WO1996034942A1

WO1996034942A1 - Novel retrovirus and diagnostic methods

Info

Publication number: WO1996034942A1
Application number: PCT/GB1996/001073
Authority: WO
Inventors: David John Griffiths; Robert Anthony Weiss; Patrick John Woodgate Venables; Mark Thomas Boyd
Original assignee: David John Griffiths; Robert Anthony Weiss; Patrick John Woodgate Venables; Mark Thomas Boyd
Priority date: 1995-05-05
Filing date: 1996-05-03
Publication date: 1996-11-07
Also published as: AU5509896A; GB9509245D0; EP0873401A1; CA2231854A1

Abstract

The present application relates to a novel retrovirus, detected in human salivary gland and lymphoid tissues and associated with autoimmune disease, as well as nucleotide sequences derived from said virus, diagnostic techniques and kits, to antibodies which bind said retrovirus and their use in diagnosis. Also included are methods of treatment of autoimmune disease and compositions for use in those methods. The retrovirus is particularly associated with Sjögren's syndrome (SS) which is a systemic autoimmune disease characterised by destruction of exocrine glands, particularly salivary and lacrimal glands.

Description

Novel Retrovirus and Diagnostic Methods

Field of the invention

The present invention relates to a novel retrovirus, detected in human salivary gland and lymphoid tissues and associated with autoimmune disease, as well as diagnostic techniques and kits, to antibodies which bind said retrovirus and their use in diagnosis. Also included are methods of treatment of autoimmune disease and compositions for use in those methods .

Description of Related Art

Sjόgren's syndrome (SS) is a systemic autoimmune disease characterised by destruction of exocrine glands, particularly salivary and lacrimal glands. (Harley et al . Immunol . Ser 1991, 54, 247-274, and Fox et a.1 . Clin . Bioche . 1992. 25: 213-222) . Reduced secretion from these glands results in dryness of eyes (keratoconjunctivitis sicca) and mouth (xerostomia) and may produce symptoms such as corneal ulceration and severe dental decay. SS may present as a primary disease or as a secondary syndrome in association with other connective tissue diseases such as rheumatoid arthritis or systemic lupus erythematosus .

Both primary and secondary SS are characterised by an increase in B lymphocyte activity resulting in the production of a number of auto-antibodies (including anti- SSA (Ro) , anti-SSB (La) , rheumatoid factors and anti- nuclear antibodies) , hypergammaglobulinaemia and a forty fold increased risk of lymphoma. Firm diagnosis of SS is dependent upon histological examination of labial salivary glands revealing lymphocytic foci. These consist predominantly of CD4+ T cells but CD8+ T cells and B cells are also present . The aetiology of SS is unknown but, as with other autoimmune diseases, a combination of genetic and environmental factors is assumed to be responsible for initiating the immune response. The basis for this assumption is that the autoantibodies, which characterise the disease, may be induced as a part of the normal response to an exogenous agent. However, these antibodies, or a sub-set of these, cross react with self antigens and it is this which leads to pathology. The genetic component here determines whether or not certain types of antibody will be produced and in individuals of a certain genetic type infection will not yield auto-reactive antibodies.

Important genetic factors include certain HLA antigens which may predispose to disease. Primary SS patients have an increased frequency of HLA-DR3 (75%) compared to control subjects (20%) (Arnett F.C., et al . , Am. J. Med. 85 (Suppl. 6) 38-41) . It has also been suggested that certain HLA-DQ antigens may be associated with higher anti-SSA and anti- SSB titres as well as hypergammaglobulinaemia (Harley J.B., et al . , Science , 1986, 232: 1145-1147) .

Attempts to identify environmental factors involved in the aetiology of SS have focused on the role of viruses, particularly Epstein Barr virus (EBV) and retroviruses (Kreig A.M. et al . , J. Au toim un . 1990, 3: 137-166, and Flescher E., et al . , Am . J. Med . 1991, 90: 283-285) .

Several apparently disparate lines of evidence have suggested a retroviral association with SS . Occasionally individuals infected with HTLV-1 or HIV develop a SS-like condition, presumably a direct consequence of the viral infection. Studies with mice transgenic for the HTLV-I tax gene have found that in some cases this results in a SS- like pathology (Green J.E., et al . , Science, 1989, 341: 72- 74) . Serum antibodies have been detected which cross react with HIV p24 (CA) protein in 14/43 patients with SS (Talal N. , et al . , Arthri tis Rheum . , 1990, 33: 774-781) . In addition particles have been detected in lysates of co-cultures of SS salivary gland biopsies with the T-cell line RH9 (Gar y R.F., et al . , Science, 1990, 250: 1127-1129) . The particles resembled retroviral intracisternal A-types (IAP) and purified on a sucrose gradient at 1.22g ml^"1, the typical density of retroviral cores and IAPs . Furthermore these same fractions were positive for reverse transcriptase (RT) activity and cross-reacted with an anti- HIV p24 monoclonal antibody (Mab) .

Summary of the Invention

The applicants have found a new human retrovirus present in the salivary gland of patients suffering from SS. Partial cloning of the virus has revealed that the virus most closely resembles the D-type family of retroviruses as judged by its genetic structure and the sequence homology. It has been found that the cloned sequence is not endogenous in the patients and must therefore derive from an infectious virus.

The present invention provides a nucleotide sequence which is derived from a retrovirus which comprises a nucleotide sequence in the protease and polymerase genes as shown in Figure 2; or variants, mutants or fragments thereof.

As used herein the term 'variant' applies to retroviral sequences which are homologous in the protease and polymerase gene to the sequence shown in Figure 2, for example having at least 90% homology to the sequence. The term 'fragment' refers to fragments which are large enough to hybridise under stringent conditions to said sequence. Suitably such fragments will be from 20 bases to lkilobase in length, and preferably from 400-500 bases in length. The retroviral sequence was first identified in the salivary glands or lymphoid tissue of patients suffering from SS and other diseases and may be a crucial factor in the aetiology of this disease. Using a strategy combining sucrose gradient purification of retroviral particles with RT-PCR to identify packaged retroviral sequences, the applicants have partially cloned and sequenced the retroviruse. The region cloned is a lkbp fragment comprising the 3' region of the protease gene and the 5' region of the reverse transcriptase gene. The primers used were anchored in conserved regions of the genome and two overlapping fragments were obtained.

This approach, but using primers derived from other conserved regions of retroviruses, would be expected to yield further information with respect to the genome. Also use of inverse PCR techniques as outlined for example in Silver and Keerikatte, 1989, J. Virology, 63: 1924-1928, Och an et al . , 1988, Genetics, 120: 621-623 and Triglia et al . , Nuc. Acid Res. 16: 8186, using primers based upon the sequences given herein and applied to geonomic DNA from an infected biopsy sample would provide information with regard co the flanking sequences.

Diagnostic tests of infection by the virus based on immunological methods, such as peptide and protein enzyme linked immunosorbent assay (ELISAs) , and western blots, as well as on PCR and other DNA or RNA detection methods, form a further aspect of the invention.

Viral antigens form a further aspect of the invention. For instance, the retrovirus or viral antigens can be used to raise antibodies which may be monoclonal or polyclonal in a conventional manner.

These antibodies can be used to screen samples such as salivary gland biopsy samples and other tissues or cell cultures taken from patients suspected of suffering from SS and other diseases, by for example immunohistochemistry, for the presence of virus. Therefore the invention also provides an antibody which binds an antigen of the above described as well as diagnostic kits which contain said antibody.

Further suitable antigens which can be used to raise antibodies are those containing epitopes from the matrix (MA) and capsid (CA) and other gag proteins as well as envelope proteins .

In addition, the invention provides methods of detecting antibodies to viral proteins. These methods are useful in disease diagnosis, including SS . Particularly preferred is an ELISA for detection of antibodies to the virus peptides or proteins. Specific assay devices of the invention comprise a viral antigen of the retrovirus of the invention immobilised on a support. Suitably purified recombinant viral antigens are used. These antigens may be expressed in eukaryotic or prokaryotic cells such as bacterial, yeast or mammalian cells, preferably bacterial cells. Affinity purified anti-viral antigen sera such as rabbit sera can be used to capture antigen for immobilisation.

Although salivary gland biopsies are believed to be the richest source of viral sequences, it is estimated that the virus is present in as few as 0.1% of cells or less. However, as illustrated hereinafter the applicants have found that very low levels of virus can be detected using PCR techniques. Thus the invention further provides a method for detecting the retrovirus of the invention in a sample which comprises employing a DNA or RNA amplification method such as PCR in order to amplify a selected sequence from said virus, and detecting said sequence. Suitable sequences include the sequence of Figure 2 or fragments or variants thereof, such as the fragment encoding the amino acid sequence shown in Figure 1.

Using a nested PCR technique, the applicants have found that samples containing as little as 1-10 molecules of viral DNA per sample can be detected. When using this technique, care should be taken with controls in order to avoid false positives.

In si tu PCR techniques may also be employed as is known in the art. Such a technique would be advantageous in that the fact that only a small number of cells harbor the virus would not present a problem.

In addition cultured virus could form the basis of a virus isolation assay as is known in the art. Methods which may be useful in the culture of the virus include direct culture methods (such as those described by Weiss R.A. ,

Chpt 3 j i Weiss et al (eds) , 1982 RNA Tumor Viruses (Cold

Spring Harbor Laboratory press) and Brookes et al . , Bri t . J. Rheum . 1995 34: 226-231) , co-cultivation methods, for example by culturing salivary gland biopsies with a target cell line. In such a method, the salivary gland biopsy is either digested with trypsin or homogenised with a mortar and pestle. This is then placed into a flask with typically 10⁵-10⁶ tissue culture cells.

Suitable tissue cells which are permissive for viral growth may include T and B lymphocytes, fibroblasts and epithelial cells .

Alternatively virus may be cultured by xenografting virus into suitably nude or severe combined immunodeficient (SCID) mice. Using this method, salivary gland fragments may be implanted subcutaneously for example into the mid- flank of an anaesthetized mouse. After this, evidence of virus growth may be assessed using PCR for RNA and/or DNA or by the sensitive RT assay described by Silver et al . , Nucl eic Acids Res . 1993, 21: 3593-3594, and the virus isolated.

The retrovirus itself may be causally involved in autoimmune disease such as SS. Assuming this to be the case, the retrovirus could be used in screening methods to determine agents such as chemical compounds which are effective in the treatment of these diseases. Such screening methods, together with agents discovered as a result of them, form a further aspect of the invention.

In addition, the invention provides methods of treatment of SS involving for example the application of inhibitors of retroviral replication such as inhibitors of reverse transcription (such chain terminators, for example zidovudine) and protease inhibitors or other anti-viral drugs.

For use in these methods, the above-mentioned agents are suitably administered in the form of a pharmaceutical composition in which they are combined with a pharmaceutically acceptable carrier or diluent. Such compositions form a further aspect of the invention.

Suitable pharmaceutically acceptable carriers include solid and liquid carriers such as water, aqueous ethanol or the like, as are conventional in the art. The form of the composition may be suitable for oral, topical or parenteral use. Suitable forms of the composition include tablets, capsules, syringes, creams, suspensium, solutions, reconstitutable powders and sterile forms for injection or infusions. Other conventional pharmaceutical acceptable materials such as diluents, binders, preservative etc may be included.

The agent is administered in a therapeutically effective amount. The precise dosage will depend upon the particular agent being employed. The nature of the disease being located as well as the patient and can be determined by a clinician in the usual manner.

Brief Description of the drawings

The invention will now be particularly described by way of example with reference to the accompanying diagrammatic drawings in which:

Figure 1 shows the deduced amino acid sequence of a DNA sequence used as a sequence tag and designated Sjo-1 and its alignment with other, known retroviral sequences.

Figure 2 is a nucleotide sequence and translation of JC96 showing two open reading frames. The protease (PR) open reading frame is frame a and the reverse transcriptase (RT) open reading frame is frame c.

Figure 3 shows the FASTA alignment of the deduced amino acid sequences of JC96 and SRV-2.

Figure 4 shows the results of PCR amplification of the single copy endogenous retroviral element target ERV-3 and the JC96 retroviral sequence.

Figure 5 illustrates detection levels of titrated cloned JC96 sequence using nested PCR.

Figure 6 shows alignments of deduced PR and RT amino-acid sequences of clones of JC96 from five individuals. Note that the JC96 sequence extends further 5' than the other clones. This is because JC96 was obtained using degenerate primers whereas the other clones were -generated using internal specific primers based on the JC96 sequence.

Figure 7 shows primers for amplification of a larger fragment of the Sjo-l/JC96 viral sequence: integrase active site.

Figure 8 shows a Coomassie stained polyacrylamide (SDS- PAGE) gel of bacterially expressed proteins encoded by JC96.

Figure 9 shows a diagram of Indirect ELISA using His-myc tagged proteins.

Figure 10 shows a diagram of Capture ELISA using His-myc tagged proteins.

In the above described DNA gel figures, the markers are phi-X174 RF DNA digested with Hae III.

Description of the Preferred Embodiments

The following examples illustrate the invention.

Example 1

Cloning a sequence tag for Sio-1

Approximately lOmg of homogenised SS salivary gland lip biopsy were co-cultured with 10⁵ H9 cells in RPMI 1640 medium supplemented with 10% foetal calf serum (Biological Industries) . The cultures were passaged twice weekly at a ratio of 1:8. After 14 days, the cells were homogenised using an ultra-Turrax T25 tissue grinder (IKA Labortechnik) at maximum speed and on ice. Cellular debris was removed by centrifugation at 4,000g for 10 minutes at 4 C. The supernatant was then re-centrifuged at 20,000g for 20 minutes at 4 C to remove mitochondria and other sub- cellular organelles . The resultant supernatant was layered over a linear 20-65% (w/v) sucrose gradient. Sucrose gradients were prepared and run in a Beckman SW28 as described by Boyd et al . , Lancet, (1989) , ii:814-817. They were then centrifuged at 100,000g for 16 hours. 1ml fractions were collected and a 20μl solution of RNA was prepared from these as follows: to 250μl sucrose, 750μl of RNAzol B (Biotecx Laboratories, Inc. Texas) is added followed by 125μl chloroform. This mixture is then vortexed briefly, incubated on ice for 5 minutes and centrifuged at 13000g, 4oC for 15 minutes. Nucleic acids are then precipitated from the aqueous phase by addition of an equal volume of isopropanol and incubation on ice for 15 minutes. Precipitated RNA is pelleted by centrifugation (13000g, 4oC for 15 minutes) and the pellets washed in ice- cold 75% ethanol. Finally the RNA is resuspended in 20μl water.

These solutions were subjected to reverse transcriptase- polymerase chain reaction (RT-PCR) using the degenerate pol primers described by Shih et al . , J. Virol . (1989) 63: 64-

75 which are capable of amplifying a wide variety of retroviral sequences . The products were then cloned into the pBluescript (KS-) plasmid (Stratagene) using standard methods (Sambrook et al 1989, Molecular Cloning 2nd ed.

(Cold Spring Harbor Laboratory press) ) and sequenced using an Applied Biosystems model 373A automated DNA sequence. A

126bp clone was obtained and designated Sjo-1. Part of the deduced amino acid sequence of Sjo-1 is shown in Figure 1 aligned with several other retroviral sequences (identified in a FASTA search of the entire Genbank and EMBL databases) . The abbreviations and GenEMBL accession codes used in the Figure are as follows.

SRV-2 Simian type D retrovirus serotype 2 (gb_vi :M16605)

MMTV Mouse mammary tumor virus (gb_vi :M15122)

Jaag Jaagsiekte sheep retrovirus (gb_vi :M80216)

RSV Rous sarcoma virus (gb_vi :D10652)

HTLV-I Human T-cell leukemia virus type I (gb_vi :L10341) HIV-1 Human immunodeficiency virus type 1 (gb_vi :D21166)

MoMLV Moloney murine leukemia virus (gb_vi :J02255)

The Sjo-1 sequence was detected in co-cultures after 14 days of co-cultivation and was obtained from 'fractions with a buoyant density of 1.15-1.16g ml^"1 (the typical density of mature retroviral particles) . This sequence was not detected in co-cultures which were passaged for longer than a month. It appears that no transfer of the virus occurred in these experiments. Moreover, it is believed that the co-cultivation, if indeed it plays a role, leads to stimulation of the cells which produce the virus.

The closest homologues of this short region as illustrated in Figure 1 are the D and B-type retroviral sequences; SRV- 2 (simian retrovirus serotype 2) and MMTV (mouse mammary tumor virus) . Whilst the aligned region is too short for this comparison to be very meaningful, it did provide information which was useful in the design of subsequent primers for flanking regions such that these were biased towards B and D-type retroviral families as will be discussed in Example 2 below. Sjo-1 could not be detected in H9 cells which had not been co-cultivated with SS salivary gland biopsy. Co-cultures from three individuals, two with primary SS and one with sicca syndrome were examined. Both the SS co-cultures were positive for Sjo-1 RNA whilst the sicca sample was negative.

Example 2

Cloning a larger fragment of the viral DNA

Based upon the sequence of Sjo-1, degenerate primers for the active site of the protease (PR) gene of B and D-type retroviruses were designed. The PR gene, encoding as it does an enzyme, contains the second most highly conserved region of the retroviral genome. At the active site there is conservation of an aspartic acid-threonine-glycine (DTG) motif and this information was used in primer design. When these degenerate primers were used in conjunction with specific 3' primers anchored within the Sjo-1 sequence, a further 806bp of sequence was amplified from sucrose gradient purified viral RNA. The primers used were:

1992 (5' GAGGTCATCCATGTAGTGTAAAATTTG 3') , 1784 (5' TAAAATTTGTACTTTTGGGCACTGCTG 3') , 3095 (5' TAGAYACKGGAGCWGATGT 3') and 3096 (5' IIIITAGAYACWGGRGCMGA 3' ) .

Where: K= G or T, M=A or C, R= A or G, W= A or T, Y= C or T and 1= inosine.

Synthesis of the cDNA was primed with lOOng 1992, followed by PCR with 200ng each of 1992 and 3096. Cycles were 94oC 1 min, [94oC 1 min; 50oC 1 min; 72oC 1 min 30 sees] for 25 cycles and a final extension at 72 C for 7 mins . lμl of the 1st round product was transferred to a second PCR reaction using 200ng each of primers 3095 and 1784. Cycles were [94°C 1 min; 52oC 1 min; 72°C 1 min 30 sees] for 25 cycles followed by a final extension at 72oC for 7 mins. The nucleotide sequence and the deduced amino acid sequence of this new clone, designated JC96, are shown in Figure 2. The two Ncol restriction sites are marked in bold. This fragment was removed to generate the positive control plasmid for PCR (pJC96ΔΝco) . Note that nucleotides 1-14 and 918-932 are derived from the degenerate primers used to clone Sjo-1 and JC96 and so may not represent the genuine sequence of this element in those regions.

Figure 3 shows the amino acid sequence of JC96 aligned with SRV-2.

Example 3

Detection of JC96 sequences

Detection of the JC96 sequence was attempted as part of an experiment to determine whether the sequence was derived from an endogenous human retrovirus. If it had been derived from expression of such an endogenous virus, the sequence would reside in the human genome at the level of at least a single copy and could be cloned from a genomic library.

Using specific primers derived from several regions of the JC96 sequence, DNA prepared from salivary gland (over 20 samples) , peripheral blood lymphocytes (over 60 samples) and several other tissue samples from patients and control subjects was examined to determine the presence or absence of this novel sequence. These DNA samples were also screened using PCR for the endogenous retroviral sequence ERV-3 (Cohen et al , Virology 1985. 147 449-458) . ERV-3 is present as a single copy sequence in human genomic DNA and therefore serves as a useful control to check the quality of the DNA samples and PCR reagents. These experiments were repeated many times and a selection of typical results is shown in figure 4. In that figure the lanes are as follows :

M markers; Φ X174 RF DNA/Hae III digest 1 non-SS PBL DNA 2 non-SS PBL DNA

3 SS PBL DNA

4 SS PBL DNA

5 SS PBL DNA

6 non-SS PBL DNA 7 non-SS salivary gland DNA (patient MB in figure

4)

8 non-SS salivary gland DNA (patient FD in figure 4)

9 SS spleen DNA (patient RB in figure 4) 10 SS salivary gland DNA

W negative controls (amplification of water) P positive control plasmid carrying cloned JC96 with a 96bp deletion (pJC96ΔNco) .

Figure 4a shows results of PCR amplifications using ERV-3 specific primers. The primers used were: 1986 ( 5 ' GAGGCATAACTATAGGAGATTGG 3 ' ) and

1987 ( 5 ' CTATCCTTTCCAAGTCTGAACTG 3 ' )

conditions were 94<>C 1 min initial denaturation; forty cycles of [94oC 30 sees; 60oC 30 sees; 72oC 30 sees] and a final extension of 72oC for 7 minutes. A quarter of each PCR product was electrophoresed on a 1.5% agarose gel.

Figure 5b shows results of nested PCR with JC96 specific primers. lOOng of DNA was used in each PCR. 40ag (approximately 10 molecules) of positive control plasmid was used as template for lane P . The primers were :

3553 (5' TCAGGTGCTTCATTGGCAGGATCA 3') 1784 (5' TAAAATTTGTACTTTTGGGCACTGCTG 3' ) ,

2060 (5' TGGGGAAGAGACATTTTAGAACA 3' )

2061 (5' TGCTTTGGGATCATAGTAGGAAC 3' )

The first round PCR conditions used lOOng of 3553 and 4527. The cycles were 94oC 1 min, [94oC 30 sec; 65oC 30 sec; 72oC 30 sees] for 25 cycles and a final extension at 72°C for 7 mins. lμl of the 1st round product was transferred to a second PCR reaction using lOOng each of primers 2060 and 2061. Cycles were [94oC 30 sec; 60oC 30 sec; 72°c 30 sec] for 25 cycles followed by a final extension at 72oC for 7 minutes. One quarter of each product was electrophoresed on a 1.5% agarose gel.

All biopsies are positive for the single copy sequence ERV- 3 (fig 4a) but negative for JC96 (fig 4b) indicating that JC96 is not present as a single copy sequence in these samples. Given that lOOng of human genomic DNA represents approximately 30,000 copies of ERV-3 and that 10 molecules of cloned JC96 were detectable by nested PCR, these results indicate that the nested PCR assay is approximately 3000 times more sensitive than would be required to detect JC96 if it were present as a single copy in the human genome. Thus although the ERV-3 sequence could be detected in these samples the JC96 sequence could not. To examine this further we titrated the cloned JC96 sequence in the presence and absence of genomic DNA as shown in figure 5. Lanes are; 2) 0.4 attograms (ag) , 4) 4ag, 6) 40ag, 8) 400ag, 10) 4 femtogram (fg) , 12) 40fg of JC96 plasmid DNA. All odd lanes contain water controls. M is phi-X174 DNA cut with Haelll . Figures 5a.) and 5b.) are from a 25 cycle single stage PCR experiment in which we could detect JC96 plasmid at 40fg with or without 500ng of genomic DNA being added to the reaction. This is equivalent to 10,000 molecules of target sequence. Figures 5c.) and 5d. ) are from a nested PCR experiment in which 40ag could be detected both in the presence and absence of 500ng of genomic DNA. This is equivalent to 10 molecules of JC96 sequence per reaction.

These experiments again demonstrated that JC96 could be detected at l/3000th of the level of a single copy gene. Since the level of detection was not different in the presence or absence of genomic DNA, it appears that any difficulty in detecting JC96 sequences was not due to one or both of the primers for the PCR reaction being "mopped up" by annealing to members of the large population of endogenous retroviral sequences present in the genome. These results, which have been confirmed by Southern blot analysis (not shown) , indicated that JC96 could not be present as an intact endogenous retroviral element and therefore represents part of the pol gene of a novel exogenous human retrovirus.

An alternative explanation for these results might be that JC96 is an endogenous sequence but that the DNA copy contains an intron which is removed by splicing of exons following transcription. The largest fragment that may generally be detected by PCR is around 3kb and therefore the presence of an intron could explain why the sequence can be detected in RNA but not in DNA. However, this explanation is unlikely to be the case because although the sequence could not be detected in DNA from most samples it was detectable using nested PCR in salivary gland DNA from one SS patient (patient CH in figure 6) . This PCR product, when sequenced, was found to be almost identical to the RT- PCR product. Thus it appears that JC96 represents a part of the pol gene from a novel exogenous human retrovirus . In addition to this DNA sample, fragments of the sequence were also amplified using nested PCR from gradient fractionated RNA from two other SS salivary glands and two non-SS salivary glands and also from a spleen from a primary SS patient who had a B cell lymphoma. Comparison of 5 of these sequences using the CLUSTALV multiple sequence alignment computer program shows that they share over 97% homology at the nucleotide level (figure 6) .

In figure 6, the following annotations have been used: CH is from DNA of the submandibular gland of a primary SS patient

JC is the original clone from gradient fractionated RNA from a lip biopsy of a primary SS patient

RB was cloned by RT-PCR from gradient fractionated RNA from the spleen of a primary SS patient with a B-cell lymphoma

FD was cloned by RT-PCR from gradient fractionated RNA from the parotid gland of a non-SS subject

MB was cloned by RT-PCR from gradient fractionated RNA from the submandibular gland of a non-SS subject The differences are mostly single base changes but there are also apparent insertions and deletions of bases that do not disrupt the ORF. One interesting observation is that the majority of differences between the five sequences occur in the CH sequence which unlike the other four sequences was amplified from DNA. A further observation from this data is that the PR ORF of one of the clones, MB, is truncated by 39 amino acids. This would render the virus non-viable if it were not compensated for by the RT ORF opening 39 amino acids earlier in this clone. The lengths of the overlap of the two ORFs are identical. The significance of these observations is at present unclear.

When considering these data attention should be drawn to the fact that PCR is notorious for giving false positive results due to cross-contamination of samples with the products of previous PCR experiments. This problem is greatly exacerbated when performing nested PCR experiments as here. Therefore in the abovementioned experiments, care was taken with controls to avoid false positives and to monitor the occurrence of cross-contamination. Specifically the measures taken were :

i) Separation of all experimental samples by including water controls which are taken through both stages of the nested reaction.

ii) UV cross-linking reaction mixes prior :o the addition of template DNA.

iii) The use of a positive control which is a different size from the viral sequence. This was made by removing an internal Ncol fragment from the JC96 clone (indicated in figure 2) .

Example 4

Further cloning of the viral genome.

In the light of the fact that this element is present at very low levels in the specimens so far examined, conventional methods (such as screening of a cDNA library prepared from infected tissue) cannot be used to clone the remainder of the virus. However , PCR based strategies may be used to clone regions of the virus flanking the JC96 clone. Firstly inverse PCR methods as by Silver et al. (supra) , Ochman et al, (supra) and Triglia et al, (supra) may be applied to genomic DNA obtained from an infected biopsy sample using primers derived from the JC96 sequence. Secondly, viral sequences flanking JC96 may be amplified using degenerate PCR primers derived from other conserved regions of retroviral genomes in conjunction with primers specific for the JC96 clone. Suitable primers are degenerate primers which work on a variety of retroviral sequences although they should be biased towards B and D- type sequences. They may be targeted towards the RnaseH and integrase regions of pol , the "immunosuppressive" region of the transmembrane protein of env, and the primer binding site (PBS) or nucleocapsid regions of gag. Examples of such primers for the integrase gene are illustrated in Figure 7.

By coupling these primers with the specific primers described above in Example 3, the cloned region of the genome could be expanded to include all but the long terminal repeat (LTR) and 3' part of env. 5' and 3' rapid amplification of cDNA ends (RACE) (Frohman et al. 1988, Proc . Na t . Acad Sci . USA 85: 8998-9002) respectively can be used to clone these regions. The target material for these primers will be sucrose gradients made from salivary gland biopsy lysates obtained as described in Example 1.

Example 5

Bacterial Expression and Antibody Production.

In order to develop antisera and monoclonal antibodies (Mabs) for the detection of viral proteins in primary tissue and in culture, fragments of the potential PR and RT proteins of JC96 have been expressed using the bacterial expression vector pTrc99A (Pharmacia) in the BL21 DE3 pLysS (Novagen) bacterial host strain. This has been accomplished using PCR amplified regions of the JC96 clone corresponding to nucleotides 31-459 for the PR gene and 378-800 for the RT gene. In addition to gene-specific nucleotides the 5' PCR primers also contained nucleotides encoding 6 consecutive histidine residues (His₆-tag) to facilitate purification of the proteins by means of a Ni²⁺-containing resin marketed by Qiagen (Ni²⁺-NTA resin) . The 3' primers also included nucleotides encoding a 10 amino-acid epitope from the human c-myc gene to enable detection of the proteins by western blotting with a monoclonal anti- c-myc antibody (9E10) specific to this epitope (Evan et al . 1985, Mol . Cell Biol . 5: 3610-3616) . In addition to the His₆ and c-myc sequence tags, the PCR primers also contained restriction sites to enable cloning into the pTrc99A vector. The PR fragment was cloned into the Ncol and Sail sites of pTrc99A and the RT fragment was cloned into the EcoRI and Sail sites of pTrc99A as this ORF contains two Ncol sites.

Proteins were purified using Νi²⁺-ΝTA resin (Qiagen) . Overnight cultures of bacteria carrying the subcloned PR and RT fragments were grown in Luria-Bertani broth supplemented with ampicillin (lOOμg/ml) and chloramphenicol (lOμg/ml) . The next day these were diluted 1:10 into fresh antibiotic-containing broth and grown at 30°C for one hour (optical density at 600nm approximately 0.6) . Expression of the proteins was then induced by addition of iso-propyl- thio-galactoside (IPTG; ImM) and culture continued for a further 90 minutes (OD₆₀₀ = 0.9) . Cells were pelleted by centrifugation and resuspended in NTA-purification buffer pH 8.0 (8M urea, lOOmM NaH₂P0₃, lOmM TRIS-C1) . Cells are then lysed by three cycles of freeze-thawing followed by brief sonication. Clarified lysates are then incubated with Ni²*-NTA resin for four hours at 4 C and then poured into a chromatography column support (Bio-Rad) . Contaminating proteins are washed off with NTA-purification buffer pH 6.3 containing 25mM imidazole. Finally the purified RT and PR proteins are eluted from the resin with NTA purification buffer pH 6.3 containing 250mM imidazole.

Using a different E. Coli host strain, M15 [pREP4] (Qiagen), fragments of the PR and RT proteins were expressed again as fusion proteins with histidine and c-myc epitope tags (as described above) . Also, an additional fragment of RT (denoted RT-L) corresponding to nucleotides 375-920 of the JC96 sequence was expressed. These proteins were purified on Ni²⁺-NTA resin (Qiagen) as described above except that kanamycin (25μg/ml) replaced chloramphenicol in the culture broth.

Fragments of the JC96 PR and RT have also been expressed in E. Coli and purified using the glutathione-S-transferase (GST) system (Pharmacia) . These proteins were used to raise polyclonal antisera in rabbits. These antisera are used as control antibodies for the ELISAs (discussed below) .

The purity of these preparations can be assessed by Coomassie blue staining of an SDS-PAGE gel (figure 8) . M = "Rainbow" markers (Amersham) . 1 = Lysate of PR expressing clone.

2 = purified PR protein.

3 = lysate of RT expressing clone.

4 = Purified RT protein.

The identity of the purified proteins can be confirmed by western blotting using the 9E10 Mab specific for the c- yc epitope tag. The proteins can then be used to raise rabbit polyclonal antisera in a known manner, preferably with the use of affinity purification to improve the specificity of the sera. Example 6

Antibody Production

Rat monoclonal antibodies specific for the JC96 RT and PR proteins have been produced. CBH/Cbi rats were immunised 4 times at 21 day intervals with lOOμg of either the PR or RT protein. The third immunisation was given via the intra- peritoneum, the other three immunisations were via Peyer's patches. The immunogens were emulsified in complete Freunds adjuvant (Difco Labs) prior to the first inoculations and in incomplete Freunds for subsequent immunisations. Three days after the last immunisation, mesenteric lymph node cells were fused with rat myeloma Y3-Ag 1,2,3, [Dean et al . , 1986, Methods in Enzymology, Vol 121, pp 52-59] . Supernatants from the resulting hybridomas were screened for antibodies to the immunising antigen by ELISA and by immunoblot.

ELISA plates were coated with immunising antigen at a concentration of lμg/ml in PBS and incubated overnight at 4°C. Hybridoma supernatants were screened for binding to the immunising antigen. After incubation for 1 hour at room temperature, the plates were washed 3 times in wash buffer(PBS, 0.1% BSA, 0.05% Tween-20) . Bound rat antibody was detected using goat anti-rat immunoglobulin conjugated to horseradish peroxidase (Seralab) and incubated at room temperature for 1 hour. Plates were washed 3 cimes in wash buffer and bound antibody detected by TMB (Sigma) to produce a soluble blue end product developed over 20 minutes. Acidification with 0.5 M H₂S0₄ stopping solution produced a yellow colour which was read using a microplate autoreader at 450nm.

Candidate hybridoma supernatants identified by ELISA were used to probe immunoblots of PR and RT. The supernatants were used at dilutions of 1:200 - 1:25 and detected with goat anti-rat immunoglobulin-horseradish peroxidase conjugate (Harlin SeraLab, diluted 1:2000) and enhanced chemiluminescence (ECL, with reagents supplied by Amersham) .

Monoclonal antibodies reactive with JC96 RT have been produced. Anti-PR hybridoma supernatants have been prepared and will be screened by immunoblot so that antibodies to JC96 PR can be prepared.

Mouse Mabs may also be prepared by methods which are conventional in the art.

Example 7

ELISAs and Immunofluorescence

ELISAs for the detection of antibodies to JC96 PR and RT proteins may be developed. An indirect ELISA and a capture ELISA system can be produced.

Indirect ELISA (Fig. 9)

ELISA plates are coated with recombinant JC96PR or RT-L (50μl; 5 μg/ml) and incubated at 4°C overnight. The plates are then washed 3 times with PBS (100 μl per well) , blocked with PBS/2% casein (100 ml/well) for 1 hour at 37°C and washed again 3 times with PBS. Test sera and standard control sera (50 μl; prepared in PBS/0.5% casein) are incubated on the plates at various dilutions for 1 hour at

37°C and the plates washed 3 times in PBS. An anti-human alkaline phosphatase conjugate (Sigma 1:1000 dilution) is then incubated on the plates for 1 hour, 37°C and washed 4 times in PBS, once in PBS/0.1% Tween 20 and then once in PBS (100 μl per well for each wash) . Conjugates to human IgG and IgM can be used which may allow the distinction between early JC96 infection (IgM antibodies) and established JC96 infection (IgG) . For control wells using polyclonal rabbit antisera or rat monoclonal antibodies, goat anti-rabbit IgG or goat anti-rat IgG conjugates are used respectively. Alkaline phosphatase substrate (Sigma- 104; 50μl/well) is then added to yield a yellow end product read at 405 nm with a microplate autoreader (BioTek Instruments) .

Capture ELISA (Fig. 10)

ELISA plates are coated with an anti-c-myc monoclonal antibody (9E10, Evan et al, 1985, Mol. Cell. Biol. 5: 3610- 3616) (5 μg/ml; 50 μl/well) overnight at 4°C. Plates are then washed 3 times in PBS, blocked with PBS/2% casein (100 μl/well) for 1 hour at 37°C and washed with PBS as before. Recombinant JC96 PR or RT-L is then bound to the plates (as above for indirect ELISA) and the plates are washed 3 times with PBS (100 μl/well) . Test sera are then incubated on the plates and detected using the alkaline phosphatase conjugate as described above for the indirect ELISA. The use of a capture ELISA may increase specificity of the ELISA since minor bacterial contaminants in the recombinant protein preparations will not bind to the 9E10-coated plates.

All ELISA results may be confirmed by immunoblotting.

45 human sera have been studied. The levels of IgG and IgM reactive with JC96 PR and JC96 RT has been looked at and some individuals have strongly positive sera. This work means that standard curves against which all sera can be referenced can be established.

The anti-JC96 RT monoclonal antibodies have been used to examine human tissue sections by indirect immunofluorescence. Tissue sections (6 μm thick) were cut in OCT compound (Miles Diagnostics) , fixed in 1:1 acetone/methanol at -20°C and air-dried. The sections are then incubated with 50 μl of diluted test antibody for 30 mins at room temperature and washed twice in PBS (5 mins) and once in water. Bound antibodies are then detected using an anti-rat IgG fluorescein isothiocyanate conjugated antibody (Sigma F1763; 50 μl) for 30 mins at room temperature. The slides are then washed twice with PBS (5 mins) and once in water before mounting in glycerol with 2.5% (w/v) 1,4 diazobicyclo-2.2.2. octane and viewing under ultraviolet light.

Example 8

Production of GST Fusion Proteins in E. coli

PCR techniques were used to clone fragments of the JC96 element into the bacterial expression plasmid pGEX-3X (Pharmacia) . Amino acids 1 (Thr) - 160 (Arg) of the PR ORF of JC96 (nt 1 - 480) and l(Lys) - 149 (Glu) of the RT ORF (nt 360 - 826) were PCR amplified and the products cloned into the bacterial expression plasmid pGEX-3X (Pharmacia) . The resulting plasmids were designated pGEX-PR and pGEX-RT respectively. Bacterial clones (E. coli strain JM 105) transformed with plasmids pGEX-PR and pGEX-RT were incubated and protein expression induced as follows: 50 ml cultures of each expression clone were grown overnight in LB-broth supplemented with 100 μg/ml ampicillin at 37°C with shaking. The culture was diluted 1:10 into fresh medium and grown at 37°C for one hour (OD₆₀₀ approximately 0.6-0.7) . Expression of GST fusion proteins was then induced by the addition of isopropyl β-O- thiogalactopyranoside (IPTG) to 0.1 mM and the bacteria grown for a further 3 hours (OD₆₀₀ approximately 0.9-1.0) . The bacteria were chilled on ice for 15 minutes and pelleted by centrifugation at 4,000 rpm, 4°C, 10 minutes (3,800 g, Jouan CX114) . The harvested cells were resuspended in 5 ml ice-cold PBS containing 1% Triton X-100 and then lysed by three cycles of freezing in dry ice/ethanol and thawing in cold water followed by sonication on ice (MSE soniprep; 3 x 30 second pulses) . The sonicates were then cleared by centrifugation at c 10,000g for 10 minutes at 4°C (Beckman JA-20, 10,000 rpm) and the supernatants retained for purification.

GST-PR and GST-RT fusion proteins were purified from the bacterial lysates as follows: 250 μl of a 50% slurry of glutathione-Sepharose 4B beads (prewashed in PBS as described in the Pharmacia product literature) were mixed with 5 ml of bacterial sonicate for 15 minutes at 4°C. The beads were then collected by centrifugation at 190g, 4°C, 3 minutes (1,000 rpm, Jouan CX114) and the supernatant removed. The beads were washed 3 times with 40 volumes (10 ml of PBS/1% Triton X-100 and bound fusion proteins were eluted with successive 250 μl washes with 6 M urea. Urea was removed by dialysis into PBS at 4°C for 48 hours with 2 changes of PBS.

The JC96 PR and RT GST fusion proteins were used to prepare polyclonal antisera in rabbits.

Anti -JC96 PR Antibodies A female NZW rabbit was immunised with 100 μg of the GST-PR fusion protein emulsified in Titremax adjuvant (CytRx Corp. Georgia) with a booster inoculation 4 weeks later. Bleeds were taken 2, 6 and 13 weeks after the first immunisation. The reactivity of these sera with the JC96 PR protein was confirmed by immunoblotting against histidine/c-myc tagged JC96 PR and RT.

Anti -JC96 RT Antibodies

Two female NZW rabbits were immunised with 100 μg of GST-RT emulsified in Titremax. Booster inoculations in these rabbits used 100 μg of RT 4 weeks and 8 weeks after the initial immunisation with GST-RT. Bleeds were taken 1, 4, 7 and 11 weeks after the GST-RT immunisation and these sera used to screen immunoblots of GST and GST-RT.

Claims

1. A nucleotide sequence which comprises or is derived from a retrovirus which comprises a nucleotide sequence in the protease and polymerase genes as shown in Figure 2, or variants, mutants or fragments thereof.

2. A nucleotide sequence according to claim 1 which comprises a variant which has 90% homology in the protease and polymerase gene to the sequence shown in Figure 2.

3. A nucleotide sequence which is derived from a retrovirus as defined in claim 1 and which is from 20 bases to lkilobase in length.

4. A nucleotide sequence according to claim 3 which is from 400-500 bases in length.

5. A nucleotide sequence according to claim 1 which encodes a viral antigen.

6. A viral antigen which comprises an amino acid sequence encoded by a sequence according to claim 5.

7. A antibody which is specific for a viral antigen according to claim 6.

8. A antibody which is specific for an antigen containing epitopes from the matrix (MA) or capsid (CA) or other gag proteins or envelope proteins of a retrovirus which comprises a nucleotide sequence in the protease and polymerase genes as shown in Figure 2; or variants, mutants or fragments thereof.

9. An antibody according to claim 7 which is monoclonal.

10. An assay for detecting the presence of a retrovirus which comprises a nucleotide sequence in the protease and polymerase genes as shown in Figure 2, or variants, mutants or fragments thereof.

11. An assay according to claim 10 which comprises a peptide or protein enzyme linked immunosorbent assay

(ELISAs) or western blots.

12. An assay according to claim 10 which utilises a DNA or RNA detection method.

13. An assay according to claim 11 which method comprises polymerase chain reaction (PCR) .

14. A kit for use in an assay according to claim 10 which comprises an antibody which binds an antigen of the above described as well as diagnostic kits which contain said antibody.

15. A method for detecting antibodies to viral peptides or proteins of a retrovirus which comprises a nucleotide sequence in the protease and polymerase genes as shown in Figure 2, or mutants thereof, said method comprising detecting said antibodies using a amino acid sequence encoded by an nucleotide sequence according to claim 1.

16. A method according to claim 15 which comprises an ELISA.

17. A method according to claim 15 wherein the said amino acid sequence comprises a viral antigen which is immobilised on a support by means of an affinity purified anti-viral antigen sera.

18. A method according to claim 17 wherein said viral antigen comprises a recombinant viral antigen.

19. A method for detecting in a sample a retrovirus which comprises a nucleotide sequence in the protease and polymerase genes as shown in Figure 2, or mutants thereof, which method comprises employing a DNA or RNA amplification method in order to amplify a selected nucleotide sequence from said virus, and detecting said selected sequence.

20. A method according to claim 19 wherein the selected sequence includes the sequence of Figure 2 or fragments or variants thereof.

21. A method according to claim 20 wherein the said fragment encodes the amino acid sequence shown in Figure 1.

22. A method according to claim 19 wherein the PCR is carried out using a series of nested primers.

23. A method according to claim 19 wherein the PCR is carried out in si tu .

24. A virus isolation assay for detecting the presence of a retrovirus which comprises a nucleotide sequence in the protease and polymerase genes as shown in Figure 2, or mutants thereof.

25. A method according to claim 24 wherein the virus in a sample is cultured using direct culture methods.

26. A method according to claim 25 wherein the virus present in a sample is co-cultivated with a target cell line.

27. A method according to claim 26 wherein the sample is a salivary gland biopsies which is either digested with trypsin or homogenised with a mortar and pestle and then placed into a flask with about 10⁵-10^D tissue culture cells.

28. A method according to claim 27 wherein said tissue culture cells are selected from T and B lymphocytes, fibroblasts and epithelial cells.

29. A method of isolating virus which comprises xenografting salivary gland fragments into suitably nude or severe combined immunodeficient (SCID) mice and thereafter isolating virus from mice.

30. A screening method for detecting agents which are effective in inhibiting a retrovirus which comprises a nucleotide sequence in the protease and polymerase genes as shown in Figure 2, or mutants thereof; which method comprises culturing said virus in the presence of an agent and thereafter detecting the presence of a nucleotide sequence according to claim 1.

31. A method of treatment of SS which method comprises applying an agent identified as a result of the screening method of claim 30.

32. A method of treatment of SS which method comprises inhibiting retroviral replication by applying an inhibitor of reverse transcription or a protease inhibitor or another anti-viral drug.

33. A method according to claim 32 wherein the inhibitor of reverse transcription is a chain terminator.

34. A pharmaceutical composition for use in the treatment of SS which comprises an effective amount of an agent identified as a result of the screening method of claim 30 in combination with a pharmaceutically acceptable carrier or diluent.

35. A pharmaceutical composition for use in the treatment of SS which comprises an effective amount of an anti-viral drug in combination with a pharmaceutically acceptable carrier or diluent.