WO1996031621A2

WO1996031621A2 - Method for determining the responsiveness of individuals to 5-ht2 receptor modulating agents

Info

Publication number: WO1996031621A2
Application number: PCT/EP1996/001437
Authority: WO
Inventors: Robert Kerwin; David Collier; Gareth Wyn Roberts
Original assignee: Smithkline Beecham Plc
Priority date: 1995-04-07
Filing date: 1996-04-01
Publication date: 1996-10-10
Also published as: GB9507230D0; ZA962716B; WO1996031621A3; AU5499196A

Abstract

A method for use in assessing whether a subject is likely to be responsive to treatment with a therapeutic agent which acts at a 5-HT2 receptor.

Description

METHOD FOR DETERMINING THE RESPONSIVENESS OF INDIVIDUALS TO 5-HT. RECEPTOR MODULATING AGENTS

The present invention relates to methods of assessing the responsiveness of individuals to therapeutic agents which interact with 5-HT2 receptors, in particular the 5-HT2 receptor, and especially neuroleptic agents such as clozapine.

Schizophrenia is a devastating neurological disease for which there is currently no cure, although advances are now being made in understanding its causes and controlling its symptoms. In general the age of onset is in late adolescence and it is a lifelong illness with a very poor prognosis. Subjects suffering from schizophrenia may exhibit positive symptoms, for example delusions and hallucinations, and /or negative symptoms such as withdrawal, isolation and de otivation leading ultimately to social decline and suicide. There are 600,000 schizophrenics at any one time in the UK and their care costs 1.6% of the total healthcare budget. Most of these costs are non-drug, community and hospital costs. Therefore better targetting of effective drug treatments has the potential for considerable economic savings. (British Journal of Psychiatry, (1994) 165 (suppl.25), 18-21).

Since the 1950's antipsychotic drugs (neuroleptic s) have been available and are used with varying degrees of success to treat the positive symptoms of schizophrenia. However, the majority of these agents ("typical" neuroleptics) do not alleviate the negative symptoms and furthermore have a number of side effects, the most distressing of which are movement disorders known as extrapyramidal side effects (eps). Examples of typical neuroleptics include haloperidol and sulpiride. Over 90% of patients in the UK are treated with such traditional antipsychotics but some 30% of patients fail to respond. The therapeutic effect of typical antipsychotic agents is believed to be exerted principally via blockade of dopamine D2 receptors; however this mechanism is also thought to be responsible for the extrapyramidal side effects.

More recently second generation antipsychotic agents, so-called "atypical" neuroleptics, having enhanced efficacy and fewer side effects have been developed. These compounds appear to have a lower affinity for D2 receptors than do the typical neuroleptics but they also interact with other receptors, notably the serotonin 5-HT2A and 5-HT2C receptors and the dopamine D4 receptor. Atypical neuroleptics provide advantages in that they improve both the positive and negative symptoms of schizophrenia and causes virtually no eps. An example of this type of drug is clozapine. However, its use has been severely limited by controversy over its propensity to produce neutropenia and its expense; hence it is reserved for the treatment of schizophrenia in subjects who do not respond to other neuroleptics. In addition there remains a proportion of patients who are resistant to treatment even with clozapine. A test, therefore, that helps to predict those patients most likely to benefit would be a valuable clinical decision-making tool.

A further example of an "atypical" neuroleptic is risperidone, which is a mixed 5-HT2A/D2 receptor antagonist. This compound, which is currently undergoing clinical trials appears to have a similar therapeutic profile to clozapine but does not cause neutropenia. Atypical neuroleptics currently in development include olanzapine, seroquel, sertindole and ziprasidone; all are antagonists at both dopamine D2 and 5- HT2A receptors.

Once schizophrenia has been diagnosed it is clearly desirable to select and administer the most appropriate therapy as quickly as possible. At present treatment with neuroleptics is largely a matter of trial and error, as there is no way of determining in advance whether a patient is likely to be responsive to drug treatment. Hence a patient may undergo several courses of treatment with various antipsychotic agents before non- responsiveness is established. In view of the side effects of these drugs it would be highly beneficial to avoid giving them to non-responders; this is particularly important in the case of clozapine, in view of its known toxicity profile. Furthermore, it is generally found that the long-term outcome of the disease is improved if a patient is given the most effective drug therapy at the outset, rather than after one or more inappropriate drugs. Therefore a means of targetting those patients more likely to respond to drug therapy would be advantageous.

Recently it has been found that the human gene encoding the 5-HT2C receptor (also known as HTR2C) exhibits polymorphism in the TMI region of the gene, comprising two alleles, termed -HT2Ccys (C68) and 5-HT2Cser (S68). (Lappalainen, J., Virkkunen, M., Dean, M., Ozaki, N., Linniola, M., Goldman, D., (1994) American Journal of Human Genetics 55, 899 "Identification of a cys-ser substitution in the 5- HT2C (HTR2C) receptor gene and allelic association to violent behaviour and alcoholism). These alleles have been found to occur in unrelated Caucasians with a frequency of 0.87 and 0.13 respectively.

It has now surprisingly been found that in a population of diagnosed schizophrenic patients treated with clozapine, the distribution of alleles C68 and S68 between patients who respond to treatment with clozapine (hereinafter "responders") and those who fail to respond to such treatment (hereinafter "non-responders") is significantly different from that in the general population. Thus the proportion of responders who possessed one or more S68 alleles (either homozygous or heterozygous) was significantly higher than in the general population. In particular allele S68 was found to be present in a significantly greater proportion of responders than non-responders. Thus there is a correlation between presence of the allele S68 and response to treatment with clozapine. This allelic variation can therefore be utilised to assess or predict which patients are most likely to respond to treatment with clozapine.

Those skilled in the treatment of conditions such as those listed herein, in particular schizophrenia will appreciate that the terms "responders" and "non-responders" as used herein are terms well known in the art. In the clinic the degree of responsiveness to a neuroleptic agent such as clozapine is generally assessed according to well- established rating scales, such as the Global Assessment Scale (GAS) or the Brief Psychiatric Rating Scale (BPRS).

In practice, as indicated above, the use of clozapine to treat schizophrenia is generally reserved for those individuals who have failed to respond to treatment with other neuroleptic agents. The method of the present invention may be used more generally to predict whether a patient is likely to respond to any of the existing typical or atypical neuroleptic agents, in particular those that are shown to interact with 5-HT2 receptors. The method of the present invention may also be used more generally to assess whether a subject is likely to be responsive or non-responsive to a therapeutic agent which acts at a 5-HT2 receptor, in particular the 5-HT2C receptor. Compounds acting at these receptors will hereinafter be referred to as 5-HT2 and 5-HT2C modulators. Such compounds include both typical and atypical neuroleptic agents. The present invention therefore provides a method for use in assessing whether a subject will be responsive or non-responsive to treatment with a 5-HT2 modulator, the method comprising testing for and detecting the presence or absence of DNA encoding the S68 and /or C68 alleles of the 5-HT2C ge^ne in said subject.

Preferably, the method is used in assessment of the likelihood of response to a 5- HT2C modulator. 5-HT2 and 5-HT2C modulators include agonists and antagonists at these receptors. Such compounds may exert a variety of therapeutic effects. Thus for example 5-HT2C antagonists may be of potential use in the treatment of CNS disorders such as schizophrenia, depression, manic-depressive illness, obsessive-compulsive disorders, panic disorders, post-traumatic stress disorders, generalised anxiety disorders, feeding disorders such as anorexia and bulimia, anhedonia, sexual dysfunction, premenstrual syndrome, migraine, epilepsy, Alzheimers disease, sleep disorders, withdrawal from drug abuse such as cocaine, ethanol, nicotine and benzodiazepines, and also disorders associated with spinal trauma and/or head injury such as hydrocephalus. In a particularly preferred embodiment the invention provides a method for use in assessing in a subject diagnosed as suffering from schizophrenia the likelihood of response by said subject to a neuroleptic agent, the method comprising testing for and detecting the presence or absence of DNA comprising the S68 and /or C68 alleles of the 5-HT2C ^ene in said subject. The neuroleptic agent is preferably a modulator of a 5- HT2 receptor, especially a 5-HT2 receptor modulator. Advantageously the neuroleptic agent is an 'atypical' neuroleptic agent such as, clozapine, risperidone, olanzapine, seroquel, sertindole or ziprasidone. Most preferably the neuroleptic agent is clozapine. In the case of clozapine, the presence of a 5-HT2Cser (S68) allele, either alone or together with a -HT2Ccys (C68) allele indicates that the subject will have a greater probability of response to treatment with this agent. In this context 'greater probability' means that the likelihood of response is higher than the 'normal' response rate, ie the response rate observed for a random group of schizpophrenic patients. Presence of a 5- HT2Cser (S68) allele, either alone or together with a 5-HT2Ccys (C68) allele also indicates that the subject will have a greater probability of response to treatment with clozapine than a subject who does not possess the S68 allele.

It will of course be understood by practitioners skilled in the treatment of conditions such as those listed above, in particular schizophrenia, that the method of the present invention does not give a precise or absolute identification of responders and non- responders but rather indicates the degree or likelihood of responsiveness and so can be used to aid and guide the clinical judgement of the physician.

In a further embodiment the present invention provides a method for assessing whether a subject suffering from a condition which may be treated with a 5-HT2 modulator will be responsive to treatment with a 5-HT2 modulator, said method comprising the steps of:

(i) testing for the presence or absence of DNA encoding the S68 and or C68 allele of the 5-HT2C gene in a sample containing DNA obtained from said subject, and (ii) comparing the result with a pre-determined correlation between the distribution of S68 and C68 alleles and the response to said 5-HT2 modulator obtained for a population of subjects suffering from said condition.

The pre-determined correlation utilised in step (ii) may itself be obtained by the following series of steps: selecting a population or cohort of subjects diagnosed as suffering from a specified condition; treating said cohort with a specified 5-HT2 (eg 5-HT2C) modulator, monitoring the outcome of said treatment and identifying responders and non-responders to the said treatment, taking from said cohort biological samples containing DNA and testing this for the presence or absence of the S68 and/or C68 alleles; analysing the distribution of alleles as between responders and non-responders; making a comparison with the distribution of alleles in a control group of subjects, not suffering from said condition; performing a statistical analysis to determine if there is a statistically significant association between presence or absence of the S68 and/or C68 alleles and response to treatment.

The invention thus also provides a method for assessing whether a subject suffering from a condition which may be treated with a 5-HT2 (eg a 5HT2C) modulator will be responsive to treatment with a specified 5-HT2 modulator, said method comprising the steps of: (i) correlating the distribution of S68 and C68 alleles in a population of subjects suffering from a specified condition requiring treament with a 5-HT2 modulator with observed clinical response to said modulator;

(ii) testing for the presence or absence of DNA encoding the S68 and or C68 allele of the 5-HT2C gene in a sample containing DNA obtained from said subject, and (iii) comparing the result with the correlation between the distribution of S68 and

C68 alleles and the response to said 5-HT2 modulator obtained for a population of subjects suffering from said condition.

In a yet further aspect the invention provides a method for generating a model to assess whether a subject is likely to be responsive to treatment with a 5HT2 (eg a 5- HT2c) modulator which method comprises:

(i) treating a cohort of patients diagnosed as suffering from a specified condition (eg schizophrenia) which may be treated with a 5HT2 modulator (eg clozapine) with said 5HT2 modulator;

(ii) assessing the outcome of treatment so as to define responders and non-responders according to pre-determined criteria;

(iii) obtaining DNA samples from the cohort of patients in (i);

(iv) obtaining DNA samples from a control group of subjects diagnosed as not suffering from said condition;

(v) analysing the samples obtained in (iii) and (iv) to identify whether they encode the 5-HT2Ccys (^C68) ^alleIe> ^{the 5}"^HT2Cser (^S68) allele or both alleles;

(vi) calculating the distribution of C68 and S68 alleles in the samples from (iii) for responders and non-responders;

(vii) calculating the distribution of C68 and S68 alleles in the samples from (iv); (viii) comparing the distributions obtained in (vi) and (vii); (ix) comparing the distribution obtained in (vi) as between responders and non- responders (x) performing statistical analysis on the results from (viii) and (ix) to generate a model for asssessing the probability of response to treatment with said 5HT2 modulator, based on whether a subject possesses the C68 and or S68 allele.

The invention also provides a method for assessing whether a subject suffering from a condition which may be treated with a 5-HT2 (eg a 5HT2C) modulator will be responsive to treatment with a specified 5-HT2 modulator, which comprises comparing said subject's genotype with the model described above.

It will be appreciated that in any of the above methods, one or more of the steps may be effected by a computer-contolled system. Thus, for example, once the biological samples have been obtained, genotyping may be carried out by a computer-controlled robotic system. A computer-controlled system may also be configured to make the comparison between the subject to be assessed and a pre-determined correlation or model. A computer controlled system may also be configured to give either a positive or negative readout depending on the outcome of the comparison. The present invention therefore extends to such computer-controlled or computer- implemented methods.

The step of testing for and detecting the presence or absence of DNA encoding S68 and/or C68 alleles may be carried out either directly or indirectly by any suitable means, such as by techniques well known in the art, and is preferably carried out ex vivo All generally involve the step of collecting a sample of biological material containing DNA from the subject, and then detecting which alleles the subject possesses from that sample. For example, the detecting step may be carried out by collecting a biological sample containing DNA from the subject, and then determining the presence or absence of DNA comprising a S68 and/or C68 allele in the biological sample. Any biological sample which contains the DNA of that subject may be employed, including tissue samples and blood samples, with blood cells being a particularly convenient source.

Determining the presence or absence of DNA comprising a S68 and or C68 allele may be carried out with an oligonucleotide probe labelled with a suitable detectable group; by means of an amplification reaction such as a polymerase chain reaction or ligase chain reaction (the product of which amplification reaction may then be detected with a labelled oligonucleotide probe) or by means of restriction nuclease digestion and electrophoretic separation to detect restriction fragment length polymorphism (RLFP). Further, the detecting step may include the step of detecting whether the subject is heterozygous or homozygous for the gene encoding a S68 or C68 allele. Numerous different oligonucleotide probe assay formats are known which may be employed to carry out the present invention.

It will readily be appreciated that the detecting steps may be carried out directly or indirectly. Thus, for example, any of the techniques described above may be used to detect either the S68 allele or the C68 allele. If only the S68 allele is detected in the subject, then it is determined that the subject is homozygous for allele S68; but if allele C68 is detected in the subject, either alone or in addition to allele S68 then it is determined that the subject is either homozygous for C68 or heterozygous. In practice, it may only be necessary to test for the presence of one of the two alleles. Thus for example in relation to clozapine response, it would only be necessary to test for the presence of the S68 allele, a positive result indicating a greater probability of response and a negative result (ie where the subject is homozygous for C68) indicating a lesser probablility of response. The present invention has utility in enabling improvements in the clinical management of patients suffering from schizophrenia. By identifying in advance of treatment those who are not likely to respond to neuroleptics such as clozapine, it will be possible to avoid unecessary and non .beneficial adminstration of such drugs together with the associated side effects and costs and instead to select a more appropriate form of therapy. Thus the invention provides direct benefits to the patient in terms of indicating the most appropriate therapy as early as possible in the treatment process and is of wider benefit in terms of health economics.

In a further embodiment therefore the present invention provides a method of treating a condition which requires treatment with a 5-HT2 modulator, said method comprising:

(i) testing for DNA comprising allele S68 and or C68 in a sample of biological material containing DNA obtained from a subject suffering from said condition, and (ii) if DNA comprising the S68 allele, either alone or in the presence of the C68 allele, is present in the sample, treating said subject with a 5-HT2 modulator. Preferably the condition is schizophrenia. The 5-HT2 modulator is preferably a neuroleptic agent, such as clozapine.

In addition the invention has utility in enabling effective and efficient design of clinical trials with neuroleptic agents. Thus in comparative trials with two or more neuroleptics, patients who are not likely to respond to either or any of the agents can be excluded.

In a further embodiment the invention also provides an assay suitable for use in the method of the present invention, said assay comprising means for determining the presence or absence of DNA encoding allele S68 and/or C68 of the human 5-HT2C gene in a biological sample. The present invention also provides a kit suitable for use in assessing the responsiveness of a subject to a 5HT2 modulator, said kit comprising: (a) means for testing for the presence or absence of DNA encoding allele S68 and/or C68 of the human 5-HT2C gene in a sample of human DNA;

(b) reagents for use in the detection process.

The means for testing preferably comprises a labelled probe or a restriction enzyme. The reagents may comprise for example diluents, wash solutions and control solutions.

In a further embodiment the present invention provides a cell line which expresses DNA encoding the S68 and/or C68 allele of the human 5-HT2C gene. Such cell lines can be obtained using known recombinant techniques and methodology. In a yet further embodiment the present invention also provides a transgenic animal, in particular a transgenic mammal such as a mouse, which expresses the human 5-HT2C gene containing the S68 allele and or expresses the human 5-HT2C gene containing the C68 allele. Such a transgenic animal may be used to screen for and identify novel antipsychotic agents. Animals which express the human 5-HT2 gene containing the S68 allele may be used to screen agents that are likely to be effective in patients who do not respond to currently available neuroleptics such as clozapine. Transgenic animals may be obtained using procedures which are standard in the field of genetic engineering.

For the avoidance of doubt, as used herein, unless the context dictates otherwise, the term '5-HT2C gene' refers to the gene encoding the and the terms 'C68 allele' and

'S68 allele' refer respectively to the 5-HT2Ccys (C68) and 5-HT2Cser (^s68) alleles of the human 5-HT2 receptor (Lappalainen, J., Virkkunen, M., Dean, M., Ozaki, N., Linniola, M., Goldman, D., (1994) American Journal of Human Genetics 55, 899). Likewise the terms 5-HT2 receptor and 5-HT2 receptor refer to the human forms of these receptors.

EXAMPLE

Method

Genotyping for Hinf I polymorphism was carried out using blood samples obtained from individuals diagnosed as suffering from schizophrenia (DSM III) and undergoing treatment with clozapine. The individuals were also separately assessed for responsiveness to clozapine treatment: non-response is defined as a drop of <20 points on GAS or <20% on BPRS after six weeks treatment. The results were correlated as shown in the table below.

Detection of Hinf I polymorphism (Alleles C68 and S68) by PCR A fragment corresponding to the putative TMI region of the serotonin receptor gene 5-HT2C (HTR2C) was amplified using the oligonucleotide primer pairs 5' ttggcctattggtttgggaat 3' (primer 1) and gtctgggaatttgaagcgtccac (primer 2). Use of these primers creates a Hinfl restriction endonuclease site when the S68 allele is present, because primer 1 has a different nucleotide (G substituted for C) to the naturally occurring gene sequence at nucleotide position 18 from the 5' start of the primer sequence. Each 15μl reaction contained buffer type IV (Applied Biosy stems), 1.5mM MgCl2, 200μM of each dNTP, 0.25μM of the respective primers, 1 U of Thermoprime polymerase (Applied Biotechnology Ltd.) and 50ng of patient DNA. The amplification programme included 35 cycles of 1' at 95°C, 2' at 50°C and 3' at 72°C. After amplification, lOμl of PCR product (104bp) were diluted with 2μl restriction enzyme buffer, 7μl of water and digested with Hinf I (New England Biolabs) (lOU/sample) at 37°C for a minimum of 3 hours. The naturally occurring DNA fragment containing the C68 allele between the first and last bases of the primer recognition sequence has the following nucleotide sequence: ttggcctattggtttggcaatgtgatatttctgtgagcccagtagcagctatag- taactgacattttcaatacctccgatggtggacgcttcaaattcccagac The naturally occurring DNA fragment containing the S68 allele between the first and last bases of the primer recognition sequence has the following nucleotide sequence: ttggcctattggtttggcaatctgatatttctgtgagcccagtagcagctatag- taactgacattttcaatacctccgatggtggacgcttcaaattcccagac The actual DNA sequence containing the C68 allele which is amplified using the primers is: ttggcctattggtttgggaatgtgatatttctgtgagcccagtagcagctatag- taactgacattttcaatacctccgatggtggacgcttcaaattcccagac

The actual DNA sequence containing the S68 allele which is amplified using the primers is: ttggcctattggtttgggaatctgatatttctgtgagcccagtagcagctatag- taactgacattttcaatacctccgatggtggacgcttcaaattcccagac

The size of the digested samples was analysed by separating them electrophoretically in 3% agarose gels containing Tris-borate EDTA buffer and 50μg of ethidium bromide per lOOmls of agarose gel. DNA fragments were visualised by ultraviolet radiation at 260nm, and sized relative to a standard DNA size ladder (Gibco, 1Kb ladder). The C68 allele (104bp) is not cut by the enzyme whereas the S68 allele is cut into two fragments, 18bp and 86bp.

Data

Results of genotypes for the C68 and S68 alleles of the 5-HT2C gene in patients being treated with clozapine are presented in Table I below. The column gasdiff indicates the difference in GAS score and pre- and post-treatment with clozapine, and the other columns indicate the number of patients classified by genotype and gasdiff. A patient with a score of 20 or greater is taken to be a responder and a patient with a score of less than 20 is taken to be a non-responder. Examination of these results by analysis of variance implemented by the SPSS package of computer programmes (SPSS

Incorporated) gives an F of 6.071 and a significance of F of 0.003, indicating that good clinical response to clozapine is influenced by the S68 allele of the 5-HT2C gene.

Table I

gasdiff homozygous C68 heterozygous homozygous S68 C68/S68

-10 1 0 0

0 11 0 0

5 7 0 0

8 1 0 0

10 13 1 1

15 11 0 0

18 1 0 0

20 15 1 2

25 14 1 1

30 13 1 0

35 6 0 2

40 7 0 1

45 3 1 0

50 3 3 1

53 0 1 0

55 3 0 0

60 2 0 0

64 0 1 0

65 1 0 0

Claims

Claims:

1. A method for use in assessing in a subject suffering from a condition which may be treated with a 5-HT2 modulator the likelihood whether said subject will be responsive to treatment with a 5-HT2 modulator, the method comprising detecting the presence or absence of DNA encoding the S68 allele and/or C68 allele of the 5-HT2C gene in said subject.

2. A method according to Claim 1 wherein the 5-HT2 modulator acts at the 5-HT2 receptor.

3. A method according to Claim 1 or Claim 2 wherein the 5-HT2 modulator is an antagonist at said 5-HT2 receptor.

4. A method according to any of claims 1 to 3 wherein the condition is schizophrenia.

5. A method according to any of claims 1 to 4 wherein the 5-HT2 modulator is a neuroleptic agent.

6. A method as claimed in claim 5 wherein the neuroleptic agent is atypical.

7. A method as claimed in claim 6 wherein the neuroleptic agent is clozapine.

8. A method as claimed in claim 6 wherein the neuroleptic agent is risperidone.

9. A method as claimed in claim 6 wherein the neuroleptic agent is selected from olanzapine, seroquel, sertindole and ziprasidone.

10. A method for assessing whether a subject suffering from a condition which may be treated with a 5-HT2 modulator will be responsive to treatment with a 5- HT2 modulator, said method comprising the steps of:

(i) testing for the presence or absence of DNA encoding the S68 and/or C68 allele of the 5-HT2 gene in a sample containing DNA obtained from said subject, and (ii) comparing the result with the correlation between the distribution of S68 and C68 alleles and the response to said 5-HT2 modulator obtained for a population of subjects suffering from said condition.

11. A method according to claim 9, said method comprising the steps of:

(i) correlating the distribution of S68 and C68 alleles in a population of subjects suffering from a specified condition which may be treated with a 5-HT2 modulator with observed clinical response to said modulator; (ii) testing for the presence or absence of DNA encoding the S68 and or C68 allele of the 5-HT2C gene in a sample containing DNA obtained from said subject, and

(iii) comparing the result with the correlation between the distribution of S68 and C68 alleles and the response to said 5-HT2 modulator obtained in step (i) for a population of subjects suffering from said condition.

12. A method for generating a model to assess whether a subject is likely to be responsive to treatment with a 5HT2 modulator which method comprises:

(i) treating a cohort of patients diagnosed as suffering from a specified condition which may be treated with a 5HT2 modulator with said 5HT2 modulator; (ii) assessing the outcome of treatment so as to define responders and non-responders according to pre-determined criteria;

(iii) obtaining DNA samples from the cohort of patients in (i); (iv) obtaining DNA samples from a control group of subjects diagnosed as not suffering from said condition; (v) analysing the samples obtained in (iii) and (iv) to identify whether they encode the 5-HT2Ccys (^C68) allele, the 5-HT₂c_Ser (^S68> allele or both alleles; (vi) calculating the distribution of C68 and S68 alleles in the samples from (iii) for responders and non-responders;

(vii) calculating the distribution of C68 and S68 alleles in the samples from (iv); (viii) comparing the distributions obtained in (vi) and (vii);

(ix) comparing the distribution obtained in (vi) as between responders and non- responders;

(x) performing statistical analysis on the results from (viii) and (ix) to generate a model for asssessing the probability of response to treatment with said 5HT2 modulator, based on whether a subject possesses the C68 and/or S68 allele.

13. A method for assessing whether a subject suffering from a condition which may be treated with a 5-HT2 modulator will be responsive to treatment with a specified 5-HT2 modulator, which comprises comparing said subject's genotype with a model as claimed in claim 12.

14. A method according to any of claims 10 to 13 wherein at least one step is effected by a computer controlled system.

15. A method according to any of claims 10, 11, 13 or 14 which is configured to detect the S68 allele.

16. A method according to any of claims 1 to 15 wherein detection of an S68 allele is indicative of good response to treatment with said 5-HT2 modulator.

17. A method according to any of claims 10 to 16 wherein the condition is schizophrenia.

18. A method according to any of claims 10 to 17 wherein the 5-HT2 modulator is a neuroleptic agent.

19. An assay comprising means for determining the presence or absence of DNA comprising allele S68 and/or C68 in a biological sample.

20. A kit suitable for use in assessing the responsiveness of a subject to a 5HT2 modulator, said kit comprising:

(a) means for testing for the presence or absence of DNA encoding allele S68 and/or C68 in a sample of human DNA;

(b) reagents for use in the detection process.

21. A transgenic mammal which expresses the human 5-HT2C gene comprising the S68 allele.

22. A transgenic mammal which expresses the human 5-HT2C gene comprising the C68 allele.

23. Use of a transgenic mammal according to claim 20 or claim 21 in screening compounds for antipsychotic activity.