptides were expressed in E. coli after fusion of their amino terminal sequence with 6 histidine residues. The histidine stretch allowed to a rapid and efficient purification of polypeptides derived from the caRLV130 insert sequence on nickel columns (see fig. 6 and table I for denomination and length of polypeptide fragments) .

Table I

Definition of nickel column purified CAHSP70 polypeptides. Peptides are coded by pDS56/RBSII-E^"-6his recombinant plasmids wherein caRLV130 fragments were cloned. The position refers to nucleotide and aminoacid sequences as shown in Fig. 1. The peptide length refers to the fusion product coded by the recombinant plasmid.

c 00 c :oding DNA coded peptide d enomination sequence position length denomination peptide position length location (nt) (bp) fragment (aa) on cDNA location

1/1 ID caRLV130/l whole 1-2229 2229 CAHSP70 whole 1-656 71.3 664 coding protein

73 caRLV130/2 3' end 1393-2229 837 CAHSP70/2 C-terminus 465-656 21.0 202 c cDNA r- m r caRLV130/3 5' end 1-732 732 CAHSP70/3 N-terminus 1-244 28.4 261 σ. cDNA caRLV130/4 5' end 1-1027 1027 CAHSP70/4 N-terminus 1-342 39.4 358 cDNA

After purification, recombinant peptides were used as immunogens to produce mouse immune sera and are therefore able also to induce monoclonal antibodies.

Therefore, according the immunization schedule shown in table II, polypeptides, and the whole purified protein as well, induce specific antibodies in a 18-22 g weight

Balb/c mouse.

Table II

Immunization schedule of 18-22 g weight Balb/c mice with CAHSP70 peptides purified as described in the text and in Fig.6.

Immunogen Immunization First boost Second boost Serum titer

(day 1) (day 21) (day 41) (day 51) CAHSP70 5 μg 5 μg 10 μg > 12.800

CAHSP70/2 5 μg 5 μg ^' 10 μg > 12.800

CAHSP70/3 5 μg 5 μg 10 μg > 12.800

CAHSP70/4 5 μg 5 μg 10 μg > 12.800

The indicated immunogen concentration was inoculated intraperitoneally in a 200 μl volume.

The titer was determined by indirect ELISA with the antigen used for coating at a 200 ng/well concentration, in a final volume of 100 μl, and represents the highest serum dilution able to give an ELISA positive reaction (optical density at 405 n > two fold the no antigen control value) .

Serum titers for each antigen resulted to be > 12.800 by immunoenzyme test (indirect ELISA) with the adsorbed antigen at 200 ng/well, in a final volume of 100 μl. The specificity of immunoenzyme test results were confirmed in immunoblot experiments on nitrocellulose filters, as shown in Fig. 7.

The same polypeptides were utilized as immunogens in proliferation assays on peripheral human blood lymphocytes by evaluating the ³H-thymidine uptake further to 7 day culturing according to standard techniques (7) . Results obtained with different donors (two examples are shown in table III) demonstrate that CAHSP70 is able to induce a good thymidine uptake and the proliferation of naive lymphocytes from umbilical cord blood (Table IV) , suggesting that the protein itself or parts thereof has a mitogenic activity.

Table III

Peripheral blood lymphocytes proliferation induction activity of CAHSP70 and fragments thereof

inducing materials dose lymphoproliferative activity "^"Η-thymidine uptake

(cp ± SD/2xl0⁴ cells) none - 500 ± 200

MP-F2 50 μg/ l 13.393 ± 11.555

IL-2 100 U/ml 28.205 ± 18.014

CAHSP70 1 μg/ml 8.730 ± 5.181

CAHSP70/2 1 μg/ml 2.900 ± 2.300

CAHSP70/3 1 μg/ml 3.600 ± 2.700

CAHSP70/4 1 μg/ml 11.685 ± 8.174

Lymphoproliferation of wealthy donor peripheral blood lymphomonocyte cultures further to induction with the CAHSP70 cloned fragments. Positive controls: C. albicans mannoproteic antigen (MP-F2) and Interleukin-2 (IL-2) . Negative controls: no materials. Shown values represent average values ± SD from 7 experiments with 5 different donors. ³H-thymidine uptake was determined after 7 days of culture. For technical details, see ref. 7.

Table IV

Umbilical cord blood cell proliferation induction activity of CAHSP70 and fragments thereof

inducing materials dose lymphoproliferative activity

^JH-thymidine uptake

(cpm ± SD/2xl0⁴ cells) cord blood 1 cord blood 2 none 2.5 ± 0.4 1.3 ± 0.3

IL-2 100 U/ml 37.7 ± 4.5 32.8 ± 6.0

MP-F2 50 μg/ml 3.0 ± 1.4 1.5 ± 0.4

CAHSP70 1 μg/ml 12.5 ± 1.8 22.8 ± 6.6

CAHSP70/2 1 μg/ml 18.2 ± 3.0 23.1 ± 3.9

CAHSP70/3 1 μg/ml 23.8 ± 5.4 20.6 ± 9.2

CAHSP70/4 1 μg/ml 14.8 ± 3.9 17.2 ± 1.7

Proliferation of two donor umbilical cord blood cultures further to induction with the CAHSP70 cloned fragments. Positive controls: C. albicans mannoproteic antigen (MP- F2) and Interleukin-2 (IL-2) . Negative controls: no materials. Shown values represent average values ± SD from 3 wells. For technical details, see table III legend and ref. 7.

Furthermore, immunoblotting experiments revealed the presence of anti-CAHSP70 antibodies in sera from adult wealthy humans, and in particular of the anti-CAHSP70/4 fragment (Fig. 8) , suggesting that this fragment contains the immunodominant epitope. Taken together, lymphoproliferations human serum immunoblotting data suggest inequivocabilly that CAHSP70 is recognized by the immune system during the Candida usual colonization of healthy subjects.

Moreover, in immunoblotting on nitrocellulose filters, anti-CAHSP70 murine sera recognize more than one component of the HSP70 family from heat induced C. albicans extracted proteins (Fig. 5) , thus showing that the expression product of caRLV130 insert is a C. albicans protein which is expressed after the heat shock. According to the above results we named as CAHSP70 the C. albicans protein having the following properties: I) it comprises the aminoacid sequence coded by the caRLV130 insert; II) its gene maps on C. albicans chromosome 1 (having the highest molecular weight); III) its expression is induced by temperature shift; IV) it induces specific antibodies able to recognize cloned and purified fragments (subunits) ; V) it induces a lymphoproliferation in lymphomonocytic cultures from peripheral human blood. The relevant gene was named as cahsp70.

The CAHSP70 cloning, and its molecular and biochemical characterization, allows to develop a diagnostic molecular method based upon the amplification of DNA inserts corresponding to caRLV130, other than immunological studies of C. albicans 70 kDa heat shock protein expression. According to the caRLV130 insert sequence, we have synthesized oligonucleotides which were utilized for polymerase chain reaction (PCR) experiments, to analyze their ability to amplify DNA fragments which are homologous to C. albicans caRLV130 DNA. Two oligonucleotides (CA2-CA4) were chosen in the regions showing the minimal homology between the caRLV130 cDNA sequence and known HSP70 coding gene sequences (see Fig. 2 for the caRLV130 and YSCSSA1 sequence aligning, see Table V for the definition of minimal homology regions and Table VI for the sequence of oligonucleotides which were utilized for the assay) . The combination of CA2 (GAAATGAAAGATAAGATTGGTGCA)and CA3 (CCACAGTAAATTACCTATTTCTTCCTC) oligonucleotides is able to amplify DNA fragments having the expected size and a sequence specific of C. albicans DNA (Fig. 9A) , whereas the assay sensitivity is shown in Fig. 9B by using CA1 (ATGTCTAAAGCTGTTGGTATTG) and CA4 (CTGCACCAATCTTATCTTTCATTTCACCATCATT) oligonucleotides.

Bibliographic references l.Odds. In "Candida and Candidiosis", Bailliere-Tindall, London (1988) . 2.Quinti et al. Clin. Exp. Immunol. 85, 485 (1991). 3.Torosantucci et al. J. Infect. Dis. 168, 427 (1993). 4.Kaufmann et al. in "The biology of heat shock and molecular chaperones'" R.I. Morimoto et al. Eds. CSHL press (1994) . 5.Morimoto et al. in "The biology of heat shock and molecular chaperones" R.I. Morimoto et al. Eds. CSHL press (1994) . δ.Stuber et al. Eur. J. Immunol. 220, 819 (1990). 7.Ausiello et al. Infect. Immun. 61, 4105 (1993). δ.Lasker B.A. et al. Expt. Micol. 16, 155 (1992).

SEQUENCE LISTING

( 1 ) GENERAL INFORMATION :

( i ) APPLICANT :

(A) NAME: Istituto Superiore di Sanita'

(B) STREET: Viale Regina Elena 299

(C) CITY: Rome

(E) COUNTRY: Italy (F) POSTAL CODE (ZIP): 00161

(A) NAME: Universita' degli Studi di Roma La Sapienza

(B) STREET: P.le Aldo Moro 5

(C) CITY: Rome (E) COUNTRY: Italy

(F) POSTAL CODE (ZIP) : 00184

(ii) TITLE OF INVENTION: Candida heath shock protein, gene and uses thereof

(iii) NUMBER OF SEQUENCES: 2

(iv) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentin Release #1.0, Version #1.30 (EPO)

(2) INFORMATION FOR SEQ ID NO: 1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 2001 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single (D) TOPOLOGY: linear

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION:1..1968 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:

ATG TCT AAA GCT GTT GGT ATT GAT TTA GGT ACA ACC TAT TCT TGT GTT 48 Met Ser Lys Ala Val Gly He Asp Leu Gly Thr Thr Tyr Ser Cys Val 1 5 10 15

GCT CAT TTT GCC AAT GAT AGA GTT GAA ATT ATT GCT AAT GAT CAA GGT 96 Ala His Phe Ala Asn Asp Arg Val Glu He He Ala Asn Asp Gin Gly 20 25 30

AAT AGA ACT ACC CCT TCA TTT GTT GCC TTC ACT GAT ACT GAA AGA TTG 144 Asn Arg Thr Thr Pro Ser Phe Val Ala Phe Thr Asp Thr Glu Arg Leu 35 40 45

ATT GGT GAT GCT GCC AAG AAT CAA GCT GCT ATG AAC CCA GCA AAC ACT 192 He Gly Asp Ala Ala Lys Asn Gin Ala Ala Met Asn Pro Ala Asn Thr 50 55 60

GTT TTC GAT GCT AAA CGT TTA ATT GGG AGA AAA TTT GAT GAT CCA GAA 240 Val Phe Asp Ala Lys Arg Leu He Gly Arg Lys Phe Asp Asp Pro Glu 65 70 75 80

GTT ATA AAT GAT GCT AAA CAT TTC CCA TTT AAA GTC ATT GAT AAA GCA 288 Val He Asn Asp Ala Lys His Phe Pro Phe Lys Val He Asp Lys Ala 85 90 95

GGT AAA CCA GTG ATT CAA GTT GAA TAT AAA GGT GAA ACT AAA ACT TTT 336 Gly Lys Pro Val He Gin Val Glu Tyr Lys Gly Glu Thr Lys Thr Phe 100 105 110

TCA CCA GAA GAA ATT TCT TCA ATG GTT TTA ACA AAA ATG AAA GAA ATT 38 Ser Pro Glu Glu He Ser Ser Met Val Leu Thr Lys Met Lys Glu He 115 120 125

GCT GAA GGT TAT TTG GGT TCT ACT GTT AAA GAT GCT GTT GTT ACT GTT 432 Ala Glu Gly Tyr Leu Gly Ser Thr Val Lys Asp Ala Val Val Thr Val 130 135 140

CCA GCT TAT TTC AAT GAT TCT CAA AGA CAA GCC ACC AAA GAT GCT GGT 480 Pro Ala Tyr Phe Asn Asp Ser Gin Arg Gin Ala Thr Lys Asp Ala Gly 145 150 155 160

ACT ATT GCT GGT TTG AAT GTT TTA AGA ATT ATT AAT GAA CCT ACT GCT 528 Thr He Ala Gly Leu Asn Val Leu Arg He He Asn Glu Pro Thr Ala 165 170 175 GCT GCC ATT GCT TAT GGT TTA GAT AAA AAA GGT TCC AGA GGT GAA CAT 576 Ala Ala He Ala Tyr Gly Leu Asp Lys Lys Gly Ser Arg Gly Glu His 180 185 190

AAT GTT TTA ATT TTC GAT TTG GGT GGT GGT ACT TTT GAT GTT TCA TTA 624 Asn Val Leu He Phe Asp Leu Gly Gly Gly Thr Phe Asp Val Ser Leu 195 200 205

TTA GCC ATT GAT GAA GGT ATT TTC GAA GTT AAA GCC ACT GCT GGT GAT 672 Leu Ala He Asp Glu Gly He Phe Glu Val Lys Ala Thr Ala Gly Asp 210 215 220

ACT CAT TTG GGT GGT GAA GAT TTT GAT AAC AGA TTA GTC AAC TTC TTT 720 Thr His Leu Gly Gly Glu Asp Phe Asp Asn Arg Leu Val Asn Phe Phe 225 230 235 240

ATT CAA GAA TTC AAG AGA AAG AAC AAG AAA GAT ATT TCC ACC AAC CAA 768 He Gin Glu Phe Lys Arg Lys Asn Lys Lys Asp He Ser Thr Asn Gin 245 250 255

AGA GCT TTA AGA AGA TTA AGA ACT GCT TGT GAA AGA GCC AAG AGA ACT 816 Arg Ala Leu Arg Arg Leu Arg Thr Ala Cys Glu Arg Ala Lys Arg Thr 260 265 270

TTG TCT TCT TCT GCT CAA ACC TCA ATT GAA ATT GAT TCC TTA TAT GAA 864 Leu Ser Ser Ser Ala Gin Thr Ser He Glu He Asp Ser Leu Tyr Glu 275 280 285

GGT ATT GAC TTC TAC ACT TCA ATC ACC AGA GCC AGA TTT GAA GAA TTG 912 Gly He Asp Phe Tyr Thr Ser He Thr Arg Ala Arg Phe Glu Glu Leu 290 295 300

TGT GCT GAC TTG TTT AGA TCC ACT TTA GAT CCA GTT GGT AAA GTT TTA 960 Cys Ala Asp Leu Phe Arg Ser Thr Leu Asp Pro Val Gly Lys Val Leu 305 310 315 320

GCT GAT GCC AAG ATT GAT AAA TCT CAA GTT GAA GAA ATT GTC TTG GTT 1008 Ala Asp Ala Lys He Asp Lys Ser Gin Val Glu Glu He Val Leu Val 325 330 335

GGT GGG TCC ACC AGA ATT CCA AAG ATT CAA AAA TTG GTT TCT GAT TTC 1056

Gly Gly Ser Thr Arg He Pro Lys He Gin Lys Leu Val Ser Asp Phe 340 345 350 TTT AAT GGT AAA GAA TTG AAT AAA TCT ATC AAC CCT GAT GAA GCT GTT 1104 Phe Asn Gly Lys Glu Leu Asn Lys Ser He Asn Pro Asp Glu Ala Val 355 360 365

GCT TAT GGT GCT GCT GTT CAA GCT GCC ATT TTA ACT GGT GAT ACT TCT 1152 Ala Tyr Gly Ala Ala Val Gin Ala Ala He Leu Thr Gly Asp Thr Ser 370 375 380

TCC AAG ACT CAA GAT ATT TTG TTA TTG GAT GTT GCT CCA TTG TCA TTA 1200 Ser Lys Thr Gin Asp He Leu Leu Leu Asp Val Ala Pro Leu Ser Leu 385 390 395 400

GGT ATT GAA ACT GCT GGT GGT ATC ATG ACC AAA TTG ATT CCA AGA AAT 1248 Gly He Glu Thr Ala Gly Gly He Met Thr Lys Leu He Pro Arg Asn 405 410 415

TCT ACT ATT CCA ACT AAG AAA TCA GAA ACT TTC TCC ACT TAT GCC GAT 1296

Ser Thr He Pro Thr Lys Lys Ser Glu Thr Phe Ser Thr Tyr Ala Asp 420 425 430

AAC CAA CCA GGT GTT TTG ATT CAA GTG TTT GAA GGT GAA AGA GCT AAA 1344 Asn Gin Pro Gly Val Leu He Gin Val Phe Glu Gly Glu Arg Ala Lys

435 440 445

ACT AAA GAT AAC AAC TTG TTG GGT AAA TTT GAA TTA TCT GGT ATT CCA 1392 Thr Lys Asp Asn Asn Leu Leu Gly Lys Phe Glu Leu Ser Gly He Pro 450 455 460

CCA GCT CCA AGA GGC GTC CCT CAA ATT GAA GTT ACT TTC GAT ATT GAT 1440 Pro Ala Pro Arg Gly Val Pro Gin He Glu Val Thr Phe Asp He Asp 465 470 475 480

GCT AAT GGT ATC TTG AAT GTT TCT GCT TTA GAA AAA GGT ACT GGT AAA 1488 Ala Asn Gly He Leu Asn Val Ser Ala Leu Glu Lys Gly Thr Gly Lys 485 490 495

ACT CAA AAG ATT ACT ATC ACC AAC GAT AAA GGT AGA TTA TCC AAA GAA 1536 Thr Gin Lys He Thr He Thr Asn Asp Lys Gly Arg Leu Ser Lys Glu 500 505 510

GAA ATT GAT AAA ATG GTT AGT GAA GCT GAA AAA TTC AAA GAA GAA GAT 1584 Glu He Asp Lys Met Val Ser Glu Ala Glu Lys Phe Lys Glu Glu Asp 515 520 525 GAA AAG GAA GCT GCT AGA GTC CAA GCC AAG AAT CAA TTG GAA TCT TAT 1632 Glu Lys Glu Ala Ala Arg Val Gin Ala Lys Asn Gin Leu Glu Ser Tyr 530 535 540

GCT TAT TCA TTG AAA AAC ACA ATC AAT GAT GGT GAA ATG AAA GAT AAG 1680 Ala Tyr Ser Leu Lys Asn Thr He Asn Asp Gly Glu Met Lys Asp Lys 545 550 555 560

ATT GGT GCA GAT GAT AAA GAA AAA TTA ACT AAA GCC ATT GAT GAA ACT 1728 He Gly Ala Asp Asp Lys Glu Lys Leu Thr Lys Ala He Asp Glu Thr

565 570 575

ATT TCT TGG TTA GAT GCA TCT CAA GCT GCT TCT ACT GAA GAA TAC GAA 1776 He Ser Trp Leu Asp Ala Ser Gin Ala Ala Ser Thr Glu Glu Tyr Glu 580 585 590

GAT AAA CGT AAA GAA TTA GAA TCA GTT GCT AAT CCA ATC ATT AGT GGT 1824

Asp Lys Arg Lys Glu Leu Glu Ser Val Ala Asn Pro He He Ser Gly 595 600 605

GCT TAT GGT GCT GCC GGT GGC GCT CCA GGT GGT GCA GGC GGA TTC CCA 1872

Ala Tyr Gly Ala Ala Gly Gly Ala Pro Gly Gly Ala Gly Gly Phe Pro 610 615 620

GGT GCT GGT GGC TTC CCA GGT GGT GCC CCA GGT GCC GGT GGT CCA GGT 1920 Gly Ala Gly Gly Phe Pro Gly Gly Ala Pro Gly Ala Gly Gly Pro Gly 625 630 635 640

GGT GCT ACT GGT GGT GAA TCT AGT GGA CCA ACT GTT GAA GAA GTT GAT 1968 Gly Ala Thr Gly Gly Glu Ser Ser Gly Pro Thr Val Glu Glu Val Asp

645 650 655

TAAATGAGGAAGAAATAGGTAATTTACTGTGG 2000

(2) INFORMATION FOR SEQ ID NO: 2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 656 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:

Met Ser Lys Ala Val Gly lie Asp Leu Gly Thr Thr Tyr Ser Cys Val 1 5 10 15 Ala His Phe Ala Asn Asp Arg Val Glu lie lie Ala Asn Asp Gin Gly 20 25 30

Asn Arg Thr Thr Pro Ser Phe Val Ala Phe Thr Asp Thr Glu Arg Leu

35 40 45 lie Gly Asp Ala Ala Lys Asn Gin Ala Ala Met Asn Pro Ala Asn Thr 50 55 60

Val Phe Asp Ala Lys Arg Leu lie Gly Arg Lys Phe Asp Asp Pro Glu

65 70 75 80

Val lie Asn Asp Ala Lys His Phe Pro Phe Lys Val He Asp Lys Ala

85 90 95 Gly Lys Pro Val He Gin Val Glu Tyr Lys Gly Glu Thr Lys Thr Phe

100 105 110

Ser Pro Glu Glu He Ser Ser Met Val Leu Thr Lys Met Lys Glu He

115 120 125

Ala Glu Gly Tyr Leu Gly Ser Thr Val Lys Asp Ala Val Val Thr Val 130 135 140

Pro Ala Tyr Phe Asn Asp Ser Gin Arg Gin Ala Thr Lys Asp Ala Gly

145 150 155 160

Thr He Ala Gly Leu Asn Val Leu Arg He He Asn Glu Pro Thr Ala

165 170 175 Ala Ala He Ala Tyr Gly Leu Asp Lys Lys Gly Ser Arg Gly Glu His

180 185 190

Asn Val Leu He Phe Asp Leu Gly Gly Gly Thr Phe Asp Val Ser Leu

195 200 205

Leu Ala He Asp Glu Gly He Phe Glu Val Lys Ala Thr Ala Gly Asp 210 215 220

Thr His Leu Gly Gly Glu Asp Phe Asp Asn Arg Leu Val Asn Phe Phe

225 230 235 240

He Gin Glu Phe Lys Arg Lys Asn Lys Lys Asp He Ser Thr Asn Gin

245 250 255 Arg Ala Leu Arg Arg Leu Arg Thr Ala Cys Glu Arg Ala Lys Arg Thr

260 265 270

Leu Ser Ser Ser Ala Gin Thr Ser He Glu He Asp Ser Leu Tyr Glu

275 280 285

Gly He Asp Phe Tyr Thr Ser He Thr Arg Ala Arg Phe Glu Glu Leu 290 295 300

Cys Ala Asp Leu Phe Arg Ser Thr Leu Asp Pro Val Gly Lys Val Leu 305 310 315 320

Ala Asp Ala Lys He Asp Lys Ser Gin Val Glu Glu He Val Leu Val 325 330 335

Gly Gly Ser Thr Arg He Pro Lys He Gin Lys Leu Val Ser Asp Phe

340 345 350

Phe Asn Gly Lys Glu Leu Asn Lys Ser He Asn Pro Asp Glu Ala Val 355 360 365 Ala Tyr Gly Ala Ala Val Gin Ala Ala He Leu Thr Gly Asp Thr Ser 370 375 380

Ser Lys Thr Gin Asp He Leu Leu Leu Asp Val Ala Pro Leu Ser Leu 385 390 395 400

Gly He Glu Thr Ala Gly Gly He Met Thr Lys Leu He Pro Arg Asn 405 410 415

Ser Thr He Pro Thr Lys Lys Ser Glu Thr Phe Ser Thr Tyr Ala Asp

420 425 430

Asn Gin Pro Gly Val Leu He Gin Val Phe Glu Gly Glu Arg Ala Lys 435 440 445 Thr Lys Asp Asn Asn Leu Leu Gly Lys Phe Glu Leu Ser Gly He Pro 450 455 460

Pro Ala Pro Arg Gly Val Pro Gin He Glu Val Thr Phe Asp He Asp 465 470 475 480

Ala Asn Gly He Leu Asn Val Ser Ala Leu Glu Lys Gly Thr Gly Lys 485 490 495

Thr Gin Lys He Thr He Thr Asn Asp Lys Gly Arg Leu Ser Lys Glu

500 505 510

Glu He Asp Lys Met Val Ser Glu Ala Glu Lys Phe Lys Glu Glu Asp 515 520 525 Glu Lys Glu Ala Ala Arg Val Gin Ala Lys Asn Gin Leu Glu Ser Tyr 530 535 540

Ala Tyr Ser Leu Lys Asn Thr He Asn Asp Gly Glu Met Lys Asp Lys 545 550 555 560

He Gly Ala Asp Asp Lys Glu Lys Leu Thr Lys Ala He Asp Glu Thr 565 570 575

He Ser Trp Leu Asp Ala Ser Gin Ala Ala Ser Thr Glu Glu Tyr Glu

580 585 590

Asp Lys Arg Lys Glu Leu Glu Ser Val Ala Asn Pro He He Ser Gly 595 600 605 Ala Tyr Gly Ala Ala Gly Gly Ala Pro Gly Gly Ala Gly Gly Phe Pro 610 615 620

Gly Ala Gly Gly Phe Pro Gly Gly Ala Pro Gly Ala Gly Gly Pro Gly 625 630 635 640

Gly Ala Thr Gly Gly Glu Ser Ser Gly Pro Thr Val Glu Glu Val Asp 645 650 655

Claims

1. A nucleic acid comprising a nucleotide sequence coding the protein having the amino acid sequence of SEQ ID No.2 or parts thereof.

2. A nucleic acid comprising a nucleotide sequence with at least a 65% homology with the nucleotide sequence of SEQ ID No.l or parts thereof.

3. A nucleic acid according to claim 2 comprising the nucleotide sequence of SEQ ID No.l or parts thereof.

4. Composition comprising a nucleic acid according to any of claims 1 to 3.

5. Use of the nucleic acid according to any of claims 1 to 3 for oligonucleotide probes to be used in diagnosis and typing of Candida and Candida related pathologies.

6. Oligonucleotide having a sequence comprised in SEQ ID No. 1 to be used for PCR (polymerase chain reaction) to detect the presence in biological and/or environment samples either of C. albicans or of other Candida species or of yeast-like related microorganisms comprising said gene and/or in a labeled form (radionuclides, biotin, enzymes, etc.) to detect the presence in biological and/or environment samples either of C. albicans or of other related and/or for the C. albicans or related species typing and/or diagnosis and/or as potential antibiotic and/or chemiotherapic targets, or antisense RNA active for Candida species and/or yeast-like related microorganisms coding an homologous sequence.

7. Polypeptide having the aminoacid sequence comprised in the SEQ ID No.l, or having at least a 50% homology with SEQ ID No. 1 or fragments, and/or functional and immunologic homologous thereof.