WO1996021728A2 - Transgenic animals having a defective thyroid hormone receptor gene - Google Patents

Abstract

According to one aspect of the invention there is provided a transgenic animal which is heterozygous for an at least partially defective thyroid hormone receptor gene. The defective gene may be inactivated for example by an insertion, deletion, substitution or inversion or other suitable genetic manipulation. According to other aspects of the invention there are provided cells derived from the transgenic mammal of the invention and methods of testing the agonist/antagonist properties of a compound using the transgenic mammal of the invention or such cells.

Description

TRANSGENIC ANIMALS HAVING A __-r_-CTTV_; THYROID HORMONE RECEPTOR GENE

This invention relates to the production and use of transgenic mice and tissues and cell lines

thereof that in a homozygous form lack the gene for thyroid hormone receptor alpha 1

(TRαl). The invention also relates to the testing of thyroid hormones such as T3, T4, rT3 as well as antagonists and agonist thereof identification and exploitation of components of other

physiological pathways that are regulated by thyroid hormones or their derivatives.

INTRODUCTION

Thyroid hormones

Thyroid hormones, thyroxine (T4) and 3, 5, S'-triiodothyronine (T3) exert profound effects

on the growth, development, and homeostasis of organisms (Schwartz, 1983). In the

amphibian, thyroid hormone is crucial for metamorphosis (Gilbert and Frieden, 1981;

Galton, 1983). The remarkable transformation of tadpole to terrestrial frog is absolutely

dependent on the presence of thyroid hormone. Furthermore, when exogenous thyroid

hormones are given, the tadpole tail is resorbed prematurely and precocious development ensues (Beckingham-Smith and Tata, 1976). These early studies showed that thyroid hormones play a crucial role in normal development and suggested that the findings may be

applied to higher organisms. Indeed, in the developing fetus and perinatal animal, they are

fundamental for the normal maturation of the skeleton and central nervous system (CNS)

(Schwartz, 1983). In addition to developmental effects, thyroid hormones influence every organ and cell type adult mammals, alter the metabolism of nutrients, and take part in regulating the expendit of energy and oxygen consumption (Larsen and Ingbar, 1992). They influence virtually every aspect of lipid metabolism as they have been shown to stimulate synthesis,

mobilization, and degradation of lipids (Sestoft, 1980; Chait et al, 1979). Finally, the

hormones exert pleiotropic effects on the heart, ranging from altering the contractile properties of cardiac muscle to influencing heart rate (Klein, 1990).

Because thyroid hormones have important and diverse influences on the organism, their

appropriate production and distribution are essential. In mammals, thyroid hormones are produced by the thyroid gland and distributed in a tightly regulated fashion. Except in lo

vertebrates, control of thyroid hormone production is mediated by the anterior pituitary peptide thyrotropin, also known as Ihyroid Stimulating Hormone (TSH). In higher

vertebrates, the control of TSH secretion is in turn influenced by Ihyrotropin Releasing Hormone (TRH). TRH is a modified tripeptide produced in the supraoptic and

paraventricular nuclei of the hypothalamus. Once TRH is produced, it is transported to an

stored in a structure called the median eminence. TRH is secreted from the median emine where it reaches the anterior pituitary gland via a specialized vascular bed, the hypophysea

portal venous system. TRH is delivered to the anterior pituitary gland where it stimulates

both the production and release of TSH. Subsequently, TSH passes into the blood stream

is transported to the thyroid gland where it regulates thyroid hormone production.

Importantly, through a negative feedback regulatory loop, thyroid hormones influence both the production of TRH and TSH. It has been demonstrated that T3 is able to antagonize TRH mediated TSH release by the anterior pituitary gland. In this manner, even in the presence of TRH, high levels of circulating thyroid hormones can block the production of TSH. Thyroid

hormones may also inhibit the production or release of TRH (Segerson et al., 1987). Finally,

it has been shown that high amounts of thyroid hormone reduce the responsiveness of the

thyroid gland to TSH (Larsen and Ingbar, 1992), suggesting that autoregulation provides an

additional sensitive control mechanism for thyroid hormone production. The regulation of thyroid hormone production is therefore an intricate process aimed at providing neither an

excess nor a deficiency of hormone.

TSH is the primary regulator of this pathway, as it dictates the production of thyroid

hormone by the thyroid gland. This gland is one of the largest endocrine organs, weighing

20 grams, and is located closely affixed to the anterior and lateral aspects of the trachea. It

has an enormous capacity to respond to TSH and with hyperstimulation can enlarge to many

hundreds of grams, a condition referred to as goiter. By light microscopy, the normal gland

can be shown to consist of closely packed sacs or follicles lined by a single layer of cuboidal

cells. The follicles are filled with colloid which consists mainly of a clear proteinaceous substance called thyroglobulin. Thyroglobulin is a thyroid protein which forms a peptide linkage with thyroid hormone precursors and thyroid hormones.

Synthesis of T4 and T3 occurs as follows: i) active transport of iodide into the thyroid

gland, ii) oxidation of iodide and iodination of tyrosyl residues within thyroglobulin to form the inactive thyroid hormone precursors MIT and DIT, and finally, iii) the coupling of iodotyrosines to form the hormones T4 and T3. Release of the hormone is achieved by

hydrolysis of thyroglobulin by thyroid peptidases and proteases to produce free iodinated

amino acids which are transferred to the blood. Upon entering the blood, thyroid hormon

are bound reversibly to proteins synthesized in the liver and transported to various tissues.

The cellular uptake of thyroid hormones is poorly understood. There is evidence for a car

transport system for each hormone independently, and this carrier system is dependent on cellular adenosine triphosphate (ATP) for energy and sodium (Mendel et al. , 1988 and

Kreening et al., 1983). In addition to the aforementioned carrier system, there is also a

saturable, stereospecific, sodium independent system (Blondeau et al., 1988). Once T4

enters the cell, it is deiodinated by tissue specific monodeiodinases to the more active for T3. There are three general classes of deiodinases, type I (3, 3', 5' monodeiodinase 1 or t I 5^*D), type II (3, 3^*, 5' monodeiodinase 2 or type 2 5'D) and type III (3, 3\ 5

monodeiodinase, 5D) (Kohrle et al., 1991). Once thyroid hormones have entered the cell,

they bind to and activate a class of transcription factors referred to as thyroid hormone

receptors alpha and beta.

Nuclear Hormone Receptors

The steroid/thyroid hormone receptor superfamily is one group of ligand dependent

transcription factors which function as sequence specific DNA binding proteins. This famil of receptors is divided into two subfamilies based on sequence homology, the steroid recep

family and the thyroid hormone/retinoic acid receptor family. The basic structure of this family of receptors and the function of various domains is shown in the accompanying Figure

1 which indicates percentage amino acid homology.

These nuclear receptors appear to have arisen from a single ancestral gene, and multiple

members of subfamilies probably arose by gene duplication events followed by dispersal to

multiple chromosomes (Laudet et al., 1992). The basic structure of the superfamily proteins

is similar and composed of several functional domains. The N-terminal domain is the most

variable between family members and in many receptors facilitates DNA binding and ligand

independent transactivation (Tasset et al., 1990). The DNA binding domain has the highest

sequence homology in the superfamily, and is critical for recognition and binding to a

specific sequence in DNA. The hinge region contains sequences important for receptor

localization (LaCasse et al., 1993) and possibly for DNA binding. The ligand binding domain encompasses almost the entire carboxyl terminus (C-terminus) of the proteins and has

additional functions such as hormone-dependent dimerization, ligand binding and the

activation of transcription (transactivation). Recent evidence also suggests that the ligand

binding domain may participate in repression of transactivation (Baniamad et al., 1992).

The DNA sequences specifically recognized and bound by steroid hormone receptors are

referred to as Hormone Response Elements (HRE's). HRE's which specifically interact with thyroid hormone receptors are referred to as Ihyroid Response Element (TRE). These have

been defined functionally by the ability of the specific receptor to bind to the sequence and

influence transcription using the experimental techniques of transient transfection, gel- retardation assays and DNA footprinting.

TR, TRE's and Control of Gene Expression

TRα was the founding member of the subfamily of nuclear hormone receptors which

includes, among others, the thyroid (TR), vitamin D3 (VD3R), retinoic acid (RAR) and

cis-retinoic acid (retinoic X, RXR) receptors (Evans, 1988; Glass and Holloway, 1990).

Also included in this family are proteins referred to as orphan receptors, as they show

conserved homology with the aforementioned receptors. However, no specific ligand has

been identified and their physiologic roles are not yet elucidated. The basic structure of

is similar to that of other members of the steroid hormone superfamily.

TR binds specific DNA sequences, TRE's, and influence gene expression. As with other HRE's, these sequences are generally found in the 5" flanking region of the gene adjacent

the coding sequence. However, there are examples of TRE's found in introns and 3' UT regions. Liganded TR bound to a TRE can either activate or repress gene expression.

TRE's which act as silencers are referred to as negative TRE's, nTRE's (for a review see Williams and Brent, 1995).

In contrast to many other ligand-dependent transcription factors, TR's appear to be nuclea

and bound to chromatin, even in the absence of ligand. Therefore, unlike other classical

steroid receptors, TR's are able to bind to TRE's in the absence of hormone. In this cont unliganded TR has been shown to act as a constitutive repressor of basal transcription on genes containing TRE's (Graupner et al., 1989).

The basic TRE's are a rather degenerate group of sequences which occur in a variety of

contexts but generally consist of the hexameric sequence AGGTCA arranged as two identifiable half sites. The optimal binding and transactivation sites for TR, based on studies

of natural TRE's, include a direct repeat hexamer separated by 4 base pairs (bp) (Dir4), an

inverted hexamer with a 6 bp spacer (TREinvό) and two hexameric sequences oriented as a

palindrome (TREpal).

In most cases, the experiments used to define TRE's are consistent with the effects of thyroid

hormone in vivo, although there is limited knowledge regarding the specific hormone-

dependent regulation of genes in an organism. For example, the Dir 4 element is found in

three genes physiologically regulated by T3, the rat growth hormone (rGH), alpha myosin

heavy chain (αMHC) and malic enzyme (ME) promoters.

The physiologic correlate of the TR-mediated response in experimental systems are suggested

by the findings that GH secretion is blunted in hypothyroidism (Yaffe and Samuels, 1984), hepatic ME mRNA shows a 15-20 fold fluctuation in response to hypothyroidism and

hyperthyroidism (Towle et al., 1980, 1981) and hypothyroidism is associated with a decrease

in the level of cardiac αMHC (Lompre et al., 1984). This suggests that the in vitro data

demonstrating hormone dependent activation of transcription using the promoter elements of

these genes is consistent with the findings of thyroid hormone induced gene expression in a physiologic context.

Finally, a very important but poorly characterized property of TR is its ability to mediate

ligand-dependent repression of gene expression. The promoters for the α and β subunit

genes of TSH have been characterized extensively (Chatterjee et al. , 1989; Burnside et al.

1989; Wood et al. ; 1989 and Wondisford et al., 1993) although a limited number of other genes have also been identified which have nTRE's in their 5^* flanking regions. There is

clear consensus sequence and the mechanism of T3-induced repression of transcription is

active area of research. However, it is postulated that negative regulation by TR may be

conferred by binding of a receptor monomer to a single half site (Crone et al., 1990 and

Thompson et al., 1992). Importantly, this regulation has physiologic implications as it is

known that thyroid hormones repress TSH transcription in vitro and in mammals thyroid

hormone excess results in decreased TSH, whereas hypothyroidism results in increased TS

Thyroid Hormone Receptors During the early 1980's the v-erbA oncogene was cloned and sequenced. The role of v-er and the characterization of its cellular homologue were facilitated by the cloning and

characterization of the sequence of the first steroid receptors, the estrogen and glucocortic

receptors, as v-erbA was found to have homology to these receptors. In 1986, the cellular homologue of v-erbA was identified as the chicken thyroid hormone receptor alpha, c-erb

or cTRα-1 (Sap et al., 1986) and immediately thereafter a second distinctive nuclear recep for T3, human TRβ, was identified (Weinberger et al., 1986). Characterization of the two

genes show they are similar in their intron exon boundaries, their overall structure and are

most related in the cysteine-rich DNA binding and C-terminal hormone binding domains.

Further analysis demonstrated that in addition to the two different receptors, alternate

splicing of the initial transcripts of each of the genes yield different mRNAs (Mitsuhashi et

al. , 1988; Izumo and Mahdavi, 1988). The various forms and isoforms are shown in Figure

1.

In mammals, the isoforms encoded by the α gene are designated α-1 and α-2 and those

encoded by the β gene are designated β-1 and β-2 (Sjόberg, 1991 and for a review see Forrest, 1994). There is an additional isoform in chicken designated β-0. The TRα gene

encodes the ligand binding isoform TRα-1 and the non ligand binding variant TRα-2. The

two receptors arise from alternative splicing which generates proteins with different C-

termini. TRα-1 is encoded by exons 1 through 9, whereas TRα-2 results from alternative splicing of exon 9 to exon 10. This alternative splicing event replaces the 40 final amino

acids encoded by TRα-1 with 120 amino acids specific for TRα-2 which abolishes the

hormone binding function and alters the DNA binding properties, RXR heterodimerization and the transactivation function of the protein. The precise role of the TRα-2 isoform is

unclear at present. In contrast, both TRβ receptor isoforms bind thyroid hormone and

activate transcription.

The various TR's show tissue specific and developmental specific patterns of expression (Sjόberg, 1994 and references therein). For example, the TRβ-2 isoform is expressed mai in the pituitary gland (Hodin et al., 1989) although recent evidence suggests that it is also

expressed at very low levels in some other tissues (Schwartz et al. , 1994). In addition, th

non-ligand binding variant, TRα-2 is expressed in some tissues at levels up to tenfold hig than the hormone binding variants and in the adult testes it is the only TR expressed (Ko

et al., 1989 and Jannini et al., 1994). Studies comparing the isoforms suggest that fetal

hormone production may influence TR expression patterns. For example, the early CNS

expresses TRα-1 isoforms prior to fetal hormone production and decreased expression of receptor is associated with the production of hormone by the fetus. This is in contrast to

1 which is abruptly increased in the CNS during the perinatal period in association with th

production of endogenous thyroid hormone. Other findings suggest that the expression of various receptors in the adult are also influenced by thyroid hormones (Hodin et al., 1990

Strait et al., 1990). These data suggest that not only do various TR's have different effects

gene expression, but they may also be differentially expressed in response to thyroid horm

The precise roles of the various receptors and isoforms remained to be defined.

Diseases associated with thyroid hormone disorders

The function of TR as a transactivator and a repressor and its implication for basal

transcription are poorly understood, but may be important in disease associated with both hypothyroidism and dominant negative interference by mutated receptors and receptor

isoforms. For example, hypothyroidism would result in the loss of ligand-dependent activ

of transcription, but in addition, unliganded TR would act as a constitutive repressor of ba transcription. Therefore, in order to understand the implications of receptor abnormalities in contrast to hormonal disturbance, it is important to describe the symptoms and abnormalities

associated with thyroid hormone excess and thyroid hormone deficiency. These abnormalities will then be compared to those associated with mutations in the TRβ gene in humans and the v-

erbA oncogene in experimental model systems.

Hypothyroidism

The term hypothyroidism is used to describe a clinical state of thyroid hormone deficiency.

There are many causes of thyroid hormone deficiency which are classified as primary if the

defect is at the level of the thyroid gland, secondary if there is a lack of TSH production, and

tertiary if it is due to lack of TRH. Regardless of the cause, hypothyroidism results in abnormalities in all organ systems and the extent and permanence of these abnormalities are

influenced by the timing and the severity of the deficiency.

Untreated hypothyroidism in the developing human is associated with permanent and profound

defects. This is the impetus which led to the widespread use of universal screening programs

to detect and treat congenital hypothyroidism. The major organ systems affected in the

developing human are the CNS and the skeleton. Untreated congenital hypothyroidism results in mental retardation. The associated CNS pathology consists of hypoplasia of cortical neurons

with poor development of cellular processes, retarded myelination and reduced vascularity.

Skeletal maturation is delayed and specific abnormalities in bone formation result in a speckled appearance of epiphyseal centers of ossification (epiphyseal dysgenesis or stippling). Linear growth is severely impaired leading to dwarfism in which the limbs are disproportionatel short in relation to the trunk. Finally, sensori-neural hearing loss is often present. These

abnormalities can be prevented if exogenous thyroid hormone is given beginning shortly

birth, but only partially reversed if treatment begins after three to six months of age.

In the adult, most organ systems are affected during hypothyroidism but return to normal

treatment with hormone. Life-threatening disorders are associated with abnormalities of

CNS and heart. Neurologic symptoms consist of a general slowing of intellectual functio

lethargy and somnolence, and in severe hypothyroidism epileptic seizures, stupor and co can develop. In addition, a particular abnormality can develop in some patients referred

cerebellar ataxia in which the patient has a wide-based and unstable gait. Histopathology the brain shows edema, mucinous deposits in and around nerve fibers, foci of degeneratio with reactive gliosis and in general, severe atherosclerosis of the cerebral vessels is prese

The cardiac system is also affected in hypothyroidism. The so called "myxedema heart"

associated with a decreased heart rate, "flabby" myocardium and decreased cardiac outpu which results in contraction of the blood volume and hypoperfusion of vital organs. This

manifest as symptoms of cold intolerance due to decreased perfusion and in some cases le

to kidney failure and congestive heart failure.

Other symptoms include decreased fertility in both men and women. In women this is du

failure to ovulate and in men to decreased sperm production. Severe anemia can also dev due to decreased production of erythropoeitin and abnormalities in red blood cell production.

Muscle stiffness and aching, fluid in the lungs (pleural effusions), mucinous edema of the skin,

hair loss and hypercholesterolemia are also frequently associated with hypothyroidism.

The molecular mechanism of these defects is largely unknown although experimentally induced

hypothyroidism in rats results in decreased brain size, a reduction in dendritic arborization of

cerebellar Purkinje cells and in delays in myelin formation in the CNS and PNS. Additionally,

studies have shown that the expression of genes which are important for normal CNS

development are decreased in hypothyroidism (Figueiredo et al., 1993 and Rodriguez-Pena et

al., 1993).

Hyperthyroidism

The term hyperthyroidism is used to describe symptoms associated with thyroid hormone

excess. As with hypothyroidism, there are many causes of hormone excess, and these are also generally classified as primary, secondary and tertiary. In general, thyroid hormone excess is

not as severe as that of thyroid hormone deficiency. The effects of hyperthyroidism are most pronounced on the cardiovascular system. Excess thyroid hormone results in an overall hypermetabolic state and the need to dissipate excess heat. This leads to compensatory changes which include dilatation of the peripheral vessels. In addition, thyroid hormones act

directly on the myocardium to stimulate the heart rate and increase the force of contraction.

Therefore, the cardiac output and workload on the heart are increased considerably. In addition, abnormalities in the normal electrical conduction of the heart often leads to cardiac arrhythmias. The stress on the heart associated with these abnormalities can lead to cardi decompensation if oxygen delivery to the heart can not exceed oxygen consumption. This the main life-threatening complication of hyperthyroidism.

Other symptoms include shortness of breath, increased appetite, muscle weakness and

fatigability, and in the CNS symptoms of excess excitation are manifest as hyperkinesia,

tremors, seizures, emotional lability and nervousness. The mechanism by which thyroid

hormone exerts the effects on the CNS and heart are unknown. However, no clear alterat in cerebral metabolism or vascular abnormalities have been noted.

Generalized Resistance to Thyroid Hormone

Importantly, no human disease has been associated with a dominant negative mutation or

deletion of the TRα-1 gene in humans. In contrast, disorders of the TRβ locus in humans

associated with the syndrome of Generalized Resistance to Thyroid Hormone (GRTH) (fo

review see Usala, 1994). GRTH is an inherited syndrome of reduced tissue responsivene thyroid hormone (Refetoff et al., 1967). The syndrome is associated with two different T

abnormalities. In the first case described, the patient had a chromosomal deletion

encompassing the TRβ locus which resulted in no receptor protein being made. In all othe

cases, the abnormality is due to mutations in the TRβ locus which render it unable to bind thyroid hormones effectively but still able to bind DNA and interfere with the function of

normal receptor. This mutant receptor inhibits the function of TR in experimental system

v-erbA has served as a paradigm transdominant negative thyroid hormone receptor for thi syndrome.

Patients with GRTH are generally identified on the basis of extremely high (two to five times normal) levels of thyroid hormone in the presence of inappropriately normal levels of TSH and

the absence of clinical evidence of hyperthyroidism. Patients with the dominantly inherited

form of GRTH exhibit variable but mild phenotypes and generally have bone abnormalities

characteristic of juvenile hypothyroidism ranging from delayed bone development to short stature, varying levels of mild mental retardation, tachycardia and attention deficit

hyperactivity disorder (ADHD) (Hauser et al. , 1993). More careful examination of these

patients has demonstrated that tissues show varying levels of resistance to thyroid hormone.

Some tissues, such as the heart, exhibit characteristics of hyperthyroidism, i.e. tachycardia, whereas tissues such as bone display characteristics of hypothyroidism.

Patients homozygous for a deletion of the TRβ locus also have high circulating levels of thyroid hormone with inappropriate TSH secretion, but also have hearing loss and a particular

bone abnormality referred to as stippled epiphyses (Refetoff et al., 1967 and Takeda et. al.,

1992). These patients were the result of consanguineous marriage and the phenotype associated with this or other recessive mutations remain to be defined. Although the majority of symptoms are similar, deafness and stippled epiphyses are more characteristic of juvenile

hypothyroidism and are more pronounced in this disease than in those with the dominantly

inherited form of the disease. These findings suggest that although the molecular defect underlying GRTH has been established, the role of TRα in modulating the influence of TRβ in an organism remains t

elucidated.

According to one aspect of the invention there is provided a transgenic animal which is heterozygous for an at least partially defective thyroid hormone receptor gene. The defec

gene may be inactivated for example by an insertion, deletion, substitution or inversion or

other suitable genetic mannipulation.

Preferably, the animal is a rodent , more preferably a mouse.

Preferably, the thyroid hormone receptor gene is the TRα gene. More preferably, the gene the TRαl gene. In such a case the mammal may include a functional TRα2 gene.

One heterozygous transgenic animal in accordance with the invention may be bred with

another such heterozygous transgenic mammal to produce a mammal which is homozygou the defective thyroid hormone receptor gene.

The invention also provides cells derived from the animal of the invention which are heterozygous or homozygous for a defective thyroid hormone receptor.

According to another aspect of the invention there is provided a method of producing a transgenic animal in accordance with the invention the method comprising :

1) preparing a gene encoding an at least partially defective thyroid hormone receptor as

described above;

2) introducing that gene into suitable carrier cells;

3) inserting those carrier cells into an embryo; and

4) replacing the embryo into a mother, and allowing the embryo to develop to full term.

Preferably, the thyroid hormone receptor gene is the TRα gene. More preferably the gene is

the TRαl gene.

According to a further aspect of the invention there is provided a method of testing the

agonist/antagonist properties of a compound in relation to the thyroid hormone receptor, the

method comprising:

contacting a transgenic animal in accordance with the invention with the compound and

monitoring subsequent development of the animal. Alternatively, the method may involve

using cells or tissues derived from the transgenic animal.

The transgenic animal of the invention is suitable for testing the effects of agonists and antagonists of thyroid hormone action, in particular those that discriminate between TRα and

TRβ .

The production of transgenic animals in accordance with the invention and their uses are now described, by way of example only, with reference to the accompanying drawings Figure

9.

Experimental outline for disruption of the mouse Trα-1 gene by homologous recombination

Genomic mapping and strategy for targeting construct

The TRa gene encodes for two different receptor isoforms, the ligand binding receptor T and the non ligand binding variant TRα-2. The two receptors arise from alternative splici

which generates proteins with different carboxy termini. TRα-1 is encoded by exons 1 thr

9 whereas TRα-2 results from alternative splicing using a donor site present 128 bp after start of exon 9, here referred to as exon 9a, to splice to the acceptor site of exon 10. Thi alternative splicing event replaces the 40 final amino acids encoded by TRα-1 with 120 a

acids specific for TRα-2. As mentioned, the TRα-2 variant is unable to bind thyroid

hormone and its physiologic function is unknown. Therefore, a targeted disruption of any the exons 1 through 9a would ablate both the hormone binding and non hormone binding

variants whereas deletion of nucleotides in exon 9 which are after the splice site, (here ref to as exon 9b) would selectively disrupt TRα-1. In addition, the orphan hormone recepto

erbA is encoded on the opposite strand of the TRα locus (Figure 2) and the last exon of t rev-erbA locus overlaps exon 10 of the TRα locus (Laudet, et. al., 1991).

Therefore, the targeting construct had to be made so that i) the coding sequence specific t TRα-1 messenger RNA (mRNA) was removed, ii) the production of a TRα-2 mRNA with a normal coding sequence was possible, iii) the region of TRα exon 10 which overlapped the rev-erbA locus was undisturbed, and iv) a selectable marker was added.

To accomplish this, the following cloning strategy was used. We planned to eliminate the

exon 9 TRα-1 specific region (exon 9b) and replace it with TRα-2 specific sequences. Then,

by the addition of a poly adenylation signal (poly (A)) to the end of the TRα-2 specific sequence, we would ensure appropriate processing of the transcript. This would also allow us

to leave the original exon 10 unaltered and thereby eliminate any chance of disturbing the rev-

erbA locus. In order to select for ES cells which had incorporated the vector, a selectable

marker was also required. To prevent the possibility of a fusion protein being made, we chose

to orient the selectable marker gene in the opposite transcriptional orientation to that of the

TRα transcript. This required that the selectable marker had its own promoter and poly (A)

signal.

To construct a targeting vector which fulfilled the criteria described above, we chose the

following approach:

i) Mapping of the 7__α locus

We first made a preliminary map of the TRα genomic locus using a 13 kb fragment of

genomic DNA derived from the FVB mouse strain (gift of F. Baas) which was believed to

contain exon 9 and exon 10 sequences (Figure 3A). Preliminary mapping showed that two Bgl II sites flanked a region of the locus which included exon 8 to exon 10. This fragment w subcloned and more detailed restriction mapping was done. Restriction mapping was

performed in an attempt to find a unique site in the 3' untranslated region (3' UT) of exo

which could be used for inserting a selectable marker and to replace exon 9b specific

sequences with exon 10 and a poly (A) signal. As depicted in Figure 3 A, the only appro

unique site was a Sea I site in exon 9b. However, most cloning vectors have Sea I sites i

ampicillin resistance gene which makes the use of the Sea I site impractical. In addition,

strategy could more easily be accomplished using a Sal I site. Therefore, we converted th

I site into a Sal I site.

ii) Production of the exon 9a +10 fragment

Simultaneously, a fragment (ex. 9a + 10) extending from the Stu I site in exon 9 (upstrea the splice donor) to just after the stop codon in exon 10 was cloned by reverse transcriptio

(RT) followed by polymerase chain reaction (PCR) using mouse brain as a template. This

generated a 522 bp fragment which was specific for the 3' terminus of the TRα-2 transcri which included the desired coding region and 47 bp of 3' UT but no poly (A) signal. In addition, a Sal I site was added using PCR directed mutagenesis at the 3' end of the produ

This allowed the fragment to be purified using a Stu I/Sal I cleavage.

iii) Generation of the pmTR ex. 9a +10 intermediate vector

The pmTRαex. 9a + 10 intermediate vector was made as follows. The pmTRαBgl II vect

was cleaved with Stu I and Sal I to remove the region encoding for TRα-1 specific sequen including much of the 3' UT region of exon 9, and replaced by the TRα-2 specific sequence

9a+ 10 described above. The resulting construct consists of exon 9a fused to exon 10 with

exon 9b regions necessary for the production of a TRα-1 transcript deleted. It also leaves the

original exon 10 region unaltered and rev-erbA unaffected.

iv) Preparation of a SV 40 poly (A) signal and selectable marker

Appropriate processing of the modified transcript, consisting of exons 9a fused to 10, still required the addition of a poly (A) signal. In addition, a selectable marker was required to

screen for cells which had taken up the vector. To ensure appropriate processing, we chose to use a SV 40 poly (A) signal and place it after the stop codon in exon 10 using the artificially

introduced Sal I site. As a selectable marker we chose to use neomycin as expressed by the pMClneo poly A vector (Stratagene) which consists of the neomycin gene driven by the

thymidine kinase (tk) promoter followed by a poly (A) signal.

In order to accomplish the addition of the SV 40 poly (A) signal, concomitantly with the

addition of the selectable marker, we proceeded as follows. A 224 bp SV 40 poly (A) signal flanked by Bam HI site was isolated. This fragment was then ligated into the Bam HI digested

pMClneo poly A plasmid so that its transcriptional orientation was opposite to that of the

neomycin resistance gene transcription. Once this was accomplished a Sal I/Xho I cleavage was used to release a fragment consisting of the SV 40 poly (A) followed by the neomycin selectable marker transcriptional unit in the opposite orientation. v) The targeting vector

In order to insert the Sal I/Xho I fragment described above, the intermediate vector, p/7.TRαex.9a+ 10 was then cleaved with Sal I. This allows for the ligation of the fragmen

consisting of the SV 40 poly (A) followed by the neomycin selectable marker into the Sal

site. The resulting vector, when used for recombination at the original locus, would gene

recombined locus as shown in Figure 3B. Of note, 2 new Bam HI sites are present in the recombined locus which were used in screening of recombinant clones as described below.

Probe design

In order to screen for homologous recombination, several probes were required as follows a probe specific to sequences 5' of the targeting construct, ii) a probe specific to sequences

of the targeting construct, iii) a probe corresponding to sequences in the targeting vector a

the normal allele which could be used to assess both the integrity of the 3' integration site for the presence of nonhomologous recombination, and finally, iv) a probe designed to tes

integrity of the 5' recombination site. To identify appropriate probes, various restriction

enzyme digestions of approximately 19 kb of the genomic locus were performed and subje

to gel electrophoresis followed by Southern Blotting. Thereafter the filter was hybridized high molecular weight DNA from 129 ES cells which was labeled by nick translation. Ba

which gave strong signals were presumed to be due to hybridization with repetitive sequen

and these areas were not used for generating probes (data not shown). The 5' probe, the i

8 internal probe, the exon 10 probe and the 3' probe corresponded to restriction fragments which gave normal strength signal, indicating binding to a single copy sequence, were cho as specific for binding to the mouse TRα locus and met the criteria for probes described above

(Figure 3A, B).

Electroporation and Screening for recombinant clones The targeting vector was cesium chloride purified and the Bgl II fragment was removed,

purified and used for electroporation into embryonic stem (ES) cells. DNA from neomycin resistant clones was extracted and screened by Southern blotting for homologous

recombination. DNA was digested with Bam HI which generates a 23 kb fragment from the

normal locus. In contrast, the recombined locus has two Bam HI sites 226 bp apart which

divides the 23 kb fragment into an approximately 13 kb 5' fragment and a 9.94 kb 3' fragment. The Bam HI digested DNA was then subject to Southern analyses and the filter hybridized

consecutively with three different probes: i) an internal probe specific for exon 10 sequences

ii) a 5" probe which recognizes sequences 5' of the targeting vector and iii) a 3^* probe

recognizing sequences 3' of the targeting vector. Exon 10 probe gave only one band for the normal locus whereas the homologous recombination on one allele gave three fragments

corresponding to the 23 kb normal allele and the 13 kb and 9.9 kb fragments from the

recombined allele. Probing with the 5' and 3" probes demonstrate the 23 kb normal allele and the 13 kb and 9.9 kb recombined alleles, respectively. In addition, the internal probe gave no

additional bands, indicating that no additional nonhomologous recombination had occurred.

Finally, to verify that the 5' recombination site remained intact and that no other recombination

events had occurred, the DNA was digested with Stu I and probed with an intron 8 probe

(Figure 4). The appropriate recombination gave only one band as both the normal and recombined alleles are similar in this area. The frequency of homologous recombination approximately 1 :100 despite using non-isogenic DNA.

Generation and Screening of Mutant Mice

Targeted ES cells from three independent clones were injected into blastocysts and impla

into pseudopregnant females according to standard protocols. Male coat color chimeras bred and offspring screened by coat color followed by PCR of tail DNA for the targeted

disruption. TRα-1 +/- mice were then interbred to obtain homozygotes and offspring scr by PCR to identify TRα-1 -/- mice.

Experimental details

Genomic mapping and targeting vector

Two independent plasmid clones which contained a total of 19 kb of 3^* mTRα locus from

FVB mouse strain were obtained (gift of F. Baas). Restriction mapping of the locus was

performed according to standard protocols (Sambrook et al., 1989 and RESULTS section

The targeting vector used for homologous recombination was constructed as follows usin

standard experimental procedures (Sambrook et al., 1989): A 7.2 kb Bgl II fragment including the region of mTRα from intron 7 to exon 10 was isolated and subcloned into t

SP70 vector (Promega) which had been modified so that only Cla I and EcoRV restrictio

remained in the polylinker. The Sea I site in the 3" UT region of exon 9 was converted in Sal I site by Sea I partial digestion followed by Sal I linker addition .

RT-PCR was performed on poly (A) selected RNA from mouse brain using poly d(T) as the

reverse primer. The cDNA was used as a template for PCR. Both primers had sequences

encoding a Sal I restriction enzyme site (underlined regions) followed by sequence

corresponding to either the beginning of exon 9 (5'SAL) (5^*

GGAGTCGACCGAGAAGAGTCAGGAG-3' . or the 3' UT region of exon 10, 47 nucleotides

after the stop codon (3'SAL) (5'GCTACTCCTTCTCCCGTCGACAAC-3'V The resulting 570

bp PCR product (9a -I- 10) was purified and cloned into pGEM 3Zf(+) vector at a Sal I site

(pGEM 9a + 10) and sequenced. Thereafter the pSP70Bgl II vector was cleaved with Stu I and

Sal I to release a 1100 bp fragment consisting of sequence just upstream of the splice donor site in exon 9, and pan of the 3' UT region of exon 9. The pGEM 9a+ 10 vector was simultaneously digested with Stu I and Sal I to release a 522 nucleotide fragment which

included exon 9a downstream of the Stu I site and exon 10, 47 bp after the stop codon. The

fragments were purified on low melting agarose TAE. The Stu I/Sal I fragment from pGEM 9a -I- 10 was then ligated into the Stu 1/ Sal I digested intermediate cloning vector to produce

the pmTRαex.9a+ 10 vector. The remainder of the vector was cloned as described in results.

Maintenance and Electroporation ofES Cells

Cells (Handyside et al. , 1989) were grown on mitomycin C-treated primary mouse embryo

fibroblasts that were derived from day 13-14 embryos of neomycin resistant transgenic mice

(Muller et. al., 1991). As growth medium, Dulbecco's modified Eagle's medium (DMEM) supplemented with 15% fetal bovine serum, 20 U penicillin, 20mg/ml streptomycin, 10

2-mercaptoethanol, 1 n_M sodium pyruvate, 1 x non-essential amino acids (Seromed), a 1000 U/ml leukemia inhibitory factor (LIF) was used.

Prior to electroporation into embryonic stem (ES) cells, cesium chloride purified plasmi

digested with Bgl II and purified using Promega Magic DNA clean up system. Electrop

of 1 x 10⁷ ES cells in 800 ml of Optimem with 10-50 μg Bgl II digested targeting vector

carried out using a BioRad Gene Pulser and parameters 250 V, 960 mF. Cells were plat

dishes with feeder cells, and 24 hours after electroporation the growth medium was supplemented with 375 μg/ml G418. Neomycin-resistant clones were picked 8 days after

electroporation and expanded for DNA analysis. We screened for homologous recombin events by Southern blotting.

Probe preparation and Southern Blot Analysis

The 5' probe was isolated by restriction digestion using Bam HI site in the plasmid

intermediate and the Kpn I site in the clone. The 3' probe corresponds to a Bam HI / Hi fragment distal to exon 10. The exon 10 probe (internal probe) was generated by PCR us

5' primer with the sequence GCGGAATTCAAGCTTTGGGGAAGACGACAGCAGTG

includes an EcoRI and Hind III site (the underlined portion represents 1377-1401 of mT cDNA) and the 3" SAL primer used to generate the PCR fragment used in the targeting construct. The 568 bp internal probe was generated using a 5' primer specific to exon 8 980 nt of mouse cDNA) and a 3' primer corresponding to the beginning of exon 9 (1002-1024 nt of mouse cDNA). PCR generated probes were labeled using [α-³²P]dCTP in the reaction

mix and the remaining probes were labeled with [α -³²P]dCTP using the random priming

method and a commercially available megaprime kit (Pharmacia, LKB).

DNA from neomycin resistant clones was prepared using a lysis buffer consisting of lOmM Tris Hcl pH = 7.8, lmM EDTA, 0.2M NaCl, 1 %SDS and 0.5mg/ml proteinase K followed

by phenol-chloroform extracted and ethanol precipitation. The DNA was then screened by

Southern blotting for homologous recombination. DNA was digested with Bam HI and

separated on 0.8% TBE agarose gels. Southern blotting was then performed using Hybond N nylon filters (Amersham), and the filters hybridized according to the manufacturers

recommendation, then stripped and rehybridized with probes as described above. Positive

clones were confirmed by digestion with Stu I followed by Southern analysis and filter

hybridization with the intron 8 probe.

Generation and Genotyping of mice

Blastocysts from C57bl females were collected 3.5 days after conception, and 10-25 ES cells were injected into each blastocoel. Re-expanded blastocysts were implanted into the uterine

horn of 2.5 days pseudopregnant F1(B₆CBA) females. Male offspring with coat color

chimerism were bred with BalbC females, and germline transmission was scored by coat color.

TRal +/- mice were identified by PCR and were then interbred to obtain homozygotes. DNA was prepared from tail clips according to Laird et al. (1991), and analyzed by PCR analysis using the 5 'SAL primers described above. The 3" primers were different for each paired reaction. In the first reaction the 3' primer (3' rvTRαl) corresponded to nucleotides 1349

1362 of mTRa-1 cDNA and in the second reaction the 3' primer (3' SV40) corresponded t

sequence 5'-ACCACAACTCGAATGCAGTG-3' of the SV 40 poly (A) tail. PCR produ were subjected to gel electrophoresis in ethidium bromide (EtBr) containing agarose gels a

visualized using UV light. In some instances, the genotype was determined by Sothern blotting. 1 cm of the tails of 3 week old pups was cut off, dissolved in lysis buffer and

extracted with phenol (Barlow et al 1994). Southern blot analyses were done with probes a described above for identification of ES cell clones that had undergone homologous

recombination.

RNA analysis of mice To verify that no TRα-1 message was made and that TRα-2 message was normally produc

in the -/- mice, 5μg of poly (A) RNA (Vennstrom and Bishop, 1982) from various tissues

used for northern blotting. Northern filters were hybridized with a full length mouse TR - cDNA probe which recognizes both isoforms. RT-PCR was done using poly d(T) as a pri for cDNA synthesis the 5' primer, 5'SAL, and 3' primer, 3' rvTRαl described above. T

PCR products were then electrophoresed through agarose gels containing EtBr and viewed

under UV light.

Analysis of hormones

Levels of free T3 And T4 in the blood of the mice was done as described previously (Barl et al 1994)

Phenotype of mice lacking a functional TRαl receptor

Breeding properties

To date, 3 founders have given rise to £100 heterozygous animals. The heterozygous animals

exhibit normal behaviour as compared to control mice in terms of viability, fertility, and

growth. When heterozygotes are bred, the resulting litter size is normal (7-10 pups), and the sex ratio male: female of the offsspring 1 : 1. An example of a cross between heterozygotes is

shown in Figure 4.

DNA prepared from the tails of 10 pups of one litter was cut with BamHI, electrophoresed in

an agarose gel,, and subjected to Southern analysis. The figure shows that 2 animals were

homozygous for the wt TRα gene, 3 homozygous for the targeted allele, and 5 heterozygous.

Homozygous animals (£50 to date) are fertile, giving normal sized litters. No goiter or any other abnormalities have been observed in animals up to 18 months of age.

Analysis of thyroid hormone receptor mRNA

To determine if the wt +/+, heterozygous +/- and homozygous -/- mice expressed the expected TRαl, TRα2/wt and TRα2/mutant mRNA, poly A + RNA from the brains of 8 week

old animals was electrophoresed in agarose gels and subjected to Northern analysis by probing

with a radiolabelled TRα cDNA probe. The results (not shown) indicated that the +/+ animals expressed only the TRαl and TRα2/wt RNAs, the -/- animals only a TRα2/muta

RNA, and the +/- mice all three RNAs. This was verified by a RT-RCR assay as shown figure 5, which utilized oligonucleotide primers specific for the 3 RNAs (see experimenta

details).

Analysis of brain gene expression

To determine if the lack of TRαl receptor affected brain gene expression, polyA+ RNA

prepared from TRαl mice, and subjected to a Northern analysis with cDNA probes speci for 2 brain-specific genes, RC3 and SE6C. The same amount of RNA was loaded in all la

Figure 6 shows that the striatum-specific gene SE6C is expressed at much lower levels in /- mice as compared to the wt animals, whereas RC3 levels were unaffected. This indicat that the brain development in the -/- mice is affected by the deletion of the TRαl gene.

Thyroid hormone assays The free T3 and T4 levels of 3 months old homozygous TRαl -/- mice was determined as described. Figure 7 shows that the 12 -/- and 11 +/ + animals tested have thyroid hormo

levels that range from euthyroid to hypothyroid, with an average that is subnormal.

EXAMELE In this example of the uses of the mice in accordance with the invention, heart rate, temperature and ECG-changes in mice lacking the gene for thyroid hormone receptor α were studied.

Methods:

Homozygote mice lacking the gene for the thyroid hormone receptor a, were anaesthetized and implanted with a telemetric device (DataScience model TA10ETA-F20) inside the peritoneum

in the upper abdomen. This allows us to measure ECG, heart rate and body temperature in the

unrestrained mice living in the animal quarter. We started the data collection two days after

the implantation of the telemetric device and continued for 47 hours. All the data were

collected using a computer system and the data were analyzed using a spread sheet program.

(Excel).

Fig. 8 shows basal heart rate in 2 knockout mice and 2 hetrozygote control mice. Mice 1, 2

were hetrozygote control mice (dotted lines) and mice 3, 4 were homozygote knockout mice

lacking the Trα-1. It will be seen that heart rate was around 620 in control mice and around

520 in the mice lacking the Trα-1.

Fig. 9 shows corresponding data for temperature changes. Body temperature measured in 4

mice via implanted telemetric equipment. Mice 1, 2 were hetrozygote control mice (dotted

lines) and mice 3, 4 were homozygote knockout mice lacking the Th_β-receptor. There was no obvious change in temperature between the knockout mice and the control mice. The change in ECG parameters are shown in table 1. It can be seen that the homozygote lacking the Trα-1 had ECG changes with shorter time between Q-wave to peak of the T- (QT-^) and to end of the T-wave (QT_end).

Mice QRS PQ QT_pc , QT_end

1 11.6 28.9 13.2 20.1

2 10.6 30.9 12.8 21.8

3 12.7 28.6 15.6 24.5

4 12.3 33.3 15.6 25.4

Table 1 : ECG changes in mice lacking the Trα-1. Mice 3 and 4 were lacking the Trα-1

mice 1 and 2 were control mice. All values are time in msec. All data were obtained an

averaged during day 2 after starting the data collection.

The results of these experiments show that mice lacking the Trα-1 had lower heart rate an moderate prolongation of QT_end and QT_peak. This might indicate disturbances in cardiac

function in these animals.

Treatment of many diseases associated with thyroid hormone function can today not be do since administration of increased doses of the hormone, to achive a desired effect in a giv

tissue, leads to adverse effects in another. The effects of thyroid hormones are mediated b two different receptors that are coexpressed in some tissues, whereas other tissues express

one of them. It should therefore be possible to design agonists and antagonists that are spe for each of the receptors and that can mediate a desired activation or repression of recepto

O:\SP\JPD\KB55PCT.WPD 32 function. The mice and their tissues and cells described above are suitable for testing the specifity of the effects of agonists and antagonists of thyroid hormone action. In addition, effects of thyroid hormones that are mediated via pathways other than those that employ the

TRs ("extrareceptor effects") can be characterized. The mice are also suitable for providing

"proof of action" for agonists and antagonists TR action.

In particular, the mice or cells derived from them may be used to study:

1. Effect on hypercholesterolemia. Administration of excess thyroid hormones decreases

high serum cholesterol levels. However, an adverse side effect is that cardiac output also increases which can lead to arrythmia. If these 2 functions of thyroid hormones are

mediated by distinct receptors, a proper administration of receptor specific agonists or

antagonists would lead to the desired decrease in serum cholesterol while leaving cardiac

function normal. In addition, the role of components of extrareceptor effects (defined below) can be studied and exploited.

2. Hypo- and hyperthyroidism adversely affect bone structure. The use of receptor specific thyroid hormone agonist or antagonists for treatment of e.g. hypercholesterolemia or other diseases must therefore include a test for their influence on bone synthesis and

turnover.

3. Regulation of heart functions such as pulse, arrythmia, or myocardiac muscle can be targeted by the use of receptor specific thyroid hormone agonist or antagonists. In addition, the role of components of extrareceptor effects can be studied and exploite

4. Many organs or tissues produce hormones in a thyroid hormone dependent manner. tissues include the hypophysis (producing growth hormone, prolacting, thyroid

stimulating hormone, luteinizing hormone), the hypothalamus (thyrotropin releasing hormone, oxytocin), periferal tissues (insulin growth factor I). The effect of recepto

specific thyroid hormone ago- or agonists on such endocrine systems can be determi with the mice described above.

5. Basal metabolic rate, gluconeogenesis, lipogenesis, lipolysis and thermogenesis are increased in hyperthyroidism and decreased during hypothyroidism. The effect of

receptor- specific thyroid hormone antagonists or agonists on such metabolic proces can be determined with the mice described above. In addition, the role of compone extrareceptor effects can be studied and exploited.

6. Toxic effects of agonists and antagonists on normal and abnormal physiological

metabolic processes. In addition, the role of components of extrareceptor effects ca studied and exploited.

7. Effects on brain or other neuronal function (hearing, peripheral nervous system), as

as effects on embryonal and fetal development of receptor specific thyroid hormone antagonists or agonists on such endocrine systems can be determined with the mice described above.

8. Effects on increasing or decreasing body growth with growth disorders.

9. A large number of genes or gene products are known to be regulated by thyroid hormones. The effects of agonists and antagonists of such systems can be tested before

clinical trials can commence

10. Effect on hemopoesis. Hypothyroid patients are usually anemic.

11. Effects in cancer chemotherapy. Human breast cancers ofthen have an amplified gene for

the cell surface receptor c-erbB2, located on chromosome 17. The human TRα gene is located close to the c-erbB2 gene, and is therefore usually co-amplified. It could

therefore contribute to the emergence of cancer. Although the contribution of the TRα

gene to tumor growth is unclear, the TR deficient mice offer an opportunity to test

antagonists and agonists in tumor chemotherapy

12. The effects of thyroid hormones that are mediated via pathways other than those that

employ the TRs ("extrareceptor effects") can be characterized, and the genes and their encoded proteins that participate in such pathways can be isolated, characterized, and

used for subsequent screening for novel agonists and -antagonists. 13. The mice will be suitable for providing "proof of action" for agonists and antagoni TR action and extrareceptor effects.

REFERENCES

Baniamad, A., Koehne, A. C. and Renkawitz, R. (1992). A transferable silencing domain is present in the thyroid hormone receptor in the v-erba oncogene product and in the retinoic acid

receptor. EMBO J., 11 , 1015-1023.

Barlow, C , Meister, B., Lardelli, M., Lendahl, U. and Vennstrom, B. (1994). Thyroid abnormalities and hepatocellular carcinoma in mice transgenic for v-erbA. EMBO J., 13, 4241-

4250.

Beckingham-Smith H. and Tata, J (1976). The hormonal control of amphibian metamorphosis.

Blackwell, Oxford.

Blondeau, J. P., Osty, J. and Francon, J. (1988). Characterization of the thyroid hormone

transport system of isolated hepatocytes. J. Biol. Chem., 263, 2685-2692.

Brinster, R. L. , Chen, H. Y., Trumbauer, M. W. and Avarbock, M. R. (1980). Translation of globin MRNA by the mouse ovum. Nature, 283, 499-501.

Burnside, J., Darling, D. S., Carr, F. E. and Chin, W. W. (1989). 'Thyroid hormone

regulation of the rat glycoprotein hormone (x-subunit gene promoter activity. J. Biol. Chem. ,

264, 6886-6991. Chait, A. , Bierman, E. L., and Albers, J. J. (1979). Regulatory role of triiodothyronine i degradation of low density lipoprotein by cultured human skin fibroblasts. J. Clin. Endoc

Metab., 48, 887-889.

Chatterjee, V. K. K. , Lee, J-K., Rentoumis, A. and Jameson, J. L. (1989). Negative

regulation of the thyroid stimulating hormone α gene by thyroid hormone: receptor intera

adjacent to the TATA box. Flroc. Natl. Acad. Sci. U.S.A., 86, 1994-1998.

Crone, D. E. , Kim, H-S. and Spindler, S. R. (1990). α and β thyroid hormone receptors

inunediately adjacent to the rat growth hormone gene TATA box in a negatively hormone

responsive promoter region. J. Biol. Chem., 265, 10851-10856.

Evans, R. M. (1988). 'The steroid and thyroid hormone receptor superfamily. Science, 2

889-895.

Figueiredo, B. , Almazan, G. M., Tetzlaff, W., Miller, F. D. and Cuello, A. C. (1993). expression in the developing cerebellum during perinatal hypo- and hyperthyroidism. Brai

Res. Mol. Brain Res. , 17, 258-68.

Foger, K. R., Wong, E. A. , Wahl, G. and Capecchi, M. R. (1982). Patterns of integratio DNA microinjected into cultured mammalian cells: evidence for homologous recombinati

between injected plasmid DNA molecules. Mol. Cell. Biol. 2, 1372-1387. Forrest, D. (1994). The erb A/ thyroid hormone receptor genes in development of the central nervous system. Sem. Cancer Biol., 5, 167-176.

Galton, V. H. (1983). Thyroid hormone action in amphibian metamorphosis. In:

Oppenheimer, J. H. and Samuels, H. H. (eds.) Molecular basis of thyroid hormone action.

Academic Press, New York, New York, 445-483.

Gilbert, L. I. and Frieden, E. (1991). Metamorphosis: a problem in developmental biology,

2nd ed. Plenum Press, New York, New York.

Glass, C. K. and Holloway, J. M. (1990). Regulation of gene expression by the thyroid hormone receptor. BBA reviews, 1032, 157.

Gordon, J. W., Scangos, G. A., Plotkin, D. J., Barbosa, J. A. and Ruddle, F. H. (1980). Genetic transformation of mouse embryos by microinjection of purified DNA. Proc. Natl.

Acad. Sci. U.S.A., 77, 7380-7384.

Graupner, G., Wills, K. N., Tzukerman, M., Zhang, K-K and Pfahl, M. (1989). Dual regulatory role for thyroid hormone receptors allows control of rednoic acid receptor activity.

Nature, 340, 653-656.

Hanahan, D. (1989). Transgenic mice as probes into complex systems. Science, 246, 1265- 1275.

Handyside, A.H., O'Neill, G.T. , Jones, M. , and Hooper, M.L. (1989). Roux Arch Dev

198, 48-55.

Hauser, P., Zametkin, A. J., Mardnez, P., Vitiello, B., Matochik, J. A., Nfixson, A. J.

Weintraub, B. D. (1993). Attention deficit hyperactivity disorder in patients with generali

resistance to thyroid hormone. NEJM. , 328, 997-1001.

Hodin, R. A., Lazar, M. A., Wintman, B. I., Darling, D. S., Koenig, R. J. , Larsen, P.

Moore, D. D. and Chin, W. W. (1989). Identification of a thyroid hormone receptor that pituitary specific. Science, 244, 76-79.

Hodin, R. A., Lazar, M. A. and Chin, W. W. (1990). Differential and tissue-specific

regulation of multiple rat c-erba messenger RNA species by thyroid hormone. J. Clin. Inv

85, 101-105.

Hogan, B., Beddington, R. , Costantini, F. and Lacy, E. (1994) 2nd ed. Manipulating the Mouse Embryo. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

Izumo, S. and Mahdavi, V. (1988). Thyroid hormone receptor α isoforins generated by

alternative splicing differentially activate myosin HC gene transcription. Namre, 334, 539 Jannini, E. A., Dolci, S., Ulisse, S. and Nikodem, V. M. (1994). Developmental regulation of

the thyroid hormone receptor alpha- 1 MRNA expression in the rat testis. Mol. Endocrinol. , 8, 89-96.

Joyner, A. L. (1993). Gene targeting: A practical approach. IRL press at Oxford University

Press, England.

Klein, I. (1990) 'Thyroid hormone and the cardiovascular system. Am. J. Med., 88, 631-637.

Koenig, R. J. , Lazar, M. A., Hodin, R. A., et. al., (1989). Inhibition of thyroid hormone

action by a non-hormone binding c-erba protein generated by alternate niRNA splicing.

Nature, 337, 659-661.

Kohrle, J., Hexch, R. D., Leonard, J. L. (1991) Intracellular pathways of thyroid hormone

metabolism. In: Braverinen, L. E. and Utiger, R. D. (ed.) Werner and Ingbar's The thyroid

gland. J.B. Lippincott Co., 5th ed., Philadelphia, Pennsylvania.

Krenning, E. P., Docter., R. Visser, T. J., et. al., (1983). Plasma membrane transport of

thyroid hormone: its possible pathophysiological significance. J. Endocrinol. Invest., 6, 59-66.

LaCasse, E. C, Lochnan, H. A., Walker, P. and Lefebvre, Y. A. (1993).

Identification of binding proteins for nuclear localisation signals of the glucocorticoid and thyroid hormone receptors. Endocrinology, 132, 1017-1025

Larsen, P. R. , and Ingbar, S. J. (1992) The thyroid gland. In: Wilson, J. D. and Foster, D.W. (eds.) Williams Textbook of Endocidnology, Sth ed., W. B. Saunders

Company, Philadelphia, Pennsylvania.

Laudet, V., Begue, A. , Henry-Duthoit, C, Joubel, A., Martin, P. , Stehelin, D. and Saule, S. (1991) Genomic organization of the human thyroid hormone receptor α (c-e 1) gene. Nucl. Acids Res., 19, 1105-1112

Laudet, V. Hanni, C, Coil, J., Catzefiis, F. and Stehelin, D. (1992) Evolution of the nuclear receptor gene superfamily. EMBO J. , 11, 1003-1013.

Lompre, A. M., Nadal-Ginard, B. and Mahdavi, V. (1984). Expression of the cardiac ventricular α- and β-myosin heavy chain genes is developmentally and

hormonally regulated. J. Biol. Chem., 259, 6437-6446.

McCIaren, A. and Biggers, J. D. (1958). Successful development and birth of n-dee cultivated in vitro as early embryos. Namre, 182, 877-878.

Mendel, C, Weiseger, R. A. and Cavalieri, R. R. (1988). Uptake of 3, 5,

3'-iodothyronine by the perfused rat liver, a return to the free hormone hypothesis. Endocrinol., 123, 1817- 1824.

Mitsuhashi, T., Tennyson, G. E. and Nikodem, V. M. (1989). Alternative splicing generates

messages encoding rat c-erba proteins that do not bind thyroid hormone. Flroc. Natl. Acad.

Sci. U.S.A., 85, 5804-5808.

Muller, W., Kuhn, R. , and Rajewsky, K. (1991). Eur. J. Immunol., 21, 921-95.

Refetoff, S., DeWind, L. T. and DeGroot, L. (1967). Familial syndrome combining deaf mutism, stippled epiphyses, goiter, and abnormally high PBI: possible target organ

refractoriness to thyroid hormone. J Clin. Endc)crinol. Metab., 27, 279-294.

Rodriguez-Pena, A., Ibarrola, N., Iniguez, M. A., Munoz, A. and Bemal J. (1993). Neonatal hypothyroidism affects the timely expression of myelin-associated glycoprotein in the rat brain.

J. Clin. Invest., 91, 812-818.

Sambrook, J., Frisch, E.F. and Maniatis, T. (1989). Molecular Cloning: A Laboratory

Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor.

Sap, J., Munoz, A., Damm, K., Goldberg, Y., Ghysdael, J., Leutz, A., Beug, H. and

Vennstrom, B. (1986). The c-erb-A protein is a high-affinity receptor for thyroid hormone.

Namre, 324, 635-640. Schwartz, H. L. (1983). Effect of thyroid hormone in growth and development. In:

Oppenheimer, J. H. and Samuels, H. H. (eds.), Molecular basis of thyroid hormone acti New York: Academic Press, 413-444.

Schwartz, H. L., Lazar, M. A. and Oppenheimer, J. H. (1994). Widespread distribution

immunoreactive thyroid hormone β2 receptor (TRβ2) in the nuclei of extrapimitary rat tis

J. Biol. Chem., 269, 24777-24782.

Segerson, T. P., Kauer, J., Wolfe, H. C, Mostake, H. , Wu, P. , Jackson, M. D. and Le

R. M. (1987). Thyroid hormone regulates TRH biosynthesis in the para ventricular nucleu the rat hypothalamus. Science, 238, 78-80.

Sestoft, L. (1980). Metabolic aspects of the calorigenic effect of thyroid hormone in mam

Clin. Endocrinol., 13, 489-506.

Sjoberg, M., Vennstrom, B., and Forrest, D. (1992). Thyroid hormone receptors in chic

retinal development: differential expression of mRNAs for α and β N-temiinal variant

receptors. Develop. , 114, 39-47.

Sjoberg, M. (1994). Expression and function of chicken thyroid hormone receptors. (The

Karolinska Institute, Stockholm, Sweden. Strait, K. A., Schwartz, H. L., Perez-Castillo, A. and Oppenheimer, J. H. (1990).

Quantitation of erba (x and P expression in developing and adult rat tissues under the influence of thyroidal stams and comparison with nuclear binding capacity. J. Biol. Chem., 265, 10514-

10521.

Takeda, K., Sakurai, A., DeGroot, L. J. and Refetoff, S. (1992). Recessive inheritance of thyroid hormone resistance caused by complete deletion of the protein-coding region of the

thyroid hormone receptor-beta gene. J. Clin. Endociinol. Metab., 74, 49-55.

Tasset, D., Tora, L., Fromental, C, Scheer, E. and Chambon, P. (1990). Distinct classes of

transcriptional activating domains function by different mechanisms. Cell, 62, 1177-1187.

Thompson, K. L., Santon, J. B. , Shephard, L. B., Walton, G. M. and Gill, G. N. (1992). A nuclear protein is required for thyroid hormone receptor binding to an inhibitory half-site in the epidermal growth factor receptor promoter. Mol. Endocrinol., 6, 627-635.

Towle, H. C, Mariash, C. N. Oppenheimer, J. H. (1980). Changes in hepatic levels of messenger ribonucleic acid for make enzyme during induction by thyroid hormone or diet.

Biochemistry, 19, 579-585.

Towle, H. C, Mariash, C. N. Schwartz, H. L., Oppenheimer, J. H. (1981). Quantitation of rat liver messenger ribonucleic acid for malic enzyme during induction by thyroid hormone. Biochemistry, 20, 3486-3492.

Usala, S. (1994). llyroid hormone resistance. In: Weintraub, B. D. (ed.), Molecular Endocrinology. Raven Press, New York, 393-409.

Vennstrom, B. and Bishop, J. M. (1982). Isolation and characterization of chicken DNA

homologous to the two putative oncogenes of avian erythroblastosis virus. Cell, 1, 135-1

Weinberger, C, Thompson, C. C , Ong, E. S. , Lebo, R., Gruol, D. J. and Evans, R. M

(1986). 'The c-erba gene encodes a thyroid hormone receptor. Namre, 324, 641-646.

Whitten, W. K. (1956). Culture of tubal mouse ova. Namre, 177, 96.

Whitten, W. K. and Biggers, J. D. (1968). Complete development in vitro of the

preimplantation stages of the mouse in a simple chemically defined medium. J. Reprod. Fertil., 17, 399_^.01.

Williams, G. R. and Brent, G. A. (1995). 'Ryroid Hormone Response Elements, In: Weintraub, B., (ed.), Molecular Endocrinology. Raven Press, New York, New York, 21

248.

Wondisford, F. E., Steinfelder, H. J., Nations, M. and Radovick, S. (1993). AP- 1 antagonizes thyroid hormone receptor action on the thyrotropin P-subunit gene. J. Biol.

Chem., 268, 2749-2754.

Wood, W. M., Kao, M. Y., Gordon, D. F. and Ridgeway, E. C. (1989). Thyroid hormone regulates the mouse thyrotropin P-subunit gene promoter in transfected primary thyrotropes. J.

Biol. Chem., 264, 14840-14847.

Yaffe, B. M. and Samuels, H. H. (1984). Hon-nonal regulation of the growth hormone gene. J. Biol. Chem., 259, 6284-6291.

Claims

1. A transgenic animal which is heterozygous for an at least partially defective thyroid hormone receptor gene.

2. A transgenic animal according to claim 1 in which the defective gene has been

inactivated by an insertion, deletion, substimtion or inversion or other suitable gene

manipulation.

3. A transgenic animal according to claim 1 or 2 which is a rodent.

4. A transgenic animal according to claim 3 which is a mouse.

5. A transgenic animal according to claim 1, 2, 3 or 4 in which the defective thyroid hormone receptor gene is the TRα gene.

6. A transgenic animal according to claim 5 in which the defective thyroid hormone receptor gene is the TRα l gene.

7. A transgenic animal according to claim 6 which has a functional TRα2 gene.

8. Cells derived from a transgenic animal according to any preceding claim which are

heterozygous or homozygous for a defective thyroid hormone receptor gene.

9. Cells according to claim 8 in which the thyroid hormone receptor gene is the TRα l gene.

10. Cells according to claim 9 which have a functional TRα2 gene.

11. A method of producing a transgenic animal in accordance with any one of claims 1 to 8

the method comprising :

1) preparing a gene encoding an at least partially defective thyroid hormone receptor

as described above;

2) introducing that gene into suitable carrier cells;

3) inserting those carrier cells into an embryo; and

4) replacing the embryo into a mother animal, and allowing the embryo to develop

to full term.

12. A method according to claim 11 in which the thyroid hormone receptor gene is the TRα gene.

13. A method according to claim 12 in which the defective thyroid hormone receptor gene is the TRαl gene.

14. A method of testing the agonist/antagonist properties of a compound in relation to the

thyroid hormone receptor, the method comprising contacting a transgenic animal in accordance with any one of claims 1 to 7 with the compound and monitoring subse development of the animal.

15. A method of testing the agonist/antagonist properties of a compound in relation to t

thyroid hormone receptor, the method comprising contacting cells or tissues deriv

from a transgenic animal in accordance with any one of claims 1 to 10.

16. A method according to claim 14 or 15 in which the animal or cells have a defective

gene.

17. A method according to claim 16 in which the animal has a functional Reα2 gene.