WO1996009395A2 - Drug for the prevention and treatment of auto-immune and viral diseases, and diagnostic agents for detecting said diseases - Google Patents

Drug for the prevention and treatment of auto-immune and viral diseases, and diagnostic agents for detecting said diseases Download PDF

Info

Publication number
WO1996009395A2
WO1996009395A2 PCT/EP1995/003726 EP9503726W WO9609395A2 WO 1996009395 A2 WO1996009395 A2 WO 1996009395A2 EP 9503726 W EP9503726 W EP 9503726W WO 9609395 A2 WO9609395 A2 WO 9609395A2
Authority
WO
WIPO (PCT)
Prior art keywords
cells
ipp
human
bpp
peptides
Prior art date
Application number
PCT/EP1995/003726
Other languages
German (de)
French (fr)
Other versions
WO1996009395A3 (en
Inventor
Thomas Franz Ferdinand Meyer
Johannes Pohlner
Susanne Christine Beck
Joachim Jose
Uwe WÖLK
Dirk R. Lorenzen
Karin Brigitte Oetzelberger
Original Assignee
MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. filed Critical MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.
Priority to AU36515/95A priority Critical patent/AU3651595A/en
Publication of WO1996009395A2 publication Critical patent/WO1996009395A2/en
Publication of WO1996009395A3 publication Critical patent/WO1996009395A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/095—Neisseria
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/22—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Neisseriaceae (F)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/12—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/564—Immunoassay; Biospecific binding assay; Materials therefor for pre-existing immune complex or autoimmune disease, i.e. systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis, rheumatoid factors or complement components C1-C9
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983—Viruses
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/58—Medicinal preparations containing antigens or antibodies raising an immune response against a target which is not the antigen used for immunisation
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/10—Musculoskeletal or connective tissue disorders
    • G01N2800/101—Diffuse connective tissue disease, e.g. Sjögren, Wegener's granulomatosis
    • G01N2800/102—Arthritis; Rheumatoid arthritis, i.e. inflammation of peripheral joints

Definitions

  • the present invention relates to pharmaceuticals and diagnostics as well as diagnostic, therapeutic and preventive methods for the treatment of autoimmune and viral diseases in humans, which are caused by pathogenic bacteria.
  • These bacteria are, in particular, microorganisms that colonize human mucous membranes and secrete certain exoproteins that are structurally related to human proteins.
  • IgA protease-like proteins which are particularly well absorbed by cells and presented as antigens on MHC molecules.
  • the polyprotein of the IgA protease (IPP) from pathogenic Neisseries has particularly pronounced homology to human proteins. For example, a certain peptide of the IPP has pronounced Ho Theology of the Link and Aggrekan joint proteins.
  • the IPP is an etiological agent of rheumatoid arthritis (RA).
  • the autoimmune response is further promoted by other properties of the IPP-producing Neisseries and the IPPs.
  • a particularly important property is the ability of the IPP to activate viruses and viral elements. This applies in particular to the activation of proviral retroviruses and endogenous retroviruses in humans. Due to the activation of viruses and viral elements, further autoimmune reactions in humans are induced.
  • the IPP-dependent activation of the HIV provirus also explains the development of the acquired immune deficiency syndrome (AIDS).
  • AIDS acquired immune deficiency syndrome
  • autoimmune diseases are multiple sclerosis (MS), insulin-dependent diabetes mellitus (IDDM), rheumatoid arthritis (RA) and possibly also arteriosclerosis (Ask). According to recent estimates, the proportion of the adult population affected by autoimmune diseases is around 5% to 15%; the economic and social burdens associated with the effects and the therapy are accordingly significant.
  • MS multiple sclerosis
  • IDDM insulin-dependent diabetes mellitus
  • RA rheumatoid arthritis
  • Ask arteriosclerosis
  • a central function of the immune system is to ward off infectious microorganisms coming from outside and to eliminate aberrant cells of the own body.
  • the ability of the immune system to distinguish its own structures (self) from foreign structures (foreign) is essential for fulfilling this task.
  • the molecular basis for the distinction between self and foreign makes the
  • B cells form antibodies on their surface that react with native antigens
  • T cells form T cell receptors that recognize peptides that are sensitive to MHC Molecules are presented.
  • T cells There are several groups of T cells: CD8 + T cells react with peptides presented on class I MHC molecules and CD4 + T cells react with peptides presented on class II MHC molecules.
  • CD4 + cells can be divided into TH1 and TH2 subgroups, which differ in their cytokine pattern and are either anti-inflammatory (TH1) or anti-inflammatory (TH2).
  • B and T cells usually require an interaction between at least two different cell types.
  • B cells need the help of CD4 + T cells to activate them.
  • T cells in turn require appropriate MHC-producing antigen presenting cells (APC) for their activation.
  • APC MHC-producing antigen presenting cells While MHC class I is formed by almost all body cells, MHC class II is formed in particular by macrophages, dendritic cells, B cells and, under certain circumstances, also by T cells, epithelial cells and fibroblasts.
  • T lymphocytes that recognize foreign structures.
  • the immune system has mechanisms to develop tolerance to certain antigens, although there has been no self-foreign alignment in the thymus in this regard. For example, tolerance can be determined by se selective elimination or anergization of lymphocytes. In these latter differentiation processes, T cell subgroups that play different (eg activating or inhibiting) cytokines obviously play a crucial role.
  • T cell subsets depend crucially on the manner in which the antigen is presented, for example with regard to the body organ in which it takes place, and the type of cell presenting the antigen.
  • B and T cells form an immunological network that serves to strike a balance between self-tolerance and external reactivity.
  • autoimmune diseases lead to disorders that align the immune system with self. This can e.g. B. happen when there are only minor differences between a foreign structure with which the immune system is confronted and the body's own structures. An immune response can be triggered in this border area, where the areas self and foreign overlap due to structural features. This leads to an increase in T-lymphocytes, which recognize not only the foreign structure but also the structurally similar structure of the body. While, under normal circumstances, after the foreign structure has been eliminated, the immune reaction goes out, it remains under these circumstances, constantly nourished by the presentation of the body's antigen.
  • Structural homologies between microbial proteins and proteins of the host organism are probably only random events in exceptional cases.
  • structural homologies can occur as the remains of a common protein ancestor, with conserved and thus homologous amino acid sequences fulfilling essential functions.
  • structural adaptation of microbial antigens to biomolecules of the host is a common phenomenon that can be explained by the co-evolution of microorganisms with the human immune system. Through such a "molecular Mimicry ", microorganisms can probably protect themselves from the immune system by mistakenly recognizing microbial structures as self. If an immune reaction nevertheless occurs, this can lead to the destruction of the body's own tissue due to a developing cross-reaction.
  • An adjuvant arthritis of the rat is a well documented example of an autoimmune disease that is triggered by a cross-reactive bacterial antigen.
  • the crucial function of specific T cells in the pathogenesis could be demonstrated by cotransferring arthritis with a T cell clone to healthy animals.
  • the T cell clone in question shows specificity for a peptide from the 65 kDa heat shock protein (Hsp60) of mycobacteria and likewise recognizes a peptide from the link protein of rats.
  • the link protein is an essential proteoglycan component of cartilage tissue, a connective tissue that is particularly damaged in arthritis.
  • Inflammatory rheumatic diseases occur in a variety of different clinical pictures such as B. Rheumatoid Arthritis, Felty Syndrome, Psoriatic Arthritis and Juvenile Arthritis (Williams in: Enzyclopedia of Immunology, Ed. Roitt and Delves, 1992, pp. 1339-1343) in appearance.
  • a number of viral and bacterial proteins are considered as potential antigens for triggering an arthritogenic T cell response. Together With bacterial infections caused by Yersinia, Neisserie and Borrelia, among other things, "reactive arthritis” often occurs.
  • the heat shock protein Hsp60 may play an important role here. It is highly conserved both among bacteria and between bacteria and humans and can therefore maintain autoreactive processes.
  • autoimmune diseases In addition to the microbial triggers, the individual genetic predisposition plays a role in the development of autoimmune diseases.
  • An overview of associations between MHC haplotype and autoimmune diseases can be found, for example, in Jacob, McDevitt and Talal (Ed.), (1991) Molecular Autoimmunity, Academic Press Inc., San Diego and in Wordsworth et al., (1992). Accordingly, rheumatoid arthritis (RA) and related autoimmune diseases are particularly often associated with the haplotypes DR1, DR4Dw4, DR4Dw14 and DR4Dwl5.
  • Autoimmune diseases can be based on different effector mechanisms, which are ultimately due to specific interactions between antigen peptides and MHC. These include self-directed antibodies, self-directed CD4 + or CD8 + T cells and an inflammatory spectrum of cytokines.
  • the T cells play a key role here because they are involved in the activation of many important effector mechanisms.
  • the interaction of peptide antigen with MHC class II molecules is correspondingly important, since the complex formation between antigen and MHC class II molecule is the prerequisite for the stimulation of CD4 + T cells of a specific subgroup.
  • Peptide antigen and T cell receptor are therefore setting the course for the development and course of an autoimmune disease.
  • the MHC molecules form a polymorphic family of proteins and each individual has a specific spectrum of different MHC molecules. There can be great differences in the antigen binding properties of different MHC molecules. Comprehensive, if incomplete, information is available on structural features of peptides that are important for binding to MHC molecules (Rotzschke and Falk, 1994). Since the MHC molecules define the spectrum of peptide antigens that can be presented, this is the reason for the genetic predisposition of individual individuals for certain autoimmune diseases. The prerequisite for a specific T cell reaction is the presentation of a peptide antigen by an MHC molecule.
  • MHC-bound peptides in a pit formed by the MHC molecule are in a certain orientation with respect to the N- and C-termini of the peptides.
  • the class II MHC molecule binding pit allows the peptides to protrude from the pit at one or both ends. It is assumed that the binding of the peptides to MHC molecules takes place or is strengthened via certain MHC allele-specific anchor positions. In principle, it is therefore also possible for peptides to be bound in opposite directions in the MHC molecule via corresponding anchor positions.
  • Such inverse peptides, in which the N- and C-termini are exchanged with an identical amino acid sequence e.g. N-LLEQKRAA-C compared to N-AARKQELL-C
  • a microbial pathogen is assumed to be the triggering agent for an autoimmune disease, this presupposes that this pathogen is widespread in accordance with the frequency of the autoimmune disease and the frequency of the genetic predisposition.
  • the degree of infection of this pathogen should correspond to the occurrence of rheumatoid arthritis and the predisposing MHC (DR1 and DR4) or the triggering component of a pathogen prevail in the population.
  • pathogenic Neisseries colonize human mucous membranes.
  • meningococci in particular are part of the permanent flora of the nasopharynx without causing any noticeable symptoms.
  • individuals who are not constantly colonized by meningococci are confronted with these bacteria from time to time in the form of asymptomatic local infections.
  • Antigens of these and other species which behave similarly in terms of their colonization on human mucous membranes, are potential triggers of autoimmune diseases in humans.
  • the object of the present invention was therefore to provide pharmaceuticals for prophylaxis and treatment and diagnostic agents for the detection of autoimmune diseases or the predisposition to them and many diseases.
  • the invention thus relates to a medicament for the prophylaxis or treatment of autoimmune diseases and / or viral
  • BPPs bacterial polyproteins
  • viral diseases are understood to mean those diseases which are induced by viruses or viral elements.
  • the invention relates to a medicament which is characterized in that the interfering is an inhibition.
  • the invention relates to a medicament which is characterized in that the substances or cells comprise:
  • BPPs bacterial polyproteins
  • the invention relates to a medicament which is characterized in that the prophylaxis comprises an immunization.
  • the invention relates to a medicament which is characterized in that the immunization is an active immunization.
  • the invention relates to a medicament which is characterized in that the immunization is a passive immunization.
  • the invention relates to a medicament which is characterized in that the autoimmune disease is rheumatoid arthritis.
  • the invention relates to a medicament which is characterized in that the bacteria producing the BPP belong to the genus Neisseria.
  • the invention relates to a medicament which is characterized in that the viral disease has been induced by HIV.
  • the invention relates to a medicament which is characterized in that the HIV-induced disease is AIDS.
  • the invention relates to a medicament, wherein capsule-specific vaccines against meningococcal infections are used for the immunization.
  • the invention relates to a medicament, the protein being a porin. In a further preferred embodiment, the invention relates to a medicament, the vaccines being produced on the basis of the Neisseries adhesins.
  • the invention relates to a medicament, wherein the passive immunization takes place with specific antibodies or T cells which are directed against membrane components or adhesins of BPP-producing bacteria, preferably Neisseries.
  • the invention relates to a medicament, antibiotics or receptor analogs to receptors of human cells to which pathogenic bacteria can bind or ligands which are specific for the receptors of a bacterial surface are competitive peptides or nonpathogenic or attenuated Neisseries as infection inhibitors.
  • the invention relates to a medicament, the competitive peptide being PilC.
  • the invention relates to a medicament, the BPP being IPP.
  • the invention relates to a. Medicinal product, in which the IGA protease activity of the IPP is specifically inhibited.
  • the invention relates to a medicament, the aspartyl protease activity of the ⁇ -domain of the IPP being specifically inhibited.
  • the invention relates to a medicament, the uptake of the ⁇ -peptide in human cells or their nucleus being inhibited.
  • the invention relates to a medicament, the consequences of the infection by BPP-forming bacteria being inhibited by an immune reaction against BPP-forming, in particular IPP-forming cells, BPP, in particular IPP or their cleavage products.
  • the invention relates to a medicament, cells representing IPP-specific peptides being eliminated by T cells.
  • the invention relates to a medicament, cells representing IPP-specific peptides being eliminated by monoclonal antibodies.
  • the invention relates to a pharmaceutical, antigen-specific suppressive T cells being used.
  • the invention relates to a medicament, wherein anti-T cell receptor antibodies are used to switch off T cells which have a specificity for the BPPs mentioned in claim 3b or the components thereof, corresponding homologous peptides of human proteins
  • the invention further relates to a diagnostic composition for the detection of the etiological agent of autoimmune diseases and / or viral diseases and / or for the detection of the control of the action of medicaments containing
  • the invention further relates to a diagnostic composition for the detection and monitoring of the course of BPP-induced autoimmune diseases and / or viral diseases and / or for the detection of the control of the action of medicaments containing
  • the invention further relates to a peptide which is in the cleavage product of an IPP from Neisseria meningitidis and has an amino acid sequence shown in FIG. 1.
  • the invention further relates to a peptide which is a cleavage product of a BPP, preferably an IPP or a fragment thereof or a human homologue thereof, the BPP, preferably the IPP or the fragment or the human homologue being obtainable by computer-aided comparison of BPP- , preferably IPP sequences with protein databases or translated nucleic acid databases from human sequences or vice versa and wherein at least 6 amino acids in a section of 10 amino acids are identical between the comparison sequences.
  • the peptide according to the invention has an amino acid sequence shown in Table VII, FIG. 2, FIG. 3 or FIG. 8.
  • the invention further relates to a human peptide which is formed by the action of a BPP, preferably an IPP or a cleavage product thereof, with the exception of the IgA 1 cleavage products.
  • the invention further relates to a viral peptide which is produced by the action of a BPP, preferably an IPP or a cleavage product thereof.
  • the invention further relates to a peptide which is a viral peptide which has arisen from the action of a BPP or a human homologue thereto, the viral peptide sequence being obtainable by computer-aided comparison with protein databases or translated nucleic acid databases from human sequences or vice versa and wherein at least 6 amino acids in a section of 10 amino acids are identical between the comparison sequences.
  • the invention relates to a peptide which is an epitope recognized by an antibody.
  • the invention relates to a peptide which is recognized by a T cell after MHC presentation.
  • the invention further relates to a method for inhibiting or activating the transcription of virally coded polypeptides, characterized in that substances, preferably biomolecules, preferably proteins, DNA, RNA or anti-sense RNA or synthetically produced molecules, preferably therapeutically active molecules, in eukaryotic , preferably introduces human cells or their cell nucleus using an IgA- ⁇ protein.
  • substances preferably biomolecules, preferably proteins, DNA, RNA or anti-sense RNA or synthetically produced molecules, preferably therapeutically active molecules, in eukaryotic , preferably introduces human cells or their cell nucleus using an IgA- ⁇ protein.
  • the invention further relates to an in vitro method for cloning and multiplying human T cells, the T cell receptor of which specifically recognizes MHC-presented IPP fragments, the T cells being more human homologous peptides in the presence of BPPs or constituents thereof Proteins, stimulated by the action of a BPPs autoreactive peptides, by the action of a BPPs activated peptides encoded by viruses or endogenous viruses or human peptides homologous to such viral peptides are stimulated under normal conditions.
  • the invention further relates to an in vitro method for cloning and multiplying immunosuppressive T cells which suppress T cells which specifically recognize derived fragments presented in MHC, the T cells being homologous in the presence of BPPs or constituents thereof Peptides of human proteins, autoreactive peptides formed by the action of a BPP, peptides activated by the action of a BPP, encoded by viruses or endogenous viruses, or to such viral peptides stimulated homologous human peptides under usual conditions.
  • the invention further relates to a method for diagnosing an autoimmune disease or a predisposition therefor, preferably rheumatoid arthritis, characterized in that in a T cell proliferation test an IPP, a cleavage product of an IPP or a fragment thereof or a human homologue thereof for proliferation tested by reactive T cells.
  • the invention relates to a method which is characterized in that the cleavage product or fragment thereof, or the human homologue thereof, has the amino acid sequence shown in Table VII.
  • the invention further relates to a method for the detection of BPPs or the bacteria forming them, characterized in that one carries out a polymerase chain reaction (PCR) with primers specific for BPP genes, and the PCR product by DNA sequence analysis or other conventional methods such as gel electrophoresis examined for BPP-specific sequences.
  • PCR polymerase chain reaction
  • the invention relates to a method for the detection of the BPP-dependent activation of viruses or viral elements, characterized in that one carries out a PCR with primers specific for the viral genes, and the PCR product by DNA sequence analysis or other conventional methods such as Gel electrophoresis is examined for BPP-specific sequences or the activity of the viral reverse transcriptase or other viral enzymes is measured.
  • Bacterial exoproteins represent a particular target for the immune response.
  • the IgA proteases can be divided into subgroups according to their amino acid sequences.
  • the IgA proteases of pathogenic Neisseries and certain Haemophilus species form such a subgroup.
  • the previously known IgA proteases from Neisseries and Haemophilus differ in certain areas, while they are homologous in other areas.
  • the IgA proteases of the pathogenic Neisseries form a structurally polymorphic family of enzymes, with each pathogenic Neisseries strain usually producing a certain variant enzyme. Of the Neisseries, meningococci in particular release this enzyme, which is classified as a virulence factor, into their environment in considerable quantities. IgA proteases are extracellular and develop from a precursor polyprotein (IPP). There are further protein domains in the precursor polyprotein (IPP) of the IgA proteases from Neisseries, which are secreted together with the enzyme.
  • IPP precursor polyprotein
  • an IPP is composed of the following separable components, namely an IgA protease domain, a 7-peptide, an ⁇ -protein and a ⁇ -domain (Pohlner et al., 1987) .
  • This invention is based on the detection of the very pronounced molecular mimicry of the Iga proteins (ie all proteins of the precursor polyprotein (IPP)) of Neisseries in relation to human proteins.
  • This molecular mimicry is demonstrated, among other things, by further sequence examples of Neisserie Iga proteins, which were obtained by DNA sequence analysis of iga genes (Example 1). Computer-aided comparisons of these derived amino acid sequences of Iga proteins with known human protein sequences gave numerous sequence homologies according to the invention with human proteins, which are shown as examples (example 2).
  • the Iga ⁇ and Iga ⁇ regions of Iga proteins contain considerable sequence homologies Protein components of the human proteoglycan, such as the link protein or the proteoglycan core protein (Aggrekan) or to other omnipresent human proteins such as myosin and caldesmon. Interestingly, it is shown in Example 2 that the inverse primary sequence of Iga has much more extensive homologies to human proteins. Since - as explained above - peptides can also bind inversely to MHC class II molecules and in this orientation have similar structures to the corresponding normal peptides, these inverse homologous peptide sequences of the Iga proteins are also important for antigenic mimicry and thus Subject of this invention. The continued presentation of one or more peptides of the Iga protein on MHC molecules therefore induces autoreactive processes which are directed against molecular structures in humans (eg cartilage tissue).
  • Another feature of the IPP according to the invention is its ability to penetrate human cells from the outside and, in certain cases, to penetrate into the nucleus. This property is demonstrated particularly impressively by the inclusion of an extracellular ⁇ protein from Neisseries which penetrates into the nucleus of certain human cells (example 7). It is deduced from the structure of the IPP that not only does the ⁇ -protein get into human cells, but also the other components of the IPP or intact IPP. The individual components of the IPP can be partially or completely split off during their transport to the nucleus in different cell compartments, where they become effective against their target cells.
  • Intracellular Neisseries internalized by human target cells also synthesize IPP.
  • intracellularly formed IPP can also penetrate into different cell compartments and also split into individual components in accordance with the IPP that penetrates from the outside.
  • the surface-exposed ⁇ -domain also reaches the target cells.
  • a known property of the IgA protease or the IgA protease domain contained in the IPP is the sequence-specific cleavage of proteins which carry a corresponding sequence required for the cleavage (Pohlner et al., 1992).
  • a preferred cleavage sequence of Neisserie IgA proteases are N-Pro-Pro -!
  • a known natural substrate of the IgA protease is human IgA-1.
  • IgA protease A consequence of the cleavage activity of the IgA protease according to the invention are changes in function in the affected cells. Due to the numerous substrates and their diverse immunological functions, an immunological malfunction of the cells affected by IgA protease is assumed. It is also believed that this immunological misregistration can adversely affect the immune system's balance with respect to its ability to distinguish between foreign and self. The IgA protease activity therefore favors the development of autoimmune diseases. An example of an effect of the IgA protease activity on eukaryotic cells is shown below (see Example 20).
  • IgA proteases are therefore particularly suitable for generating peptides for presentation in MHC molecules and therefore favor the formation of new peptides and their presentation to the immune system.
  • Such peptides can thus arise from human proteins which are not produced in the absence of IgA protease.
  • new self-peptides are recognized as foreign by the immune system because they have not previously occurred. This triggers an immune response against self.
  • the release of the ⁇ -peptide from the Iga protein is also a result of the cleavage activity of the IgA protease, which immediately proves the antigen-processing activity of the IgA protease.
  • a property of the ⁇ -peptide according to the invention is to be presented by class II MHC molecules (example 5).
  • the ⁇ -peptide has the property of binding to MHC molecules which are predisposed to RA-like diseases, namely the MHC alleles DR1, DR4w4 and DR4wl4.
  • CD4 + T cells are activated under natural conditions and can be detected in T cell proliferation tests (Examples 6 and 17).
  • it can be shown that antibodies against the 7-peptide cross-react with peptides of these human proteins (Example 3).
  • a property of the ⁇ -proteins is to penetrate human cells from an extracellular environment either alone or in combination with other components of the IPP. This process obviously requires the binding of the ⁇ -protein to one or more cellular receptors. In the course of this process, ⁇ proteins enter the cell nucleus of human cells. Due to their special structural properties, they interact with other cellular factors and in particular with the DNA of affected cells. This triggers processes (for example gene regulatory processes) that affect the function of affected cells influence. As a result, the cytokine pattern of affected cells is changed. Ultimately, these ⁇ -protein-related processes disturb the balance of the immune system, which, in addition to the molecular mimicry of IPP, favors the development and maintenance of autoimmune reactions.
  • EBV Epstein-Barr virus
  • DR1, DR4w4, DR4wl4 human RA-associated HLA-DR alleles
  • viruses In addition to the structural similarities between viral and human proteins that can lead to autoimmune reactions, certain viruses also encode immunomodulatory factors that can favor autoimmune reactions. These include, on the one hand, immunosuppressive factors such as the Tat protein of the human immunodeficiency virus (HIV) (Viscidi et al., 1989) or certain retroviral gene products that, like the superantigen of MMTV, lead to antigen-unspecific clonal activation of the immune system (especially of T cells) can lead (Held et al., 1993).
  • immunosuppressive factors such as the Tat protein of the human immunodeficiency virus (HIV) (Viscidi et al., 1989) or certain retroviral gene products that, like the superantigen of MMTV, lead to antigen-unspecific clonal activation of the immune system (especially of T cells) can lead (Held et al., 1993).
  • retroviral elements could be detected by electron microscopy in the synovial fluid of RA patients. Similar viral particles were also detected in patients with Sjögren's syndrome (Itescu et al., 1990). In addition, the activity of a reverse transcriptase typical of such viruses was demonstrated in the synovial fluid of RA patients. Little is known about the exact origin of such viral particles that are associated with autoimmune diseases. However, it is believed, for example, that they are activated endogenous retroviral elements (Perl et al., 1993) which, according to recent estimates, make up a large part of the human genome (between 2 and 10%).
  • HIV human immunodeficiency virus
  • SIV closely related viruses
  • phase II HIV rests in the genome of CD4 + cells - especially CD4 + T cells - as a so-called provirus.
  • provirus behaves similarly to endogenous retroviruses.
  • phase III propagation spurts
  • the crucial, as yet unsolved question about the development of AIDS therefore concerns the mechanism of the activation of HIV provirus in the infected cells.
  • the provirus is activated by a transcription of the provirus genome, which originates from the promoter of the "long terminal repeat” (LTR) of the provirus.
  • the Tat protein encoded by the provirus plays a central role in this activation of the LTR.
  • the Tat protein interacts with cellular factors and newly formed viral RNA, which contains the "Tat responsive element” (TAR).
  • TAR "Tat responsive element”
  • Recent results show that the Tat protein has the property of penetrating certain human cells as a soluble protein and penetrating the nucleus thereof. If these cells contain the HIV provirus, HIV is transactivated in these cells.
  • Tat protein is therefore able to activate HIV proviruses in neighboring cells.
  • An important basis of this invention is the structural and functional relationship of the iga genes of Neisseries with viruses or viral elements including endogenous proviruses.
  • IgA-Pro teasen of pathogenic Neisseries is striking their strict association with pathogenic bacterial species.
  • Genomic DNA hybridization experiments using the iga gene from N. gonorrhoeae and an adjacent gene (comA) as a probe indicate that the comA gene, in contrast to the igra gene, occurs in both pathogenic and non-pathogenic Neisseries (Facius and Meyer, 1993).
  • the iga gene probably integrated into the genome of the pathogenic Neisseries as an additional genetic element.
  • sequence homologies of the Iga proteins with viral proteins indicate a viral origin of the iga genes.
  • sequence homologies of the iga gene products and viral proteins can be detected by computer-aided amino acid sequence comparisons (Examples 12 and 18).
  • homologies to viral polyproteins and viral coat proteins occur frequently. Since many Neisserie species are naturally transformation-competent and closely linked to the interaction with mammalian organisms (especially humans), the incorporation of a viral element into the Neisserien genome can be explained by the way of the transformation.
  • a particularly striking structural homology of the neisserial Iga proteins relates to an otherwise unusual amino acid sequence motif of the active center of an aspartyl protease in prokaryotes (Example 11).
  • the active center of the HIV aspatyl protease has the greatest homology to that of the iga gene product. This finding indicates a particularly close relationship between iga and the HIV virus.
  • the active center of the Neisserie aspartyl protease is located in the membrane-bound ⁇ -domain of the Iga protein and can get into cells in connection with the Neisserien infection, for example.
  • Iga proteins are initially formed in the form of large precursor polyproteins and, in the manner of viral polyproteins, break down into several individual proteins by autoproteolysis ( Krausslich et al., 1989).
  • ⁇ proteins of the Neisseries are relatively small (approx. 10 to 30 kDa), predominantly ⁇ -helical, positively charged proteins, which have the ability to dimerize.
  • ⁇ -proteins and Tat proteins share the unusual property of penetrating the nucleus of a human cell from the extracellular milieu (Frankel and Pabo, 1988; Example 7).
  • the ⁇ proteins of the pathogenic Neisseries represent a polymorphic protein class (Example 1), the properties described here are fulfilled by all allelic forms tested to date.
  • the Neisserie ⁇ -proteins and the Tat protein of HIV also have biologically similar effects on eukaryotic cells. Both proteins are equally immunosuppressive as can be measured in a T cell proliferation test (Example 8).
  • the ⁇ proteins of the Neisseries also have an activating effect on certain viral promoters (Example 12).
  • the ⁇ -proteins of the Neisseries can therefore - possibly in combination with the other components of the IPP - penetrate into the nucleus of HIV-infected human cells and activate the HIV-Provirus contained, so that the virus replicates and spreads. This mechanism therefore explains the continued HIV flare-ups, as a result of which a latent HIV infection in phase II develops into infection phase III.
  • the ⁇ proteins of the pathogenic Neisseries also activate other endogenous retroviruses of the human genome.
  • the formation of endogenous retroviral proteins, together with the other properties of IPP, favors the development or progression of autoimmune reactions in the manner described above.
  • AIDS can also be seen as an autoimmune disease (Atlan, 1994).
  • different alleles of the ⁇ -proteins or the IPPs activate certain exogenous or endogenous viruses in different ways. Superimposed by the genetic predisposition of individual individuals, the sometimes different biological functions of the Neisseries iga genes and their gene products explain the development of different clinical pictures.
  • Genes which code for bacterial polyproteins (BPPs) and have structural and functional relationships to the iga gene of the pathogenic Neisseries are, for example, the vacA gene from Helicobacter pylori (Schmitt and Haas, 1993), the aida gene from enteropathogenic E. coli (Benz and Schmidt, 1989), the Bordetella parapertussis pertactin gene (Dougan et al., 1991) and the Serratia marcescens serine protease gene (Nakahama et al., 1986).
  • neisserial Iga proteins or IPPs for the activation of viral elements (in particular HIV proviruses and other endogenous retroviruses) is demonstrated.
  • the present invention thus explains the development of AIDS by activating HIV in virus-infected persons on the basis of the biological function of the Iga proteins or the IPPs of Neisseries.
  • the activation of viral elements, especially endogenous retroviruses causes autoimmune reactions that are indirectly attributable to the biological effects of BPPs, in particular the Neisseries IgaProteine or IPPs.
  • BPPs in particular the Neisseries IgaProteine or IPPs.
  • the diverse structure and effects of BPPs and the respectively activated viral elements explain the variety of the symptoms.
  • Pathogenic IgA protease-forming Neisseries (especially meningococci) infect the human mucosa. Individuals can be infected temporarily or persistently with alternating strains. The infections can be asymptomatic or symptomatic.
  • the pathogens form IgA proteases, which can take various forms and contain amino acid sequences which represent molecular mimicry with respect to human proteins. For example, there is molecular mimicry between the 7-peptide portion of the Neisserie IPP and human link protein or aggrekan.
  • IPP peptides in particular the 7-peptide portion, are presented on class II MHC molecules.
  • CD4 T cells whose T cell receptor is directed against an MHC-presented peptide (foreign) of the IPP are activated.
  • T cells cross-react with a self-peptide, which is also presented to MHC. That these T cells are also activated by MHC-presented self-peptide.
  • Self-reactive T and B cells are introduced into certain regions of the body in which corresponding self-antigens are formed.
  • the continuous stimulation with self-antigens and the formation of inflammatory cytokines set in motion a chronic inflammatory reaction, in the course of which unspecific cell proliferation and tissue destruction occur.
  • IPP immunoglobulin-like protein
  • ⁇ -protein is produced intracellularly alone or in combination with other constituents of the IPP or is absorbed from outside into cells
  • IgA protease cleaves functionally important proteins such as IgAl, CD8 etc.
  • the regulatory properties of the ⁇ protein and other areas of the IPP accelerate or suppress immunological reactions.
  • viral elements are activated due to the effects of the neisserial IPPs in the course of the neisserie infection.
  • the resulting viral particles and other viral gene products perform a variety of different functions, which can result in different clinical forms of autoimmune diseases in humans.
  • the HIV virus is activated. In this case, the clinical picture is determined by the progressive HIV infection.
  • Neisseries is an etiological agent of autoimmune and viral diseases in humans, especially rheumatoid arthritis and AIDS
  • a first approach to combating these diseases against infections with IgA protease-producing pathogenic Neisseries, including asymptomatic infections is aimed.
  • active immunization a first approach to combating these diseases against infections with IgA protease-producing pathogenic Neisseries, including asymptomatic infections.
  • passive immunization Several fundamentally different methods can be used for this, (a) active immunization, (b) passive immunization, (c) treatment with infection inhibitors including antibiotics and (d) combined methods.
  • a further possibility for combating Neisseries infections and autoimmune and viral diseases based thereon is the administration of specific infection inhibitors which prevent the multiplication and or the infection of the human mucous membranes with pathogenic Neisseries.
  • specific antibiotics against Neisseries and receptor analogs that prevent the binding of the Neisseries to cellular receptors can be used, for example.
  • Particularly effective receptor analogs are substances which prevent the PilC-mediated binding of the Neisseries to human epithelial cells (German patent application P 43 36 530.2) or block the cellular invasiveness of the Neisseries mediated by opa proteins (Example 15).
  • the latter substances, which block the invasiveness of the Neisseries include Compounds that have structural similarities to heparan sulfates (e.g. heparin, example 15).
  • a combined method to combat Neisseries infections is to administer a Li found the Neisserien surface, which is coupled with an antigen.
  • a certain antigen is deposited on the bacterial surface. If antibodies against this antigen are formed, the antibodies can bind to the bacterial surface via the ligand and inactivate the bacterium via one of the known reactions.
  • This possibility of pathogen elimination is particularly suitable in the case of the Neisseries, since these bacteria form structural and antigen-variable surface components (Robertson and Meyer, 1992).
  • many variable surface proteins express conserved receptor-binding or ligand-binding properties, the Neisseries can be effectively eliminated via the path of the ligand.
  • Neisserie proteins with a conserved binding of ligands are the PorB (or PI-Porin), which binds purine nucleotide triphosphates (Rudel, 1994), a gangliosyl tetraosylceramide binding surface adhesin (Paruchuri, 1990) and the surface-bound PilC protein the Neisseries (Rudel, 1994).
  • the ligands of these bacterial receptors are preferably coupled with an antigen against which antibodies are already active; However, it is also possible to carry out an active immunization against the coupled antigen or to passively administer antigen-specific antibodies. It is also possible to change the ligand in such a way that its affinity for the bacterial surface is increased.
  • pathogenic and non-pathogenic Neisseries sometimes recognize very similar or identical receptors on the mucous membrane of humans and use them for infection. It is therefore possible to use non-pathogenic or attenuated Neisseries to replace pathogenic, IgA protease-producing Neisseries. Through such a competition for the receptors on the human Mucous membranes can be largely prevented from infections with pathogenic Neisseries.
  • IPP has been shown to trigger Neisserie-induced autoimmune diseases of certain viral diseases. Accordingly, substances (including vaccines) are used to combat such diseases, which are directed against the enzymatic activities of the IPP.
  • substances including vaccines
  • the level of IgA protease activity in the IPP prevents the release of the 7-peptide, which plays a central role in autoimmune pathogenesis.
  • Synthetic peptides of the structure RboroPro-OH have been described as an effective specific inhibitor of the proteolytic activity of the IgA protease (Bachovchin et al., 1990). Such or similar substances can therefore be used to combat autoimmune diseases.
  • substances can be used which have an inhibitory effect on other functions of the IPP or its individual components.
  • substances can be used which lead to an inhibition of the aspartyl protease of the ⁇ domain or to a blocking of the uptake of the ⁇ protein in human cells or their nucleus.
  • a special feature of the Neisseries IPPs is their intracellular site of action.
  • the description makes it clear that a Neisserie IPP or its cleavage products contain numerous functions that have an intracellular effect.
  • a Neisserien IPP and in particular the ⁇ -protein By using the intracellular transport function of a Neisserien IPP and in particular the ⁇ -protein, it is possible to transport other biological molecules to the exact site where the native IPP or its cleavage products develop their natural effects. It is therefore possible to transport substances to the natural site of action of an IPP that inhibit the natural biological function of an IPP. It is also possible to add molecules transport, inhibit the subsequent reactions (eg replication of viral elements) and thus limit an autoimmune reaction or virus multiplication.
  • IPP transport functions are used to introduce nucleic acids into human cells, which in turn carry out antagonistic functions of the IPP or its subsequent reactions and thus prevent an autoimmune reaction or virus multiplication.
  • nucleic acid segments could code for inhibitory proteins and integrate them as DNA into the genome of the affected cell or have one of numerous other inhibitory properties.
  • human cells affected under natural conditions include in particular certain cells of the human mucosa (e.g. the nasopharynx) and certain cells in human blood.
  • a further possibility for utilizing the targeting properties of the alpha protein consists in the chemical synthesis of analog peptides, which represent partial areas of the alpha protein and have similar transport and targeting properties.
  • An advantage of chemically synthesized peptides is, in particular, the possibility of introducing active groups that are coupled to biologically active groups Substances such as active proteins, nucleic acids or other substances can be used.
  • the ⁇ -protein can also be used for "gene targeting" experiments. E Elimination of IPP-affected cells using specific antibodies or cytotoxic T-sites
  • IPP-derived peptides Human cells that are affected by uptake of extracellular IPPs or by infection with pathogenic Neisseries present IPP-derived peptides on their MHC molecules. This fact can be used to specifically eliminate affected cells as described below:
  • IPP-derived peptides presented on MHC class I can be specifically recognized and eliminated by CD8 + T cells. It is possible to multiply such specific T cells by cloning in vitro and to return them to affected individuals. A prerequisite for this application, however, is that these specific T cells do not react against self-antigens; this can be ruled out by suitable screening procedures.
  • IPP-derived peptides that are presented either MHC class I or class II by means of specific monoclonal antibodies, which are obtained by known methods (for example by hybridoma technology, humanization of animal antibodies and / or recombinant antibody technology), to eliminate.
  • This can take place in that the bound antibody activates the complement system or elicits an antibody-dependent cytotoxic cell-mediated reaction (ADCC), which in each case results in the elimination of affected antigen-presenting cells.
  • ADCC antibody-dependent cytotoxic cell-mediated reaction
  • previous screening must ensure that the antibody obtained is not directed against self-antigens.
  • T-cells directed against self can have predominantly activating or predominantly suppressive properties. In the event that predominantly activating T cells are present, the autoimmune reaction is favored. On the other hand, an autoimmune reaction can be suppressed if there are sufficient suppressing T cells in addition to the activating T cells. An autoimmune reaction can thus be suppressed by stimulating or increasing the antigen-specific suppressing T cells. The stimulation of suppressing T cells depends on organ and cell-specific parameters of the antigen presentation of self-peptides or self-similar peptides (Mitchison, 1993). For example, predominantly suppressive T cells can be generated by oral administration of such peptides and the autoimmune reaction can be suppressed.
  • antigen-specific T cells can be modified by genetic manipulation in vitro so that they assume the properties of suppressing T cells. This is done, for example, by transfecting T cells with the functional genes of suppressing interleukins. the methods used for this correspond to the state of the art. G Development of a T cell vaccine
  • autoreactive T cells with certain variable V ⁇ or V ⁇ chains of the T cell receptor often play a role.
  • Such clonal autoreactive T cells which may have arisen from the action of a superantigen, can also be used for the production of a T cell vaccine.
  • MHC molecules bind a large number of different peptides. It is therefore also possible to load the MHC molecules with peptides that allow either no autoreak ⁇ tive T-cell activation or anergize autoreactive T-cells.
  • the autoimmune and virus-related diseases according to the invention are triggered by the bacterial polyproteins (BPPs) or the BPP-forming bacteria.
  • BPPs bacterial polyproteins
  • This invention therefore relates to diagnostic methods which are suitable for a qualitative or quantitative detection of BPPs or the bacteria which form them.
  • diagnostic methods include known microbiological, direct (antigen-specific) and indirect (antibody-specific, T-cell-specific) immunological, as well as enzymatic and gene-analytical detection methods.
  • the gene analysis methods include in particular the polymerase chain reaction (PCR) and DNA hybridization methods.
  • the detection methods mentioned relate in particular to the pathogenic Neisseries and the IPPs they have formed.
  • This invention therefore relates to diagnostic methods which provide information about the course of the disease. These include methods for the quantitative and qualitative detection of the immune status and the antigen-specific immune reactions at the B and T cell levels. Furthermore, this includes methods for the detection of the activation of viruses or viral elements, for example by means of genetic analysis (e.g. PCR techniques; Hermann and Kalden, 1994) and / or enzymatic (e.g. detection of reverse transcriptase activity). In addition, this includes detection methods of other typical effects of bacterial BPPs and in particular the Neisserie IPPs.
  • the results presented in this invention enable a large number of new antigen-specific methods for therapy or prevention against autoimmune and viral diseases in humans. These include the examples of therapy listed above and other forms of therapy described in the literature (eg Bläß, 1994; Tisch et al., 1994 and the literature cited therein).
  • the antigen-specific forms of therapy - based on the role of the pathogenic Neisseries - are based on the following antigens: * Peptides of the Iga gene products of the pathogenic Neisseries,
  • Viruses or endogenous viruses encoded peptides and
  • This invention furthermore relates to all of the methods exemplified above for the therapy of or for the prevention of autoimmune and viral diseases in humans which are directed directly or indirectly against the biological action of bacterial polyproteins (BPPs), in particular the Neisseries IPPs.
  • BPPs bacterial polyproteins
  • These procedures include in particular
  • This invention furthermore relates to diagnostic methods insofar as they are derived from the results mentioned above and which are of importance for the diagnosis of autoimmune and viral diseases in humans. These include in particular
  • BPP refers to bacterial polyproteins in general and includes the IgA protease polyproteins from pathogenic Neisseries (IPPs).
  • IPP refers not only to the direct gene product of the iga gene of the pathogenic Neisseries, but also to the secondary products "IgA protease", “ ⁇ -protein”, “7-peptide” and ⁇ -domain or intermediate fusions of these proteins.
  • pathogenic Neisseria refers to Neisseria gonorrhoeae and Neisseria meningitidis. If the term “Neisseries” is not explained in more detail, it includes at least the two pathogenic Neisseries.
  • viral diseases is understood to mean pathogenetic processes which are a consequence of the activation of viruses or viral elements, the activation being brought about by bacterial pathogens or their BPPs. The activation takes place in particular through the action of an IPP of pathogenic Neisseries on human cells.
  • viruses is understood to mean viruses which are activated by BPPs, in particular an IPP of pathogenic Neisseries, in their gene expression and or replication. It cannot be ruled out that different IPPs of pathogenic Neisseries have qualitatively and quantitatively different effects on viruses or viral elements.
  • viruses refers to genetically complete viruses or virus genomes (e.g. HIV or HIV provirus), while the term viral elements refers to genetically incomplete viral genomes (e.g. endogenous retroviruses).
  • Figure 1 DNA sequences and derived amino acid sequences
  • the Iga ⁇ 3 and Iga ⁇ 4 domains show pronounced homologies with each other as well as with the corresponding Iga ⁇ 1 and Iga ⁇ 2 domains of N. gonorrhoeae in the primary and
  • the Iga ⁇ 2 alleles are identical to the Iga ⁇ 1 allele of N. gonorrhoeae except for the amino acid at position 4.
  • the associated DNA sequences iga ⁇ 2 and iga ⁇ 2 * differ in the base at position 93.
  • the iga ⁇ 3 allele has a deletion of 4 triplets in the central region compared to iga ⁇ 2.
  • the iga ⁇ 4 allele shows a conversion of glycine-alanine to Senn-proline, which is due to a replacement of G by A at position 49 and a replacement of G by C at position 52 of the corresponding coding region.
  • FIG. 1 Homologies between amino acid sequences of the IgA protease precursor (IPP) of pathogenic Neisseries and various human proteins.
  • IPP IgA protease precursor
  • Igap, Iga ⁇ , Iga ⁇ and Igass denote the different domains of the Iga proteme, which have different functions and which are broken down by specific autoproteolysis ⁇ Pohlner et al., 1987).
  • the sequences are given in the one-letter code in the orientation from the amino to the carboxyl end.
  • the numbers at the amino end of the sequence sections indicate the corresponding positions in the Iga protein of N. gonorrhoeae MS11 (Igap, Iga ⁇ , Iga ⁇ 1 and Igass; (Pohlner et al., 1987), N. gonorrhoeae R16 (Iga ⁇ 2; Schur et al., 1989 ) and N.
  • meningitidis B1939 (Iga ⁇ 4 position based on the amino end of the ⁇ protein) and the sequence position in the human proteins. Identical amino acid positions between IgA proteins and the human proteins are highlighted by frames. Positions which are occupied by amino acids with similar properties Abbreviations: Hs47, 47 kd heat shock protein; Rsmb, small nuclear ribonucleoprotein-associated protein; Nfh, neurofilament triplet h protein; Qxyb, oxysterol binding protein.
  • Figure 3 Homologies between amino acid sequences of the ⁇ -peptide of pathogenic Neisseries (here N. gonorrhoeae MS11 and R16) and various connective tissue proteins in humans.
  • the first homology areas shown come from the most common protein components of the extracellular matrix of the cartilage tissue.
  • the link protein forms, with hyaluronic acid and the proteoglycan core protein, huge aggregates that serve to stabilize and elasticize the cartilage by absorbing water. While only a single PTR exists in the link protein and in the fibroblast proteoglycan, the proteoglycan core protein consists of two domains (G1 and G2) with two PTRs each.
  • the serine position at the amino end corresponds to position 960 in the Iga protein of N. gonorrhoeae MS11 (Pohlner et al., 1987).
  • the numbers at the amino end of the sequence sections indicate the respective positions in the human proteins. Identical amino acids between Iga ⁇ alleles and human
  • Proteins are printed in bold. Positions that are occupied by amino acids with similar properties are underlined. Following the sequences, the identity with the ⁇ -peptide is in
  • the polyprotein IPP is composed of the signal peptide (S), the enzymatic part (P), the ⁇ -peptide ( ⁇ ), the ⁇ -peptide ( ⁇ ) and the ⁇ -core ( ⁇ ). Cys marks the two cysteine residues preserved in all lPP s. Below are the areas that have been shown to be conserved or variable in N. gonorrhoeae (2) and N. menigi ⁇ dis (3) in the sequence analysis of various IPPs.
  • Domains marked in black are each variaoel, obliquely striped
  • Lines 4-8 show the homologies to human proteins.
  • a black square marks a homology of 7 or 6 identical amino acids in one piece.
  • the position marked with a square in line 6 shows one Range within the IPP that has sequence homology to a human protein of 5 essential amino acids in a row, this homology being part of a window in which at least 7 out of 10 amino acids are identical.
  • Lines 7 and 8 show sequence homologies of the reverse amino acid sequence of the N. gonorhoeae MS11 lPP with human proteins, a square in the seventh line corresponding to 7 identical amino acids in one piece, and a square in line 8 correspondingly to 6 amino acids.
  • FIG. 5 Construction of the expression plasmid pOK19.
  • the 1032 bp insert of the plasmid pOK18 (shown in white) codes for the 339 amino acid link protein (see FIG. 6). After restriction with the enzymes EcoRI and BamHI, it was inserted into the vector pEV41a via the same interfaces, resulting in the expression plasmid pOK19 was created.
  • Figure 6 Amino acid sequence of the human link protein.
  • Fig. 3 are underlined.
  • FIG. 7 Proteins of humans, which can serve as IgA protease substrates.
  • a variety of human proteins contain a sequence of
  • Ig-A immunoglobulin A-1; C chain
  • MsF macrophage stimulating protein
  • Tf-g T cell specific transcription factor G
  • NF-kappa-b core protein NF-kappa-b p100 subunit
  • TNF R1 tumor necrosis factor receptor 1
  • CC10 Complement C-10 component, C chain
  • cd45 leukocyte common antigen Cd45
  • FIG. 8 Comparison of a possible MHC class II binding motif with two putative cryptic ones that were created by IgA protease activity
  • the binding motif for MHC class II-bound peptides postulated by Rotzschke and Falk (1994) is shown in line (1).
  • Ac marks the position of hydrophobic amino acids, via which anchoring with the MHC molecule can take place.
  • X marks an amino acid that cannot be characterized in more detail.
  • line (2) and line (3) based on the two potential IgA protease substrates CD8 (Cd8; alpha chain) and CC10 (complement C-10 component; C chain), the correspondence of this binding motif with peptides by Iga protease activity can be rewritten. Direct matches with the binding motif are printed in bold in the IgA protease cleavage products.
  • Figure 9 Homologies of various retroviral aspartyl proteases with the IgA protease from Neisseries.
  • the alignment shows the area around the catalytic center of the aspartyl proteases. Amino acids printed in bold represent identical or similar residues. The following abbreviations are used:
  • MMTV mouse mammary tumor virus
  • HTLV-2 human t-cell leukemia virus II
  • CIV chimpanzee immunodificiency virus
  • HIV-2 human immunodificiency virus II
  • HIV-1 human immunodificiency virus I
  • FIV feline immunodificiency viru
  • EIV equine immunodificiency virus
  • RRP retrovirus related polyprotein
  • IgA-P neisserial IgA protease
  • oligonucleotides J0154 (5'CAGGAAACAGCTATGACCACACCGTTCGGTACAGCA) / J0126 (5'CAGGAAACAGCTATGACCACACCGTTCGGTACAGCA) and were used as sud toopri- mer oligonucleotides J0136 (5'TGTAAAACGAATGGCGAGGGCGGTGCGGCA) / J0146 (5'TGTAAAACGACGGCCAGTATGATGGCGAGGGCGGTGCCGGCA) as the forward primer. Based on their length, the amplified DNA fragments could be divided into two size groups. DNA sequence analyzes were carried out according to the dideoxy method.
  • flanking sequence areas were analyzed by means of PCR cycle sequencing using fluorescent dye-labeled universal forward (5'-TGTAAAACGACGGCCAGT) and universal reverse primers (5'-CAGGAAACAGCTATGACC), and in parallel using fluorescence-labeled dideoxynucleotides.
  • iga was determined in 13 different menigococcal strains.
  • sequences of the iga ⁇ regions of N. meningitidis D1941 and B1939 were determined after their subcloning in M13mpl8 / 19.
  • the amplification was carried out according to standard conditions with the primer pair J097 (5'-TCGAATTCCGGTATTACCCGGTTGT) / JO24 (5'-TCCAGCGCATCCAAGGGG) and the DNA fragments were then purified by agarose gel electrophoresis. After filling in the ends with Klenow polymerase and trimming at the 5 'end with EcoRI, the fragments were inserted between the EcoRI and HincII sites of the M13mpl8 / 19 vectors. The size of the iga ⁇ fragment from strain B1939 made further subcloning necessary for the sequencing, in which the central PstI fragment was inserted into the corresponding interface of M13mp19.
  • iga 4 at the amino acid positions 18 and 19 contains serine and proline instead of glycine and alanine, as with all other iga ⁇ forms.
  • the iga domains of all strains examined so far can be divided into these four groups.
  • the corresponding DNA sequences were highly conserved.
  • An amino acid exchange was manifested by the exchange of a single nucleotide at position 1 of the corresponding codon, which is why the number of amino acid exchanges can be equated with the number of nucleotide exchanges.
  • An additional variation in the Iga proteins resulted at position 22. Here either proline or alanine was found, although this was not specifically assigned to a group of iga forms.
  • the iga ⁇ 3 and iga ⁇ 4 alleles code for ⁇ proteins of 169 and 392 amino acids, respectively. In the N-terminal region these proteins are identical over 25 amino acids to the Iga ⁇ 1 and Iga ⁇ 2 alleles (Halter et al., 1989) from N gonorrhoeae Msll and R16. In addition, there are pronounced homologies between all four alleles, which are distributed in the form of short sequence motifs over the proteins. In addition to the homologies with one another, a large number of homologies to cellular proteins and matrix proteins of human origin occur (FIG. 2).
  • homologies mainly occur with connective tissue components such as proteoglycan and link protein (FIG. 3).
  • the 1532 amino acid sequence of the Neisseria gonorrhoeae MSII IPP was divided into successive peptides of 50 amino acids in length, each with an overlap of 10 amino acids.
  • the Wisconsin Sequence Analysis Package from GCG was first used in various databases to search for sequences which also occur in human proteins.
  • the homologies of IPP to human proteins concentrate on four areas, the ⁇ -peptide, the ⁇ -protein, part of the ß-core, and a constant area of the peptides that.
  • the vast majority of homologies to human proteins are in areas that are conserved in the previously known IPP forms of various Neisseries. This conforms to the hypothesis that there is molecular mimicry in these areas, and indicates that these sequences of sequences have been adapted to the protein pattern of the host and have proven themselves evolutionarily.
  • the constant and variable ranges of the different IPPs are in both N. gonorrhoeae and N. Meningitidis obtained in the same arrangement.
  • FIG. 2 Selected examples of the molecular mimicry of IPP are shown in FIG. 2. From this it can be seen that a large number of sequence patterns of human proteins have been copied in the IPP, with the primary aim of protecting the protein from the host's immune response on the basis of the tolerance existing against "self". If an immune response nevertheless occurs, possibly through the inclusion of flanking non-identical regions, this can also be directed against the body's own protein and is retained by constant stimulation after the actual trigger has disappeared. A number of partial sequences of the IPP, which show homologies to human proteins, also meet the criteria that have hitherto been known for the binding of peptides by MHC class II molecules, that is, for antigen presentation.
  • the total mRNA was isolated from primary cultures of human chondrocytes of the hip joint. This mRNA was rewritten with reverse transformer scriptase in cDNA and used as a template in order to use the specific oligonucleotides (J0123 5'-GCGAATTCCGATCATCTTTCAGACAACTATACT and J0125 5'-AACGGATCCTCATCAGTTGTATGATGATGCTCT to polymerize the gene in the linkC-PCR protein -A gene of the LinkCase protein) to amplify the gene in the linkC-protein (PCR) chain. After purification and restriction with EcoRI and BamHI, the I032bp fragment thus obtained was cloned into the vector pBluescriptII-SK and sequenced.
  • the vector pOK19 resulting from this step was introduced by electroporation into the E. coli strain 2136, which has the temperature-sensitive repressor CI857 in the genome. After temperature induction at 42 °, the fusion protein is produced in large quantities and deposited in the inclusion body inside the cell. After the cells have been lysed, these inclusion bodies are dissolved in guanidinium hydrochloride. The fusion protein is then bound to a nickel column using its amino-terminal "histidine tag" and eluted by changing the pH after washing the column (Diagen GmBH, Quigen Inc. QuiaExpress, 1992). Preparation of peptide antiserum:
  • mice Female Balb / c mice were immunized intraperitoneally three times with 100 mg each of the synthetically produced Pam 3 Cys- ⁇ -peptide (Pam 3 Cys-SPAANTASQAQKATQTDGAQIAKPQNIVVA) in saline.
  • the "Pam 3 Cys" -effective portion of the lipopeptides replaces an adjuvant (Wiesmüller et al., 1989).
  • the antiserum was obtained according to the state of the art. It reacts very well in the ELISA in a dilution of 1: 2000 with the synthetic ⁇ -peptide, as well as with the shorter peptides P2 (TDGAQIAKPQNIWA) and P3 (QKATQTDGAQIAKPQ).
  • this antiserum recognizes both a recombinant ⁇ -fusion protein and the recombinant link protein (see FIG. 6).
  • antibodies directed against the ⁇ -peptide can also cross-react with the human link protein.
  • mice were repeatedly immunized with the P121 protein, which contains the entire ⁇ and ⁇ region of the Neisseria gonorrhoeae MSII IPP. After hybridization of the macrophages obtained with the cell line NS-1 and repeated subcloning, seven cell clones producing monoclonal antibodies were found. All procedures were carried out under standard conditions. One of the monoclonal antibodies produced, designated JOP1, recognized a conserved epitope of approximately 12 amino acids (QAKAEQVKRQQA) at the amino end of the Neisseria ⁇ -proteins 1-4.
  • JOP1 One of the monoclonal antibodies produced, designated JOP1, recognized a conserved epitope of approximately 12 amino acids (QAKAEQVKRQQA) at the amino end of the Neisseria ⁇ -proteins 1-4.
  • JOP1 showed a cross-reaction with human cells (Chang conjunctiva), which in indirect immunofluorescence microscopy was expressed like a myosin-specific staining of the cells (without illustration)
  • Example 5
  • EBV-transformed homozygous B cell lines (Kimura et al., 1992) were cultivated on a large scale. Due to the virus transformation, these B cells show a greatly increased expression rate of MHC class II molecules (Gorga et al., 1987), which enables them to be isolated using affinity chromatography. For this purpose, a monoclonal antibody that specifically recognizes HLA-DR molecules was coupled to CNBr-activated Sepharose (Halter et al., [1993]).
  • HLA alleles important for the aetiology of rheumatism are important for the aetiology of rheumatism.
  • the peptide H3 (HPTKLTYDEAVQACL) comes from a region of the human link protein which has 40% identity to the neisserial antigen. H3 binds to the alleles DR1 and DR4 with high affinity.
  • the activation of T cells by antigens or mitogens can be determined qualitatively and quantitatively by inducing various T cell functions, such as proliferation, cytokine formation or expression of activation markers (IL-2 receptor, HLA-DR etc.).
  • the aim of the present study is to determine the existence of peptide-specific T cells in the peripheral blood of rheumatism patients (characterized by ACR Criteria). To check this, we use the property of T cells in our test system to proliferate after antigenic stimulation.
  • the link peptide (L40) (Table VII) was used as an antigen in a T cell proliferation test (see below), which has particularly clear homologies in the amino acid sequence with 7-peptide (see example 3, Figure 5).
  • the mononuclear cells (MNZ) were isolated from heparinized whole blood (20 U / ml) using Ficoll density gradient centrifugation (Böyum, 1969). The
  • Blood was diluted 1: 2 with Hanks' BSS and 30 ml portions of the mixture were layered on 15 ml Ficoll-Hypaque (density 1.077 g / ml). After subsequent centrifugation in the swing-out rotor (35 min, 400 xg, 21 ° C), the supernatant plasma was sucked off sterile and the MNZ was harvested from the interphase using a Pasteur pipette. The MNZ were then washed twice with Hanks' BSS and included in RPMI 1640 in a certain number of cells. The number of living cells was determined by microscopic counting in the Neubauer counting chamber after trypan blue staining.
  • peptides were adjusted to a concentration of 20 ⁇ g / ml in RPMI 1640 (without serum, + 1% glutamine + 50 ⁇ g / ml penicillin and 50 ⁇ g / ml streptomycin) immediately before the test.
  • Tetanus toxoid (TT) which was present in a final concentration of 2.5 LF / ml, was used as the bacterial control antigen.
  • the MNZ proliferation rate was determined by the incorporation of 3 H-thymidine during DNA synthesis.
  • the cells were concentrated in a concentration of 1 ⁇ 10 5 cells / wells in round-bottom microtiter plates together with the corresponding peptides (25 ⁇ g / ml) in a volume of 100 ⁇ l for 2 hours at 37 ° C. in a culture cabinet (5% CO 2 ) pre-incubated. Then 50 ⁇ l of RPMI, supplemented with 15% heat-inactivated human serum of blood group AB, was added to each well and the plates were cultivated for 7 days (or 10 days with the addition of IL-2, see below). 24 hours before the harvest the radioactive isotope ( 3 H-labeled thymidine, Amersham, 0.2 ⁇ Ci / well).
  • the cells were provided with the growth-promoting cytokine IL-2 (20 U / ml) after 6 days of culture and cultured for a further 3 days before these were labeled with 3 H-thymidine for 24 hours.
  • IL-2 potentially reactive anergic T cells can also be stimulated to proliferation, which may be "triggered” by a similar antigenic peptide, but which lack costimulatory signals (Meuer et al., 1986).
  • the plates were first frozen at -20 ° C. and later applied to filter mats using a cell harvester. The incorporation rate of the radioactive isotope was determined by liquid scintillation measurements in the LKB counter (Pharmacia). The mean value of the counts per minute (cpm) of three wells (triplicets) was determined from each stimulation approach.
  • a T cell response to the 7-peptide was also found in exactly the same patients. Interestingly, proliferation on both link and 7-peptide could only be induced in one case by the addition of IL-2 (patient No. 2).
  • the shaded boxes in Table IV document the agreement of the proliferation rates as a result of the stimulation with the link peptide or 7 peptide.
  • the T cells of these donors also showed a very good proliferation triggered by tetanus toxoid, an indication of the good antigenic stimulability of the cells of these donors.
  • proliferation after administration of IL-2 was also found in the cells of patients 6, 7 and 8 stimulated with link peptide, no proliferation in connection with 7-peptide and IL-2 could be detected there.
  • T cell clones which were isolated and established under optimized and defined conditions, could then be tested for their cross-reactivity on link or 7 peptide. With the help of the proliferation test, binding motifs and potential T cell epitopes of the peptide could then be studied, precisely defined and used as immunodiagnostics.
  • ⁇ protein occurs in all pathogenic Neisseria gonorrhoeae and Neisseria meningitidis strains. It discloses very good sequence and structural homologies to known viral and eukaryotic proteins (see example 11 / example 12).
  • a unique ability of the ⁇ protein is that it can be taken up by cells by incubation with receptor-mediated endocytosis and accumulated in the nucleus. That this is a specific process is confirmed by the fact that only a few cell types allow this nuclear localization.
  • the explanted corneas stored at 30 ° C in DMEM 5% FCS (fetal calf serum) are divided with a sterile scalpel into 16 pieces of tissue of the same size and up to a preconfluent growth stage (80% of the cover glass overgrown) in 24 "well" plates (Nunc, Dk) incubated on coverslips (human corneas from the Interuniversitary Ophthalmologic Institute, Academic Medical Center, Amsterdam were used).
  • coverslips human corneas from the Interuniversitary Ophthalmologic Institute, Academic Medical Center, Amsterdam were used.
  • the orientation of the corneal fragments on the cover slip is with the endothelial side down.
  • the used DMEM medium with 5% FCS is now replaced with fresh Medium replaced without FCS (this step serves to free receptors that are occupied by serum proteins). After an hour of incubation, the medium is changed again.
  • the cells are now cultured in FCS-free medium supplemented with ⁇ -protein (5 mg / ml) for a further five hours (this recombinant ⁇ -protein was used as a fusion protein in an overproducing E. coli strain (UT 5600, OrnpT-) "His-Tag" expressed, separated from the cell lysate via a nickel agarose (Ni 2+ -NTA agarose, Quiagen) and purified with the aid of affinity chromatography (BioRex 70, BioRad). Physiological buffer conditions were dialyzed against 1 x PBS without This is followed by fixation and permeabilization of the cells, which finally allow immunofluorescence microscopy to be carried out:
  • the cells are washed once with 1 x PBS (without divalent cations) and fixed for 10 min with a 1% paraformaldehyde solution (in 1 x PBS). The cells are then permeabilized for 30 min with a 0.5% Triton x-100 solution (in 1 x PBS).
  • the primary antibody solution diluted in 1 ⁇ PBS / 1% BSA, is then incubated for two hours at room temperature or overnight at 4 ° C. Unbound primary antibody is washed three times for 10 min with 1 x PBS / 0.05% Tween 20 and a fluorescent dye-labeled secondary antibody / protein A is incubated in the appropriate dilutions with the cells for 30 min.
  • lymphocytes and macrophages Another class of human primary cells that can endocytate the ⁇ protein and accumulate in the nucleus are lymphocytes and macrophages. This could be demonstrated with mononuclear parts (MNZ) from whole blood from different donors.
  • MNZ mononuclear parts
  • RPMI medium resuspended and counted. Between 5 x 10 5 and 1 x 10 6 MNZ can be used for a recording experiment. After incubation of the cells with serum-free RPMI medium for one hour, the uptake of the ⁇ -protein is carried out analogously to the procedure as described for the cornea cells. Depending on the immune status of the donors, one could recognize in the immunofluorescence especially in subpopulations of the round-nucleus lymphocytes or in almost all cells an uptake and nuclear accumulation. The immunosuppressive effect of the ⁇ protein shown in Example 8 could be explained by the endocytosis ability described here. After a very short incubation period with ⁇ -protein (less than 1.5 hours), only a few cells with nuclear accumulation can be found.
  • the immunosuppressive effect of the ⁇ protein can also be based on binding and inhibition of the CD26 activation marker of T cells (Gutheil et al., 1994).
  • the autocatalytic processing of the IgA protease polyprotein takes place in the extracellular environment. This process is concentration-dependent and is observed above all in the case of overexpression in the heterologous Escherichia coli system. Such high concentrations are probably not reached in vivo in IgA protease positive strains.
  • the T cells are directly involved in the defense against viruses and microorganisms as cytotoxic T cells or regulate the cellular and humoral immune reactions as so-called T helper cells through the formation and secretion of cytokines.
  • Microorganisms that, like Neisseries, infect and colonize the human host must have developed coevolutive skills to affect the host's immune system.
  • the regulation of the specific immune response appears to be of particular importance. There are some interesting examples of the manipulation of this regulation. For example, mycobacteria inhibit antigen processing or influence staphylococci and salmonella in antigen presentation; in both cases, this ultimately leads to a reduced T cell response (Marrack and Kappler, 1994; Pryjma et al., 1994).
  • the monocytes were also partially removed by plastic adherence (1 hour, 37 ° C, 5% CO 2 , serum-free).
  • the so-called non-adherent cells (NAZ) contained less than 2% monocytes.
  • MNZ and NAZ were on a concentra tion 1 x 10 6 cells / ml and preincubated under serum-free conditions with the ⁇ -protein (5 ⁇ g / ml in RPMI) at 37 ° C. The incubation of the cells with cell culture medium without ⁇ -protein was used in parallel as a control.
  • the cells were then further cultivated in flat-bottom microtiter plates (0.5 x 10 5 c / well; volume 200 ⁇ l) with RPMI + 10% heat-inactivated fetal calf serum.
  • the T cells were stimulated with the lectin PHA (1 ⁇ g / ml) or the antigen tuberculin, PPD (10 ⁇ g / ml), which guarantees a specific and strong reaction after 4 days of culture under the culture conditions specified below (Lorenzen, 1992 ).
  • the cells were labeled with 3 H-thymidine (0.2 mCi / well), harvested 18 hours later and measured using the liquid scintillation counter in the LKB-beta counter. The evaluation of this experiment is shown in Table V.
  • PPD Purified Protein Derivative
  • PHA phytohemagglutinin
  • the proliferation can be determined after 4 days of culture by incorporating tritiated thymidine and given as cpm x 1000
  • the results are averages calculated from triplicate determinations.
  • PPD-induced T cell proliferation was significantly reduced in both approaches after treatment with ⁇ -protein, while polyclonal activation with PHA was not significantly inhibited.
  • This experiment shows that the neisserial ⁇ protein not only has biochemical and cell biological similarities to the Tat protein, but also has immunophysiologically similar properties.
  • the similar effect on T cells, in which the proliferation of antigen-specific T cells is selectively inhibited suggests that this biological effect may be due to the nuclear transport found for both proteins within the eukaryotic cells (see Example 7).
  • Such suppression of certain antigen-specific T cell clones could, for example, by disrupting suppressive T cells or certain cytokine-producing T cells, disrupt the balance of the immunological network and ultimately also contribute to the development and maintenance of autoimmune diseases such as RA.
  • the known substrates of the IgA protease are human immunoglobulin A and the precursor protein of the IgA protease itself. This means that the IgA protease exhibits an auto-catalytic activity in order to cut out the various functional units from the IPP.
  • the amino acid sequences recognized and cut can be determined from the cleavage products obtained (Klauser et al., 1993; Plaut et al., 1975). They can be simply described using the scheme YP-
  • the hydrolysis of the peptide bond by the IgA protease takes place within this linear recognition sequence, the presence of this sequence being sufficient for a specific cleavage by the enzyme (Pohlner et al., 1992).
  • the known and realized variations of the recognition sequence are shown in Table VI.
  • the known substrates of the IgA protease are human immunoglobulin A and the respective IgA protease precursor proteins themselves.
  • the combination of the cleaved sequences results in the generally applicable cleavage motif of the IgA protease "YP
  • the sequence data obtained by computer-aided comparisons show that a proportion of 7 percent of all human proteins carry a potential IgA protease interface, a selection of interesting examples being shown in FIG. 9.
  • the surprisingly high number of human proteins found with IgA protease cleavage sites are transcription factors or cellular receptors. It seems plausible that the activity of the IgA protease in the host organism cleaves an extracellular receptor component and that correct signal detection is no longer possible. On the other hand, an intracellular Re share of the signal can be prevented.
  • the IgA protease cleavage sites found in human proteins through database comparisons are actually recognized and cut by the enzyme, as was shown by the leukocyte surface marker CD8 (Pohlner et al., 1992).
  • CD8 leukocyte surface marker
  • a 205 amino acid fragment of CD8 which contained the potential IgA protease cleavage site (FIG. 9) was fused with an N-terminal part of the MS2 polymerase and was converted into E. coli expressed.
  • the purified fusion product was cleaved by the IgA protease.
  • N-terminal peptide sequencing showed that the IgA protease sequence had been recognized and hydrolyzed within the CD8 region as predicted.
  • An MHC class II antigen thus consists of a processed peptide with flanking proline residues, which contains a central core epitope with defined hydrophobic anchor positions (FIG. 10).
  • the ability to carry a proline in the second position is not limited to peptides presented in MHC class II.
  • a number of peptides which are associated with various MHC class I alleles also show an increased occurrence of proline at position 2 (Engelhard, 1994).
  • IgA protease allows host proteins to be processed in such a way that they are suitable for presentation by MHC class II.
  • These self-peptides which arise as a result of the enzymatic activity of the IgA protease, are recognized as foreign due to a lack of tolerance which was not previously necessary and a T-cell reaction against the body's own proteins occurs.
  • the IgA protease is formed as part of a precursor molecule (IPP).
  • IPP precursor molecule
  • the translocation through the outer membrane takes place with the help of the C-terminal part of the precursor, the ⁇ -core. While the IgA protease splits off autocatalytically as a polyprotein and matures further extracellularly, the ⁇ core remains in the membrane (Pohlner et al., 1987).
  • Cysteine, serine, metallo and aspartyl proteases are assigned to the four classes mentioned. What is striking for aspartyl proteases is the small number of conserved residues which are necessary in order to be catalytically active (Miller et al., 1989).
  • a sequence analysis of the ⁇ core with various viral enzymes shows a high degree of homology in the area mentioned above (FIG. 7). Even the distance to another conserved area, probably a part that contributes to the structure formation, is exactly the same. The high variability outside the conserved areas is also remarkable. A large number of non-identical / non-similar amino acid residues also occur here in closely related viruses such as HIV-1 and HIV-2.
  • the ⁇ -core has sufficient sequence information to represent a functional and membrane-bound aspartyl protease.
  • the family of viral aspartyl proteases has another thing in common. This is the non-specific recognition sequence that is cleaved (Dougherty et al. 1993). So that not all proteins in the environment are cleaved uncontrollably, intracellular changes can be a mechanism for regulation. Aspartyl proteases have a pH optimum in the acidic range. In phagocytes, the effects of a bacterial aspartyl protease are likely to develop fully and contribute to the survival of the intracellular bacterium.
  • peptides interacting with the protease can have altered antigenic properties which, in turn - as presented by MHC - lead to an autoreactive immune system (Anomasin et al., 1990).
  • Lentiviruses are a separate family within retroviruses. Lentiviruses include HIV, HTLV and animal pathogenic species, which also cause immune deficiency diseases.
  • the genome of the lentiviruses can be divided into three coding areas: gag codes the structural pro teine of the inner envelope, env the glycoproteins of the outer membrane and pol enzymes which are necessary for virus replication, such as the reverse transcriptase, endonuclease and a protease.
  • tat gene which can differ in the individual viruses in this group. The transcription of viral genes is activated by the tat gene product, the tat protein.
  • the directional transport into the nucleus is ensured by the core localization sequence.
  • the binding of the Tat protein to the TAR (transactivation responsive elements) within the LTR (long terminal repeats) of the virus DNA activates the transcription, which ultimately leads to the removal of infectious virus particles.
  • ⁇ protein as a transcription factor is investigated using a eukaryotic cell system.
  • This Cells carry a gene construct consisting of LTR from HIV or other retroviruses in connection with a reporter gene, such as CAT or luciferase. If the ⁇ -protein gets into the nucleus of these cells and the LTR are activated, this leads to the expression of chloramphenicol acetyltransferase (CAT), the activity of which is specifically detectable.
  • CAT chloramphenicol acetyltransferase
  • ERSs Activity of the ⁇ protein as a transcription factor could prove to be important with regard to the activation of ERSs.
  • the eukaryotic genome normally carries between 5 and 10% so-called retrotransposable ERSs (endogenous retroviral sequences). These ERSs are an important factor in the reorganization of the eukaryotic genome, but it is unknown how these retroviral elements got into the eukaryotic DNA. At least it is certain that human ERSs per se are defective proviral elements that are no longer able to produce viruses. Overall, however, these elements represent a large reservoir of viral genes that are caused by mutations or recombinations with exogenous retroviruses or other factors such as e.g.
  • HRES is an endogenous retroviral element similar to HTLV, which contains functional transcription elements, including LTR, and is thus capable of protein expression (Banki et al., 1992).
  • autoimmune diseases such as B. Multiple sclerosis, SJörgen's syndrome and lupus erythematosus were found to have auto-antibodies to HRES, i.e. HRES can act as an autoantigen.
  • ERSs encode so-called superantigens and can thereby trigger autoimmune responses (Krieg et al., 1990). Regardless of the antigenic specificity of a T cell, superantigens are able to bind to the V ⁇ chain of the TCR and to the MHC II complex of an antigen presenting cell and thus trigger an immune reaction.
  • Patients with RA have been reported in the Synovial fluid detected the expansion of V ⁇ - specific T cells. This expansion of V ⁇ -specific T cells is believed to have been triggered by superantigens (Paliard et al., 1991). New evidence for the pathogenesis of rheumatoid arthritis was provided by electron microscopic examinations of synovial cells. Previously unknown retrovirus-like particles were found here. An explanation for this would be the LTR-dependent activation of endogenous retroviral elements, which could lead to the expression of virus-like particles (Keyszer et al., 1994).
  • the function of the ⁇ protein is therefore interesting not only with regard to the LTR activation of virus-infected cells, but also with regard to the possible function as a transcription factor of ERSs, which can be responsible for the development of autoimmune diseases. Since approx. 50% of the population repeatedly asymptomatic carriers of N. meningitidis, and therefore exposure to ⁇ -protein is present, the activating function of the ⁇ -protein on the LTR of endogenous retroviral elements could indicate a connection to common autoimmune diseases such as RA.
  • the first contact of human-pathogenic Neisseries with the host cell takes place via surface structures of the bacterial cell, the pili.
  • the close adhesion of the bacterial cell to the host cell membrane, which ultimately leads to invasion into the host cell, is mediated on the bacterial side via opa proteins of the outer membrane.
  • grandpa proteins play a central role in the expression of tissue specificity (Kupsch et al., 1993).
  • the specific adhesion to epithelial cells is mediated by Opa 50 , the proteins Opa 51-60, however, are responsible for the adhesion to peripheral blood lymphocytes.
  • About the receptors on Sei Little is known about the host cells and the molecular mechanisms of this cell specificity of the Neisseries.
  • the opa-mediated adhesion and invasion to epithelial cells was inhibited by means of certain proteolytic enzymes and inhibitors.
  • the epithelial cells were treated with Neisseries and the following additives before infection:
  • the cellular receptor for grandpa-mediated adhesion is a membrane-bound heparan sulfate proteoglycan.
  • Cell surface proteoglycans are a large family of highly polymorphic glycoproteins, which are divided into different groups according to the respective core protein, the composition of the glycosaminoglycan side chains attached to the core and the anchorage in the cell membrane: the syndecans, beta-glycans and CD-44 (Bernfield et al., 1992).
  • Syndecans are characterized by a core protein that consists of a large extracellular domain with a large number of possible glycosaminoglycan binding sites, a highly conserved, hydrophobic transmembrane domain and a short carboxy-terminal cytoplasmic part.
  • the interaction of bacterial Opa 50 protein and cellular Syndekan-1 thus plays a key role in the course of the infection.
  • This specific interaction between the pathogenic organism and its host cell offers different approaches to drug development.
  • parts of the Opa 50 protein can be used as vaccines, which lead to the formation of specific antibodies against the adhesive domain of Opa 50 , thus preventing the adhesion and invasion of Neisseries, and thereby protecting them from infection.
  • drugs for Neisseries infections are not only important with regard to primary symptoms of the disease, but especially with regard to secondary late damage, such as the development of autoimmune diseases; i.e. Vaccine against Neisserei could also vaccine against certain autoimmune diseases such as. B. mean rheumatoid arthritis.
  • T cell clones are reactivated by superantigens
  • such cross-reactive T cell populations are also stimulated to multiply, exceed a critical number and acquire the ability to develop their pathogenic potential.
  • peptide-specific T cells in the peripheral blood of healthy donors expressing the corresponding MHC haplotype should be detected earlier, before the actual manifestation of the disease.
  • These T cells are then stimulated in vitro by the antigens for proliferation, similar to the T cells of the RA patients (Example 6).
  • the proliferation is measured analogously to the conditions under Example 6 by means of 3 H-thymidine incorporation during the DNA synthesis.
  • Retroviruses a number of functional proteins are formed by cleaving a precursor protein, the ver The protease responsible is a component of the precursor polyprotein (Kösslich et al., 1989). So there is a structural similarity between retroviral elements and the IgA protease precursor. In order to demonstrate similarities also at the level of the primary structure, sequence comparisons of the IPP with gene products of retroviruses were carried out using the Wisconsin Sequence Analysis Package from GCG (Genetics Computer Group Inc.). For this purpose, a database called Retrovirus was first created, in which the amino acid sequences of the retroviral elements previously stored in the Swissprot database were merged.
  • sequence homology was found between the amino acid sequence of the 7-peptide and a Nef protein of HIV-1 (accession number: P04603). Here 36% of 25 amino acids were conserved identically and 44% with similar properties were preserved, which resulted in a total similarity of these sequence segments of 80%. Furthermore, sequence homologies between the ⁇ -core and the Env protein of various retroviruses were found, but also as shown in Example 11 for the retroviral aspartyl protease. The ⁇ -protein showed homologies to various polyprotein precursors and to the Tat protein, also beyond the range of the nuclear translation signal. The 7-peptide also showed homologies to a number of NEF proteins and a polyprotein from
  • Grapewine Fanleaf Virus A characteristic of almost all found sequence homologies of IPP with retroviral proteins was that the conserved identical amino acids were in areas that are locally concentrated and additionally have a high number of similar amino acids. Thus, sequence sections of high similarity could be found, which were surrounded by areas without sequence matches. Such a clustering of the sequence homologies could be explained by an origin or a change in the IPP as a result of recombination with retroviral elements.
  • ⁇ -protein An important functional activity of the ⁇ -protein can be derived from the following experiment.
  • cotransfection studies in which one plasmid encodes the ⁇ protein and the second plasmid contains the neomycin resistance marker, an effect of the ⁇ protein on the transcription level was observed for the first time.
  • TK mouse L
  • all clones selected for antibiotic resistance were also ⁇ -protein positive (Langenberg, 1993).
  • the ⁇ -protein coding plasmid was co-transfected with the selection marker plasmid only in the same amount (1-5 mg Quiagen DNA), each neomycin-resistant clone was also ⁇ -protein positive.
  • stage VI oocytes are used, which have matured until the first meiotic division has started.
  • stage VI oocytes are used, which have matured until the first meiotic division has started.
  • a fully grown egg cell has stopped at the boundary between G2 and M phase in the cell cycle (Ford, 1985).
  • hormones for example progesterone
  • meiosis I proceeds to the metaphase of meiosis II, in which the egg cell then remains until fertilization (Merriam, 1971).
  • stage VI oocytes led to the following phenotypic changes in stage VI oocytes (Rauber, 1991). About 3 hours after the injections, the oocytes got a visible, bright spot in the dark, animal pole. After a longer incubation, their characteristic light-dark coloration changed to a stain or stripe pattern and finally they died. At the same time, one could see that after three hours of incubation there was no sharp separation between nucleus and cytoplasm; instead, the nucleus had a changed oval to elongated shape and was located on the inside of the cytoplasmic membrane in the dark pole.
  • the injections of IGA protease and protease inhibitor molecules in oocytes of the clawed frog were carried out as follows: The ovary, or only parts of it, depending on the amount of the oocytes required, was in MBS-H buffer (88 mM NaCl, 1 mM KCl, 2, 4 mM NaHCO 3 , 0.8 mM MgSO 4 , 0.33 mM Ca (NO 3 ) 2, 0.41 mM CaCl 2 , 10 mM Hepes pH 7.4, supplemented with 10 mg / ml benzylpenecillin and streptomycin), washed with crushed two forceps and incubated by adding collagenase (2 mg / ml) until more than 90% of the oocytes were isolated.
  • MBS-H buffer 88 mM NaCl, 1 mM KCl, 2, 4 mM NaHCO 3 , 0.8 mM MgSO 4 , 0.33 m
  • the oocytes were then washed again in MBS-H buffer to remove the collagenase. All injection experiments were carried out on a tempered steel plate (20 ° C).
  • the injection apparatus consisted of a Hamilton syringe which could be operated with a constant feed via a Secura perfusor and an extended glass capillary which was fitted in a micromanipulator.
  • the capillary was connected to the syringe via a Teflon tube, which was filled with an inert oil for pressure transmission.
  • stage VI oocytes were aligned in the wells of a glass plate under MBS-H buffer so that they could be injected into the light pole without damaging the core in the dark half.
  • Human nasopharyngeal tissue is another target tissue for the specific uptake and nuclear localization of the alpha protein.
  • the alpha protein secreted by Neisserien has functional core localization sequences. If the alpha protein is expressed by transfected cells, it accumulates specifically in the nucleus. In addition, however, the alpha protein is able to penetrate cells from outside and then accumulate in the nucleus. However, this only happens in very specific cells of primary cultures of certain human tissues. It is striking that these are tissues that are also target tissues for infection with Neisseries. As described in Example 7, a certain "subset" of cells from primary cell cultures of human cornea and a certain "subset" of human mononuclear blood cells show external uptake and nuclear localization of the alpha protein. Another target tissue is tissue from the human nasopharyngeal area.
  • Surgical removal of the nasal polyps which are used to remove the natural microflora, primarily with a medium containing antibiotics (DMEM, 250 E / ml penicillin / streptomycin, 5 ⁇ g / ml fungi zone, 25 mM Hepes, 100 ⁇ g / ml gentamycin, 50 mg / ml nystatin).
  • DMEM 250 E / ml penicillin / streptomycin, 5 ⁇ g / ml fungi zone, 25 mM Hepes, 100 ⁇ g / ml gentamycin, 50 mg / ml nystatin.
  • the tissue in this medium is freed from attached fat and connective tissue and then broken down into pieces of approximately 2 mm 2 . Then fresh medium is added and the tissue pieces are incubated at 37 ° C. overnight. The following day, this medium is replaced by the addition of fresh antibiotic medium to which 10% FCS has been added.
  • the antibiotic medium is removed and the tissue pieces are placed individually on microscopic cover glasses in tissue culture plates with 24 wells. As soon as the tissue pieces have settled (after 5 hours until overnight at 37 ° C in the incubator), Culture medium (DMEM / Ham's F12 1: 1, 10% FCS, 1% penicillin / strepomycin, 1% fungizone, 2.5% Hepes, 0.4% methyl cellulose) was added. These cultures are incubated approx. 1-2 weeks with changing media twice a week. If at least 20% of the cover glasses are covered with cells, they are used for the experiments. The detection of the alpha protein uptake and nuclear localization is then carried out as described in Example 7 in the case of the primary culture from cornea.
  • DMEM / Ham's F12 1 1, 10% FCS, 1% penicillin / strepomycin, 1% fungizone, 2.5% Hepes, 0.4% methyl cellulose
  • the alpha protein is taken up by many cells, but then degraded in vesicles. In a few cells of certain tissues, the specific uptake leads to accumulation in the nucleus, which suggests a specific uptake mechanism that depends on a very specific cell type / status.
  • Peptide B from R16
  • the frames represent the core localization sequences.
  • Peptide A from MS11, without core localization sequence
  • ⁇ no binding to cells or matrix Peptide C from MSII, nuclear localization sequence No. 4
  • Peptide B from R16, nuclear localization sequences No. 1 and 2
  • Peptide D from R16, core localization sequence No. 3
  • the alpha protein only penetrates into the nucleus in certain cells of certain tissues.
  • This specific function can be used to selectively introduce either DNA, proteins or other substances into these cells via coupling with the alpha protein or with individual peptides from the alpha protein.
  • a peptide from the alpha protein (see Example 22) is coupled with polylysine.
  • DNA binds very effectively to polylysine (Wagner et al., 1990).
  • the vector pSV3neo (Berg, 1982), which encodes the SV40 Large T region, is specifically introduced into nuclear localization-positive cells. The expression of the SV40 Large T leads to the immortalization of the cells and thus to the generation of a cell line.

Abstract

The present invention concerne drugs and diagnostic agents as well as diagnostic, therapeutic and preventive methods for treating auto-immune and viral diseases in humans, these diseases being caused by pathogenic bacteria which are, in particular, micro-organisms colonizing human mucus membranes and secreting given exoproteins which display structural similarities to human proteins. Proteins similar to IgA protease which are absorbed particularly well by cells and present as antigens on MHC molecules are of particular significance in this respect. The IgA protease polyprotein (IPP) of pathogenic Neisseriae has a particularly marked homology to human proteins. For example, a given IPP peptide has marked homology to the articular proteins link and aggrekan. It is thus proven, for example, that the IPP is an etiological agent of rheumatoid arthritis (RA). The auto-immune reaction is further encouraged by other properties of the IPP-producing Neisseriae and IPPs. A particularly important property is the ability of the IPP to activate viruses and viral elements. This concerns in particular the activation of proviral retroviruses and endogenic retroviruses in humans. Further auto-immune reactions are induced in humans owing to the activation of viruses and viral elements. The development of acquired immune deficiency syndrome (AIDS) is also explained by the IPP-dependent activation of the HIV provirus. The properties according to the invention of the pathogenic Neisseriae and the IPPs formed thereby give rise to numerous novel diagnostic, therapeutic and preventive processes.

Description

Arzneimittel zur Prophylaxe und Behandlung von und Diagnostika zur Erkennung von Autoimmunkrankheiten und viralen Erkrankungen  Medicines for the prophylaxis and treatment of and diagnostics for the detection of autoimmune diseases and viral diseases
Die vorliegende Erfindung betrifft Arzneimittel und Diagnostika sowie diagnostische, therapeutische und vorbeugende Verfahren zur Behandlung von Autoimmun- und Viruskrankheiten des Menschen, die durch pathogene Bakterien hervorgerufen werden. Diese Bakterien sind insbesondere Mikroorganismen, die die Schleimhäute des Menschen kolonisieren und bestimmte Exoproteine sezernieren, die strukturelle Verwandtschaften zu menschlichen Proteinen aufweisen. Besondere Bedeutung kommt dabei den IgA-Protease-ähnlichen Proteinen zu, die besonders gut von Zellen aufgenommen werden und als Antigene auf MHC-Molekülen präsentiert werden. Besonders ausgeprägte Homologie zu menschlichen Proteinen besitzt das Polyprotein der IgA-Protease (IPP) von pathogenen Neisserien. Beispielsweise besitzt ein bestimmtes Peptid des IPP ausgeprägte Ho mologie zu den Gelenkproteinen Link und Aggrekan. So wird z.B. der Nachweis geführt, daß das IPP ein ätiologisches Agens der rheumatoiden Arthritis (RA) ist. Die Autoimmunreaktion wird ferner durch andere Eigenschaften der IPP-produzierenden Neisserien und der IPPs begünstigt. Eine besonders wichtige Eigenschaft ist die Fähigkeit des IPP Viren und virale Elemente zu aktivieren. Dies betrifft insbesondere die Aktivierung von proviralen Retroviren und endogenen Retroviren des Menschen. Aufgrund der Aktivierung von Viren und viralen Elementen werden weitere Autoimmunreaktionen des Menschen induziert. Durch die IPP-abhängige Aktivierung des HlV-Provirus wird darüber hinaus auch die Entwicklung des acquired immune deficiency syndrome (AIDS) erklärt. The present invention relates to pharmaceuticals and diagnostics as well as diagnostic, therapeutic and preventive methods for the treatment of autoimmune and viral diseases in humans, which are caused by pathogenic bacteria. These bacteria are, in particular, microorganisms that colonize human mucous membranes and secrete certain exoproteins that are structurally related to human proteins. Of particular importance are the IgA protease-like proteins, which are particularly well absorbed by cells and presented as antigens on MHC molecules. The polyprotein of the IgA protease (IPP) from pathogenic Neisseries has particularly pronounced homology to human proteins. For example, a certain peptide of the IPP has pronounced Ho Theology of the Link and Aggrekan joint proteins. For example, evidence is provided that the IPP is an etiological agent of rheumatoid arthritis (RA). The autoimmune response is further promoted by other properties of the IPP-producing Neisseries and the IPPs. A particularly important property is the ability of the IPP to activate viruses and viral elements. This applies in particular to the activation of proviral retroviruses and endogenous retroviruses in humans. Due to the activation of viruses and viral elements, further autoimmune reactions in humans are induced. The IPP-dependent activation of the HIV provirus also explains the development of the acquired immune deficiency syndrome (AIDS).
Aus den erfindungsgemäßen Eigenschaften der pathogenen Neisserien und der von ihnen gebildeten IPPs leiten sich zahlreiche neue diagnostische, therapeutische und vorbeugende Verfahren ab. Numerous new diagnostic, therapeutic and preventive methods are derived from the properties of the pathogenic Neisseries according to the invention and the IPPs they form.
Die Ätiologie von Autoimmunkrankheiten des Menschen ist in vielen Fällen ungeklärt. Es gibt Vermutungen, daß neben bestimmten individuellen genetischen Prädispositionen auch infektiöse Mikroorganismen eine Rolle bei der Entwicklung von Autoimmunkrankheiten spielen. Wichtige Beispiele für Autoimmunkrankheiten sind die multiple Sklerose (MS), der insulinabhängige Diabetes Mellitus (IDDM), die rheumatoide Arthritis (RA) und möglicherweise auch die Arteriosklerose (Ask). Neueren Schätzungen zufolge liegt der Anteil der von Autoimmunkrankheiten betroffenen erwachsenen Bevölkerung bei etwa 5% bis 15%; die mit den Auswirkungen und der Therapie einhergehenden wirtschaftlichen und sozialen Belastungen sind dementsprechend bedeutsam. The etiology of autoimmune diseases in humans is in many cases unclear. There are speculations that in addition to certain individual genetic predispositions, infectious microorganisms also play a role in the development of autoimmune diseases. Important examples of autoimmune diseases are multiple sclerosis (MS), insulin-dependent diabetes mellitus (IDDM), rheumatoid arthritis (RA) and possibly also arteriosclerosis (Ask). According to recent estimates, the proportion of the adult population affected by autoimmune diseases is around 5% to 15%; the economic and social burdens associated with the effects and the therapy are accordingly significant.
Eine zentrale Funktion des Immunsystems ist es, von außen kommende infektiöse Mikroorganismen abzuwehren und aberrante Zellen des eigenen Körpers zu eliminieren. Zur Erfüllung dieser Aufgabe ist die Fähigkeit des Immunsystems essentiell, eigene Strukturen (Selbst) von fremden Strukturen (Fremd) zu unterscheiden. Die molekulare Grundlage für die Unterscheidung zwischen Selbst und Fremd stellt dieA central function of the immune system is to ward off infectious microorganisms coming from outside and to eliminate aberrant cells of the own body. The ability of the immune system to distinguish its own structures (self) from foreign structures (foreign) is essential for fulfilling this task. The molecular basis for the distinction between self and foreign makes the
Wechselwirkung von hochvariablen Rezeptormolekülen auf der Oberfläche von B-Zellen und von T-Zellen dar. B-Zellen bilden Antikörper auf ihrer Oberfläche, die mit nativen Antigenen reagieren, und T-Zellen bilden T-Zellrezeptoren, die Peptide erkennen, die auf MHC-Molekülen präsentiert werden. Von den T-Zellen gibt es mehrere Gruppen: CD8+ T-Zellen reagieren mit Peptiden, die auf Klasse I MHC-Molekülen präsentiert werden, und CD4+ T-Zellen reagieren mit Peptiden, die auf Klasse II MHC-Molekülen präsentiert werden. Ferner lassen sich CD4+ Zellen in TH1 und TH2 Untergruppen unterteilen, die sich in ihrem Cytokin-Muster unterscheiden und entweder entzündungsfordernd (TH1) bzw. entzündungshemmend (TH2) sind. Interaction of highly variable receptor molecules on the surface of B cells and T cells. B cells form antibodies on their surface that react with native antigens, and T cells form T cell receptors that recognize peptides that are sensitive to MHC Molecules are presented. There are several groups of T cells: CD8 + T cells react with peptides presented on class I MHC molecules and CD4 + T cells react with peptides presented on class II MHC molecules. Furthermore, CD4 + cells can be divided into TH1 and TH2 subgroups, which differ in their cytokine pattern and are either anti-inflammatory (TH1) or anti-inflammatory (TH2).
Die Aktivierung bzw. Inaktivierung von B- und T-Zellen setzt meist eine Interaktion zwischen mindestens zwei verschiedenen Zelltypen voraus. So benötigen B-Zellen für ihre Aktivierung die Hilfe von CD4+ T-Zellen. T-Zellen wiederum benötigen für ihre Aktivierung entsprechende MHC-bildende antigenpräsentierende Zellen (APC). Während MHC Klasse I von fast allen Körperzellen gebildet wird, wird MHC Klasse II insbesondere von Makrophagen, dendritischen Zellen, B-Zellen und unter bestimmten Umständen auch von T-Zellen, Epithelzellen und Fibroblasten gebildet. The activation or inactivation of B and T cells usually requires an interaction between at least two different cell types. B cells need the help of CD4 + T cells to activate them. T cells in turn require appropriate MHC-producing antigen presenting cells (APC) for their activation. While MHC class I is formed by almost all body cells, MHC class II is formed in particular by macrophages, dendritic cells, B cells and, under certain circumstances, also by T cells, epithelial cells and fibroblasts.
Der Unterscheidungsprozeß zwischen Selbst und Fremd findet vermutlich auf mehreren Ebenen statt. So werden B- Zellen, die gegen Selbst gerichtete Antikörpermoleküle auf ihrer Oberfläche tragen, in einer frühen Entwicklungsphase eliminiert. Einen ähnlichen Selektionsprozeß durchlaufen T- Zellen bei ihrer Entwicklung im Thymus, wobei Selbst-reaktive T-Zellen eliminiert oder unterdrückt werden. Für die weitere Differenzierung und Verbreitung im Organismus verbleiben dann vorwiegend solche T-Lymphozyten, die fremde Strukturen erkennen. Darüber hinaus besitzt das Immunsystem Mechanismen, Toleranz gegenüber bestimmten Antigenen zu entwickeln, obgleich diesbezüglich kein Selbst-Fremd-Abgleich im Thymus stattgefunden hat. So kann Toleranz z.B. durch se lektive Eliminierung bzw. Anergetisierung von Lymphozyten erzeugt werden. Bei diesen letzteren Unterscheidungsprozessen spielen offensichtlich T-Zell-Untergruppen eine entscheidende Rolle, die unterschiedliche (z.B. aktivierende oder hemmende) Cytokine bilden. Die Bildung unterschiedlicher T-Zell-Untergruppen hängt wiederum in entscheidendem Maße von der Art und Weise der Antigenpräsentation ab, beispielsweise hinsichtlich des Körperorgans, in dem sie stattfindet, und des Typs der antigenpräsentierenden Zelle. Darüber hinaus bilden B- und T-Zellen ein immunologisches Netzwerk, das dazu dient, ein ausgewogenes Gleichgewicht zwischen Selbst-Toleranz und Fremd-Reaktivität zu erhalten. The process of distinguishing between oneself and others presumably takes place on several levels. In this way, B cells that have self-directed antibody molecules on their surface are eliminated in an early development phase. A similar selection process goes through their development in the thymus, whereby self-reactive T cells are eliminated or suppressed. For further differentiation and dissemination in the organism, there are mainly those T lymphocytes that recognize foreign structures. In addition, the immune system has mechanisms to develop tolerance to certain antigens, although there has been no self-foreign alignment in the thymus in this regard. For example, tolerance can be determined by se selective elimination or anergization of lymphocytes. In these latter differentiation processes, T cell subgroups that play different (eg activating or inhibiting) cytokines obviously play a crucial role. The formation of different T cell subsets, in turn, depends crucially on the manner in which the antigen is presented, for example with regard to the body organ in which it takes place, and the type of cell presenting the antigen. In addition, B and T cells form an immunological network that serves to strike a balance between self-tolerance and external reactivity.
Ungeachtet dieser Regelmechanismen kommt es bei Autoimmunkrankheiten zu Störungen, die das Immunsystem gegen Selbst ausrichten. Dies kann z. B. dann geschehen, wenn zwischen einer Fremdstruktur, mit der das Immunsystem konfrontiert wird und körpereigenen Strukturen nur geringfügige Unterschiede bestehen. In diesem Grenzbereich, in dem sich aufgrund struktureller Merkmale die Bereiche Selbst und Fremd überschneiden, kann es zur Auslösung einer Immunantwort kommen. Es kommt dabei zur Vermehrung von T-Lymphozyten, die nicht nur die Fremdstruktur sondern auch die strukturell ähnliche körpereigene Struktur erkennen. Während unter normalen Umständen nach Eliminierung der Fremdstruktur die Immunreaktion erlischt, bleibt sie unter diesen Umständen erhalten, ständig genährt durch die Präsentation des körpereigenen Antigens.  Regardless of these regulatory mechanisms, autoimmune diseases lead to disorders that align the immune system with self. This can e.g. B. happen when there are only minor differences between a foreign structure with which the immune system is confronted and the body's own structures. An immune response can be triggered in this border area, where the areas self and foreign overlap due to structural features. This leads to an increase in T-lymphocytes, which recognize not only the foreign structure but also the structurally similar structure of the body. While, under normal circumstances, after the foreign structure has been eliminated, the immune reaction goes out, it remains under these circumstances, constantly nourished by the presentation of the body's antigen.
Strukturelle Homologien zwischen mikrobiellen Proteinen und Proteinen des Wirtsorganismus sind vermutlich nur in Ausnahmefällen zufällige Ereignisse. Einerseits können Strukturhomologien als Überreste eines gemeinsamen Protein- Vorfahren auftreten, wobei konservierte und damit homologe Aminosäuresequenzen essentielle Funktionen erfüllen. Andererseits ist die strukturelle Anpassung mikrobieller Antigene an Biomoleküle des Wirts ein häufiges Phänomen, das mit der Ko-Evolution von Mikroorganismen mit dem Immunsystem des Menschen erklärt werden kann. Durch solch ein "Molekulares Mimikry" können sich Mikroorganismen vermutlich vor dem Immunsystem schützen, indem mikrobielle Strukturen fälschlicherweise als Selbst erkannt werden. Kommt es dennoch zu einer Immunreaktion, kann dies aufgrund einer sich entwickelnden Kreuzreaktion zur Zerstörung körpereigenen Gewebes führen. Structural homologies between microbial proteins and proteins of the host organism are probably only random events in exceptional cases. On the one hand, structural homologies can occur as the remains of a common protein ancestor, with conserved and thus homologous amino acid sequences fulfilling essential functions. On the other hand, the structural adaptation of microbial antigens to biomolecules of the host is a common phenomenon that can be explained by the co-evolution of microorganisms with the human immune system. Through such a "molecular Mimicry ", microorganisms can probably protect themselves from the immune system by mistakenly recognizing microbial structures as self. If an immune reaction nevertheless occurs, this can lead to the destruction of the body's own tissue due to a developing cross-reaction.
Für derartige Autoimmunreaktionen gibt es bereits einige Beispiele. So bilden Streptokokken, ein extrazellulär sekretiertes M-Protein, das Homologien zu menschlichem Herzmuskelprotein aufweist. Streptokokkeninfektionen können deshalb indirekt durch Auslösung einer Autoimmunreaktion zur Schädigung des Herzens führen. Die durch Trypanosomen hervorgerufene Chagas-Krankheit führt ebenfalls zu einer Autoimmunerkrankung. Diese und weitere Beispiele sind u.a. in de Vries, Cohen und van Rood (Hrsg.), The role of microorganisms in non-infectious disease, Springer 1990, beschrieben.  There are already some examples of such autoimmune reactions. This is how streptococci form, an extracellularly secreted M protein that has homologies to human heart muscle protein. Streptococcal infections can therefore indirectly lead to damage to the heart by triggering an autoimmune reaction. Chagas disease caused by trypanosomes also leads to an autoimmune disease. These and other examples include in de Vries, Cohen and van Rood (ed.), The role of microorganisms in non-infectious disease, Springer 1990.
Ein im Tiermodell gut dokumentiertes Beispiel einer Autoimmunerkrankung, die durch ein kreuzreaktives bakterielles Antigen ausgelöst wird, ist die Adjuvansarthritis der Ratte. Die entscheidende Funktion spezifischer T-Zellen bei der Pathogenese konnte durch den Kotransfer der Arthritis mit einem T-Zellklon auf gesunde Tiere demonstriert werden. Der betreffende T-Zellklon zeigt Spezifität für ein Peptid aus dem 65 kDa Hitzeschockprotein (Hsp60) von Mykobakterien und erkennt gleichermaßen ein Peptid aus dem Linkprotein von Ratten. Interessanterweise ist das Linkprotein ein wesentlicher Proteoglykan-Bestandteil des Knorpelgewebes, einem Bindegewebe, das bei der Arthritis besonderen Schaden nimmt.  An adjuvant arthritis of the rat is a well documented example of an autoimmune disease that is triggered by a cross-reactive bacterial antigen. The crucial function of specific T cells in the pathogenesis could be demonstrated by cotransferring arthritis with a T cell clone to healthy animals. The T cell clone in question shows specificity for a peptide from the 65 kDa heat shock protein (Hsp60) of mycobacteria and likewise recognizes a peptide from the link protein of rats. Interestingly, the link protein is an essential proteoglycan component of cartilage tissue, a connective tissue that is particularly damaged in arthritis.
Entzündlich-rheumatische Erkrankungen treten in einer Vielzahl verschiedener Krankheitsbilder wie z. B. Rheumatoide Arthritis, Felty-Syndrom, Psoriatic Arthritis und Juvenile Arthritis (Williams in: Enzyclopedia of Immunology, Hrg. Roitt und Delves, 1992, pp. 1339-1343) in Erscheinung. Als potentielle Antigene für die Auslösung einer arthritogenen T-Zellantwort werden eine Reihe viraler und bakterieller Proteine in Betracht gezogen. Im Zusammen hang mit bakteriellen Infektionen, die u.a. durch Yersinien, Neisserien und Borrelien verursacht werden, treten häufig "reaktive Arthritiden" auf. Eine wichtige Rolle spielt hier möglicherweise das Hitzeschockprotein Hsp60, das sowohl unter den Bakterien als auch zwischen Bakterien und dem Menschen stark konserviert ist und dadurch autoreaktive Prozesse unterhalten kann. Inflammatory rheumatic diseases occur in a variety of different clinical pictures such as B. Rheumatoid Arthritis, Felty Syndrome, Psoriatic Arthritis and Juvenile Arthritis (Williams in: Enzyclopedia of Immunology, Ed. Roitt and Delves, 1992, pp. 1339-1343) in appearance. A number of viral and bacterial proteins are considered as potential antigens for triggering an arthritogenic T cell response. Together With bacterial infections caused by Yersinia, Neisserie and Borrelia, among other things, "reactive arthritis" often occurs. The heat shock protein Hsp60 may play an important role here. It is highly conserved both among bacteria and between bacteria and humans and can therefore maintain autoreactive processes.
Neben den mikrobiellen Auslösern spielt die individuelle genetische Prädisposition eine Rolle bei der Entwicklung von Autoimmunkrankheiten. Ein besonders deutlicher Zusammenhang besteht zwischen dem individuellen MHC-Haplotyp, d.h. der Bildung bestimmter MHC-Moleküle, und dem Auftreten bestimmter Autoimmunkrankheiten. Eine Übersicht über Assoziationen zwischen MHC-Haplotyp und Autoimmunkrankheiten ist beispielsweise in Jacob, McDevitt and Talal (Ed.), (1991) Molecular Autoimmunity, Academic Press Inc., San Diego und in Wordsworth et al., (1992) zu finden. Demnach sind rheumatoide Arthritis (RA) und verwandte Autoimmunkrankheiten besonders häufig mit den Haplotypen DR1, DR4Dw4, DR4Dw14 und DR4Dwl5 assoziiert.  In addition to the microbial triggers, the individual genetic predisposition plays a role in the development of autoimmune diseases. A particularly clear connection exists between the individual MHC haplotype, i.e. the formation of certain MHC molecules, and the appearance of certain autoimmune diseases. An overview of associations between MHC haplotype and autoimmune diseases can be found, for example, in Jacob, McDevitt and Talal (Ed.), (1991) Molecular Autoimmunity, Academic Press Inc., San Diego and in Wordsworth et al., (1992). Accordingly, rheumatoid arthritis (RA) and related autoimmune diseases are particularly often associated with the haplotypes DR1, DR4Dw4, DR4Dw14 and DR4Dwl5.
Autoimmunkrankheiten können auf unterschiedlichen Effektor-Mechanismen beruhen, die letztlich auf spezifische Wechselwirkungen zwischen Antigen-Peptiden und MHC zurückzuführen sind. Hierzu zählen gegen Selbst gerichtete Antikörper, gegen Selbst gerichtete CD4+ bzw. CD8+ T-Zellen und ein entzündungsforderndes Zytokinspektrum. Den T-Zellen kommt dabei eine Schlüsselrolle zu, da sie bei der Aktivierung vieler wichtiger Effektor-Mechanismen beteiligt sind. Entsprechend wichtig ist die Wechselwirkung von Peptidantigen mit MHC Klasse II-Molekülen, denn die Komplexbildung zwischen Antigen und MHC Klasse II-Molekül stellt die Voraussetzung für die Stimulation von CD4+ T-Zellen einer bestimmten Untergruppe dar. Bei der trimolekularen Wechselwirkung zwischen MHC Klasse II, Peptidantigen und T-Zellrezeptor werden daher die Weichen für die Entstehung und den Verlauf einer Autoimmunerkrankung gestellt. Die MHC-Moleküle bilden eine polymorphe Proteinfamilie und jedes Individuum besitzt ein spezifisches Spektrum von unterschiedlichen MHC-Molekülen. Hinsichtlich der Antigenbindungseigenschaften unterschiedlicher MHC-Moleküle können große Unterschiede bestehen. Über strukturelle Merkmale von Peptiden, die für die Bindung an MHC-Moleküle von Bedeutung sind, liegen umfassende wenn auch noch unvollständige Informationen vor (Rotzschke and Falk, 1994). Da die MHC-Moleküle das Spektrum an präsentationsfähigen Peptidantigenen definieren, liegt hierin die Ursache für die genetische Prädisposition einzelner Individuen für bestimmte Autoimmunkrankheiten. Denn Voraussetzung für eine spezifische T-Zellreaktion ist die Präsentation eines Peptidantigens durch ein MHC-Molekül. Autoimmune diseases can be based on different effector mechanisms, which are ultimately due to specific interactions between antigen peptides and MHC. These include self-directed antibodies, self-directed CD4 + or CD8 + T cells and an inflammatory spectrum of cytokines. The T cells play a key role here because they are involved in the activation of many important effector mechanisms. The interaction of peptide antigen with MHC class II molecules is correspondingly important, since the complex formation between antigen and MHC class II molecule is the prerequisite for the stimulation of CD4 + T cells of a specific subgroup. In the trimolecular interaction between MHC class II , Peptide antigen and T cell receptor are therefore setting the course for the development and course of an autoimmune disease. The MHC molecules form a polymorphic family of proteins and each individual has a specific spectrum of different MHC molecules. There can be great differences in the antigen binding properties of different MHC molecules. Comprehensive, if incomplete, information is available on structural features of peptides that are important for binding to MHC molecules (Rotzschke and Falk, 1994). Since the MHC molecules define the spectrum of peptide antigens that can be presented, this is the reason for the genetic predisposition of individual individuals for certain autoimmune diseases. The prerequisite for a specific T cell reaction is the presentation of a peptide antigen by an MHC molecule.
Allgemein wird davon ausgegangen, daß MHC-gebundene Peptide in einer vom MHC-Molekül gebildeten Grube in einer bestimmten Orientierung in bezug auf die N- und C-Termini der Peptide liegen. Die Bindungsgrube der Klasse II MHC-Moleküle ermöglicht, daß die Peptide an einem oder beiden Enden aus der Grube herausragen. Es wird angenommen, daß die Bindung der Peptide an MHC-Moleküle über bestimmte MHC-allelspezifische Ankerpositionen erfolgt bzw. verstärkt wird. Prinzipiell ist es daher auch möglich, daß Peptide in entgegengesetzter Orientierung im MHC-Molekül über entsprechende Ankerpositionen gebunden werden. Derartige inverse Peptide, in denen bei identischer Aminosäuresequenz N- und C-Termini vertauscht sind (z.B. N-LLEQKRAA-C gegenüber N-AARKQELL-C), weisen eine hohe strukturelle Ähnlichkeit mit ihrem Gegenstück auf.  It is generally assumed that MHC-bound peptides in a pit formed by the MHC molecule are in a certain orientation with respect to the N- and C-termini of the peptides. The class II MHC molecule binding pit allows the peptides to protrude from the pit at one or both ends. It is assumed that the binding of the peptides to MHC molecules takes place or is strengthened via certain MHC allele-specific anchor positions. In principle, it is therefore also possible for peptides to be bound in opposite directions in the MHC molecule via corresponding anchor positions. Such inverse peptides, in which the N- and C-termini are exchanged with an identical amino acid sequence (e.g. N-LLEQKRAA-C compared to N-AARKQELL-C), show a high structural similarity to their counterpart.
Nimmt man als auslösendes Agens für eine Autoimmunerkrankung einen mikrobiellen Erreger an, so setzt dies voraus, daß dieser Erreger entsprechend der Häufigkeit der Autoimmunerkrankung und der Häufigkeit der genetischen Prädisposition verbreitet ist. So sollte ein dem Auftreten der rheumatoiden Arthritis und dem prädisponierenden MHC (DR1 und DR4) entsprechender Durchseuchungsgrad dieses Erregers bzw. der auslösenden Komponente eines Erregers in der Bevölkerung vorherrschen. If a microbial pathogen is assumed to be the triggering agent for an autoimmune disease, this presupposes that this pathogen is widespread in accordance with the frequency of the autoimmune disease and the frequency of the genetic predisposition. For example, the degree of infection of this pathogen should correspond to the occurrence of rheumatoid arthritis and the predisposing MHC (DR1 and DR4) or the triggering component of a pathogen prevail in the population.
Beispielsweise besiedeln pathogene Neisserien die Schleimhäute des Menschen. Bei einem erheblichen Anteil der Bevölkerung gehören insbesondere Meningokokken zur permanenten Flora des Nasen-Rachenraumes, ohne merklich Symptome auszulösen. Auch Individuen, die nicht ständig von Meningokokken besiedelt werden, werden von Zeit zu Zeit in Form asymptomatischer lokaler Infektionen mit diesen Bakterien konfrontiert. Antigene dieser und anderer Spezies, die sich bezüglich ihrer Kolonisierung auf menschlichen Schleimhäuten ähnlich verhalten, stellen potentielle Auslöser von Autoimmunkrankheiten des Menschen dar.  For example, pathogenic Neisseries colonize human mucous membranes. In a significant proportion of the population, meningococci in particular are part of the permanent flora of the nasopharynx without causing any noticeable symptoms. Even individuals who are not constantly colonized by meningococci are confronted with these bacteria from time to time in the form of asymptomatic local infections. Antigens of these and other species, which behave similarly in terms of their colonization on human mucous membranes, are potential triggers of autoimmune diseases in humans.
Die Prophylaxe und Behandlung sowie die Diagnose von Autoimmunkrankheit, wie auch vieler viral induzierter Krankheiten hat sich in der Vergangenheit als besonders schwerwiegendes medizinisches Problem erwiesen; es sind wenige zeitlich erfolgversprechende Ansätze bekannt, die zur Lösung dieses Problems geeignet erscheinen.  The prophylaxis and treatment as well as the diagnosis of autoimmune disease, as well as many virally induced diseases, has proven to be a particularly serious medical problem in the past; There are only a few known promising approaches that seem suitable for solving this problem.
Aufgabe der vorliegenden Erfindung war somit, Arzneimittel zur Prophylaxe und Behandlung und Diagnostika zur Erkennung von Autoimmunkrankheiten oder der Prädisposition dazu und vielen Erkrankungen bereitzustellen.  The object of the present invention was therefore to provide pharmaceuticals for prophylaxis and treatment and diagnostic agents for the detection of autoimmune diseases or the predisposition to them and many diseases.
Diese Aufgabe wird durch die in den Ansprüchen gekennzeichneten Ausführungsformen gelöst.  This object is achieved by the embodiments characterized in the claims.
Somit betrifft die Erfindung ein Arzneimittel zur Prophylaxe oder Behandlung von Autoimmunkrankheiten und/oder viralen The invention thus relates to a medicament for the prophylaxis or treatment of autoimmune diseases and / or viral
Erkrankungen, dadurch gekennzeichnet, daß das ArzneimittelDiseases characterized in that the drug
Stoffe oder Zellen enthält, die mit der natürlichen Funktion von bakteriellen Polyproteinen (BPPs) oder Bestandteilen davon oder mit den sie produzierenden Bakterien interferieren. Contains substances or cells that interfere with the natural function of bacterial polyproteins (BPPs) or components thereof or with the bacteria producing them.
Unter viralen Erkrankungen werden erfindungsgemäß solche erkrankungen verstanden, die von Viren oder viralen Elementen induziert werden. In einer bevorzugten Ausführungsform betrifft die Erfindung ein Arzneimittel, das dadurch gekennzeichnet ist, daß das Interferieren eine Inhibierung ist. In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein Arzneimittel, das dadurch gekennzeichnet ist, daß die Stoffe oder Zellen umfassen: According to the invention, viral diseases are understood to mean those diseases which are induced by viruses or viral elements. In a preferred embodiment, the invention relates to a medicament which is characterized in that the interfering is an inhibition. In a further preferred embodiment, the invention relates to a medicament which is characterized in that the substances or cells comprise:
(a) bakterielle Polyproteine (BPPs) oder Bestandteile davon; (a) bacterial polyproteins (BPPs) or components thereof;
(b) immunkompetente Zellen oder immunologisch aktive Moleküle, die spezifisch sind für die BPPs oder die(b) immunocompetent cells or immunologically active molecules that are specific for the BPPs or the
Beständteile davon, für entsprechende homologe Peptide menschlicher Proteine, durch Wirkung der BPPs gebildete autoreaktive Peptide, durch die Wirkung der BPPs aktivierte, von Viren bzw. endogenen Viren codierte Peptide oder zu derartigen viralen Peptiden homologe menschliche Peptide; Constituents thereof, for corresponding homologous peptides of human proteins, autoreactive peptides formed by the action of the BPPs, peptides activated by the action of the BPPs, encoded by viruses or endogenous viruses, or human peptides homologous to such viral peptides;
(c) nicht-pathogene oder nicht-pathogen gemachte Bakterien oder Bestandteile davon,  (c) non-pathogenic or non-pathogenic bacteria or components thereof,
(d) Infektionshemmer;  (d) anti-infectious agents;
(e) Stoffe, die die biologische Aktivität von BPPs inhibieren;  (e) substances that inhibit the biological activity of BPPs;
(f) Peptide oder Peptidanaloga, die Peptide aus MHC-Molekülen aufgrund einer hohen Bindungsaffinität verdrängen, deren Präsentation zu einer Autoimmunkrankheit führt.  (f) Peptides or peptide analogs that displace peptides from MHC molecules due to their high binding affinity, the presentation of which leads to an autoimmune disease.
(g) Stoffe, die die BPP- oder BPP-Bestandteil- induzierende Virusaktivierung inhibieren; oder  (g) substances that inhibit virus activation that induces BPP or BPP constituents; or
(h) Stoffe, die die Virus-bedingten Autoimmunreaktionen inhibieren, wobei diese Reaktionen durch BPPs oder deren Bestandteile induziert werden.  (h) substances which inhibit the virus-related autoimmune reactions, these reactions being induced by BPPs or their components.
In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein Arzneimittel, das dadurch gekennzeichnet ist, daß die Prophylaxe eine Immunisierung umfaßt. In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein Arzneimittel, das dadurch gekennzeichnet ist, daß die Immunisierung eine aktive Immunisierung ist. In a further preferred embodiment, the invention relates to a medicament which is characterized in that the prophylaxis comprises an immunization. In a further preferred embodiment, the invention relates to a medicament which is characterized in that the immunization is an active immunization.
In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein Arzneimittel, das dadurch gekennzeichnet ist, daß die Immunisierung eine passive Immunisierung ist. In a further preferred embodiment, the invention relates to a medicament which is characterized in that the immunization is a passive immunization.
In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein Arzneimittel, das dadurch gekennzeichnet ist, daß die Autoimmunkrankheit rheumatoide Arthritis ist. In a further preferred embodiment, the invention relates to a medicament which is characterized in that the autoimmune disease is rheumatoid arthritis.
In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein Arzneimittel, das dadurch gekennzeichnet ist, daß die die BPP produzierenden Bakterien zur Gattung Neisseria gehören. In a further preferred embodiment, the invention relates to a medicament which is characterized in that the bacteria producing the BPP belong to the genus Neisseria.
In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein Arzneimittel, das dadurch gekennzeichnet ist, daß die virale Erkrankung durch HIV induziert wurde. In a further preferred embodiment, the invention relates to a medicament which is characterized in that the viral disease has been induced by HIV.
In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein Arzneimittel, das dadurch gekennzeichnet ist, daß die durch HIV induzierte Krankheit AIDS ist. In a further preferred embodiment, the invention relates to a medicament which is characterized in that the HIV-induced disease is AIDS.
In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein Arzneimittel, wobei zur Immunisierung kapselspezifische Impfstoffe gegen Meningokokken-Infektionen verwendet werden. In a further preferred embodiment, the invention relates to a medicament, wherein capsule-specific vaccines against meningococcal infections are used for the immunization.
In einer weiteren bevorzugten Ausführungsform betrifft dieIn a further preferred embodiment, the
Erfindung ein Arzneimittel, wobei die Impfstoffe auf derInvention a drug, the vaccines on the
Basis der Proteine der äußeren Membran von Bakterien der Gattung Neisseria hergestellt werden. Basis of the proteins of the outer membrane are produced by bacteria of the genus Neisseria.
In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein Arzneimittel, wobei das Protein ein Porin ist. In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein Arzneimittel, wobei die Impfstoffe auf der Basis der Adhesine der Neisserien hergestellt werden. In a further preferred embodiment, the invention relates to a medicament, the protein being a porin. In a further preferred embodiment, the invention relates to a medicament, the vaccines being produced on the basis of the Neisseries adhesins.
In einer weiteren bevorzugten Ausführungsform betrifft dieIn a further preferred embodiment, the
Erfindung ein Arzneimittel, wobei das Adhesin ein PilC-Invention a drug, the adhesive being a PilC
Protein ist. In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein Arzneimittel, wobei die passive Immunisierung mit spezifischen Antikörpern oder T-Zellen erfolgt, die gegen Membrankomponenten oder Adhesinen von BPP- produzierenden Bakterien, vorzugsweise Neisserien gerichtet sind. Is protein. In a further preferred embodiment, the invention relates to a medicament, wherein the passive immunization takes place with specific antibodies or T cells which are directed against membrane components or adhesins of BPP-producing bacteria, preferably Neisseries.
In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein Arzneimittel, wobei als Infektionshemmer Antibiotika oder Rezeptoranaloga zu Rezeptoren menschlicher Zellen, an die pathogene Bakterien binden können oder Liganden, die spezifisch für die Rezeptoren einer Bakterienoberfläche sind, kompetitive Peptide, oder nichtpathogene oder attenuierte Neisserien sind. In a further preferred embodiment, the invention relates to a medicament, antibiotics or receptor analogs to receptors of human cells to which pathogenic bacteria can bind or ligands which are specific for the receptors of a bacterial surface are competitive peptides or nonpathogenic or attenuated Neisseries as infection inhibitors.
In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein Arzneimittel, wobei das kompetitive Peptid PilC ist. In a further preferred embodiment, the invention relates to a medicament, the competitive peptide being PilC.
In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein Arzneimittel, wobei das BPP IPP ist. In a further preferred embodiment, the invention relates to a medicament, the BPP being IPP.
In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein. Arzneimittel, wobei die IGA-Proteaseaktivität des IPP spezifisch gehemmt wird. In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein Arzneimittel, wobei die Aspartylproteaseaktivität der β-Domäne des IPP spezifisch gehemmt wird. In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein Arzneimittel, wobei die Aufnahme des α-Peptids in menschliche Zellen oder deren Nukleus gehemmt wird. In a further preferred embodiment, the invention relates to a. Medicinal product, in which the IGA protease activity of the IPP is specifically inhibited. In a further preferred embodiment, the invention relates to a medicament, the aspartyl protease activity of the β-domain of the IPP being specifically inhibited. In a further preferred embodiment, the invention relates to a medicament, the uptake of the α-peptide in human cells or their nucleus being inhibited.
In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein Arzneimittel, wobei die Folgen der Infektion durch BPP-bildende Bakterien durch Immunreaktion gegen BPP- bildende, insbesondere IPP bildende Zellen, BPP, insbesondere IPP oder deren Spaltprodukte inhibiert werden. In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein Arzneimittel, wobei IPP-spezifische Peptidepräsentierende Zellen von T-Zellen eliminiert werden. In a further preferred embodiment, the invention relates to a medicament, the consequences of the infection by BPP-forming bacteria being inhibited by an immune reaction against BPP-forming, in particular IPP-forming cells, BPP, in particular IPP or their cleavage products. In a further preferred embodiment, the invention relates to a medicament, cells representing IPP-specific peptides being eliminated by T cells.
In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein Arzneimittel, wobei IPP-spezifische Peptidepräsentierende Zellen von monoclonalen Antikörpern eliminiert werden. In a further preferred embodiment, the invention relates to a medicament, cells representing IPP-specific peptides being eliminated by monoclonal antibodies.
In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein Arzneimittel, wobei antigenspezifische suppressive T-Zellen verwendet werden. In a further preferred embodiment, the invention relates to a pharmaceutical, antigen-specific suppressive T cells being used.
In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein Arzneimittel, wobei anti-T-Zell-Rezeptorantikörper zum Ausschalten von T-Zellen verwendet werden, die eine Spezifität für die in Anspruch 3b genannten BPPs oder die Bestandteile davon, entsprechende homologe Peptide menschlicher Proteine, durch Wirkung der BPP-Genprodukte gebildete autoreaktive Peptide, durch Wirkung der BPP- Genprodukte induzierte, von Viren bzw. endogenen Viren codierte Peptide oder zu derartigen viralen Peptiden homologe menschliche Peptide aufweisen. Weiterhin betrifft die Erfindung eine diagnostische Zusammensetzung für den Nachweis des ätiologischen Agens von Autoimmunkrankheiten und/oder viralen Erkrankungen und/oder für den Nachweis der Kontrolle der Wirkung von Arzneimittel enthaltend In a further preferred embodiment, the invention relates to a medicament, wherein anti-T cell receptor antibodies are used to switch off T cells which have a specificity for the BPPs mentioned in claim 3b or the components thereof, corresponding homologous peptides of human proteins The effect of the auto-reactive peptides formed by the BPP gene products, peptides induced by the action of the BPP gene products, encoded by viruses or endogenous viruses, or human peptides homologous to such viral peptides. The invention further relates to a diagnostic composition for the detection of the etiological agent of autoimmune diseases and / or viral diseases and / or for the detection of the control of the action of medicaments containing
(a) Oligonucleotide bzw. Primer, die für BPP codierende Gene spezifisch sind,  (a) oligonucleotides or primers which are specific for genes coding for BPP,
(b) Antikörper, die spezifisch für BPPs oder Bestandteile davon oder BPP bildende Bakterien sind;  (b) antibodies specific for BPPs or constituents thereof or BPP-forming bacteria;
(c) Substrate, die zum Nachweis der biologischen Aktivität der BPPs eingesetzt werden können; und/oder  (c) substrates that can be used to demonstrate the biological activity of the BPPs; and or
(d) Antigene, die von Antikörpern gemäß Merkmal (b) gebunden werden.  (d) Antigens that are bound by antibodies according to feature (b).
Weiterhin betrifft die Erfindung eine diagnostische Zusammensetzung für den Nachweis und die Überwachung des Verlaufs von BPP-induzierten Autoimmunkrankheiten und/oder viralen Erkrankungen und/oder für den Nachweis der Kontrolle der Wirkung von Arzneimitteln, enthaltend The invention further relates to a diagnostic composition for the detection and monitoring of the course of BPP-induced autoimmune diseases and / or viral diseases and / or for the detection of the control of the action of medicaments containing
(a) Peptide, die autoreaktive immunkompetente Zellen spezifisch stimulieren,  (a) peptides that specifically stimulate autoreactive immunocompetent cells,
(b) Antikörper, die spezifisch sind für BPP-induzierte virale Antigene oder Viren;  (b) antibodies specific for BPP-induced viral antigens or viruses;
(c) Oligonucleotide bzw. Primer, die für BPP codierende Gene spezifisch sind;  (c) oligonucleotides or primers which are specific for genes coding for BPP;
(d) Antikörper, die für BPP-bildende Bakterien oder deren Antigene spezifisch sind;  (d) antibodies specific for BPP-forming bacteria or their antigens;
(e) Antigene, die von Antikörpern gemäß (b) oder (d) spezifisch gebunden werden; und/oder  (e) antigens which are specifically bound by antibodies according to (b) or (d); and or
(f) Substrate, die von viralen Genprodukten umgesetzt werden, wobei die viralen Genprodukte von BPPs induziert worden sind.  (f) substrates which are converted by viral gene products, the viral gene products being induced by BPPs.
Die Erfindung betrifft ferner ein Peptid, das im Spaltprodukt eines IPP von Neisseria meningitidis ist und eine der in Figur 1 dargestellte Aminosäuresequenz aufweist. Die Erfindung betrifft ferner ein Peptid, das ein Spaltprodukt eines BPP, vorzugsweise eines IPP oder ein Fragment davon ist oder ein menschliches Homologes dazu ist, wobei das BPP, vorzugsweise das IPP oder das Fragment oder das menschliche Homologe erhältlich ist durch Computergestützten Vergleich von BPP-, vorzugsweise IPP-Sequenzen mit Proteindatenbanken oder translatierten Nucleinsäuredatenbanken von menschlichen Sequenzen oder umgekehrt und wobei mindestens 6 Aminosäuren in einem Abschnitt von 10 Aminosäuren zwischen den Vergleichssequenzen identisch sind. The invention further relates to a peptide which is in the cleavage product of an IPP from Neisseria meningitidis and has an amino acid sequence shown in FIG. 1. The invention further relates to a peptide which is a cleavage product of a BPP, preferably an IPP or a fragment thereof or a human homologue thereof, the BPP, preferably the IPP or the fragment or the human homologue being obtainable by computer-aided comparison of BPP- , preferably IPP sequences with protein databases or translated nucleic acid databases from human sequences or vice versa and wherein at least 6 amino acids in a section of 10 amino acids are identical between the comparison sequences.
In einer bevorzugten Ausführungsform weist das erfindungsgemäße Peptid eine in Tabelle VII, Fig. 2, Fig. 3 oder Fig. 8 dargestellte Aminosäuresequenz auf. In a preferred embodiment, the peptide according to the invention has an amino acid sequence shown in Table VII, FIG. 2, FIG. 3 or FIG. 8.
Die Erfindung betrifft ferner ein menschliches Peptid, das durch Einwirkung eines BPP, vorzugsweise eines IPP oder eines Spaltproduktes davon entsteht, ausgenommen die IgA1- Spaltprodukte. The invention further relates to a human peptide which is formed by the action of a BPP, preferably an IPP or a cleavage product thereof, with the exception of the IgA 1 cleavage products.
Ferner betrifft die Erfindung ein virales Peptid, das durch Einwirkung eines BPP, vorzugsweise eines IPP oder eines Spaltproduktes davon entsteht. The invention further relates to a viral peptide which is produced by the action of a BPP, preferably an IPP or a cleavage product thereof.
Weiterhin betrifft die Erfindung ein Peptid, das ein virales Peptid, das durch die Einwirkung eines BPP entstanden ist, oder ein menschliches Homologes dazu ist, wobei die virale Peptidsequenz durch Computer-gestützten Vergleich mit Proteindatenbanken oder translatierten Nucleinsäuredatenbanken von menschlichen Sequenzen oder umgekehrt erhältlich ist und wobei mindestens 6 Aminosäure in einem Abschnitt von 10 Aminosäuren zwischen den Vergleichssequenzen identisch sind. In einer bevorzugten Ausführungsform betrifft die Erfindung ein Peptid, das ein von einem Antikörper erkanntes Epitop darstellt. In einer weiteren bevorzugten Ausführungsform betrifft die Erfindung ein Peptid, das nach MHC-Präsentation von einer T- Zelle erkannt wird. The invention further relates to a peptide which is a viral peptide which has arisen from the action of a BPP or a human homologue thereto, the viral peptide sequence being obtainable by computer-aided comparison with protein databases or translated nucleic acid databases from human sequences or vice versa and wherein at least 6 amino acids in a section of 10 amino acids are identical between the comparison sequences. In a preferred embodiment, the invention relates to a peptide which is an epitope recognized by an antibody. In a further preferred embodiment, the invention relates to a peptide which is recognized by a T cell after MHC presentation.
Die Erfindung betrifft ferner ein Verfahren zur Hemmung oder Aktivierung der Transkription viral codierter Polypeptide, dadurch gekennzeichnet, daß man Stoffe, vorzugsweise Biomoleküle, vorzugsweise Proteine, DNA, RNA oder Anti- Sense-RNA oder synthetisch hergestellte Moleküle, vorzugsweise therapeutisch wirksame Moleküle, in eukaryontische, vorzugsweise menschliche Zellen oder deren Zellkern unter Verwendung eines IgA-α-Proteins einschleust. The invention further relates to a method for inhibiting or activating the transcription of virally coded polypeptides, characterized in that substances, preferably biomolecules, preferably proteins, DNA, RNA or anti-sense RNA or synthetically produced molecules, preferably therapeutically active molecules, in eukaryotic , preferably introduces human cells or their cell nucleus using an IgA-α protein.
Ferner betrifft die Erfindung ein in vitro-Verfahren zur Clonierung und Vermehrung von menschlichen T-Zellen, deren T-Zellrezeptor MHC-präsentierte IPP-Fragmente spezifisch erkennt, wobei man die T-Zellen in Gegenwart von BPPs oder Bestandteilen davon, entsprechenden homologen Peptiden menschlicher Proteine, durch Wirkung eines BPPs gebildeten autoreaktiven Peptiden, durch die Wirkung eines BPPs aktivierten, von Viren bzw. endogenen Viren codierten Peptiden oder zu derartigen viralen Peptiden homologen menschlichen Peptiden unter üblichen Bedingungen stimuliert. The invention further relates to an in vitro method for cloning and multiplying human T cells, the T cell receptor of which specifically recognizes MHC-presented IPP fragments, the T cells being more human homologous peptides in the presence of BPPs or constituents thereof Proteins, stimulated by the action of a BPPs autoreactive peptides, by the action of a BPPs activated peptides encoded by viruses or endogenous viruses or human peptides homologous to such viral peptides are stimulated under normal conditions.
Die Erfindung betrifft ferner ein in vitro-Verfahren zur Clonierung und Vermehrung immunsuppressiver T-Zellen, die T- Zellen supprimieren, welche in MHC-präsentierte abgeleitete Fragmente spezifisch erkennen, wobei man die T-Zellen in Gegenwart von BPPs oder Bestandteilen davon, entsprechenden homologen Peptiden menschlicher Proteine, durch Wirkung eines BPPs gebildeten autoreaktiven Peptiden, durch die Wirkung eines BPPs aktivierten, von Viren bzw. endogenen Viren codierten Peptiden oder zu derartigen viralen Peptiden homologen menschlichen Peptiden unter üblichen Bedingungen stimuliert. The invention further relates to an in vitro method for cloning and multiplying immunosuppressive T cells which suppress T cells which specifically recognize derived fragments presented in MHC, the T cells being homologous in the presence of BPPs or constituents thereof Peptides of human proteins, autoreactive peptides formed by the action of a BPP, peptides activated by the action of a BPP, encoded by viruses or endogenous viruses, or to such viral peptides stimulated homologous human peptides under usual conditions.
Ferner betrifft die Erfindung ein Verfahren zur Diagnose einer Autoimmunkrankheit oder einer Prädisposition dazu, vorzugsweise von rheumatoider Arthritis, dadurch gekennzeichnet, daß man in einem T-Zell-Proliferationstest ein IPP, ein Spaltprodukt eines IPPs oder ein Fragment davon oder ein menschliches Homologes dazu auf Proliferation von reaktiven T-Zellen testet. The invention further relates to a method for diagnosing an autoimmune disease or a predisposition therefor, preferably rheumatoid arthritis, characterized in that in a T cell proliferation test an IPP, a cleavage product of an IPP or a fragment thereof or a human homologue thereof for proliferation tested by reactive T cells.
In einer bevorzugten Ausführungsform betrifft die Erfindung ein Verfahren, das dadurch gekennzeichnet ist, daß das Spaltprodukt oder Fragment davon, oder das menschliche Homologe dazu die in Tabelle VII dargestellte Aminosäuresequenz aufweist. In a preferred embodiment, the invention relates to a method which is characterized in that the cleavage product or fragment thereof, or the human homologue thereof, has the amino acid sequence shown in Table VII.
Ferner betrifft die Erfindung ein Verfahren zum Nachweis von BPPs oder der sie bildenden Bakterien, dadurch gekennzeichnet, daß man eine Polymerasekettenreaktion (PCR) mit für BPP-Gene spezifischen Primern durchführt, und das PCR- Produkt durch DNA-Sequenzanalyse oder andere übliche Verfahren wie Gelelektrophorese auf BPP-spezifische Sequenzen untersucht. The invention further relates to a method for the detection of BPPs or the bacteria forming them, characterized in that one carries out a polymerase chain reaction (PCR) with primers specific for BPP genes, and the PCR product by DNA sequence analysis or other conventional methods such as gel electrophoresis examined for BPP-specific sequences.
Schließlich betrifft die Erfindung ein Verfahren zum Nachweis der BPP-abhängigen Aktivierung von Viren oder viralen Elementen, dadurch gekennzeichnet, daß man eine PCR mit für die viralen Gene spezifischen Primern durchführt, und das PCR-Produkt durch DNA-Sequenzanalyse oder andere übliche Verfahren, wie Gelelektrophorese auf BPP-spezifische Sequenzen untersucht oder die Aktivität der viralen reversen Transkriptase oder anderer viraler Enzyme mißt. Finally, the invention relates to a method for the detection of the BPP-dependent activation of viruses or viral elements, characterized in that one carries out a PCR with primers specific for the viral genes, and the PCR product by DNA sequence analysis or other conventional methods such as Gel electrophoresis is examined for BPP-specific sequences or the activity of the viral reverse transcriptase or other viral enzymes is measured.
Bakterielle Exoproteine stellen in einem besonderen Maße Angriffspunkte für die Immunantwort dar. Eine wichtige Gruppe von Exoproteinen, die sowohl von gramnegativen wie von grampositiven Bakterien gebildet werden, sind die IgA- Proteasen, die entsprechend ihrer Eigenschaft, menschliches Immunglobulin AI (IgAl) an spezifischer Stelle zu spalten, benannt sind. Entsprechend ihrer Aminosäuresequenzen können die IgA-Proteasen in Untergruppen gegliedert werden. Eine solche Untergruppe bilden die IgA-Proteasen von pathogenen Neisserien und bestimmter Haemophilus-Spezies. Die bisher bekannten IgA-Proteasen von Neisserien und Haemophilus unterscheiden sich wiederum in bestimmten Bereichen, während sie in anderen Bereichen homolog sind. Die IgA-Proteasen der pathogenen Neisserien bilden eine strukturell polymorphe Enzymfamilie, wobei üblicherweise jeder pathogene Neisserien-Stamm ein bestimmtes variantes Enzym produziert. Von den Neisserien geben vor allem Meningokokken dieses als Virulenzfaktor eingestufte Enzym in erheblichen Mengen in ihre Umgebung ab. IgA-Proteasen liegen extrazellulär vor und entwickeln sich aus einem Vorläuferpolyprotein (IPP). In dem Vorläuferpolyprotein (IPP) der IgA-Proteasen von Neisserien befinden sich weitere Proteindomänen, die zusammen mit dem Enzym sekretiert werden. Ein IPP setzt sich neben dem Signalpeptid für den Transport über die innere Bakterienmembran aus folgenden separablen Komponenten zusammen, nämlich einer IgA-Protease-Domäne, einem 7-Peptid, einem α-Protein und einer ß-Domäne (Pohlner et al., 1987). Bacterial exoproteins represent a particular target for the immune response. An important group of exoproteins that are both Gram-negative and are formed by gram-positive bacteria, the IgA proteases, which are named according to their ability to cleave human immunoglobulin AI (IgAl) at a specific location. The IgA proteases can be divided into subgroups according to their amino acid sequences. The IgA proteases of pathogenic Neisseries and certain Haemophilus species form such a subgroup. The previously known IgA proteases from Neisseries and Haemophilus differ in certain areas, while they are homologous in other areas. The IgA proteases of the pathogenic Neisseries form a structurally polymorphic family of enzymes, with each pathogenic Neisseries strain usually producing a certain variant enzyme. Of the Neisseries, meningococci in particular release this enzyme, which is classified as a virulence factor, into their environment in considerable quantities. IgA proteases are extracellular and develop from a precursor polyprotein (IPP). There are further protein domains in the precursor polyprotein (IPP) of the IgA proteases from Neisseries, which are secreted together with the enzyme. In addition to the signal peptide for transport across the inner bacterial membrane, an IPP is composed of the following separable components, namely an IgA protease domain, a 7-peptide, an α-protein and a β-domain (Pohlner et al., 1987) .
Dieser Erfindung liegt der Nachweis des sehr ausgeprägten molekularen Mimikry der Iga-Proteine (d.h. alller Proteine des Vorläuferpolyproteins (IPP)) von Neisserien in bezug auf menschliche Proteine zugrunde. Diese molekulare Mimikry wird unter anderem durch weitere Sequenzbeispiele von Neisserien Iga-Proteinen belegt, die durch DNA-Sequenzanalyse von iga-Genen erhalten wurden (Beispiel 1). Computerunterstützte Vergleiche dieser abgeleiteten Aminosäuresequenzen von Iga-Proteinen mit bekannten menschlichen Proteinsequenzen ergaben zahlreiche erfindungsgemäße Sequenzhomologien mit menschlichen Proteinen, die exemplarisch dargestellt sind (Beispiel 2). So enthalten die Igaγ- und Igaα- Bereiche von Iga-Proteinen erhebliche Sequenzhomologien mit Proteinbestandteilen des menschlichen Proteoglykans wie z.B. dem Linkprotein oder dem Proteoglykankernprotein (Aggrekan) bzw. zu anderen omnipräsenten menschlichen Proteinen wie Myosin und Caldesmon. Interessanterweise wird im Beispiel 2 gezeigt, daß die inverse Primärsequenz von Iga vielfach umfassendere Homologien zu menschlichen Proteinen aufweist. Da - wie oben ausgeführt - Peptide prinzpiell auch invers an MHC-Klasse II-Moleküle binden können und in dieser Orientierung ähnliche Strukturen wie die entsprechenden normalen Peptide aufweisen, sind auch diese invers-homologen Peptidesequenzen der Iga-Proteine für antigenes Mimikry von Bedeutung und somit Gegenstand dieser Erfindung. Durch die fortgesetzte Präsentation von einem oder mehreren Peptiden des Iga-Proteins auf MHC-Molekülen werden daher autoreaktive Prozesse induziert, die sich gegen Molekülstrukturen des Menschen (z.B. Knorpelgewebe) richten. This invention is based on the detection of the very pronounced molecular mimicry of the Iga proteins (ie all proteins of the precursor polyprotein (IPP)) of Neisseries in relation to human proteins. This molecular mimicry is demonstrated, among other things, by further sequence examples of Neisserie Iga proteins, which were obtained by DNA sequence analysis of iga genes (Example 1). Computer-aided comparisons of these derived amino acid sequences of Iga proteins with known human protein sequences gave numerous sequence homologies according to the invention with human proteins, which are shown as examples (example 2). The Iga γ and Iga α regions of Iga proteins contain considerable sequence homologies Protein components of the human proteoglycan, such as the link protein or the proteoglycan core protein (Aggrekan) or to other omnipresent human proteins such as myosin and caldesmon. Interestingly, it is shown in Example 2 that the inverse primary sequence of Iga has much more extensive homologies to human proteins. Since - as explained above - peptides can also bind inversely to MHC class II molecules and in this orientation have similar structures to the corresponding normal peptides, these inverse homologous peptide sequences of the Iga proteins are also important for antigenic mimicry and thus Subject of this invention. The continued presentation of one or more peptides of the Iga protein on MHC molecules therefore induces autoreactive processes which are directed against molecular structures in humans (eg cartilage tissue).
Ein weiteres erfindungsgemäßes Merkmal des IPP ist seine Eigenschaft, in menschliche Zellen von außen her einzudringen und in bestimmten Fällen bis in den Nukleus vorzudringen. Diese Eigenschaft wird besonders eindrucksvoll durch die Aufnahme eines extrazellulären α-Proteins von Neisserien belegt, das in den Nukleus bestimmter menschlicher Zellen eindringt (Beispiel 7). Aus der Struktur des IPP wird abgeleitet, daß nicht nur das α-Protein in menschliche Zellen gelangt, sondern auch die anderen Komponenten des IPP bzw. intaktes IPP. Die einzelnen Komponenten des IPP können während ihres Transports zum Nukleus in unterschiedlichen Zeilkompartimenten teilweise oder ganz abgespalten werden, wo sie gegenüber ihren Zielzellen wirksam werden.  Another feature of the IPP according to the invention is its ability to penetrate human cells from the outside and, in certain cases, to penetrate into the nucleus. This property is demonstrated particularly impressively by the inclusion of an extracellular α protein from Neisseries which penetrates into the nucleus of certain human cells (example 7). It is deduced from the structure of the IPP that not only does the α-protein get into human cells, but also the other components of the IPP or intact IPP. The individual components of the IPP can be partially or completely split off during their transport to the nucleus in different cell compartments, where they become effective against their target cells.
Intrazelluläre Neisserien, die von menschlichen Zielzellen internalisiert wurden, synthetisieren ebenfalls IPP. Entsprechend kann auch intrazellulär gebildetes IPP aufgrund seiner Transporteigenschaften in verschiedene Zellkomparti- mente eindringen und sich auch entsprechend dem von außen eindringenden IPP in einzelne Komponenten aufspalten. Zusammen mit den internalisierten Neisserien gelangt auch die oberflächenexponierte β-Domäne in die Zielzellen hinein. Eine bekannte Eigenschaft der IgA-Protease bzw. der im IPP enthaltenen IgA-Protease-Domäne ist die sequenzspezifische Spaltung von Proteinen, die eine entsprechende für die Spaltung benötigte Sequenz tragen (Pohlner et al., 1992). Eine bevorzugte Spaltsequenzen von Neisserien IgA-Proteasen sind N-Pro-Pro-!-Thr/Ser-Pro-C, wobei ! die Spaltstelle bezeichnet. Daraus resultierend trägt das C-terminale Spaltfragment an zweiter Position seines Aminoterminus die Aminosäure Pro. Ein bekanntes natürliches Substrat der IgA-Protease ist menschliches IgA-1. Intracellular Neisseries internalized by human target cells also synthesize IPP. Correspondingly, due to its transport properties, intracellularly formed IPP can also penetrate into different cell compartments and also split into individual components in accordance with the IPP that penetrates from the outside. Together with the internalized Neisseries, the surface-exposed β-domain also reaches the target cells. A known property of the IgA protease or the IgA protease domain contained in the IPP is the sequence-specific cleavage of proteins which carry a corresponding sequence required for the cleavage (Pohlner et al., 1992). A preferred cleavage sequence of Neisserie IgA proteases are N-Pro-Pro -! - Thr / Ser-Pro-C, where! designated the fission point. As a result, the C-terminal cleavage fragment bears the amino acid Pro at the second position of its amino terminus. A known natural substrate of the IgA protease is human IgA-1.
Aufgrund der Eigenschaft des IPP, in menschliche Zellen einzudringen ommt es dort zur Spaltung menschlicher Proteine. Erfindungsgemäß wird hier auf diese Existenz weiterer natürlicher Substrate der neisserialen IgA-Proteasen erfindungsgemäß hingewiesen (Beispiel 9). Der Sequenzvergleich bereits bekannter Spaltsequenzen der IgA-Protease mit bekannten Aminosäuresequenzen menschlicher Proteine in Datenbanken ergibt Aufschluß über eine Vielzahl von intrazellulären bzw. zeilassoziierten menschlichen Proteinen, die ein Substrat für IgA-Protease darstellen.  Due to the property of IPP to penetrate human cells, human proteins are split there. According to the invention, this existence of further natural substrates of the neisserial IgA proteases is pointed out according to the invention (Example 9). The sequence comparison of already known cleavage sequences of the IgA protease with known amino acid sequences of human proteins in databases provides information about a large number of intracellular or cell-associated human proteins which represent a substrate for IgA protease.
Eine erfindungsgemäße Folge der Spaltaktivität der IgA- Protease sind Funktionsänderungen in den betroffenen Zellen. Aufgrund der zahlreichen Substrate und ihrer vielfältigen immunologischen Funktionen wird eine immunologische Fehlsteuerung der von IgA-Protease betroffenen Zellen angenommen. Es ist weiterhin anzunehmen, daß sich diese immunologische Fehlsteuerung negativ auf das Gleichgewicht des Immunsystems in bezug auf seine Fähigkeit, zwischen Fremd und Selbst zu unterscheiden, auswirken kann. Die IgA-Protease- Aktivität begünstigt daher die Entstehung von Autoimmunkrankheiten. Ein Beispiel für eine Wirkung der IgA-Protease- Aktivität auf eukaryote Zellen ist nachfolgend dargestellt (siehe Beispiel 20).  A consequence of the cleavage activity of the IgA protease according to the invention are changes in function in the affected cells. Due to the numerous substrates and their diverse immunological functions, an immunological malfunction of the cells affected by IgA protease is assumed. It is also believed that this immunological misregistration can adversely affect the immune system's balance with respect to its ability to distinguish between foreign and self. The IgA protease activity therefore favors the development of autoimmune diseases. An example of an effect of the IgA protease activity on eukaryotic cells is shown below (see Example 20).
Eine weitere Folge der Spaltung menschlicher Proteine durch IgA-Protease ist erfindungsgemäß die Bildung neuer Selbst-Peptide (Beispiel 10). Interessanterweise entsprechen C-terminale Produkte, die durch Spaltung mit IgA-Protease entstanden sind, einer bevorzugten Aminosäuresequenz, die bei Klasse I und Klasse II-präsentierten Peptiden vorgefunden wird, die wie die Spaltprodukte der IgA-Protease an ihrer 2. Position die Aminosäure Pro tragen (Falk and Rotzschke, 1994; Engelhard, 1994). IgA-Proteasen sind daher besonders geeignet, Peptide für die Präsentation in MHC-Molekülen zu erzeugen, und begünstigen daher die Entstehung neuer Peptide und deren Präsentation gegenüber dem Immunsystem. Derartige Peptide können so aus menschlichen Proteinen hervorgehen, die in Abwesenheit von IgA-Protease nicht erzeugt werden. Solche neuen Selbst-Peptide werden von dem Immunsystem als Fremd erkannt, da sie zuvor nicht aufgetreten sind. Dadurch wird eine Immunreaktion gegen Selbst in Gang gesetzt. Another consequence of the cleavage of human proteins by IgA protease is, according to the invention, the formation of new self-peptides (example 10). Interestingly, C-terminal products correspond by cleavage with IgA protease have arisen, a preferred amino acid sequence which is found in class I and class II-presented peptides which, like the cleavage products of the IgA protease, carry the amino acid Pro in their 2nd position (Falk and Rotzschke, 1994; Engelhard, 1994). IgA proteases are therefore particularly suitable for generating peptides for presentation in MHC molecules and therefore favor the formation of new peptides and their presentation to the immune system. Such peptides can thus arise from human proteins which are not produced in the absence of IgA protease. Such new self-peptides are recognized as foreign by the immune system because they have not previously occurred. This triggers an immune response against self.
Interessanterweise ist die Freisetzung des γ-Peptids aus dem Iga-Protein ebenfalls ein Ergebnis der Spaltaktivität der IgA-Protease, wodurch die antigenprozessierende Aktivität der IgA-Protease unmittelbar belegt wird. Eine erfindungsgemäße Eigenschaft des γ-Peptids ist es, durch Klasse II MHC-Moleküle präsentiert zu werden (Beispiel 5). Insbesondere besitzt das γ-Peptid die Eigenschaft, an MHC-Moleküle zu binden, die eine Prädisposition für RA-ähnliche Krankheiten darstellen, nämlich die MHC-Allele DR1, DR4w4 und DR4wl4. Als Folge der MHC-Bindung des 7-Peptids kommt es unter natürlichen Bedingungen zur Aktivierung von CD4+ T- Zellen, die in T-Zell-Proliferationstests nachgewiesen werden kann (Beispiele 6 und 17). Darüber hinaus kann gezeigt werden, daß Antikörper gegen das 7-Peptid mit Peptiden dieser menschlichen Proteine kreuzreagieren (Beispiel 3). Interestingly, the release of the γ-peptide from the Iga protein is also a result of the cleavage activity of the IgA protease, which immediately proves the antigen-processing activity of the IgA protease. A property of the γ-peptide according to the invention is to be presented by class II MHC molecules (example 5). In particular, the γ-peptide has the property of binding to MHC molecules which are predisposed to RA-like diseases, namely the MHC alleles DR1, DR4w4 and DR4wl4. As a result of the MHC binding of the 7-peptide, CD4 + T cells are activated under natural conditions and can be detected in T cell proliferation tests (Examples 6 and 17). In addition, it can be shown that antibodies against the 7-peptide cross-react with peptides of these human proteins (Example 3).
Interessanterweise kreuzreagieren einzelne Klone stimulierter menschlicher T-Zellen mit MHC-präsentierten Peptiden, die von menschlichen Proteinen abstammen, beispielsweise Linkprotein bzw. Aggrekan (Beispiel 5). Kreuzreaktive T-Zellen können aus Synovialflüssigkeit und periphären Blutzellen von RA-Patienten oder aus dem Blut von Personen isoliert werden, die eine genetische Prädispostion für rheumatoide Arthritis besitzen (Beispiel 17). Diese Befunde bele gen den ätiologischen Zusammenhang zwischen RA und den Iga-Interestingly, individual clones of stimulated human T cells cross-react with MHC-presented peptides derived from human proteins, for example link protein or aggrekan (example 5). Cross-reactive T cells can be isolated from synovial fluid and peripheral blood cells from RA patients or from the blood of people who are genetically predisposed to rheumatoid arthritis (Example 17). These findings bele the etiological connection between RA and the IgA
Proteinen pathogener Neisserien. Diese Ergebnisse zeigen auch, daß die Gegenwart von IPP-spezifischen T-Zellen zwar eine Voraussetzung für Autoimmukrankheiten darstellt, daß aber nachfolgende pathogenetische Prozesse ebenfalls beteiligt sein können. Der experimentelle Nachweis mit 7-Peptid und korrespondierenden menschlichen Peptiden stimulierbarer periphären T-Zellen kann in bezug auf die Diagnostik rheumatoider Krankheiten genutzt werden (Beispiel 17). Proteins from pathogenic Neisseries. These results also show that the presence of IPP-specific T cells is a prerequisite for autoimmune diseases, but that subsequent pathogenetic processes can also be involved. The experimental detection with 7-peptide and corresponding human peptides stimulable peripheral T cells can be used in relation to the diagnosis of rheumatoid diseases (Example 17).
Neben dem 7-Peptid gibt es zahlreiche andere Bereiche im Iga-Protein bzw. im IPP, die hinsichtlich des molekularen Mimikrys mit menschlichen Proteinen bedeutsam sind. Dies verdeutlicht der Vergleich der Aminosäuresequenzen von Iga- Proteinen mit bekannten menschlichen Proteinen (Beispiel 2). Diese Vergleiche lassen auf weitere ätiologische Zusammenhänge zwischen IPP von pathogenen Neisserien und menschlichen Autoimmunkrankheiten schließen, beispielsweise SLE (Argow et al., 1989) und SS (Williams in: Enzyclopedia of Immunology, Hrg. Roitt und Delves, 1992, pp. 1339-1343). Experimentelle Evidenzen für derartige Zusammenhänge bilden beispielsweise die immunologische Kreuzreaktion von monoklonalen Antikörpern und polyklonalen Antiseren gegen IPP mit menschlichen Proteinen. So erkennt der monoklonale Antikörper JOP-1, der gegen einen stark konservierten Bereich innerhalb von Igaα gerichtet ist, ein eukaryontisches Zellgerüstprotein (Beispiel 4). In addition to the 7-peptide, there are numerous other areas in the Iga protein or in the IPP which are important with regard to the molecular mimicry with human proteins. This illustrates the comparison of the amino acid sequences of IgA proteins with known human proteins (Example 2). These comparisons suggest further etiological relationships between IPP of pathogenic Neisseries and human autoimmune diseases, for example SLE (Argow et al., 1989) and SS (Williams in: Enzyclopedia of Immunology, Hrg. Roitt and Delves, 1992, pp. 1339-1343 ). Experimental evidence for such relationships is, for example, the immunological cross-reaction of monoclonal antibodies and polyclonal antisera against IPP with human proteins. The monoclonal antibody JOP-1, which is directed against a highly conserved region within Iga α , recognizes a eukaryotic cell framework protein (example 4).
Eine Eigenschaft der α-Proteine ist es, aus einer extrazellulären Umgebung entweder allein oder im Verbund mit anderen Bestandteilen des IPP in menschliche Zellen einzudringen. Dieser Vorgang setzt offenbar die Bindung des α- Proteins an einen oder mehrere zelluläre Rezeptoren voraus. Im Verlauf dieses Prozesses gelangen α-Proteine in den Zellkern menschlicher Zellen. Aufgrund ihrer besonderen Struktureigenschaften interagieren sie mit anderen zellulären Faktoren und insbesondere mit der DNA betroffener Zellen. Hierdurch werden Prozesse (beispielsweise genregulatorische Prozesse) ausgelöst, die die Funktion betroffener Zellen be einflussen. Als eine Folge davon wird das Cytokinmuster betroffener Zellen verändert. Letztlich wird durch diese α- Protein-bedingten Vorgänge die Balance des Immunsystems gestört, was zusätzlich zum molekularen Mimikry des IPP die Entstehung und den Erhalt von Autoimmunreaktionen begünstigt. A property of the α-proteins is to penetrate human cells from an extracellular environment either alone or in combination with other components of the IPP. This process obviously requires the binding of the α-protein to one or more cellular receptors. In the course of this process, α proteins enter the cell nucleus of human cells. Due to their special structural properties, they interact with other cellular factors and in particular with the DNA of affected cells. This triggers processes (for example gene regulatory processes) that affect the function of affected cells influence. As a result, the cytokine pattern of affected cells is changed. Ultimately, these α-protein-related processes disturb the balance of the immune system, which, in addition to the molecular mimicry of IPP, favors the development and maintenance of autoimmune reactions.
Eine weitere regulatorische Eigenschaft der Iga-Proteine bzw. der IPPs wirkt sich auf den Zustand exogener und endogener viraler Elemente aus. Es gibt zahlreiche Hinweise auf eine Rolle von Viren und anderen viralen Elementen im Zusammenhang mit der Atiologie von Autoimmunkrankheiten des Menschen. Beispielsweise kann das Epstein-Barr-Virus (EBV) bestimmte Arthritiden des Menschen hervorrufen. Hierfür ist möglicherweise eine strukturelle Homologie zwischen einer Region im Nukleokapsidprotein gp110 von EBV (Roudier et al., 1988) und dem "shared epitope" (Gregersen et al., 1987) bestimmter, mit RA-assoziierten HLA-DR-Allele des Menschen (z.B. DR1, DR4w4, DR4wl4) verantwortlich. Neben den strukturellen Ähnlichkeiten zwischen viralen und menschlichen Proteinen, die zu Autoimmunreaktionen führen können, kodieren bestimmte Viren auch immunmodulatorische Faktoren, die Autoimmunreaktionen begünstigen können. Hierzu zählen einerseits immunsuppressive Faktoren wie zum Beispiel das TatProtein des human immundeficiency virus (HIV) (Viscidi et al., 1989) oder bestimmte retrovirale Genprodukte, die ähnlich dem Superantigen des MMTV zu einer antigenunspezifischen klonalen Aktivierung des Immunsystems (insbesondere von T-Zellen) führen können (Held et al., 1993).  Another regulatory property of the Iga proteins or the IPPs affects the state of exogenous and endogenous viral elements. There is ample evidence of the role of viruses and other viral elements in the etiology of autoimmune diseases in humans. For example, the Epstein-Barr virus (EBV) can cause certain human arthritis. This may require structural homology between a region in EBV's gp110 nucleocapsid protein (Roudier et al., 1988) and the shared epitope (Gregersen et al., 1987) of certain human RA-associated HLA-DR alleles ( e.g. DR1, DR4w4, DR4wl4) responsible. In addition to the structural similarities between viral and human proteins that can lead to autoimmune reactions, certain viruses also encode immunomodulatory factors that can favor autoimmune reactions. These include, on the one hand, immunosuppressive factors such as the Tat protein of the human immunodeficiency virus (HIV) (Viscidi et al., 1989) or certain retroviral gene products that, like the superantigen of MMTV, lead to antigen-unspecific clonal activation of the immune system (especially of T cells) can lead (Held et al., 1993).
Tatsächlich gibt es Hinweise auf einen Zusammenhang zwischen retroviralen Elementen und Autoimmunkrankheiten des Menschen. So konnte man in der Synovialflüssigkeit von RA- Patienten virusähnliche Partikel elektronenmikroskopisch nachweisen. Auch bei Patientien mit dem Sjögren's-Syndrom konnten ähnliche virale Partikel nachgewiesen werden (Itescu et al., 1990). Darüber hinaus wurde in der Synovialflüssigkeit von RA-Patienten die Aktivität einer für solche Viren typischen Reversen Transcriptase nachgewiesen. Zum genauen Ursprung derartiger viraler Partikel, die im Zusammenhang mit Autoimmunkrankheiten stehen, ist wenig bekannt. Es wird jedoch angenommen, daß es sich beispielsweise um aktivierte endogene retrovirale Elemente handelt (Perl et al., 1993), die nach neueren Schätzungen einen großen Teil des menschlichen Genoms (zwischen 2 und 10 %) ausmachen. In welchem Maße die im menschlichen Genom enthaltenen retroviralen Elemente aktivierbar sind, wurde bisher nicht bestimmt. Aufgrund des oben erwähnten Nachweises von Viruspartikeln und von Reverse Transcriptase ist jedoch eine gelegentliche Aktivierung endogener Retroviren wahrscheinlich. Über die Mechanismen der Aktivierung endogener Retroviren ist bisher wenig bekannt. Indeed, there is evidence of a link between retroviral elements and autoimmune diseases in humans. For example, virus-like particles could be detected by electron microscopy in the synovial fluid of RA patients. Similar viral particles were also detected in patients with Sjögren's syndrome (Itescu et al., 1990). In addition, the activity of a reverse transcriptase typical of such viruses was demonstrated in the synovial fluid of RA patients. Little is known about the exact origin of such viral particles that are associated with autoimmune diseases. However, it is believed, for example, that they are activated endogenous retroviral elements (Perl et al., 1993) which, according to recent estimates, make up a large part of the human genome (between 2 and 10%). The extent to which the retroviral elements contained in the human genome can be activated has not yet been determined. Due to the above-mentioned detection of virus particles and reverse transcriptase, occasional activation of endogenous retroviruses is likely. Little is known about the mechanisms of activation of endogenous retroviruses.
Eine wichtige Klasse der Retroviren sind die Lentiviren, denen der aus medizinischer Sicht bedeutende "human immundeficiency virus" (HIV bzw. HIV-1) angehört. Der phyloge- netische Ursprung des HIV ist bisher ungeklärt, jedoch besitzt dieses Virus eine Reihe von nahe verwandten Viren (z.B. HIV-2, SIV), die teils beim Menschen, teils bei anderen Säugern vorkommen. Diese Verwandtschaft deutet auf eine Abstammung des HIV von anderen HIV-ähnlichen Viren hin; Es ist denkbar, daß bestimmte gesellschaftlich isolierte Bevölkerungsgruppen in Afrika, das als Ursprung des HIV angesehen wird, schon seit längerer Zeit mit HIV infiziert waren, bevor sich das Virus weltweit ausbreiten konnte. Vieles spricht für einen "zweiten Faktor", der die HlV-Pandemie induziert hat.  An important class of retroviruses are the lentiviruses, to which the "human immunodeficiency virus" (HIV or HIV-1), which is of medical importance, belongs. The phylogenetic origin of HIV has not yet been clarified, but this virus has a number of closely related viruses (e.g. HIV-2, SIV), some of which are found in humans, some in other mammals. This relationship indicates ancestry of HIV from other HIV-like viruses; It is conceivable that certain socially isolated population groups in Africa, which is considered to be the origin of HIV, had been infected with HIV for a long time before the virus could spread worldwide. There is much to be said for a "second factor" that has induced the HIV pandemic.
Ein solcher "zweiter Faktor" muß auch für die Aktivierung des HIV innerhalb eines bereits infizierten Individuums postuliert werden. Nach Infektion eines Menschen beginnt sich das HIV zunächst stark zu vermehren (Phase I der Infektion). Danach folgt eine Latenzperiode (Phase II), in der kaum freie Viren im Blut des Infizierten vorhanden sind: Das HIV ruht im Genom von CD4+ Zellen - insbesondere CD4+ T-Zellen - als sogenanntes Provirus. In dieser proviralen Form verhält sich das HIV ähnlich den endogenen Retroviren. Durch einen bisher unbekannten Mechanismus wird das HlV-Provirus jedoch wiederholt aktiviert; es kommt zu einer Serie von Vermehrungsschüben (Phase III), in deren Verlauf die CD4+ T- Zellpopulation stark vermindert wird. Eine Folge davon wird das Immunsystem stark geschwächt und es entsteht in der Phase IV der HIV-Infektion das "acguired immune deficiency syndrome" (AIDS). Interessant ist jedoch, daß die HIV-Infektion in einer kleinen Zahl HlV-infizierter Personen trotz langer Latenzzeit (Phase II z.T. über 10 Jahren) nicht in eine Phase III übergegangen ist. Dies deutet darauf hin, daß ein bestimmter Personenkreis zwar mit HIV infiziert wurde und den integrierten HlV-Provirus besitzt, aber der im Genom der Zellen integrierte Provirus nicht aktiviert wird. Such a "second factor" must also be postulated for the activation of HIV within an already infected individual. After infection of a person, HIV begins to multiply rapidly (phase I of the infection). This is followed by a latency period (phase II) in which there are hardly any free viruses in the infected person's blood: HIV rests in the genome of CD4 + cells - especially CD4 + T cells - as a so-called provirus. In this proviral form, HIV behaves similarly to endogenous retroviruses. Through a previously unknown mechanism, the HIV provirus however repeatedly activated; there is a series of propagation spurts (phase III), in the course of which the CD4 + T cell population is greatly reduced. As a result, the immune system is severely weakened and the "acguired immune deficiency syndrome" (AIDS) develops in phase IV of the HIV infection. It is interesting, however, that the HIV infection in a small number of HIV-infected people did not move into phase III despite a long latency period (phase II, sometimes over 10 years). This indicates that a certain group of people has been infected with HIV and has the integrated HIV provirus, but the provirus integrated in the cell genome is not activated.
Die entscheidende, bisher ungelöste Frage zur Entwicklung von AIDS betrifft daher den Mechanismus der Aktivierung des HlV-Provirus in den infizierten Zellen. Experimentell kann gezeigt werden, daß die Aktivierung des Provirus durch eine Transkription des Provirusgenoms erfolgt, die vom Promotor des "long terminal repeat" (LTR) des Provirus ausgeht. Bei dieser Aktivierung des LTR spielt das vom Provirus kodierte Tat-Protein eine zentrale Rolle. Das Tat-Protein wirkt mit zellulären Faktoren und neugebildeter viraler RNA zusammen, die das "Tat responsive element" (TAR) enthält. Neuere Ergebnisse zeigen, daß das Tat-Protein die Eigenschaft besitzt, als lösliches Protein in bestimmte menschliche Zellen einzudringen und in den Nukleus dieser vorzudringen. Sofern diese Zellen das HlV-Provirus enthalten, kommt es zur Transaktivierung des HIV in diesen Zellen. Das Tat- Protein ist also in der Lage, HlV-Proviren in benachbarten Zellen zu aktivieren. Diese Befunde zur Funktion von Tat geben zwar Aufschluß über die genetische Kontrolle der HIV-Aktivierung, erklären jedoch nicht die Aktivierung des HIV- Provirus in den Zellen eines Infizierten; hierfür wird vielmehr ein zusätzlicher exogener Faktor angenommen.  The crucial, as yet unsolved question about the development of AIDS therefore concerns the mechanism of the activation of HIV provirus in the infected cells. It can be shown experimentally that the provirus is activated by a transcription of the provirus genome, which originates from the promoter of the "long terminal repeat" (LTR) of the provirus. The Tat protein encoded by the provirus plays a central role in this activation of the LTR. The Tat protein interacts with cellular factors and newly formed viral RNA, which contains the "Tat responsive element" (TAR). Recent results show that the Tat protein has the property of penetrating certain human cells as a soluble protein and penetrating the nucleus thereof. If these cells contain the HIV provirus, HIV is transactivated in these cells. The Tat protein is therefore able to activate HIV proviruses in neighboring cells. These findings on the functioning of Tat provide information about the genetic control of HIV activation, but do not explain the activation of HIV provirus in the cells of an infected person; an additional exogenous factor is assumed.
Eine wichtige Basis dieser Erfindung ist die strukturelle und funktioneile Verwandtschaft der iga-Gene von Neisserien mit Viren bzw. viralen Elementen einschließlich endogener Proviren. Hinsichtlich der Evolution der IgA-Pro teasen pathogener Neisserien ist ihre strikte Assoziation mit pathogenen Bakterien-Spezies auffällig. Genomische DNA- Hybridisierungsversuche, die mittels des iga-Gens von N . gonorrhoeae und eines benachbarten Gens {comA) als Sonde durchgeführt wurden, deuten an, daß das comA-Gen im Gegensatz zum igra-Gen sowohl in pathogenen wie nicht-pathogenen Neisserien vorkommt (Facius and Meyer, 1993). Vermutlich integrierte das iga-Gen im Laufe der Evolution in das Genom der pathogenen Neisserien als ein zusätzliches genetisches Element. Vielfach vorhandene Sequenzhomologien der Iga-Proteine mit viralen Proteinen deuten auf einen viralen Ursprung der iga-Gene hin. Derartige Sequenzhomologien der iga-Genprodukte und viraler Proteine können durch Computerunterstützte Aminosäuresequenzvergleiche nachgewiesen werden (Beispiele 12 und 18). Dabei treten beispielsweise Homologien zu viralen Polyproteinen und viralen Hüllproteinen gehäuft auf. Da viele Neisserien-Spezies natürlich transformationskompetent und eng an die Wechselwirkung mit Säugetierorganismen (insbesondere dem Menschen) gebunden sind, kann der Einbau eines viralen Elements in das Neisserien-Genom über den Weg der Transformation erklärt werden. An important basis of this invention is the structural and functional relationship of the iga genes of Neisseries with viruses or viral elements including endogenous proviruses. Regarding the evolution of IgA-Pro teasen of pathogenic Neisseries is striking their strict association with pathogenic bacterial species. Genomic DNA hybridization experiments using the iga gene from N. gonorrhoeae and an adjacent gene (comA) as a probe indicate that the comA gene, in contrast to the igra gene, occurs in both pathogenic and non-pathogenic Neisseries (Facius and Meyer, 1993). In the course of evolution, the iga gene probably integrated into the genome of the pathogenic Neisseries as an additional genetic element. Frequently existing sequence homologies of the Iga proteins with viral proteins indicate a viral origin of the iga genes. Such sequence homologies of the iga gene products and viral proteins can be detected by computer-aided amino acid sequence comparisons (Examples 12 and 18). For example, homologies to viral polyproteins and viral coat proteins occur frequently. Since many Neisserie species are naturally transformation-competent and closely linked to the interaction with mammalian organisms (especially humans), the incorporation of a viral element into the Neisserien genome can be explained by the way of the transformation.
Eine besonders auffallende Strukturhomologie der neisserialen Iga-Proteine betrifft ein bei Prokaryonten ansonsten ungewöhnliches Aminosäuresequenzmotiv des aktiven Zentrums einer Aspartylprotease (Beispiel 11). Überraschenderweise besitzt von allen bekannten Sequenzmotiven das aktive Zentrum der Aspatylprotease von HIV die größte Homologie zu dem des iga Genprodukts. Dieser Befund deutet auf eine besonders enge Verwandtschaft zwischen iga und dem HIV- Virus hin. Das aktive Zentrum der Neisserien-Aspartylpro- tease ist in der membrangebundenen β-Domäne des Iga-Proteins gelegen und kann beispielsweise im Zusammenhang mit der Neisserien-Infektion in Zellen gelangen. Es wird angenommen, daß diese zusätzliche proteolytische Aktivität, die auf der Oberfläche von pathogenen Neisserien gebunden ist, in Prozesse der Antigenpräsentation und der Regulation der Zellfunktionen - ähnlich wie die Aktivität der IgA-Protease - eingreift und auf diese Weise die Aktivierung viraler Elemente sowie die Entwicklung von Autoimmunkrankheiten unterstützt. A particularly striking structural homology of the neisserial Iga proteins relates to an otherwise unusual amino acid sequence motif of the active center of an aspartyl protease in prokaryotes (Example 11). Surprisingly, of all known sequence motifs, the active center of the HIV aspatyl protease has the greatest homology to that of the iga gene product. This finding indicates a particularly close relationship between iga and the HIV virus. The active center of the Neisserie aspartyl protease is located in the membrane-bound β-domain of the Iga protein and can get into cells in connection with the Neisserien infection, for example. It is believed that this additional proteolytic activity, which is bound to the surface of pathogenic Neisseries, in processes of antigen presentation and regulation of cell functions - similar to the activity of the IgA protease - intervenes and in this way supports the activation of viral elements and the development of autoimmune diseases.
Ein weiteres Merkmal der Verwandtschaft zwischen den iga-Genen und bestimmten Viren ist die bereits oben erwähnte Tatsache, daß die Iga-Proteine zunächst in Form großer Vorläufer-Polyproteine gebildet werden und in der Manier viraler Polyproteine durch Autoproteolyse sich selbst in mehrere einzelne Proteine zerlegen (Kräusslich et al., 1989).  Another characteristic of the relationship between the iga genes and certain viruses is the fact already mentioned above that the Iga proteins are initially formed in the form of large precursor polyproteins and, in the manner of viral polyproteins, break down into several individual proteins by autoproteolysis ( Krausslich et al., 1989).
Eine besonders interessante Verwandtschaft besteht darüber hinaus zwischen den α-Proteinen der Neisserien und dem HlV-kodierten Tat-Protein. Bei beiden Proteinen handelt es sich um relativ kleine (ca. 10 bis 30 kDa), vorwiegend α-helikale, positiv geladene Proteine, die die Fähigkeit zur Dimerisierung besitzen. α-Proteine und Tat-Proteine teilen sich die ungewöhnliche Eigenschaft, vom extrazellulären Milieu in den Nukleus einer menschlichen Zelle einzudringen (Frankel and Pabo, 1988; Beispiel 7). Obwohl die α-Proteine der pathogenen Neisserien eine polymorphe Proteinklasse darstellen (Beispiel 1), werden die hier beschriebenen Eigenschaften von allen bisher getesteten allelen Formen erfüllt.  There is also a particularly interesting relationship between the α proteins of the Neisseries and the HIV-encoded Tat protein. Both proteins are relatively small (approx. 10 to 30 kDa), predominantly α-helical, positively charged proteins, which have the ability to dimerize. α-proteins and Tat proteins share the unusual property of penetrating the nucleus of a human cell from the extracellular milieu (Frankel and Pabo, 1988; Example 7). Although the α proteins of the pathogenic Neisseries represent a polymorphic protein class (Example 1), the properties described here are fulfilled by all allelic forms tested to date.
Die α-Proteine der Neisserien und das Tat-Protein des HIV üben auch biologisch ähnliche Wirkungen auf eukaryontische Zellen aus. So wirken beide Proteine gleichermaßen immunsuppressiv wie in einem T-Zell- Proliferationstest gemessen werden kann (Beispiel 8). Ebenso wie das Tat-Protein wirken auch die α-Proteine der Neisserien aktivierend auf bestimmte virale Promotoren (Beispiel 12). Die α-Proteine der Neisserien können daher - möglicherweise im Verbund mit den anderen Bestandteilen des IPP - in den Kern HlV-infizierter menschlicher Zellen eindringen und den enthaltenen HlV-Provirus aktivieren, so daß eine Re- plikation und Ausbreitung des Virus erfolgt. Dieser Mechanismus erklärt daher die fortgesetzten HlV-Virusschübe, wodurch sich eine latente HIV-Infektion der Phase II zur Infektionsphase III hinentwickelt. In dieser Weise aktivieren die α-Proteine der pathogenen Neisserien auch andere endogene Retroviren des menschlichen Genoms. Die Bildung endogener retroviraler Proteine begünstigt zusammen mit den anderen Eigenschaften des IPP die Entstehung bzw. das Fortschreiten von Autoimmunreaktionen in der oben beschriebenen Weise. Nach neueren Erkenntnissen kann auch AIDS als eine Autoimmunkrankheit angesehen werden (Atlan, 1994). Es ist möglich, daß unterschiedliche Allele der α-Proteine bzw. der IPPs bestimmte exogene oder endogene Viren in unterschiedlicher Weise aktivieren. Überlagert durch die genetisch bedingte Prädisposition einzelner Individuen erklären die teilweise unterschiedlichen biologischen Funktionen der Neisserien iga-Gene und ihrer Genprodukte die Entstehung unterschiedlicher Krankheitsbilder. The Neisserie α-proteins and the Tat protein of HIV also have biologically similar effects on eukaryotic cells. Both proteins are equally immunosuppressive as can be measured in a T cell proliferation test (Example 8). Just like the Tat protein, the α proteins of the Neisseries also have an activating effect on certain viral promoters (Example 12). The α-proteins of the Neisseries can therefore - possibly in combination with the other components of the IPP - penetrate into the nucleus of HIV-infected human cells and activate the HIV-Provirus contained, so that the virus replicates and spreads. This mechanism therefore explains the continued HIV flare-ups, as a result of which a latent HIV infection in phase II develops into infection phase III. In this way, the α proteins of the pathogenic Neisseries also activate other endogenous retroviruses of the human genome. The formation of endogenous retroviral proteins, together with the other properties of IPP, favors the development or progression of autoimmune reactions in the manner described above. According to recent findings, AIDS can also be seen as an autoimmune disease (Atlan, 1994). It is possible that different alleles of the α-proteins or the IPPs activate certain exogenous or endogenous viruses in different ways. Superimposed by the genetic predisposition of individual individuals, the sometimes different biological functions of the Neisseries iga genes and their gene products explain the development of different clinical pictures.
Es ist zu erwarten, daß in anderen bakteriellen Krankheitserregern weitere Gene existieren, die eine den Neisserien iga-Genen ähnliche biologische Funktion besitzen. Gene, die für bakterielle Polyproteine (BPPs) kodieren und strukturelle und funktioneile Verwandtschaften zu dem iga- Gen der pathogenen Neisserien aufweisen, sind beispielsweise das vacA-Gen von Helicobacter pylori (Schmitt and Haas, 1993), das aida-Gen von enteropathogenen E. coli (Benz and Schmidt, 1989), das pertactin-Gen von Bordetella parapertussis (Dougan et al., 1991) und das Gen für die Serinprotease von Serratia marcescens (Nakahama et al., 1986).  It is to be expected that other genes exist in other bacterial pathogens which have a biological function similar to the Neisserien iga genes. Genes which code for bacterial polyproteins (BPPs) and have structural and functional relationships to the iga gene of the pathogenic Neisseries are, for example, the vacA gene from Helicobacter pylori (Schmitt and Haas, 1993), the aida gene from enteropathogenic E. coli (Benz and Schmidt, 1989), the Bordetella parapertussis pertactin gene (Dougan et al., 1991) and the Serratia marcescens serine protease gene (Nakahama et al., 1986).
In ihrer Gesamtheit belegen diese unerwarteten Befunde erstmals einen Zusammenhang zwischen BPPs (d.h. bakteriellen IgA-Proteasen und deren assoziierten Proteine, sowie Iga- ähnlichen Proteinen anderer pathogener Bakterien) und Autoimmun- und Viruskrankheiten des Menschen. Insbesondere offenbaren die dargestellten Ergebnisse einen Zusammenhang zwischen Neisserien-Infektionen und Autoimmunkrankheiten des Menschen. Demnach stellen IgA-Protease-bildende Neisserien beispielsweise das ätiologische Agens RA-ähnlicher Autoimmunkrankheiten des Menschen dar. Desweiteren offenbart die vorliegende Erfindung erstmals die Rolle von BPPs und der sie bildenden Bakterienspezies bei der Aktivierung von viralen Elementen. So wird wird beispielhaft die Rolle der neisserialen Iga-Proteine bzw. IPPs für die Aktivierung von viralen Elementen (inbesondere von HlV-Proviren und anderen endogenen Retroviren) demonstriert. Die vorliegende Erfindung erklärt somit die Entstehung von AIDS, indem HIV in Virus-infizierten Personen aufgrund der biologischen Funktion der Iga-Proteine bzw. der IPPs von Neisserien aktiviert wird. Durch die Aktivierung viraler Elemente, insbesondere endogener Retroviren, werden Autoimmunreaktionen hervorgerufen, die indirekt auf die biologische Wirkung von BPPs, insbesondere der Neisserien IgaProteine bzw. IPPs, zurückzuführen sind. Aus der unterschiedlichen Struktur und Wirkung von BPPs und der jeweils aktivierten viralen Elemente erklärt sich die Vielfalt der hervorgerufenen Krankheitsbilder. In their entirety, these unexpected findings prove for the first time a connection between BPPs (ie bacterial IgA proteases and their associated proteins, as well as IgA-like proteins of other pathogenic bacteria) and autoimmune and viral diseases in humans. In particular, the results presented reveal a connection between Neisserie infections and autoimmune diseases in humans. Accordingly, Neisseries forming IgA proteases are, for example, the etiological agent of RA-like autoimmune diseases in humans. Furthermore, the present invention for the first time discloses the role of BPPs and the bacterial species that form them in the activation of viral elements. For example, the role of neisserial Iga proteins or IPPs for the activation of viral elements (in particular HIV proviruses and other endogenous retroviruses) is demonstrated. The present invention thus explains the development of AIDS by activating HIV in virus-infected persons on the basis of the biological function of the Iga proteins or the IPPs of Neisseries. The activation of viral elements, especially endogenous retroviruses, causes autoimmune reactions that are indirectly attributable to the biological effects of BPPs, in particular the Neisseries IgaProteine or IPPs. The diverse structure and effects of BPPs and the respectively activated viral elements explain the variety of the symptoms.
In dem durch IPP bzw. indirekt durch Neisserien hervorgerufenen pathogenetischen Prozeß spielen beispielsweise folgende Ereignisse eine Rolle: The following events, for example, play a role in the pathogenetic process caused by IPP or indirectly by Neisseries:
1. Pathogene IgA-Protease-bildende Neisserien (insbesondere Meningokokken) infizieren die menschliche Schleimhaut. Die Infektion einzelner Individuen kann vorübergehend oder persistierend mit abwechselnd unterschiedlichen Stämmen erfolgen. Die Infektionen können asymptomatisch oder auch symptomatisch verlaufen.  1. Pathogenic IgA protease-forming Neisseries (especially meningococci) infect the human mucosa. Individuals can be infected temporarily or persistently with alternating strains. The infections can be asymptomatic or symptomatic.
2. Die Erreger bilden IgA-Proteasen, die in Varianten Formen auftreten können und Aminosäuresequenzen beinhalten, die molekulares Mimikry in bezug auf menschliche Proteine darstellen. So besteht beispielsweise molekulares Mimikry zwischen dem 7-Peptid-Anteil des Neisserien IPP und menschlichem Linkprotein bzw. Aggrekan.  2. The pathogens form IgA proteases, which can take various forms and contain amino acid sequences which represent molecular mimicry with respect to human proteins. For example, there is molecular mimicry between the 7-peptide portion of the Neisserie IPP and human link protein or aggrekan.
3. Peptide des IPP, insbesondere des 7-Peptid-Anteils, werden auf Klasse II MHC-Molekülen präsentiert. 4. Es werden CD4 T-Zellen, deren T-Zellrezeptor gegen ein MHC-präsentiertes Peptid (Fremd) des IPP gerichtet ist, aktiviert. 3. IPP peptides, in particular the 7-peptide portion, are presented on class II MHC molecules. 4. CD4 T cells whose T cell receptor is directed against an MHC-presented peptide (foreign) of the IPP are activated.
5. Diese aktivierten T-Zellen reagieren kreuz mit einem Selbst-Peptid, das ebenfalls MHC präsentiert wird. D.h. diese T-Zellen werden auch durch MHC-präsentiertes Selbst-Peptid aktiviert.  5. These activated T cells cross-react with a self-peptide, which is also presented to MHC. That these T cells are also activated by MHC-presented self-peptide.
6. Ähnliche Kreuzreaktionen kommen auf B-Zell-Ebene zustande, indem Antikörper, die zunächst gegen IPP gerichtet sind mit Selbst kreuzreagieren und entsprechende B- Zellen durch die Hilfe aktivierter T-Zellen aktiviert werden.  6. Similar cross-reactions occur at the B-cell level in that antibodies which are initially directed against IPP cross-react with self and corresponding B-cells are activated with the help of activated T cells.
7. Selbstreaktive T- und B-Zellen werden in bestimmte Körperregionen eingeschleust, in denen entsprechende Selbst-Antigene gebildet werden. Durch die fortlaufende Stimulation mit Selbstantigen und die Bildung inflammatorischer Zytokine wird eine chronische entzündliche Reaktion in Gang gesetzt, in deren Verlauf es zu einer unspezifischen Zellproliferation und Gewebszerstörung kommt.  7. Self-reactive T and B cells are introduced into certain regions of the body in which corresponding self-antigens are formed. The continuous stimulation with self-antigens and the formation of inflammatory cytokines set in motion a chronic inflammatory reaction, in the course of which unspecific cell proliferation and tissue destruction occur.
8. Durch die fortschreitende Freisetzung von proteolytischen Spaltprodukten von Selbst-Antigen kommt es zu weiteren Autoimmunreaktionen.  8. The progressive release of proteolytic cleavage products from self-antigen leads to further autoimmune reactions.
9. Ein oder mehrere zusätzliche Eigenschaften des IPP begünstigen das Zustandekommen einer Autoimmunreaktion gegen menschliche Selbstproteine, indem beispielsweise 9. One or more additional properties of IPP favor the development of an autoimmune reaction against human self proteins, for example by
(a) α-Protein allein oder im Verbund mit anderen Bestandteilen des IPP intrazellulär produziert oder von außen in Zellen aufgenommen wird, (a) α-protein is produced intracellularly alone or in combination with other constituents of the IPP or is absorbed from outside into cells
(b) IgA-Protease funktionell wichtige Proteine wie IgAl, CD8 etc. spaltet,  (b) IgA protease cleaves functionally important proteins such as IgAl, CD8 etc.,
(c) durch die Spaltung von menschlichen Proteinen neue T-Zell-Epitope generiert werden, die eine gegen Selbst gerichtete Immunreaktion bewirken, und/oder  (c) new T-cell epitopes are generated by the cleavage of human proteins, which bring about a self-directed immune reaction, and / or
(d) durch die regulatorischen Eigenschaften des α-Proteins und anderer Bereiche des IPP immunologische Reaktionen beschleunigt oder supprimiert werden. 10. In einer weiteren Reaktion, die parallel zu den oben geschilderten Vorgängen abläuft, werden aufgrund der Wirkungen der neisseriellen IPPs im Verlauf der Neisserien-Infektion virale Elemente aktiviert. Die entstehenden viralen Partikel und anderen viralen Genprodukte üben eine Vielzahl unterschiedlicher Funktionen aus, die entsprechend unterschiedliche klinische Formen der Autoimmunkrankheiten des Menschen ergeben können. 11. Trifft das neisserielle IPP auf eine HlV-infizierte Zelle, so kommt es zur Aktivierung des HIV-Virus. In diesem Fall wird das klinische Bild durch die fortschreitende HIV-Infektion bestimmt. (d) the regulatory properties of the α protein and other areas of the IPP accelerate or suppress immunological reactions. 10. In a further reaction, which runs parallel to the processes described above, viral elements are activated due to the effects of the neisserial IPPs in the course of the neisserie infection. The resulting viral particles and other viral gene products perform a variety of different functions, which can result in different clinical forms of autoimmune diseases in humans. 11. If the neisserial IPP encounters an HIV-infected cell, the HIV virus is activated. In this case, the clinical picture is determined by the progressive HIV infection.
Es ist sehr wahrscheinlich, daß die BPPs anderer bakterieller Mikroorganismen bei Einwirkung auf den menschlichen Organismus und seine Zellen ähnliche Reaktionen hervorrufen wie das IPP der pathogenen Neisserien. It is very likely that the BPPs of other bacterial microorganisms, when acted on the human organism and its cells, produce reactions similar to the IPP of the pathogenic Neisseries.
Dieser oben beschriebene Sachverhalt erlaubt die Entwicklung rationaler Strategien zur Bekämpfung von Autoimmunreaktionen und viraler Infektionen. Darüber hinaus ergeben sich diagnostische Verwendungsmöglichkeiten zur Identifizierung von Risikogruppen und der frühzeitigen Diagnose solcher Krankheiten. So leiten sich aus den beschriebenen Erkenntnissen unmittelbar folgende diagnostische, therapeutische und vorbeugende Verfahren ab: This issue described above allows the development of rational strategies to combat autoimmune reactions and viral infections. In addition, there are diagnostic uses for the identification of risk groups and the early diagnosis of such diseases. The following diagnostic, therapeutic and preventive procedures can be derived directly from the findings described:
A Anti-Neisserien-Vakzine und Inhibitoren A anti-neisserie vaccine and inhibitors
Da Neisserien ein ätiologisches Agens von Autoimmunund Viruskrankheiten des Menschen, insbesondere der rheumatoiden Arthritis und von AIDS, darstellen, richtet sich daher ein erster Ansatz zur Bekämpfung dieser Krankheiten gegen Infektionen mit IgA-Protease-produzierenden pathogenen Neisserien einschließlich asymptomatisch verlaufender Infektionen. Mehrere prinzipiell unterschiedliche Methoden können hierfür angewandt werden, (a) die aktive Immunisierung, (b) die passive Immunisierung, (c) die Behandlung mit Infek tionshemmern einschließlich Antibiotika und (d) kombinierte Methoden. Since Neisseries is an etiological agent of autoimmune and viral diseases in humans, especially rheumatoid arthritis and AIDS, a first approach to combating these diseases against infections with IgA protease-producing pathogenic Neisseries, including asymptomatic infections, is aimed. Several fundamentally different methods can be used for this, (a) active immunization, (b) passive immunization, (c) treatment with infection inhibitors including antibiotics and (d) combined methods.
(a) Aktive kapselspezifische Vakzine gegen Meningokokken-Infektionen der Serogruppen A und C sind bereits erhältlieh, nicht jedoch anderer Serogruppen einschließlich der weit verbreiteten Serogruppe B. Daneben wurden jedoch weitere Ansatzpunkte zur Entwicklung wirksamer Neisserien-Vakzine beschrieben, die beispielsweise auf der Basis von Proteinen der äußeren Membran insbesondere der Porine (Wiertz, 1993) hergestellt werden und/oder gegen wesentliche Adhäsine gerichtet sind, insbesondere das Pilus-assoziierte PilC-Protein (Meyer et al., Deutsche Patentanmeldung P 43 36 530.2; Normark und Jonsson, PCT-Anmeldung WO 92/13 871).  (a) Active capsule-specific vaccines against meningococcal infections in serogroups A and C have already been obtained, but no other serogroups, including the widespread serogroup B, have been described. In addition, however, other starting points for the development of effective Neisserie vaccines have been described, for example based on proteins the outer membrane, in particular the porine (Wiertz, 1993), and / or are directed against essential adhesins, in particular the Pilus-associated PilC protein (Meyer et al., German patent application P 43 36 530.2; Normark and Jonsson, PCT application) WO 92/13 871).
(b) Passive Immunisierungen mittels spezifischer Antikörper oder T-Zellen, die gegen entsprechende Komponenten der Neisserien gerichtet sind, können ebenfalls als wirksamer Schutz vor Neisserien-induzierten Autoimmun- und Viruskrankheiten verwendet werden.  (b) Passive immunizations by means of specific antibodies or T cells which are directed against corresponding components of the Neisseries can also be used as effective protection against Neisseries-induced autoimmune and viral diseases.
(c) Eine weitere Möglichkeit zur Bekämpfung von Neisserien-Infektionen und darauf beruhender Autoimmun- und Viruskrankheiten besteht in der Verabreichung von spezifischen Infektionshemmern, die die Vermehrung und oder die Infektion der menschlichen Schleimhäute mit pathogenen Neisserien verhindern. Als solche können beispielsweise spezifische Antibiotika gegen Neisserien und Rezeptoranaloga, die die Bindung der Neisserien an zelluläre Rezeptoren verhindern, verwendet werden. Besonders wirksame Rezeptoranaloga stellen solche Substanzen dar, die die PilC-vermittelte Bindung der Neisserien an menschliche Epithelzellen verhindern (Deutsche Patentanmeldung P 43 36 530.2) oder die von Opa- Proteinen vermittelte zelluläre Invasivität der Neisserien blockieren (Beispiel 15). Zu letzteren Substanzen, die die Invasivität der Neisserien blockieren, zählen u.a. Verbindungen, die strukturelle Ähnlichkeiten mit Heparansulfaten besitzen (z.B. Heparin, Beispiel 15).  (c) A further possibility for combating Neisseries infections and autoimmune and viral diseases based thereon is the administration of specific infection inhibitors which prevent the multiplication and or the infection of the human mucous membranes with pathogenic Neisseries. As such, specific antibiotics against Neisseries and receptor analogs that prevent the binding of the Neisseries to cellular receptors can be used, for example. Particularly effective receptor analogs are substances which prevent the PilC-mediated binding of the Neisseries to human epithelial cells (German patent application P 43 36 530.2) or block the cellular invasiveness of the Neisseries mediated by opa proteins (Example 15). The latter substances, which block the invasiveness of the Neisseries, include Compounds that have structural similarities to heparan sulfates (e.g. heparin, example 15).
(d) Eine kombinierte Methode zur Bekämpfung von Neisserieninfektionen besteht in der Verabreichung eines Li ganden der Neisserien-Oberfläche, der mit einem Antigen gekoppelt ist. Durch Bindung des Liganden an die NeisserienOberfläche wird somit ein bestimmtes Antigen auf der Bakterienoberfläche deponiert. Werden gegen dieses Antigen Antikörper gebildet, so können die Antikörper über den Liganden an die Bakterienoberfläche binden und das Bakterium über eine der bekannten Reaktionen inaktivieren. Diese Möglichkeit der Erregereliminierung ist insbesondere für den Fall der Neisserien geeignet, da diese Bakterien strukturell und antigen-variable Oberflächenkomponenten ausprägen (Robertson und Meyer, 1992). Da viele variable Oberflächenproteine jedoch konservierte rezeptorbindende bzw. ligandenbindende Eigenschaften ausprägen, können die Neisserien über den Weg des Liganden effektiv eliminiert werden. Beispiele für Neisserien-Proteine mit einer konservierten Bindung von Liganden sind das PorB (oder P.I-Porin), das Purinnukleo- tidtriphosphate bindet (Rudel, 1994), ein Gangliosyltetrao- sylceramid-bindendes Oberflächenadhäsin (Paruchuri, 1990) und das oberflächengebundene PilC-Protein der Neisserien (Rudel, 1994). Die Liganden dieser bakteriellen Rezeptoren werden vorzugsweise mit einem Antigen gekoppelt, gegen das bereits wirksame Antikörper vorliegen; es ist jedoch auch möglich eine aktive Immunisierung gegen das gekoppelte Antigen durchzuführen bzw. antigenspezifische Antikörper passiv zu verabreichen, es is auch möglich, den Liganden derart zu verändern, daß seine Affinität zur Bakterienoberfläche gesteigert wird. (d) A combined method to combat Neisseries infections is to administer a Li found the Neisserien surface, which is coupled with an antigen. By binding the ligand to the Neisserie surface, a certain antigen is deposited on the bacterial surface. If antibodies against this antigen are formed, the antibodies can bind to the bacterial surface via the ligand and inactivate the bacterium via one of the known reactions. This possibility of pathogen elimination is particularly suitable in the case of the Neisseries, since these bacteria form structural and antigen-variable surface components (Robertson and Meyer, 1992). However, since many variable surface proteins express conserved receptor-binding or ligand-binding properties, the Neisseries can be effectively eliminated via the path of the ligand. Examples of Neisserie proteins with a conserved binding of ligands are the PorB (or PI-Porin), which binds purine nucleotide triphosphates (Rudel, 1994), a gangliosyl tetraosylceramide binding surface adhesin (Paruchuri, 1990) and the surface-bound PilC protein the Neisseries (Rudel, 1994). The ligands of these bacterial receptors are preferably coupled with an antigen against which antibodies are already active; However, it is also possible to carry out an active immunization against the coupled antigen or to passively administer antigen-specific antibodies. It is also possible to change the ligand in such a way that its affinity for the bacterial surface is increased.
B Kompetition um Neisserien-spezifische Rezeptoren B Competition for Neisserie-specific receptors
Es ist bekannt, daß pathogene und nicht-pathogene Neisserien z.T. sehr ähnliche bzw. identische Rezeptoren auf der Schleimhaut des Menschen erkennen und zur Infektion benutzen. Es ist daher möglich, nicht-pathogene oder attenu- ierte Neisserien zur Verdrängung von pathogenen, IgA-Protease-produzierenden Neisserien zu benutzen. Durch eine derartige Kompetition um die Rezeptoren auf den menschlichen Schleimhäuten können Infektionen mit pathogenen Neisserien weitgehend unterbunden werden. It is known that pathogenic and non-pathogenic Neisseries sometimes recognize very similar or identical receptors on the mucous membrane of humans and use them for infection. It is therefore possible to use non-pathogenic or attenuated Neisseries to replace pathogenic, IgA protease-producing Neisseries. Through such a competition for the receptors on the human Mucous membranes can be largely prevented from infections with pathogenic Neisseries.
C Inhibition der IPP-Funktionen C Inhibition of IPP functions
Als auslösendes Agens von Neisserien-induzierten Autoimmunkrankheiten bestimmter viraler Krankheiten wurde IPP nachgewiesen. Demnach dienen zur Bekämpfung solcher Krankheiten Substanzen (einschließlich Impfstoffe), die gegen die enzymatischen Aktivitäten des IPP gerichtet sind. So verhindert die Ausprägung der IgA-Protease-Aktivität im IPP beispielsweise die Freisetzung des 7-Peptids, das eine zentrale Rolle bei der Autoimmunpathogenese spielt. Als wirksamer spezifischer Inhibitor der proteolytischen Aktivität der IgA-Protease wurden synthetische Peptide der Struktur RboroPro-OH beschrieben (Bachovchin et al., 1990). Solche oder ähnlich wirkende Substanzen können daher zur Bekämpfung von Autoimmunkrankheiten eingesetzt werden.  IPP has been shown to trigger Neisserie-induced autoimmune diseases of certain viral diseases. Accordingly, substances (including vaccines) are used to combat such diseases, which are directed against the enzymatic activities of the IPP. For example, the level of IgA protease activity in the IPP prevents the release of the 7-peptide, which plays a central role in autoimmune pathogenesis. Synthetic peptides of the structure RboroPro-OH have been described as an effective specific inhibitor of the proteolytic activity of the IgA protease (Bachovchin et al., 1990). Such or similar substances can therefore be used to combat autoimmune diseases.
Desweiteren können Substanzen eingesetzt werden, die auf andere Funktionen des IPP oder seiner einzelnen Bestandteile inhibitorisch wirken. Insbesondere können Substanzen verwendet werden, die zu einer Hemmung der Aspartyl-Protease der β-Domäne oder zu einer Blockierung der Aufnahme des α- Proteins in menschliche Zellen oder deren Nukleus führen. D Nutzbarmachung von Funktionen des IPP  Furthermore, substances can be used which have an inhibitory effect on other functions of the IPP or its individual components. In particular, substances can be used which lead to an inhibition of the aspartyl protease of the β domain or to a blocking of the uptake of the α protein in human cells or their nucleus. D Utilization of functions of the IPP
Eine besondere Eigenschaft der Neisserien IPPs ist ihr intrazellulärer Wirkort. Die Beschreibung macht deutlich, daß ein Neisserien IPP bzw. dessen Spaltprodukte zahlreiche Funktionen enthält, die intrazellulär wirksam werden. Durch Verwendung der intrazellulären Transportfunktion eines Neisserien IPP und insbesondere des α-Proteins ist es möglich, auch andere biologische Moleküle an genau den Wirkort zu transportieren wo das native IPP bzw. dessen Spaltprodukte ihre natürlichen Wirkungen entfalten. Es ist daher möglich, an den natürlichen Wirkort eines IPP Substanzen zu transportieren, die die natürliche biologische Funktion eines IPP inhibieren. Es ist ebenso möglich, Moleküle zu transportieren, die Folgereaktionen (z.B. die Replikation von viralen Elementen) inhibieren und damit eine Autoimmunreaktion bzw. die Virusvermehrung begrenzen. So ist es beispielsweise möglich, spezifische Antikörper oder Antikörperfragmente in menschliche Zellen bis in den Nukleus zu schleusen und auf diese Weise pathologische Reaktionen zu stoppen. Ein alternatives Verfahren besteht darin, IPPs derart zu modifizieren, daß sie ihre natürliche Funktion nicht mehr ausüben können, sondern vielmehr IPP-spezifische Reaktionen blockieren. In einem weiteren Verfahren werden mit Hilfe der IPP-Transportfunktionen Nukleinsäuren in menschliche Zellen eingeschleust, die ihrerseits antagonistische Funktionen des IPP bzw. seiner Folgereaktionen ausüben und somit eine Autoimmunreaktion bzw. eine Virusvermehrung unterbinden. Derartige Nukleinsäureabschnitte könnten für inhibitorische Proteine kodieren und als DNA in das Genom der betroffenen Zelle integrieren oder eine von zahlreichen anderen inhibitorischen Eigenschaften besitzen. Der besondere Vorteil dieser Methode ist, daß mittels der IPP-Transportfunktion inhibitorische Moleküle in die selben Zellen eines Organismus gelangten, die auch unter natürlichen Bedingungen von den IPPs der Neisserien betroffen werden. A special feature of the Neisseries IPPs is their intracellular site of action. The description makes it clear that a Neisserie IPP or its cleavage products contain numerous functions that have an intracellular effect. By using the intracellular transport function of a Neisserien IPP and in particular the α-protein, it is possible to transport other biological molecules to the exact site where the native IPP or its cleavage products develop their natural effects. It is therefore possible to transport substances to the natural site of action of an IPP that inhibit the natural biological function of an IPP. It is also possible to add molecules transport, inhibit the subsequent reactions (eg replication of viral elements) and thus limit an autoimmune reaction or virus multiplication. For example, it is possible to channel specific antibodies or antibody fragments into human cells down to the nucleus and thus stop pathological reactions. An alternative method is to modify IPPs in such a way that they can no longer carry out their natural function, but rather block IPP-specific reactions. In a further method, the IPP transport functions are used to introduce nucleic acids into human cells, which in turn carry out antagonistic functions of the IPP or its subsequent reactions and thus prevent an autoimmune reaction or virus multiplication. Such nucleic acid segments could code for inhibitory proteins and integrate them as DNA into the genome of the affected cell or have one of numerous other inhibitory properties. The particular advantage of this method is that by means of the IPP transport function, inhibitory molecules get into the same cells of an organism that are affected by the Neisseries IPPs even under natural conditions.
Zu diesen unter natürlichen Bedingungen betroffenen menschlichen Zellen zählen insbesondere bestimmte Zellen der menschlichen Schleimhaut (z.B. des Nasopharynx) und bestimmte Zellen im menschlichen Blut. These human cells affected under natural conditions include in particular certain cells of the human mucosa (e.g. the nasopharynx) and certain cells in human blood.
Eine weitere Möglichkeit, die Targeting-Eigenschaften des alpha-Proteins nutzbar zu machen, besteht in der chemischen Synthese von analogen Peptiden, die Teilbereiche des alpha- Proteins darstellen und ähnliche Transport- und Targetingeigenschaften besitzen. Ein Vorteil chemisch synthetisierter Peptide besteht insbesondere in der Möglichkeit, aktive Gruppen einzuführen, die zur Kopplung an biologisch wirksame Substanzen wie aktive Proteine, Nukleinsäuren bzw. andere Substanzen verwendet werden können. Somit kann das α-Protein auch für "gene targeting" -Experimente verwendet werden. E Eliminierung IPP-betroffener Zellen mittels spezifischer Antikörper oder cytotoxischer T-Tellen A further possibility for utilizing the targeting properties of the alpha protein consists in the chemical synthesis of analog peptides, which represent partial areas of the alpha protein and have similar transport and targeting properties. An advantage of chemically synthesized peptides is, in particular, the possibility of introducing active groups that are coupled to biologically active groups Substances such as active proteins, nucleic acids or other substances can be used. Thus, the α-protein can also be used for "gene targeting" experiments. E Elimination of IPP-affected cells using specific antibodies or cytotoxic T-sites
Menschliche Zellen, die durch Aufnahme extrazellulären IPPs oder durch Infektion mit pathogenen Neisserien betroffen sind, präsentieren IPP-abgeleitete Peptide auf ihren MHC-Molekülen. Dieser Umstand läßt sich nutzen, um betroffene Zellen, wie nachfolgend beschrieben, spezifisch zu eliminieren:  Human cells that are affected by uptake of extracellular IPPs or by infection with pathogenic Neisseries present IPP-derived peptides on their MHC molecules. This fact can be used to specifically eliminate affected cells as described below:
(a) IPP-abgeleitete Peptide, die auf MHC-Klasse I präsentiert werden, können von CD8+ T-Zellen spezifisch erkannt und eliminiert werden. Es ist möglich, solche spezifischen T-Zellen durch Klonierung in vitro zu vermehren und in betroffene Individuen zurückzubringen. Voraussetzung für diese Anwendung ist jedoch, daß diese spezifischen T-Zellen nicht gegen Selbst-Antigene reagieren; dies kann durch geeignete Screening-Verfahren ausgeschlossen werden. (a) IPP-derived peptides presented on MHC class I can be specifically recognized and eliminated by CD8 + T cells. It is possible to multiply such specific T cells by cloning in vitro and to return them to affected individuals. A prerequisite for this application, however, is that these specific T cells do not react against self-antigens; this can be ruled out by suitable screening procedures.
(b) Entsprechend ist es möglich, IPP-abgeleitete Peptide, die entweder MHC Klasse I oder Klasse II präsentiert werden, mittels spezifischer monoklonaler Antikörper, die mittels bekannter Verfahren (z.B. durch Hybridomatechnik, Humanisierung tierischer Antikörper und/oder rekombinante Antikörpertechnologie) gewonnen werden, zu eliminieren. Dies kann dadurch erfolgen, daß der gebundene Antikörper das Komplementsystem aktiviert oder eine Antikörper-abhängige zytotoxische zellvermittelte Reaktion (ADCC) hervorruft, was jeweils die Eliminierung betroffener antigenpräsentierender Zellen zur Folge hat. Auch hierbei muß durch vorangegangenes Screening sichergestellt sein, daß der gewonnene Antikörper nicht gegen Selbst-Antigene gerichtet ist. F Toleranzerzeugung durch antigenspezifische, suppressive T-Zellen (b) Accordingly, it is possible to use IPP-derived peptides that are presented either MHC class I or class II by means of specific monoclonal antibodies, which are obtained by known methods (for example by hybridoma technology, humanization of animal antibodies and / or recombinant antibody technology), to eliminate. This can take place in that the bound antibody activates the complement system or elicits an antibody-dependent cytotoxic cell-mediated reaction (ADCC), which in each case results in the elimination of affected antigen-presenting cells. Here, too, previous screening must ensure that the antibody obtained is not directed against self-antigens. F Generation of tolerance by antigen-specific, suppressive T cells
(a) Gegen Selbst gerichtete T-Zellen können vorwiegend aktivierende oder vorwiegend supprimierende Eigenschaften ausprägen. Für den Fall, daß vorwiegend aktivierende T-Zellen vorhanden sind, wird die Autoimmunreaktion begünstigt. Andererseits kann eine Autoimmunreaktion unterdrückt werden, wenn neben den aktivierenden T-Zellen genügend supprimierende T-Zellen vorhanden sind. Durch Stimulierung bzw. Vermehrung der antigenspezifischen supprimierenden T-Zellen kann also eine Autoimmunreaktion unterdrückt werden. Die Stimulierung supprimierender T-Zellen hängt von organ- und zellspezifischen Parametern der Antigenpräsentation von Selbst-Peptiden bzw. Selbst-ähnlichen Peptiden ab (Mitchison, 1993). So können beispielsweise durch orale Gabe solcher Peptide vorwiegend supprimierende T-Zellen erzeugt und die Autoimmunreaktion unterdrückt werden.  (a) T-cells directed against self can have predominantly activating or predominantly suppressive properties. In the event that predominantly activating T cells are present, the autoimmune reaction is favored. On the other hand, an autoimmune reaction can be suppressed if there are sufficient suppressing T cells in addition to the activating T cells. An autoimmune reaction can thus be suppressed by stimulating or increasing the antigen-specific suppressing T cells. The stimulation of suppressing T cells depends on organ and cell-specific parameters of the antigen presentation of self-peptides or self-similar peptides (Mitchison, 1993). For example, predominantly suppressive T cells can be generated by oral administration of such peptides and the autoimmune reaction can be suppressed.
(b) Entsprechend ist es möglich, antigenspezifische supprimierende T-Zellenaus Patienten zu isolieren, in vitro zu vermehren und die vermehrten T-Zellen in großer Zahl in geeigneter Form zu verabreichen. Diese T-Zellen können sodann supprimierend auf die entsprechenden aktivierenden antigenspezifischen T-Zellen einwirken und so die antigenspezifische Autoimmunreaktion unterdrücken. Die in vitro- Vermehrung der supprimierenden T-Zellen erfolgt unter bekannten Standardbedingungen wie sie in Beispiel 6 beschrieben werden.  (b) Accordingly, it is possible to isolate antigen-specific suppressing T cells from patients, to multiply them in vitro, and to administer the multiplicated T cells in a suitable form in large numbers. These T cells can then suppress the corresponding activating antigen-specific T cells and thus suppress the antigen-specific autoimmune reaction. The in vitro propagation of the suppressing T cells takes place under known standard conditions as described in Example 6.
(c) Entsprechend können antigenspezifische T-Zellen durch genetische Manipulation in vitro verändert werden, so daß sie die Eigenschaften von supprimierenden T-Zellen annehmen. Dies geschieht beispielsweise durch die Transfektion von T-Zellen mit den funktionellen Genen supprimierender Interleukine. die hierzu verwendeten Methoden entsprechen dem Stand der Technik. G Entwicklung einer T-Zell-Vakzine (c) Accordingly, antigen-specific T cells can be modified by genetic manipulation in vitro so that they assume the properties of suppressing T cells. This is done, for example, by transfecting T cells with the functional genes of suppressing interleukins. the methods used for this correspond to the state of the art. G Development of a T cell vaccine
(a) Da autoreaktive T-Zellen mit kontrollierenden T- Zellen ein Gleichgewicht bilden, das bei Autoimmunkrankheiten gestört ist, besteht weiterhin die Möglichkeit, autoreaktive T-Zellen durch Vakzinierung zu eliminieren (Zhang et al., 199.3; Atlan et al., 1994). Die Entwicklung einer T- Zell-Vakzine ist immer dann möglich, wenn das Selbst-Antigen bekannt ist und so die Herstellung antigenspezifischer attenuierter T-Zellen in vitro ermöglicht wird.  (a) Since autoreactive T cells form a balance with controlling T cells that are disturbed in autoimmune diseases, there is still the possibility of eliminating autoreactive T cells by vaccination (Zhang et al., 199.3; Atlan et al., 1994 ). The development of a T-cell vaccine is always possible if the self-antigen is known and thus the production of antigen-specific attenuated T cells is made possible in vitro.
(b) Bei Autoimmunkrankheiten spielen oftmals autoreaktive T-Zellen mit bestimmten an variablen Vβ bzw. Vα-Ketten des T-Zell-Rezeptors ein Rolle. Solche klonalen autoreaktiven T-Zellen, die möglicherweise durch die Einwirkung eines Superantigens entstanden sind, können ebenfalls für die Herstellung einer T-Zell-Vakzine verwendet werden. (b) In autoimmune diseases, autoreactive T cells with certain variable V β or V α chains of the T cell receptor often play a role. Such clonal autoreactive T cells, which may have arisen from the action of a superantigen, can also be used for the production of a T cell vaccine.
(c) Andererseits ist es auch möglich, gegen antigenspezifische autoreaktive T-Zellen Antikörper zu entwickeln, die spezifisch gegen autoreaktive T-Zellen reagieren und somit die Elimination der autoreaktiven T-Zellen ermöglichen.  (c) On the other hand, it is also possible to develop antibodies against antigen-specific autoreactive T cells which react specifically against autoreactive T cells and thus enable the autoreactive T cells to be eliminated.
H Kompetitive bzw. anergisierende Peptide und peptidanaloge Agentien H Competitive or anergizing peptides and peptide-analogous agents
Einzelne MHC-Moleküle binden jeweils eine Vielzahl unterschiedlicher Peptide. Es ist daher auch möglich, MHC-Moleküle mit Peptiden zu beladen, die entweder keine autoreak¬ tive T-Zell-Aktivierung ermöglichen oder autoreaktive T-Zellen anergisieren. Individual MHC molecules bind a large number of different peptides. It is therefore also possible to load the MHC molecules with peptides that allow either no autoreak ¬ tive T-cell activation or anergize autoreactive T-cells.
I Diagnostika für den direkten Nachweis des ätiologischen Agens von Autoimmun- und Viruskrankheiten des Menschen sowie für die Kontrolle der Wirkung von Arzneimitteln I Diagnostics for the direct detection of the etiological agent of autoimmune and viral diseases in humans as well as for the control of the effect of drugs
Auslöser der erfindungsgemäßen Autoimmun- und Virus bedingten Krankheiten sind die bakteriellen Polyproteine (BPPs) bzw. die BPP-bildenden Bakterien. Gegenstand dieser Erfindung sind daher diagnostische Verfahren, die sich für einen qualitativen oder quantitativen Nachweis von BPPs bzw. der sie bildenden Bakterien eignen. Hierzu zählen bekannte mikrobiologische, direkte (antigenspezifische) und indirekte (antikörperspezifische, T-Zell-spezifische) immunologische, sowie enzymatische und genanalytische Nachweismethoden. Zu den genanalytischen Methoden zählen insbesondere die Polymerase-Chain-Reaction (PCR) und DNA-Hybridiesierungsmethoden. Die genannten Nachweisverfahren betreffen insbesondere die pathogenen Neisserien und die von ihnen gebildeten IPPs. The autoimmune and virus-related diseases according to the invention are triggered by the bacterial polyproteins (BPPs) or the BPP-forming bacteria. This invention therefore relates to diagnostic methods which are suitable for a qualitative or quantitative detection of BPPs or the bacteria which form them. These include known microbiological, direct (antigen-specific) and indirect (antibody-specific, T-cell-specific) immunological, as well as enzymatic and gene-analytical detection methods. The gene analysis methods include in particular the polymerase chain reaction (PCR) and DNA hybridization methods. The detection methods mentioned relate in particular to the pathogenic Neisseries and the IPPs they have formed.
J Diagnostika für den Nachweis und die Überwachung des Verlaufs von Autoimmun- und Viruskrankheiten des Menschen sowie für die Kontrolle der Wirkung von Arzneimitteln J Diagnostics for the detection and monitoring of the course of autoimmune and viral diseases in humans as well as for the control of the effect of drugs
Die dargestellten Krankheitsformen durchlaufen mehrere Stadien. Die Kenntnis des genauen Stadiums des Krankheitsverlaufs ist wichtig für eine gezielte therapeutische oder vorbeugende Behandlung. Gegenstand dieser Erfindung sind daher diagnostische Verfahren, die Aufschluß über den Krankheitsverlauf geben. Hierzu zählen Verfahren zum quantitativen und qualitativen Nachweis des Immunstatus und der antigenspezifischen Immunreaktionen auf B- und T-Zellebene. Desweiteren zählen hierzu Verfahren zum Nachweis der Aktivierung von Viren bzw. viralen Elementen beispielsweise mittels genanalytischer (z.B. PCR Techniken; Hermann und Kalden, 1994) und/oder enzymatischer (z.B. Nachweis von Reverser Transcriptase-Aktivität). Darüber hinaus zählen hierzu Nachweisverfahren anderer typischer Wirkungen bakterieller BPPs und insbesondere der Neisserien IPPs.  The forms of disease shown go through several stages. Knowing the exact stage of the course of the disease is important for targeted therapeutic or preventive treatment. This invention therefore relates to diagnostic methods which provide information about the course of the disease. These include methods for the quantitative and qualitative detection of the immune status and the antigen-specific immune reactions at the B and T cell levels. Furthermore, this includes methods for the detection of the activation of viruses or viral elements, for example by means of genetic analysis (e.g. PCR techniques; Hermann and Kalden, 1994) and / or enzymatic (e.g. detection of reverse transcriptase activity). In addition, this includes detection methods of other typical effects of bacterial BPPs and in particular the Neisserie IPPs.
K Davon abgeleitete diagnostische Kits etc. K Diagnostic kits etc. derived from this
L Kurzfassung der erfindungsgemäßen Verfahren L Summary of the method according to the invention
(a) Zusammenfassend ermöglichen die in dieser Erfindung dargestellten Ergebnisse eine Vielzahl neuer antigenspezifischer Verfahren zur Therapie- bzw. Vorbeugung gegen Autoimmun- und Viruskrankheiten des Menschen. Hierzu zählen die oben beispielhaft aufgeführten und weitere, in der Literatur beschriebene Therapieformen (z.B. Bläß, 1994; Tisch et al., 1994 und darin zitierte Literatur). Den antigenspezifischen Therapieformen liegen - bezogen auf die Rolle der pathogenen Neisserien - folgende Antigene zugrunde: * Peptide der Iga-Genprodukte der pathogenen Neisserien,(a) In summary, the results presented in this invention enable a large number of new antigen-specific methods for therapy or prevention against autoimmune and viral diseases in humans. These include the examples of therapy listed above and other forms of therapy described in the literature (eg Bläß, 1994; Tisch et al., 1994 and the literature cited therein). The antigen-specific forms of therapy - based on the role of the pathogenic Neisseries - are based on the following antigens: * Peptides of the Iga gene products of the pathogenic Neisseries,
* entsprechende homologe Peptide menschlicher Proteine,* corresponding homologous peptides of human proteins,
* durch die Wirkung der Iga-Genprodukte gebildete autoreaktive Peptide, * autoreactive peptides formed by the action of the Iga gene products,
* durch die Wirkung der Iga-Genprodukte hervorgerufene, von * caused by the action of Iga gene products
Viren bzw. endogenen Viren kodierte Peptide und Viruses or endogenous viruses encoded peptides and
* und zu solchen viralen Peptiden homologe menschliche Peptide.  * and human peptides homologous to such viral peptides.
(b) Desweiteren sind Gegenstand dieser Erfindung alle oben beispielhaft aufgeführten Verfahren zur Therapie von, oder zur Vorbeugung gegen Autoimmun- und Viruskrankheiten des Menschen, die direkt oder indirekt gegen die biologische Wirkung bakterieller Polyproteine (BPPs), insbesondere der Neisserien IPPs, gerichtet sind. Zu diesen Verfahren zählen insbesondere  (b) This invention furthermore relates to all of the methods exemplified above for the therapy of or for the prevention of autoimmune and viral diseases in humans which are directed directly or indirectly against the biological action of bacterial polyproteins (BPPs), in particular the Neisseries IPPs. These procedures include in particular
* gegen Infektionen mit pathogenen Neisserien gerichtete Verfahren,  * procedures against infections with pathogenic Neisseries,
* gegen ein IPP von pathogenen Neisserien oder dessen Spaltprodukte gerichtetes Verfahren und  * procedure directed against an IPP of pathogenic Neisseries or its fission products and
* Verfahren, die sich eine oder mehrere spezifische Eigenschaften der Neisserien IPPs zunutzemachen.  * Procedures that take advantage of one or more specific properties of the new series IPPs.
(c) Desweiteren sind Gegenstand dieser Erfindung diagnostische Verfahren, sofern sie sich aus den oben genannten Ergebnissen ableiten und die für die Diagnostik von Autoimmun- und Viruskrankheiten des Menschen von Belang sind. Hierzu zählen insbesondere  (c) This invention furthermore relates to diagnostic methods insofar as they are derived from the results mentioned above and which are of importance for the diagnosis of autoimmune and viral diseases in humans. These include in particular
* Verfahren, die auf der direkten oder indirekten Verwendung eines oder mehrerer der oben unter L(a) genannten Peptide beruhen,  * Methods which are based on the direct or indirect use of one or more of the peptides mentioned under L (a) above,
* immunologische Verfahren  * immunological procedures
* Verfahren zum Nachweis pathogener Neisserien  * Procedure for the detection of pathogenic Neisseries
* Verfahren zum direkten oder indirekten Nachweis von Viren oder viralen Elementen, die durch die Wirkung pathogener Neisserien bzw. eines Neisserien-IPP aktiviert worden sind, bzw. deren Genprodukte oder Reaktionen, die durch die Wirkung pathogener Neisserien bzw. eines Neisserien-IPP hervorgerufen worden sind. Definitionen * Methods for the direct or indirect detection of viruses or viral elements which have been activated by the action of pathogenic Neisseries or a Neisseries IPP, or their gene products or reactions which have been caused by the action of pathogenic Neisseries or a Neisseries IPP are. Definitions
Die hier verwendete Bezeichnung "BPP" bezieht sich auf bakterielle Polyproteine im Allgemeinen und schließt die IgA- Protease-Polyproteine von pathogenen Neisserien (IPPs) mit ein. Der Begriff "IPP" bezieht sich nicht nur auf das unmittelbare Genprodukt des iga-Gens der pathogenen Neisserien, sondern auch auf die bei der nachfolgenden autoproteolytischen Prozessierung entstehenden Folgeprodukte "IgA-Protease", "α-Protein", "7-Peptid" und ß-Domäne bzw. intermediäre Fusionen dieser Proteine. The term "BPP" as used herein refers to bacterial polyproteins in general and includes the IgA protease polyproteins from pathogenic Neisseries (IPPs). The term "IPP" refers not only to the direct gene product of the iga gene of the pathogenic Neisseries, but also to the secondary products "IgA protease", "α-protein", "7-peptide" and β-domain or intermediate fusions of these proteins.
Der Begriff pathogene Neisserien bezieht sich auf Neisseria gonorrhoeae und Neisseria meningitidis . Sofern der Begriff "Neisserien" nicht näher erläutert wird, schließt er zumindest die beiden pathogenen Neisserien mit ein.  The term pathogenic Neisseria refers to Neisseria gonorrhoeae and Neisseria meningitidis. If the term "Neisseries" is not explained in more detail, it includes at least the two pathogenic Neisseries.
Unter dem Begriff Viruskrankheiten werden pathogeneti- sche Prozesse verstanden, die eine Folge der Aktivierung von Viren oder viralen Elementen sind, wobei die Aktivierung durch bakterielle Krankheitserreger bzw. deren BPPs bewirkt wird. Die Aktivierung erfolgt insbesondere durch die Einwirkung eines IPP von pathogenen Neisserien auf menschliche Zellen. Unter dem Begriff "Viren" werden Viren verstanden, die in ihrer Genexpression und oder Replikation eine Aktivierung durch BPPs, insbesondere ein IPP pathogener Neisserien, erfahren. Es ist nicht auszuschließen, daß unterschiedliche IPPs pathogener Neisserien qualitativ und quantitativ unterschiedliche Wirkungen auf Viren oder virale Elemente ausüben. Der Begriff Viren bezieht sich auf genetisch vollständige Viren bzw. Virusgenome (z.B. HIV bzw. HlV-Provirus), während sich der Begriff virale Elemente auf genetisch unvollständige virale Genome (z.B. endogene Retroviren) bezieht.  The term viral diseases is understood to mean pathogenetic processes which are a consequence of the activation of viruses or viral elements, the activation being brought about by bacterial pathogens or their BPPs. The activation takes place in particular through the action of an IPP of pathogenic Neisseries on human cells. The term “viruses” is understood to mean viruses which are activated by BPPs, in particular an IPP of pathogenic Neisseries, in their gene expression and or replication. It cannot be ruled out that different IPPs of pathogenic Neisseries have qualitatively and quantitatively different effects on viruses or viral elements. The term viruses refers to genetically complete viruses or virus genomes (e.g. HIV or HIV provirus), while the term viral elements refers to genetically incomplete viral genomes (e.g. endogenous retroviruses).
Die Figuren zeigen: Figur 1 : DNA-Sequenzen und davon abgeleitete AminosäuresecruenzenThe figures show: Figure 1: DNA sequences and derived amino acid sequences
(im Einbuchstabencode) von N. meningitidis iga-Domänen. (in single letter code) of N. meningitidis iga domains.
In den IgA-Proteasegenen von Memngokokken existieren zwei alleleigaα-Bereiche, wobei igaα3 ca. 475 Basenpaare und igaα4 ca 1175 There are two alleleigaα regions in the IgA protease genes of memngococci, with igaα3 approx. 475 base pairs and igaα4 approx. 1175
Basenpaare umfaßt. Die Igaα3- und Igaα4-Domänen zeigen untereinander wie auch zu den entsprechenden Igaα1- und Igaα2-Domänen von N. gonorrhoeae ausgeprägte Homologien in den Primär- undIncludes base pairs. The Igaα3 and Igaα4 domains show pronounced homologies with each other as well as with the corresponding Igaα1 and Igaα2 domains of N. gonorrhoeae in the primary and
Sekundärstrukturen. Die Igaγ2-Allele stimmen bis auf die Aminosäure an Position 4 mit dem Igaγ1-Allel von N. gonorrhoeae überein. Die zugehörigen DNA-Sequenzen igaγ2 und igaγ2* unterscheiden sich in der Base an Position 93. Das igaγ3-Allel weist gegenüber igaγ2 eine Deletion von 4 Triplets im zentralen Bereich auf. Das igaγ4-Allel zeigt neben dieser Deletion eine Konversion von Glycin-Alanin zu Senn-Prolin auf, die durch einen Ersatz von G durch A an Position 49 und einen Ersatz von G durch C an Position 52 der entsprechenden kodierenden Region bedingt ist. Secondary structures. The Igaγ2 alleles are identical to the Igaγ1 allele of N. gonorrhoeae except for the amino acid at position 4. The associated DNA sequences igaγ2 and igaγ2 * differ in the base at position 93. The igaγ3 allele has a deletion of 4 triplets in the central region compared to igaγ2. In addition to this deletion, the igaγ4 allele shows a conversion of glycine-alanine to Senn-proline, which is due to a replacement of G by A at position 49 and a replacement of G by C at position 52 of the corresponding coding region.
Figur 2: Homologien zwischen Aminosäuresequenzen des IgA-Proteasevorläufers (IPP) pathogener Neisserien und verschiedenen humanen Proteinen. Figure 2: Homologies between amino acid sequences of the IgA protease precursor (IPP) of pathogenic Neisseries and various human proteins.
Igap, Igaγ, Igaα und Igaß bezeichnen die verschiedenen Domänen des Iga-Protems, die unterschiedliche Funktionen erfüllen und die durch spezifische Autoproteolyse aufgespalten werden {Pohlner et al., 1987). Die Sequenzen sind im Einbuchstabenkode m der Orientierung vom Amino- zum Carboxylende angegeben. Die Nummern am Aminoende der Sequenzausschnitte geben die entsprechenden Positionen im Iga- Protein von N. gonorrhoeae MS11 (Igap, Igaγ, Igaα1 und Igaß; (Pohlner et al., 1987), N. gonorrhoeae R16 (Igaα2; Halter et al., 1989) und N. meningitidis B1939 (Igaα4 Position bezogen auf Aminoende vom α-Protein) sowie die Sequenzposition in den humanen Proteinen an. Identische Aminosäurepositionen zwischen Iga- Protemen und den menschlichen Proteinen sind durch Einrahmungen hervorgehoben. Positionen, die mit Aminosäuren ähnlicher Eigenschaften besetzt sind, sind fett gedruckt. Abkürzungen: Hs47, 47 kd Hitzeschockprotein; Rsmb, Small Nuclear Ribonucleoprotein assoziiertes Protein; Nfh, Neurofllament Triplet h Protein; Qxyb, Oxysterol-Bmdungsprotein. Figur 3 : Homologien zwischen Ammosäuresequenzen des γ-Peptides pathogener Neisserien (hier N. gonorrhoeae MS11 und R16) und verschiedener Bindegewebsproteine des Menschen. Igap, Igaγ, Igaα and Igass denote the different domains of the Iga proteme, which have different functions and which are broken down by specific autoproteolysis {Pohlner et al., 1987). The sequences are given in the one-letter code in the orientation from the amino to the carboxyl end. The numbers at the amino end of the sequence sections indicate the corresponding positions in the Iga protein of N. gonorrhoeae MS11 (Igap, Igaγ, Igaα1 and Igass; (Pohlner et al., 1987), N. gonorrhoeae R16 (Igaα2; Halter et al., 1989 ) and N. meningitidis B1939 (Igaα4 position based on the amino end of the α protein) and the sequence position in the human proteins. Identical amino acid positions between IgA proteins and the human proteins are highlighted by frames. Positions which are occupied by amino acids with similar properties Abbreviations: Hs47, 47 kd heat shock protein; Rsmb, small nuclear ribonucleoprotein-associated protein; Nfh, neurofilament triplet h protein; Qxyb, oxysterol binding protein. Figure 3: Homologies between amino acid sequences of the γ-peptide of pathogenic Neisseries (here N. gonorrhoeae MS11 and R16) and various connective tissue proteins in humans.
Die erster, secns gezeigten Homologiebereiche stammen aus den häuf igsten Protein bestandteilen der extrazellulären Matrix des Knorpelgewebes. Das Link-Protein bildet mit Hyaluronsäure und dem Proteoglykan-Kernprotein riesige Aggregate, die durch Wasseraufnahme der Stabilisierung und Elastizität des Knorpels dienen Diese Smdegewebs bestandteile sind untereinander hoch konserviert und aus duplizierten Sequenzbereichen, den sogenannten Proteoglykan-Tandem- Repeats (PTR), aufgebaut. Während im Link-Protein und im Fibroblasten-Proteoglykan jeweils nur ein einzelner PTR existiert, besteht das Proteoglykan-Kernprotein aus zwei Domänen (G1 und G2) mit je zwei PTR's.  The first homology areas shown, come from the most common protein components of the extracellular matrix of the cartilage tissue. The link protein forms, with hyaluronic acid and the proteoglycan core protein, huge aggregates that serve to stabilize and elasticize the cartilage by absorbing water. While only a single PTR exists in the link protein and in the fibroblast proteoglycan, the proteoglycan core protein consists of two domains (G1 and G2) with two PTRs each.
Die Sequenzen sind im Einbuchstabenkode in der Orientierung vomThe sequences are in the one-letter code in the orientation of
Amino- zum Carboxylende angegeben. Das γ-Peptid ist in seiner vollenAmino specified to the carboxyl end. The γ peptide is in full
Länge dargestellt, wobei die Serinposition am Aminoende der Position 960 im Iga-Protein von N. gonorrhoeae MS11 entspricht (Pohlner et al., 1987). Die Nummern am Aminoende der Sequenzausschnitte geben die jeweiligen Positionen in den menschlichen Proteinen an. Identische Aminosäuren zwischen Igaγ-Allelen und den menschlichenLength shown, the serine position at the amino end corresponds to position 960 in the Iga protein of N. gonorrhoeae MS11 (Pohlner et al., 1987). The numbers at the amino end of the sequence sections indicate the respective positions in the human proteins. Identical amino acids between Igaγ alleles and human
Proteinen sind fett gedruckt. Positionen, die mit Aminosäuren ähnlicher Eigenschaften besetzt sind, sind unterstrichen. Im Anschluß an die Sequenzen ist die Identität mit dem γ-Peptid inProteins are printed in bold. Positions that are occupied by amino acids with similar properties are underlined. Following the sequences, the identity with the γ-peptide is in
Prozent angegeben. Percent specified.
Figur 4 : übersieht der Sequenzhomologien zwischen menschlichen Proteinen und IPP. Figure 4: overlooks the sequence homologies between human proteins and IPP.
1) Das Polyprotein IPP setzt sich zusammen aus dem Signalpeptid (S) dem enzymatischen Teil (P), dem γ-Peptid (γ), dem α-Peptid (α) und dem β-Core (β). Cys markiert die beiden m allen lPP s konservierten Cysteinreste. Darunter sind die Bereiche dargestellt, die sich bei der Sequenzanalyse verschiedener IPP's als konserviert oder variabel in N. gonorrhoeae (2) bzw. N. menigiαdis (3) erwiesen haben. 1) The polyprotein IPP is composed of the signal peptide (S), the enzymatic part (P), the γ-peptide (γ), the α-peptide (α) and the β-core (β). Cys marks the two cysteine residues preserved in all lPP s. Below are the areas that have been shown to be conserved or variable in N. gonorrhoeae (2) and N. menigiαdis (3) in the sequence analysis of various IPPs.
Schwarz markierte Domänen liegen jeweils variaoel, schräg gestreifteDomains marked in black are each variaoel, obliquely striped
Domänen liegen jeweils konserviert vor. Domains are conserved.
In den Zeilen 4 - 8 sind die Homologien zu menschlichen Proteinen dargestellt. In Zeile 4 und Zeile 5 markiert ein schwarzes Quadrat eine Homologie von 7 bzw.6 identiscnen Aminosäuren an einem Stück. Lines 4-8 show the homologies to human proteins. In lines 4 and 5, a black square marks a homology of 7 or 6 identical amino acids in one piece.
Die in der Zeile 6 mit einem Quadrat markierte Position zeigt einen Bereich inn erha lb des IPP an, der eine Sequenzhomologie zu einem menschlichen Protein von 5 inentischen Aminosäuren in Folge hat, wovei diese Homologie ein Teil eines Fensters ist, indem mindestens 7 von 10 Aminosäuren identisch sind. In den Zeilen 7 und 8 sind Sequenzhomologien der reversen Aminsoäuresequenz des lPP von N. gonorhoeae MS11 mit menschlichen Proteinen dargestellt, wobei ein Quadrat in siebten Zeile 7 identischen Aminosäuren an einem Stück entspricht, und ein Quadrat in Zeile 8 dementsprechend 6 Aminosäuren. The position marked with a square in line 6 shows one Range within the IPP that has sequence homology to a human protein of 5 essential amino acids in a row, this homology being part of a window in which at least 7 out of 10 amino acids are identical. Lines 7 and 8 show sequence homologies of the reverse amino acid sequence of the N. gonorhoeae MS11 lPP with human proteins, a square in the seventh line corresponding to 7 identical amino acids in one piece, and a square in line 8 correspondingly to 6 amino acids.
Figur 5 : Konstruktion des Expressionsplasmids pOK19. Figure 5: Construction of the expression plasmid pOK19.
Das 1032 bp große Insert des Plasmids pOK18 (weiß dargestellt) kodiert für das 339 Aminosäuren große Link-Protein (s. Fig.6) Nach Restriktion mit den Enzymen EcoRI und BamHI wurde es über dieselben Schnittstellen in den Vector pEV41a eingesetzt, wodurch das Expressionsplasmid pOK19 entstand. The 1032 bp insert of the plasmid pOK18 (shown in white) codes for the 339 amino acid link protein (see FIG. 6). After restriction with the enzymes EcoRI and BamHI, it was inserted into the vector pEV41a via the same interfaces, resulting in the expression plasmid pOK19 was created.
Figur 6: Aminosäuresequenz des menschlichen Link-Proteins. Figure 6: Amino acid sequence of the human link protein.
Die Sequenz ist im Einbuchstabenkode in der Orientierung vom Aminozum Carboxylende angegeben ohne ihre Signalsequenz, welche aus 15 Aminosäuren besteht. Die Nummern auf der rechten 3ildseιte bezeichnen die entsprechenden Aminosäurepositionen. Das Sternchen an der Position 340 bezeichnet das Stopkodon. Der konservative Aminosäureaustausch gegenüber der von Perkins S.J. et al (1989) veröffentlichten Sequenz an der Position 27 (Val /Leu) ist fett gedruckt dargestellt. Die homologen Bereiche zu dem γ-Peptid, wie in The sequence is given in the one-letter code in the orientation from the amino to the carboxyl end without its signal sequence, which consists of 15 amino acids. The numbers on the right side indicate the corresponding amino acid positions. The asterisk at position 340 denotes the stop codon. The conservative amino acid exchange compared to that of Perkins S.J. et al (1989) published sequence at position 27 (Val / Leu) is shown in bold. The homologous regions to the γ peptide as in
Fig.3 gezeigt, sind unterstrichen. Fig. 3 are underlined.
Figur 7 : Proteine des Menschen, die als IgA-Protease Substrate dienen können. Figure 7: Proteins of humans, which can serve as IgA protease substrates.
Eine Vielzahl von menschlichen Proteinen enthält eine Abfolge von A variety of human proteins contain a sequence of
Aminosäuren, die von IgA-Protease erkannt und geschnitten werden kann (Tab. 6). In einer Auswahl von menschlichen Proteinen sind diese Sequenzen fettgedruckt dargestellt, wobei die Hochzahlen dieAmino acids that can be recognized and cut by IgA protease (Tab. 6). These sequences are shown in bold in a selection of human proteins, the high numbers being the
Lage der dargestellten Abschnitte innerhalb der entsprechendenLocation of the sections shown within the corresponding
Proteine angeben. Verwendete Abkürzungen: Specify proteins. Used abbreviations:
Ig-A = Immunglobulin A-1; C-Kette  Ig-A = immunoglobulin A-1; C chain
Cd8 = Cd8; alpha-Kette Cd8 = Cd8; alpha chain
Cd6 = Cd6  Cd6 = Cd6
MsF = Makrophagen stimulierendes Protein  MsF = macrophage stimulating protein
Kol = Kollagen alpha-1  Kol = collagen alpha-1
Tf-g = T-Zellen spezifischer Transkriptionsfaktor G Tf-g = T cell specific transcription factor G
NF-kappa-b = Kernprotein NF-kappa-b p100 Untereinheit NF-kappa-b = core protein NF-kappa-b p100 subunit
Mse55 = Serum Protein Mse55  Mse55 = serum protein Mse55
11-11 = Interleukin-11  11-11 = interleukin-11
TNF R1 = Tumor Nekrose Faktor Rezeptor 1 TNF R1 = tumor necrosis factor receptor 1
CC10 = Complement C-10 Komponente, C-Kette  CC10 = Complement C-10 component, C chain
Cd2 = Cd2  Cd2 = Cd2
rfx = MHC Klasse II Regulationsfaktor rfx = MHC class II regulation factor
cd45 = Leukocyten Common Antigen Cd45 cd45 = leukocyte common antigen Cd45
Figur 8: Vergleich eines möglichen MHC-Klasse II Bindungsmotivs mit zwei putativen durch lgA-Protease-Aktivit.it entstandenen kryptischenFIG. 8: Comparison of a possible MHC class II binding motif with two putative cryptic ones that were created by IgA protease activity
Selbstepitopen. Self epitopes.
Das von Rotzschke und Falk (1994) postulierte Bindungsmotiv für MHC- Klasse II gebundene Peptide ist in Zeile (1) gezeigt. Ac markiert die Position von hydrophoben Aminosäuren, über die eine Verankerung mit dem MHC-Molekül erfolgen kann. X markiert eine Aminosäure, die nicht näher charakterisiert werden kann. In Zeile (2) und Zeile (3) sind anhand von den zwei potentiellen IgA-Protease Substraten CD8 (Cd8; alpha-Kette) und CC10 (Complement C-10 Komponente; C-Kette) die Übereinstimmungen dieses Bindungsmotivs mit Peptiden, die durch Iga-Protease-Aktivitat neu entsehen können dargestellt. Direkte Übereinstimmungen mit dem Bindungsmotiv sind in den IgA-Protease Spaltprodukten fettgedruckt. Figur 9 : Homologien verschiedener retroviraler Aspartylproteasen mit der IgA-Protease von Neisserien. The binding motif for MHC class II-bound peptides postulated by Rotzschke and Falk (1994) is shown in line (1). Ac marks the position of hydrophobic amino acids, via which anchoring with the MHC molecule can take place. X marks an amino acid that cannot be characterized in more detail. In line (2) and line (3), based on the two potential IgA protease substrates CD8 (Cd8; alpha chain) and CC10 (complement C-10 component; C chain), the correspondence of this binding motif with peptides by Iga protease activity can be rewritten. Direct matches with the binding motif are printed in bold in the IgA protease cleavage products. Figure 9: Homologies of various retroviral aspartyl proteases with the IgA protease from Neisseries.
Das Allignment zeigt den Bereich um das katalytische Zentrum der Aspartylproteasen. Fett gedruckte Aminosäuren stellen identische oder ähnliche Reste dar. Folgende Abkürzungen werden verwendet:  The alignment shows the area around the catalytic center of the aspartyl proteases. Amino acids printed in bold represent identical or similar residues. The following abbreviations are used:
MMTV = mouse mammary tumor virus  MMTV = mouse mammary tumor virus
HTLV-2 = human t-cell leukemia virus II  HTLV-2 = human t-cell leukemia virus II
SIV = simian immunodeficiency virus  SIV = simian immunodeficiency virus
CIV = chimpanzee immunodificiency virus CIV = chimpanzee immunodificiency virus
HIV-2 = human immunodificiency virus IIHIV-2 = human immunodificiency virus II
HIV-1 = human immunodificiency virus I HIV-1 = human immunodificiency virus I
FIV = feline immunodificiency viru  FIV = feline immunodificiency viru
EIV = equine immunodificiency virus  EIV = equine immunodificiency virus
RRP = retrovirus related polyprotein  RRP = retrovirus related polyprotein
from Drosophila  from Drosophila
IgA-P = neisserial IgA-protease IgA-P = neisserial IgA protease
Beispiel 1 : Example 1 :
DNA-Sequenzanalyse relevanter IgA-Protease-Genfragmente von N . meningitidis Stämmen Die chromosomale DNA verschiedener Meningokokkenstämme wurde isoliert, die iga γα-Regionen mittels der Polymerase-Kettenreaktion (PCR) amplifiziert und in einer Agarosegelelektrophorese auf ihre Größe untersucht. Für die PCR-Amplifikation wurden als Vorwärtsprimer die Oligonukleotide J0154 (5'- CAGGAAACAGCTATGACCACACCGTTCGGTACAGCA) / J0126 (5'- CAGGAAACAGCTATGACCACACCGTTCGGTACAGCA) und als Rückwärtspri- mer die Oligonukleotide J0136 (5'- TGTAAAACGAATGGCGAGGGCGGTGCGGCA) / J0146 (5'- TGTAAAACGACGGCCAGTATGATGGCGAGGGCGGTGCCGGCA) eingesetzt. An- hand ihrer Länge konnten die amplifizierten DNA-Fragmente in zwei Größengruppen eingeteilt werden. DNA-Sequenzanalysen wurden nach der Dideoxymethode durchgeführt. Die flankierenden Sequenzbereiche wurden mittels PCR-Cyclus-Sequenzierung unter Verwendung von Fluoreszenzfarbstoff-markierten Universalvorwärts- (5'-TGTAAAACGACGGCCAGT) und Universalrückwärtsprimern (5'-CAGGAAACAGCTATGACC), sowie parallel dazu unter Einsatz von Fluoreszenz-markierten Dideoxynukleotiden analysiert. Auf diese Art wurde iga bei 13 verschiedenen Menigokokken-Stämmen bestimmt. Die Sequenzen der iga γα-Bereiche von N. meningitidis D1941 und B1939 wurden nach deren Subklonierung in M13mpl8/19 ermittelt. Die Amplifikation wurde nach Standardbedingungen mit dem Primerpaar J097 (5'- TCGAATTCCGGTATTACCCGGTTGT) / JO24 (5'-TCCAGCGCATCCAAGGGG) durchgeführt und die DNA-Fragmente anschließend über Agarose-Gelelektrophorese gereinigt. Nach dem Auffüllen der Enden mit Klenow-Polymerase und Nachschneiden am 5'-Ende mit EcoRI- wurden die Fragmente zwischen die EcoRI und HincII- Schnittstellen der M13mpl8/19-Vektoren inseriert. Die Größe des iga γα-Fragments vom Stamm B1939 machte für die Sequenzierung eine weitere Subklonierung erforderlich, in der das zentrale PstI-Fragment in die entsprechende Schnittstelle von M13mp19 eingesetzt wurde. Alle verwendeten Klonierungs und Sequenzierungstechniken entsprachen dem Stand der Technik und richteten sich nach der Methodenbeschreibung von Sambrook et al. (Molecular Cloning, A Laboratory Manual. CSH Press 1989) bzw. nach Herstellerangeben für Enzyme und verwendete Geräte (Perkin Eimer Cetus und Applied Biosytems).DNA sequence analysis of relevant IgA protease gene fragments from N. meningitidis strains The chromosomal DNA of various meningococcal strains was isolated, the iga γα regions were amplified by means of the polymerase chain reaction (PCR) and their size was examined in an agarose gel electrophoresis. For PCR amplification of the oligonucleotides J0154 (5'CAGGAAACAGCTATGACCACACCGTTCGGTACAGCA) / J0126 (5'CAGGAAACAGCTATGACCACACCGTTCGGTACAGCA) and were used as Rückwärtspri- mer oligonucleotides J0136 (5'TGTAAAACGAATGGCGAGGGCGGTGCGGCA) / J0146 (5'TGTAAAACGACGGCCAGTATGATGGCGAGGGCGGTGCCGGCA) as the forward primer. Based on their length, the amplified DNA fragments could be divided into two size groups. DNA sequence analyzes were carried out according to the dideoxy method. The flanking sequence areas were analyzed by means of PCR cycle sequencing using fluorescent dye-labeled universal forward (5'-TGTAAAACGACGGCCAGT) and universal reverse primers (5'-CAGGAAACAGCTATGACC), and in parallel using fluorescence-labeled dideoxynucleotides. In this way, iga was determined in 13 different menigococcal strains. The sequences of the iga γα regions of N. meningitidis D1941 and B1939 were determined after their subcloning in M13mpl8 / 19. The amplification was carried out according to standard conditions with the primer pair J097 (5'-TCGAATTCCGGTATTACCCGGTTGT) / JO24 (5'-TCCAGCGCATCCAAGGGG) and the DNA fragments were then purified by agarose gel electrophoresis. After filling in the ends with Klenow polymerase and trimming at the 5 'end with EcoRI, the fragments were inserted between the EcoRI and HincII sites of the M13mpl8 / 19 vectors. The size of the iga γα fragment from strain B1939 made further subcloning necessary for the sequencing, in which the central PstI fragment was inserted into the corresponding interface of M13mp19. All cloning used and sequencing techniques corresponded to the state of the art and were based on the method description by Sambrook et al. (Molecular Cloning, A Laboratory Manual. CSH Press 1989) or according to the manufacturer's instructions for enzymes and devices used (Perkin Elmer Cetus and Applied Biosytems).
Für die iga -Domäne von Menigokokken wurden drei Hauptallele, repräsentiert durch die Stämme D1941 (iga γ2) , Ngl7/84 (iga γ3) und B48 (iga γ4) , gefunden (Figur 1). Gegenüber dem iga γ1-hllel von N. gonorrhoeae, das für ein Ala an Position 4 von Igaγ kodiert, enthalten alle Igaγ-Allele von Meningokokken ein Threonin an der entsprechenden Position kodiert. Iga 3 unterscheidet sich von iga γ2 durch eine Deletion von vier Kodons (Figur3). Zusätzlich zu dieser Deletion enthält iga 4 an den Aminosäurepositionen 18 und 19 Serin und Prolin anstelle von Glycin und Alanin, wie bei allen anderen igaγ-Formen. Die iga -Domänen aller bisher untersuchten Stämmen ließen sich in diese vier Gruppen einteilen. Die entsprechenden DNA-Sequenzen waren in hohem Maß konserviert. Ein Aminosäureaustausch manisfestierte sich durch den Austausch eines einzigen Nukleotids an der Position 1 des entsprechenden Kodons, weshalb man die Anzahl der Aminosäureaustausche gleichsetzen kann mit der Anzahl der Nukleotidaustausche. Eine zusätzliche Variation in den Iga -Proteinen ergab sich an Position 22. Hier wurde entweder Prolin oder Alanin gefunden, wobei dies jedoch nicht spezifisch einer Gruppe von iga -Formen zuzuordnen war. Three main alleles, represented by the strains D1941 (iga γ2 ), Ngl7 / 84 (iga γ3 ) and B48 (iga γ4 ), were found for the ig domain of menigococci (FIG. 1). Compared to the iga γ1 shell of N. gonorrhoeae, which codes for an Ala at position 4 of Igaγ, all Igaγ alleles of meningococci contain a threonine which codes for the corresponding position. Iga 3 differs from iga γ2 by a deletion of four codons (Figure 3). In addition to this deletion, iga 4 at the amino acid positions 18 and 19 contains serine and proline instead of glycine and alanine, as with all other iga γ forms. The iga domains of all strains examined so far can be divided into these four groups. The corresponding DNA sequences were highly conserved. An amino acid exchange was manifested by the exchange of a single nucleotide at position 1 of the corresponding codon, which is why the number of amino acid exchanges can be equated with the number of nucleotide exchanges. An additional variation in the Iga proteins resulted at position 22. Here either proline or alanine was found, although this was not specifically assigned to a group of iga forms.
Die igaα3- und igaα4-Allele kodieren für α-Proteine von 169 bzw. 392 Aminosäuren. Im N-terminalen Bereich sind diese Proteine über 25 Aminosäuren identisch mit dem Igaα1- und Igaα2-Allelen (Halter et al., 1989) von N gonorrhoeae Msll und R16. Darüberhinaus finden sich zwischen allen vier Allelen ausgeprägte Homologien, die in der Form kurzer Sequenzmotive über die Proteine verteilt sind. Neben den Homologien untereinander treten eine Vielzahl von Homologien zu zellulären Proteinen und Matrixproteinen menschlichen Ursprungs auf (Figur 2). Ein monoklonaler Antikörper, der ein Epitop im konservierten N-terminalen Bereich der α-Proteine erkennt, zeigt eine ausgeprägte Kreuzreaktivität mit Strukturen menschlicher Zellen, die ein myosinähnliches Verteilungsmuster aufweisen. In der Igaγ-Domäne treten Homologien hauptsächlich zu Bindegewebsbestandteilen wie Proteoglykan und Linkprotein auf (Figur 3). The iga α3 and iga α4 alleles code for α proteins of 169 and 392 amino acids, respectively. In the N-terminal region these proteins are identical over 25 amino acids to the Iga α1 and Iga α2 alleles (Halter et al., 1989) from N gonorrhoeae Msll and R16. In addition, there are pronounced homologies between all four alleles, which are distributed in the form of short sequence motifs over the proteins. In addition to the homologies with one another, a large number of homologies to cellular proteins and matrix proteins of human origin occur (FIG. 2). A monoclonal antibody that is an epitope in the conserved N-terminal region of α-proteins recognizes, shows a marked cross-reactivity with structures of human cells that have a myosin-like distribution pattern. In the Igaγ domain, homologies mainly occur with connective tissue components such as proteoglycan and link protein (FIG. 3).
Beispiel 2 Example 2
Sequenzvergleiche mit menschlichen Proteinen  Sequence comparisons with human proteins
Um herauszufinden, welche Bereiche der IgA-Protease am molekularen Mimikry beteiligt sein können und welche Aminosäuresequenzen als mögliche B-Zell-oder T-Zell-Epitope in Frage kommen wurden computergestützte Vergleiche der Aminosäuresequenz des IgA-Protease-Precursors (IPP) mit Proteinen des Menschen durchgeführt. In order to find out which areas of the IgA protease can be involved in the molecular mimicry and which amino acid sequences are possible B-cell or T-cell epitopes, computer-aided comparisons of the amino acid sequence of the IgA protease precursor (IPP) with proteins of the People performed.
Zu diesem Zweck wurde die aus 1532 Aminosäuren bestehende Sequenz des IPP von Neisseria gonorrhoeae MSll in aufeinanderfolgende Peptide von 50 Aminosäuren Länge unterteilt, die eine Überlappung von jeweils 10 Aminosäuren aufwiesen. Mit den so entstandenen IPP-Polypeptiden wurde zunächst unter Verwendung der Wisconsin Sequence Analysis Package von GCG (Genetics Computer Group Inc.) in verschiedenen Datenbanken nach Sequenzen, die auch in menschlichen Proteinen vorkommen, gesucht. Als Datenbanken standen die SWISS-PROT Daten- bank, die NBRF PIR(R) Protein Datenbank und die Genpept Datenbank, die die Translationsprodukte aller kodierenden DNA- Sequenzen aus der Genbank Nukleinsäure Datenbank enthält, zur Verfügung. Eine Zusammensfassung der erhaltenen Ergebnisse ist in Figur 4 dargestellt. Bereiche des IPP, die gehäuften Homologien zu menschlichen Proteinen zeigten, wurden mit Hilfe des Blast Algorithmus (Best local alignment search tool) nach Altschul et al. 1990, der Fasta Facility (Pearson and Lipman, 1988) und des Algorithmus nach Smith and Waterman (1981) unter Verwendung des Blast-Servers am NCBI in Bethesda, USA und des Blitz-Servers am EMBL in Heidelberg auf Hinweise bezüglich funktioneller oder Struktur-bildender Eigenschaften untersucht. Handelte es sich um Bereiche, die in den bisher bekannten IPP's variabel sind, wurden alleFor this purpose, the 1532 amino acid sequence of the Neisseria gonorrhoeae MSII IPP was divided into successive peptides of 50 amino acids in length, each with an overlap of 10 amino acids. With the resulting IPP polypeptides, the Wisconsin Sequence Analysis Package from GCG (Genetics Computer Group Inc.) was first used in various databases to search for sequences which also occur in human proteins. The SWISS-PROT database, the NBRF PIR (R) protein database and the Genpept database, which contains the translation products of all coding DNA sequences from the Genbank nucleic acid database, were available as databases. A summary of the results obtained is shown in FIG. 4. Areas of the IPP that showed frequent homologies to human proteins were analyzed using the Blast algorithm (Best local alignment search tool) according to Altschul et al. 1990, the Fasta Facility (Pearson and Lipman, 1988) and the algorithm according to Smith and Waterman (1981) using the Blast server at the NCBI in Bethesda, USA and the Blitz server at the EMBL in Heidelberg for information regarding functional or structural investigated properties. Was it areas that were variable in the previously known IPPs, all
Variationen zum Datenbankvergleich eingesetzt. Variations used for database comparison.
Bei MHC-Klasse II präsentierten Peptiden konnte bisher keine einheitliche Länge nachgewiesen werden (Falk et al., 1994). So ist es durchaus möglich, daß die gebundenen Peptide mit einem oder mit beiden Enden aus der Bindungstasche herausschauen (Rötzschke and Falk, 1994). Das bedeutet, daß die terminalen NH2- und COOH-Gruppen des Peptides bei der MHC-Peptidwechselwirkung ohne Bedeutung sind. Es wäre also durchaus möglich, daß MHC-Klasse II präsentierte Antigene in unterschiedlicher Orientierung gebunden werden. deshalb wurde eine Computersimulation mit dem Peptid LLEQKRAA, dem "shared epitope" der MHC-Moleküle des mit RA verbunden Typus DR4 und DR1 durchgeführt. Die "shared epitope hypothesis" wurde erstmals von Gregersen et al. (1987) aufgestellt und besagt, daß die mit RA assoziierten DR4-Subtypen ein gemeinsames Epitop besitzen, welches auf den mit RA nicht assozierten Subtypen nicht vorkommt. Es zeigte sich, daß beide möglichen Orientierungen des Peptids bezüglich des NH2-Terminus ähnliche Oberflächeneigenschaften aufweisen. Dies ist um so mehr von Bedeutung, da die Bindung zwischen MHC-Molekül und präsentiertem Peptid nicht von der vollständigen Sequenz des Peptids, sondern anscheinend nur von bestimmten Aminosäuren an distinkten Positionen, sogenannten Ankerpositionen abhängig zu sein scheint (Sinigaglia and Hammer, 1994). Grundsätzlich ist es also möglich, daß verschiedene MHC-Subtypen verschiedene Peptide in unterschiedlicher Orientierung binden. Aus diesem Grund wurde der IPP von N . gonorrhoeae mit Hilfe des Computers invertiert und mit den Proteinen des Menschen verglichen. Es zeigte sich, daß die umgekehrte Sequenz einen signifikant höheren Anteil von identischen Sequenzen mit menschlichem Proteinen teilt, als der IPP in seiner nativen Form. (Figur 4) In the case of peptides presented in MHC class II, no uniform length has so far been demonstrated (Falk et al., 1994). So it is quite possible that the bound peptides look out of the binding pocket with one or both ends (Rötzschke and Falk, 1994). This means that the terminal NH 2 and COOH groups of the peptide are of no importance in the MHC-peptide interaction. It would therefore be quite possible for MHC class II presented antigens to be bound in different orientations. therefore, a computer simulation with the peptide LLEQKRAA, the "shared epitope" of the MHC molecules of the type DR4 and DR1 linked to RA, was carried out. The "shared epitope hypothesis" was first developed by Gregersen et al. (1987) and states that the DR4 subtypes associated with RA have a common epitope which does not occur on the subtypes not associated with RA. It was found that both possible orientations of the peptide with respect to the NH 2 terminus have similar surface properties. This is all the more important since the bond between the MHC molecule and the peptide presented does not appear to be dependent on the complete sequence of the peptide, but apparently only on certain amino acids at distinct positions, so-called anchor positions (Sinigaglia and Hammer, 1994). In principle, it is therefore possible for different MHC subtypes to bind different peptides in different orientations. For this reason, the IPP from N. gonorrhoeae inverted with the help of the computer and compared with human proteins. It was shown that the reverse sequence shares a significantly higher proportion of identical sequences with human proteins than the IPP in its native form. (Figure 4)
Man kann darüberhinaus erkennen, daß sich die Homologien des IPP zu menschlichen Proteinen auf vorwiegend vier Bereiche konzentrieren, auf das γ-Peptid, das α-Protein, einen Teil des ß-Cores, sowie einen konstanten Bereich der Pepti dase. Die überwiegende Mehrheit der Homologien zu menschlichen Proteinen befindet sich in Bereichen, die in den bisher bekannten IPP-Formen verschiedener Neisserien konserviert sind. Dies geht mit der Hypothese konform, daß in diesen Bereichen ein molekulares Mimikry vorliegt, und deutet daraufhin, daß es in diesen Sequenzabschnitten zu einer Anpassung an das Proteinmuster des Wirtes gekommen ist, die sich evolutionär bewährt haben. Interessanterweise sind die konstanten und die variablen Bereiche der verschiedenen IPPs sowohl bei N. gonorrhoeae als auch bei N . meningitidis in der gleichen Anordnung erhalten. It can also be seen that the homologies of IPP to human proteins concentrate on four areas, the γ-peptide, the α-protein, part of the ß-core, and a constant area of the peptides that. The vast majority of homologies to human proteins are in areas that are conserved in the previously known IPP forms of various Neisseries. This conforms to the hypothesis that there is molecular mimicry in these areas, and indicates that these sequences of sequences have been adapted to the protein pattern of the host and have proven themselves evolutionarily. Interestingly, the constant and variable ranges of the different IPPs are in both N. gonorrhoeae and N. Meningitidis obtained in the same arrangement.
Ausgewählte Beispiele des molekularen Mimikry von IPP sind in Figur 2 dargestellt. Daraus wird ersichtlich, daß im IPP eine Vielzahl von Sequenzmustern menschlicher Proteine kopiert ist, mit dem vorrangigen Ziel das Protein vor der Immunantwort des Wirtes, aufgrund der gegen "Selbst" bestehenden Toleranz zu schützen. Kommt es dennoch, möglicherweise durch Miteinbeziehung von flankierenden nicht-identischen Regionen zu einer Immunantwort, so kann diese sich auch gegen das körpereigene Protein richten und bleibt nach dem Verschwinden des eigentlichen Auslösers durch eine ständige Stimulation erhalten. Eine Reihe von Teilsequenzen des IPP, die Homologien zu menschlichen Proteinen zeigen, erfüllen auch die Kriterien, die bisher für die Bindung von Peptiden durch MHC-Klasse II Moleküle, also zur Antigen-Präsentation bekannt sind. Der Weg von der bakteriellen Infektion hin zur Entwicklung der Autoimmunkrankheit ist somit - einmal in Gang gekommen - unwiderruflich vorgezeichnet. Ein Beispiel, in Bezug auf RA von besonders großem Interesse, ist das 7- Peptid des IPP. Hier zeigt sich molekulares Mimikry bezüglich menschlichem Link-Protein bzw. Aggrecan (Figur 3), wobei die Kriterien für eine mögliche Antigenpräsentation ebenfalls erfüllt sind. Beispiel 3 Selected examples of the molecular mimicry of IPP are shown in FIG. 2. From this it can be seen that a large number of sequence patterns of human proteins have been copied in the IPP, with the primary aim of protecting the protein from the host's immune response on the basis of the tolerance existing against "self". If an immune response nevertheless occurs, possibly through the inclusion of flanking non-identical regions, this can also be directed against the body's own protein and is retained by constant stimulation after the actual trigger has disappeared. A number of partial sequences of the IPP, which show homologies to human proteins, also meet the criteria that have hitherto been known for the binding of peptides by MHC class II molecules, that is, for antigen presentation. The path from bacterial infection to the development of autoimmune disease has thus - once started - irrevocably mapped. An example of particular interest with respect to RA is the 7-peptide of the IPP. This shows molecular mimicry with regard to human link protein or aggrecan (FIG. 3), the criteria for a possible antigen presentation also being met. Example 3
Herstellung des rekombinanten menschlichen Link-Proteins  Production of the recombinant human link protein
Aus Primärkulturen menschlicher Chondrocyten des Hüftgelenks wurde die Gesamt-mRNA isoliert. Diese mRNA wurde mit reverser Trafϊscriptase in cDNA umgeschrieben und als Matrize verwendet, um mit Hilfe spezifischer Oligonukleotide (J0123 5'-GCGAATTCCGATCATCTTTCAGACAACTATACT und J0125 5'- AACGGATCCTCATCAGTTGTATGATGATGCTCTGAAGCAGTA) das Gen des Link-Proteins in einer Polymerase-Kettenreaktion (PCR) zu amplifizieren. Nach Aufreinigung und Restriktion mit EcoRI und BamHI wurde das auf diese Weise erhaltene, I032bp große Fragment in den Vektor pBluescriptll-SK kloniert und sequenziert. The total mRNA was isolated from primary cultures of human chondrocytes of the hip joint. This mRNA was rewritten with reverse transformer scriptase in cDNA and used as a template in order to use the specific oligonucleotides (J0123 5'-GCGAATTCCGATCATCTTTCAGACAACTATACT and J0125 5'-AACGGATCCTCATCAGTTGTATGATGATGCTCT to polymerize the gene in the linkC-PCR protein -A gene of the LinkCase protein) to amplify the gene in the linkC-protein (PCR) chain. After purification and restriction with EcoRI and BamHI, the I032bp fragment thus obtained was cloned into the vector pBluescriptII-SK and sequenced.
Die Sequenz des Fragmentes (Insert des Plasmids p0K18 siehe Fig.5) stimmt mit der von S.J. Perkins et al. (1989) veröffentlichten bis auf den konservativen Austausch einer Aminosäure (Val/Leu) an der Position 27 überein (siehe Fig.6) Zur Expression des Proteins wurde das pEV41a-System gewählt, dessen MS2-Polymerase-Anteil unter der Kontrolle des lP1-Promoters eine gesteigerte Proteinsynthese gewährleistet und dessen 6 Histidine eine einfache Aufreinigung mittels Affinitätschromatographie erlauben (Pohlner et al., 1993). The sequence of the fragment (insert of the plasmid p0K18 see FIG. 5) agrees with that of SJ Perkins et al. (1989) published up to the conservative exchange of an amino acid (Val / Leu) at position 27 (see FIG. 6). The pEV41a system was chosen for the expression of the protein, the MS2 polymerase portion of which was under the control of P1 Promoter ensures increased protein synthesis and its 6 histidines allow easy purification using affinity chromatography (Pohlner et al., 1993).
Der durch diesen Schritt entstandene Vektor pOK19 (siehe Fig.5) wurde durch Elektroporation in den E. coli-Stamm 2136 eingebracht, der im Genom den temperatursensitiven Repressor CI857 besitzt. Nach Temperaturinduktion bei 42° wird das Fusionsprotein in großen Mengen produziert und im Innern der Zelle in Einschlußkörper abgelagert. Nach der Lyse der Zellen werden diese Einschlußkörper in Guanidiniumhydrochlorid gelöst. Das Fusionprotein wird dann mit Hilfe seines aminoterminalen "Histidin-tags" an eine Nickelsäule gebunden und nach dem Waschen der Säule durch pH-Änderung eluiert (Diagen GmBH, Quigen Inc. QuiaExpress, 1992). Herstellung von Peptidantiserum: The vector pOK19 resulting from this step (see FIG. 5) was introduced by electroporation into the E. coli strain 2136, which has the temperature-sensitive repressor CI857 in the genome. After temperature induction at 42 °, the fusion protein is produced in large quantities and deposited in the inclusion body inside the cell. After the cells have been lysed, these inclusion bodies are dissolved in guanidinium hydrochloride. The fusion protein is then bound to a nickel column using its amino-terminal "histidine tag" and eluted by changing the pH after washing the column (Diagen GmBH, Quigen Inc. QuiaExpress, 1992). Preparation of peptide antiserum:
Weibliche Balb/c-Mäuse wurden intraperitoneal dreimal mit je 100mg des synthetisch hergestellten Pam3Cys-γ-Peptids (Pam3Cys-SPAANTASQAQKATQTDGAQIAKPQNIVVA) in Saline immuni- siert. Der "Pam3Cys"- wirksame Anteil der Lipopeptids ersetzt ein Adjuvans (Wiesmüller et al., 1989). Das Antiserum wurde nach dem Stand der Technik gewonnen. Es reagiert im ELISA in einer Verdünnung von 1:2000 sehr gut mit dem synthetischen γ-Peptid, sowie mit den kürzeren Peptiden P2 (TDGAQIAKPQNIWA)und P3 (QKATQTDGAQIAKPQ). Im Immunoblot erkennt dieses Antiserum sowohl ein rekombinantes γ-Fusionsprotein, als auch das rekombinante Link-Protein (siehe Figur 6). Offensichtlich können also Antikörper, die gegen das γ- Peptid gerichtet sind, auch mit dem menschlichen Link-Protein kreuzreagieren. Female Balb / c mice were immunized intraperitoneally three times with 100 mg each of the synthetically produced Pam 3 Cys-γ-peptide (Pam 3 Cys-SPAANTASQAQKATQTDGAQIAKPQNIVVA) in saline. The "Pam 3 Cys" -effective portion of the lipopeptides replaces an adjuvant (Wiesmüller et al., 1989). The antiserum was obtained according to the state of the art. It reacts very well in the ELISA in a dilution of 1: 2000 with the synthetic γ-peptide, as well as with the shorter peptides P2 (TDGAQIAKPQNIWA) and P3 (QKATQTDGAQIAKPQ). In the immunoblot, this antiserum recognizes both a recombinant γ-fusion protein and the recombinant link protein (see FIG. 6). Obviously, antibodies directed against the γ-peptide can also cross-react with the human link protein.
Beispiel 4 Example 4
Kreuzreaktivität des monoklonalen Antikörpers JOPl mit humanen zellulären Proteinen.  Cross-reactivity of the monoclonal antibody JOPl with human cellular proteins.
BalbB Mäuse wurden wiederholt mit dem Protein P121, das das gesamten γ- und α-Bereich des IPP von Neisseria gonorrhoeae MSll enthält, immunisiert. Nach Hybridisierung der erhaltenen Makrophagen mit der Zellinie NS-1 und wiederholter Subklonierung fanden sich sieben monoklonale Antikörper produzierende Zeilklone. Alle Verfahren wurden unter Standardbedingungen durchgeführt. Einer der produzierten monoklonalen Antikörper, mit JOP1 bezeichnet, erkannte ein konserviertes Epitop von ca. 12 Aminosäuren (QAKAEQVKRQQA) am Aminoende der Neisseria α-Proteine 1-4. Dies konnte durch Epitop-Kartierung unter Verwendung von Immunoassays im Anschluß an Kolonieblotting mit einer Vielzahl rekombinanter E coli- Stämme, die unterschiedliche α- und 7-Proteine exprimierten, gezeigt werden. Mit menschlichen Zellen (Chang-Konjunktiva) zeigte JOP1 eine Kreuzreaktion, die sich in der indirekten Immunfluoreszenzmikroskopie wie eine Myosin-spezifische Färbung der Zellen äußerte, (ohne Abb.) Beispiel 5 BalbB mice were repeatedly immunized with the P121 protein, which contains the entire γ and α region of the Neisseria gonorrhoeae MSII IPP. After hybridization of the macrophages obtained with the cell line NS-1 and repeated subcloning, seven cell clones producing monoclonal antibodies were found. All procedures were carried out under standard conditions. One of the monoclonal antibodies produced, designated JOP1, recognized a conserved epitope of approximately 12 amino acids (QAKAEQVKRQQA) at the amino end of the Neisseria α-proteins 1-4. This could be demonstrated by epitope mapping using immunoassays following colony blotting with a variety of recombinant E coli strains that expressed different α and 7 proteins. JOP1 showed a cross-reaction with human cells (Chang conjunctiva), which in indirect immunofluorescence microscopy was expressed like a myosin-specific staining of the cells (without illustration) Example 5
MHC-Bindungstest MHC binding test
Kommerziell erhältliche EBV-transformierte homozygote B- Zellinien (Kimura et al., 1992), wurden in großen Maßstab kultiviert. Durch die Virustransformation zeigen diese B- Zellen eine stark erhöhte Expressionsrate von MHC-Klasse II Molekülen (Gorga et al., 1987), was deren Isolierung über Affinitätschromatographie ermöglicht. Dazu wurde ein mono- klonaler Antikörper, der spezifisch HLA-DR Moleküle erkennt, an CNBr-aktivierte Sepharose gekoppelt (Halter et al., [1993]). Ungefähr 1 mg der aufgereinigten MHC-Dimere wurden bei 37° und pH 5.5 mit etwa 0,1 mg eines Fluoreszenzmarkierten Peptides (als Fluorochroro wird AMCA verwendet; siehe Kaibacher, 1992), das bekannte Bindungsaffinitäten besitzt, inkubiert. Nach 48h wird der Ansatz mit Hilfe einer Gelfiltrationsmethode (High Pressure Size Exclusion Cromatographie, Superdex TM75 ) aufgetrennt und das Verhältnis Fluoreszenz (F) zu Proteinmenge (UV) bestimmt. Dieser Wert repräsentiert 100% Bindung. Im nächsten Schritt werden dann zusätzlich unmarkierte Peptide im 20-fachen Überschuß zugegeben und die Verringerung des F/UV -Wertes als Maß für die Bindung an das entsprechende Allel definiert (Kropshofer et al., 1993). Auf diese Weise wurde in Kompetitionsassays die Bindung verschiedener Abschnitte des 7-Peptids, sowie verschiedener humaner Peptide an für die Atiologie von Rheuma bedeutsame HLA-Allele untersucht (Tabelle I). Tabelle I Commercially available EBV-transformed homozygous B cell lines (Kimura et al., 1992) were cultivated on a large scale. Due to the virus transformation, these B cells show a greatly increased expression rate of MHC class II molecules (Gorga et al., 1987), which enables them to be isolated using affinity chromatography. For this purpose, a monoclonal antibody that specifically recognizes HLA-DR molecules was coupled to CNBr-activated Sepharose (Halter et al., [1993]). About 1 mg of the purified MHC dimers were incubated at 37 ° and pH 5.5 with about 0.1 mg of a fluorescence-labeled peptide (AMCA is used as the fluorochroro; see Kaibacher, 1992), which has known binding affinities. After 48 hours, the mixture is separated using a gel filtration method (high pressure size exclusion chromatography, Superdex TM75) and the ratio of fluorescence (F) to amount of protein (UV) is determined. This value represents 100% binding. In the next step, unlabeled peptides are then added in a 20-fold excess and the reduction in the F / UV value is defined as a measure of the binding to the corresponding allele (Kropshofer et al., 1993). In this way, the binding of various sections of the 7-peptide and various human peptides to HLA alleles which are important for the aetiology of rheumatism was examined in competition assays (Table I). Table I
Für die Atiologie von Rheuma bedeutsame HLA-Allele.HLA alleles important for the aetiology of rheumatism.
Mit "+" gekennzeichnete Allele sind genetisch assoziiert mitAlleles marked with "+" are genetically associated with
Rheumafaktor positiver rheumatoider Arthritis (RA; Wordsworth et al., 1992). Rheumatoid factor of positive rheumatoid arthritis (RA; Wordsworth et al., 1992).
Figure imgf000056_0001
Figure imgf000056_0001
Dabei konnte gezeigt werden, daß die Peptide P3 und P4 (Tabelle VII) aus der mittleren Region des 7-Peptides, welche die homologen Bereiche enthält, Affinität zu den HLA-Al- lelen DR1 und DR4, die beide mit RA assoziiert sind, aufweisen. Dies ist in Tabelle II dargestellt. Die HLA-Allele DR4wl3 und DR3 sind nicht mit RA assoziiert und wurden als Kontrolle verwendet. It could be shown that the peptides P3 and P4 (Table VII) from the middle region of the 7-peptide, which contains the homologous regions, have affinity for the HLA alleles DR1 and DR4, both of which are associated with RA . This is shown in Table II. The HLA alleles DR4wl3 and DR3 are not associated with RA and were used as controls.
Tabelle II Table II
MHC-Bindung der neisserialen Peptide: MHC binding of the neisserial peptides:
Ergebnisse des MHC-Bincungsassays der neisserialen Peptide P1-P6 (Tab.8) im Vergleich zu den fluoreszenz-markierten Referenzpeptiden S1, S2 oder S3 (Tab.8) an verschiedener. MHC-  Results of the MHC binding assay of the neisserial peptides P1-P6 (Tab. 8) in comparison to the fluorescence-labeled reference peptides S1, S2 or S3 (Tab. 8) on various. MHC-
Figure imgf000057_0001
Figure imgf000057_0001
Aminoterminale Peptide der zum 7-Peptid homologen humanen Bereiche wurden ebenfalls diesem Bindungsasssay unterworfen. Das Peptid H3 (HPTKLTYDEAVQACL) entstammt aus einer Region des menschlichen Link-Proteins, die 40% Identität zum neisserialen Antigen besitzt. H3 bindet mit hoher Affinität an die Allele DR1 und DR4. Amino-terminal peptides of the human regions homologous to the 7-peptide were also subjected to this binding assay. The peptide H3 (HPTKLTYDEAVQACL) comes from a region of the human link protein which has 40% identity to the neisserial antigen. H3 binds to the alleles DR1 and DR4 with high affinity.
Tabelle III Table III
MHC-Bindung der Peptide humanen Ursprungs MHC binding of peptides of human origin
Die Kompetition der Peptide humanen Ursprungs (H1-H6, sowie N5 und N6) wurde an den Allelen DRIDwl und DR4Dw4 im Vergleich zu dem Referenzpeptid S2; an dem HLA-Typ DR3 im Vergleich zu S3 gemessen.  The competition of the peptides of human origin (H1-H6, as well as N5 and N6) was on the alleles DRIDwl and DR4Dw4 compared to the reference peptide S2; measured on the HLA type DR3 compared to S3.
Figure imgf000058_0001
Figure imgf000058_0001
Wenn also Antigen präsentierende Zellen Link-Protein aufnehmen und prozessieren, was für Monozyten und B-Zellen beschrieben wurde (Martin et al., 1992), besteht eine hohe Wahrscheinlichkeit, daß sie das Epitop H3 präsentieren. Damit ist die notwendige Voraussetzung für eine kreuzreaktive T-Zell Erkennung gegeben. Thus, when antigen presenting cells take up and process link protein, which has been described for monocytes and B cells (Martin et al., 1992), there is a high probability that they will present the epitope H3. This is the necessary prerequisite for cross-reactive T cell detection.
Beispiel 6 Example 6
Antigenspezifische Aktivierung von peripheren T-Lymphozyten aus RA-Patienten  Antigen-specific activation of peripheral T lymphocytes from RA patients
Die Aktivierung von T-Zellen durch Antigene bzw. Mitogene läßt sich durch die Induktion verschiedener T-Zellfunktionen, wie Proliferation, Zytokinbildung oder Expression von Aktivierungs-markern (IL-2 Rezeptor, HLA-DR u.a.) qualitativ wie quantitativ erfassen. Ziel der vorliegenden Untersuchung ist es, die Existenz von Peptid-spezifischen T-Zellen im peripheren Blut von Rheumapatienten (charakterisiert nach ACR- Kriterien) nachzuweisen. Um dieses zu überprüfen, nutzen wir in unserem Testsystem die Eigenschaft von T-Zellen, nach antigener Stimulation zu proliferieren. Neben einem neisserialen Peptid, dem sogenannten 7-Peptid, wurde das Link-Peptid (L40) (Tabelle VII) als Antigen in einem T-Zellproliferationstest (s.u.) verwendet, das besonders deutliche Homologien in der Aminosäuresequenz mit 7-Peptid aufweist (siehe Beispiel 3, Figur 5). Die mononukleären Zellen (MNZ) wurden aus heparinisierten Vollblut (20 U/ml) mit Hilfe der Ficoll- Dichtegradienten-zentrifugation isoliert (Böyum, 1969). DasThe activation of T cells by antigens or mitogens can be determined qualitatively and quantitatively by inducing various T cell functions, such as proliferation, cytokine formation or expression of activation markers (IL-2 receptor, HLA-DR etc.). The aim of the present study is to determine the existence of peptide-specific T cells in the peripheral blood of rheumatism patients (characterized by ACR Criteria). To check this, we use the property of T cells in our test system to proliferate after antigenic stimulation. In addition to a neisserial peptide, the so-called 7-peptide, the link peptide (L40) (Table VII) was used as an antigen in a T cell proliferation test (see below), which has particularly clear homologies in the amino acid sequence with 7-peptide (see example 3, Figure 5). The mononuclear cells (MNZ) were isolated from heparinized whole blood (20 U / ml) using Ficoll density gradient centrifugation (Böyum, 1969). The
Blut wurde 1:2 mit Hanks' BSS verdünnt und je 30 ml des Gemisches auf 15 ml Ficoll-Hypaque (Dichte 1,077 g/ml) geschichtet. Nach anschließender Zentrifugation im Ausschwingrotor (35 min, 400 x g, 21°C) wurde das überstehende Plasma steril abgesaugt und die MNZ mit Hilfe einer Pasteur- pipette aus der Interphase geerntet. Danach wurden die MNZ noch zweimal mit Hanks' BSS gewaschen und in einer bestimmten Zellzahl in RPMI 1640 aufgenommen. Die Lebendzellzahl wurde durch mikroskopische Auszählung in der Neubauerzählkammer nach Trypanblaufärbung ermittelt. Die obengenannten Peptide wurden unmittelbar vor dem Test in RPMI 1640 (ohne Serum, + 1 % Glutamin + 50 μg/ml Penicillin und 50 μg/ml Streptomycin) auf eine Konzentration von 20 μg/ml eingestellt. Als bakterielles Kontrollantigen wurde Tetanustoxoid (TT) verwendet, das in einer Endkonzentration von 2,5 LF/ml vorlag. Die Proliferationsrate der MNZ wurde über den Einbau von 3H-Thymidin während der DNA-Synthese bestimmt. Blood was diluted 1: 2 with Hanks' BSS and 30 ml portions of the mixture were layered on 15 ml Ficoll-Hypaque (density 1.077 g / ml). After subsequent centrifugation in the swing-out rotor (35 min, 400 xg, 21 ° C), the supernatant plasma was sucked off sterile and the MNZ was harvested from the interphase using a Pasteur pipette. The MNZ were then washed twice with Hanks' BSS and included in RPMI 1640 in a certain number of cells. The number of living cells was determined by microscopic counting in the Neubauer counting chamber after trypan blue staining. The above-mentioned peptides were adjusted to a concentration of 20 μg / ml in RPMI 1640 (without serum, + 1% glutamine + 50 μg / ml penicillin and 50 μg / ml streptomycin) immediately before the test. Tetanus toxoid (TT), which was present in a final concentration of 2.5 LF / ml, was used as the bacterial control antigen. The MNZ proliferation rate was determined by the incorporation of 3 H-thymidine during DNA synthesis.
Für den Proliferationsansatz wurden die Zellen in einer Konzentration 1 x 105 Zellen/Vertiefungen in Rundboden-Mikrotiterplatten zusammen mit den entsprechenden Peptiden (25 μg/ml) in einem Volumen von 100 μl für 2 Stunden bei 37°C im Kulturschrank (5 % CO2) vorinkubiert. Anschließend wurde zu jeder Vertiefung 50 μl RPMI, supplementiert mit 15 % hitzeinaktiviertem menschlichen Serum der Blutgruppe AB, zugegeben und die Platten 7 Tage (bzw. 10 Tage bei Zugabe von IL-2,s.u.) kultiviert. 24 Stunden vor der Ernte wurde mit dem radioaktivem Isotop (3H-markiertes Thymidin, Amersham, 0,2 μCi/Vertiefung) markiert. For the proliferation approach, the cells were concentrated in a concentration of 1 × 10 5 cells / wells in round-bottom microtiter plates together with the corresponding peptides (25 μg / ml) in a volume of 100 μl for 2 hours at 37 ° C. in a culture cabinet (5% CO 2 ) pre-incubated. Then 50 μl of RPMI, supplemented with 15% heat-inactivated human serum of blood group AB, was added to each well and the plates were cultivated for 7 days (or 10 days with the addition of IL-2, see below). 24 hours before the harvest the radioactive isotope ( 3 H-labeled thymidine, Amersham, 0.2 μCi / well).
In einem Teil der Ansätze wurden die Zellen nach 6 Kulturtagen mit dem wachstumsfördernden Zytokin IL-2 (20 U/ml) versehen und weitere 3 Tage kultiviert, bevor diese mit 3H-Thymidin für 24 Stunden markiert wurden. Unter Zugabe von IL-2 lassen sich auch potentiell reaktive anerge T-Zellen zur Proliferation anregen, die möglicherweise zwar durch ein ähnlichen antigenes Peptid "getriggert" werden, aber denen kostimulatorische Signale fehlen (Meuer et al., 1986). Die Platten wurden nach Ablauf der Kulturzeit zunächst bei -20°C eingefroren und später mit einem Zellerntegerät auf Filtermatten aufgebracht. Die Einbaurate des radioaktiven Isotops wurde durch Flüssigkeitsszintillationsmessungen im LKB- Counter (Pharmacia) bestimmt. Von jedem Stimulationsansatz wurde der Mittelwert der counts per minute (cpm) von je drei Vertiefungen (Triplicets) ermittelt. In part of the batches, the cells were provided with the growth-promoting cytokine IL-2 (20 U / ml) after 6 days of culture and cultured for a further 3 days before these were labeled with 3 H-thymidine for 24 hours. With the addition of IL-2, potentially reactive anergic T cells can also be stimulated to proliferation, which may be "triggered" by a similar antigenic peptide, but which lack costimulatory signals (Meuer et al., 1986). After the culture period, the plates were first frozen at -20 ° C. and later applied to filter mats using a cell harvester. The incorporation rate of the radioactive isotope was determined by liquid scintillation measurements in the LKB counter (Pharmacia). The mean value of the counts per minute (cpm) of three wells (triplicets) was determined from each stimulation approach.
In den Ansätzen mit den relevanten Antigenen zeigte sich, daß die T-Zellen von zwei Patienten, Nr. 3 und 5 (bei Nr. 6 gab es nur eine schwache Stimulation), der insgesamt acht RA-Patienten mit dem Link-Peptid reagierten Tabelle IV. The batches with the relevant antigens showed that the T cells of two patients, No. 3 and 5 (there was only weak stimulation in No. 6), of a total of eight RA patients reacted with the link peptide table IV.
Figure imgf000061_0001
Figure imgf000061_0001
Genau bei denselben Patienten ließ sich auch eine T-Zellreaktion auf das 7-Peptid feststellen. Interessanterweise konnte eine Proliferation sowohl auf Link- als auch auf 7- Peptid in einem Fall erst durch die Zugabe von IL-2 induziert werden (Patient Nr. 2). Die schattierten Kästchen in der Tabelle IV dokumentieren die Übereinstimmungen der Proliferationraten als Folge der Stimulation mit dem Link-Peptid bzw. 7-Peptid. Die T-Zellen dieser Spender zeigten auch eine sehr gute durch Tetanustoxoid ausgelöste Proliferation, ein Indiz für die gute antigene Stimulierbarkeit der Zellen dieser Spender. Eine Proliferation nach Gabe von IL-2 konnte zwar auch in den mit Link-Peptid stimulierten Zellen der Patienten 6, 7 und 8 festgestellt werden, dort ließ sich jedoch keine Proliferation in Verbindung mit 7-Peptid und IL-2 nachweisen. Die Daten beweisen die Existenz von Peptid-spezifischen T-Zellen im peripheren Blut von RA-Patienten, die unter definierten Bedingungen sowohl durch das Link-Peptid wie auch durch das homologe 7-Peptid zur Proliferation stimuliert werden können. Die Isolierung und Etablierung anti- genspezifischer T-Zellen aus dem peripheren Blut von Rheumapatienten scheint unter diesen Gesichtspunkten erfolgsversprechend. Allerdings ist die nähere Charakterisierung der Patienten z.B hinsichtlich des MHC-Alleltyps notwendig, um gemäß der hier gezeigten bevorzugten Bindungsaffinitäten der untersuchten Peptide an RA-assozierte MHC-Allele DR1, DR4Dw4 und DR4DW14 (Beispiel 4) eine T-Zell Reaktion in vitro direkt zu korrelieren. Diese unter optimierten und definierten Bedingungen isolierten und etablierten T-Zellklone ließen sich dann hinsichtlich ihrer Kreuzreaktivität auf Link- bzw. 7-Peptid testen. Mit Hilfe des Proliferationtests ließen sich dann Bindungsmotive und potentielle T-Zellepitope des Peptids studieren, genau definieren und als Immundiagnostika einsetzen. Beispiel 7 A T cell response to the 7-peptide was also found in exactly the same patients. Interestingly, proliferation on both link and 7-peptide could only be induced in one case by the addition of IL-2 (patient No. 2). The shaded boxes in Table IV document the agreement of the proliferation rates as a result of the stimulation with the link peptide or 7 peptide. The T cells of these donors also showed a very good proliferation triggered by tetanus toxoid, an indication of the good antigenic stimulability of the cells of these donors. Although proliferation after administration of IL-2 was also found in the cells of patients 6, 7 and 8 stimulated with link peptide, no proliferation in connection with 7-peptide and IL-2 could be detected there. The data demonstrate the existence of peptide-specific T cells in the peripheral blood of RA patients, which can be stimulated for proliferation under defined conditions both by the link peptide and by the homologous 7-peptide. The isolation and establishment of antigen-specific T cells from the peripheral blood of rheumatism patients seems promising from this point of view. However, the more detailed characterization of the patients, for example with regard to the MHC allele type, is necessary in order to directly generate a T cell reaction in vitro in accordance with the preferred binding affinities of the peptides to RA-associated MHC alleles DR1, DR4Dw4 and DR4DW14 (example 4) shown here correlate. These T cell clones, which were isolated and established under optimized and defined conditions, could then be tested for their cross-reactivity on link or 7 peptide. With the help of the proliferation test, binding motifs and potential T cell epitopes of the peptide could then be studied, precisely defined and used as immunodiagnostics. Example 7
Aufnahme des α-Proteins und von IPP-Intermediaten Inclusion of the α protein and IPP intermediates
Wir konnten kürzlich zeigen, daß neben der Protease als wichtiger Virulenzfaktor ein weiteres Produkt des posttranslational gespaltenen Polyproteins funktionelle Eigenschaften enthält (Pohlner et al., 1994). Dieses α-Protein kommt sowohl in allen pathogenen Neisseria gonorrhoeae als auch Neisseria meningitidis Stämmen vor. Es offenbart sehr gute Sequenz- und Strukturhomologien zu bekannten viralen und eukaryontischen Proteinen (siehe Beispiel 11/ Beispiel 12). Eine bisher einzigartige Fähigkeit des α-Proteins besteht darin, daß es durch Inkubation mit Zellen von diesen durch Rezeptor-vermittelte Endozytose aufgenommen und im Kern akkumuliert werden kann. Daß dies ein spezifischer Prozeß ist wird dadurch bestätigt, daß nur wenige Zelltypen diese Kernlokalisation zulassen. Außer humanen Primärzellen, die auch in vivo natürliche Habitate des Pathogens darstellen, konnten bisher keine Zellinien gefunden werden, die diese Eigenschaft besitzen. Dagegen haben aber alle getesteten Zellinien die Möglichkeit das Protein aufzunehmen, in lysosomenähnliche Kompartimente zu transportieren und dort zu degradieren. Die Lokalisation im Kern der Wirtszelle wird, wie wir zeigen konnten, durch eine oder mehrere Kernlokalisationssignale vermittelt (Pohlner et al., 1994). Der genaue experimentelle Versuchsablauf zur Detektion dieser Lokalisation sieht folgendermaßen aus: We have recently been able to show that, in addition to protease as an important virulence factor, another product of the post-translationally cleaved polyprotein contains functional properties (Pohlner et al., 1994). This α protein occurs in all pathogenic Neisseria gonorrhoeae and Neisseria meningitidis strains. It discloses very good sequence and structural homologies to known viral and eukaryotic proteins (see example 11 / example 12). A unique ability of the α protein is that it can be taken up by cells by incubation with receptor-mediated endocytosis and accumulated in the nucleus. That this is a specific process is confirmed by the fact that only a few cell types allow this nuclear localization. Apart from human primary cells, which are also natural habitats of the pathogen in vivo, no cell lines which have this property have been found to date. In contrast, however, all cell lines tested have the option of taking up the protein, transporting it into lysosome-like compartments and degrading it there. As we have been able to show, the location in the nucleus of the host cell is mediated by one or more nuclear localization signals (Pohlner et al., 1994). The exact experimental procedure for the detection of this location looks like this:
Die bei 30°C in DMEM 5 % FKS (foetales Kälberserum) gelagerten explantierten Corneas werden mit einem sterilen Skalpell in 16 gleichgroße Gewebestückchen geteilt und bis zu einem präkonfluenten Wachstumsstadium (80 % des Deckglases bewachsen) in 24 "Well"-Platten (Nunc, Dk) auf Deckgläschen inkubiert (Es wurden humane Corneas aus dem Interuniversitary Ophthalmologic Institute, Academic Medical Center, Amsterdam verwendet). Die Orientierung der Cornea- Fragmente auf den Deckgläschen ist mit der Endothelseite nach unten. Das verbrauchte DMEM-Medium mit 5 % FKS wird jetzt gegen frisches Medium ohne FKS ausgetauscht (dieser Schritt dient dazu Rezeptoren, die durch Serumproteine besetzt sind, frei zu machen). Nach einer Stunde Inkubation wird das Medium wiederum gewechselt. Die Zellen werden nun in FKS-freiem, mit α-Protein (5 mg/ml) supplementierten Medium für weitere fünf Stunden kultiviert (Dieses rekombinante α-Protein wurde in einem überproduzierenden E.coli Stamm (UT 5600, OrnpT-) als Fusionsprotein mit "His-Tag" expremiert, über eine Nickel- Agarose ( Ni2+-NTA-Agarose, Quiagen) vom Zellysat abgetrennt und mit Hilfe einer Affinitätschromatographie (BioRex 70, BioRad) aufgereinigt. Physiologische Pufferbedingungen wurden durch Dialyse gegen 1 x PBS, ohne divalente Kationen, erhalten. Hieran schließen sich Fixierung und Permeabilisie- rung der Zellen an; diese Schritte erlauben es schließlich eine Immunfluoreszenzmikroskopie durchzuführen: The explanted corneas stored at 30 ° C in DMEM 5% FCS (fetal calf serum) are divided with a sterile scalpel into 16 pieces of tissue of the same size and up to a preconfluent growth stage (80% of the cover glass overgrown) in 24 "well" plates (Nunc, Dk) incubated on coverslips (human corneas from the Interuniversitary Ophthalmologic Institute, Academic Medical Center, Amsterdam were used). The orientation of the corneal fragments on the cover slip is with the endothelial side down. The used DMEM medium with 5% FCS is now replaced with fresh Medium replaced without FCS (this step serves to free receptors that are occupied by serum proteins). After an hour of incubation, the medium is changed again. The cells are now cultured in FCS-free medium supplemented with α-protein (5 mg / ml) for a further five hours (this recombinant α-protein was used as a fusion protein in an overproducing E. coli strain (UT 5600, OrnpT-) "His-Tag" expressed, separated from the cell lysate via a nickel agarose (Ni 2+ -NTA agarose, Quiagen) and purified with the aid of affinity chromatography (BioRex 70, BioRad). Physiological buffer conditions were dialyzed against 1 x PBS without This is followed by fixation and permeabilization of the cells, which finally allow immunofluorescence microscopy to be carried out:
Die Zellen werden einmal mit 1 x PBS (ohne divalente Kationen) gewaschen und für 10 min mit einer 1 % Paraformaldeydlösung (in 1 x PBS) fixiert. Mit einer 0,5 % Triton x-100 Lösung (in 1 x PBS) werden nun die Zellen 30 min permeabilisiert. Anschließend wird die in 1 x PBS/1 % BSA verdünnte Primär-Antikörper Lösung zwei Stunden bei Raumtemperatur oder über Nacht bei 4°C inkubiert. Nichtgebundener PrimärAntikörper wird dreimal 10 min mit 1 x PBS/0,05 % Tween 20 abgewaschen und ein Fluoreszenzfarbstoff markierter Sekundärantikörper/Protein A wird in den entsprechenden Verdünnungen mit den Zellen für 30 min inkubiert. Weitere drei Waschschritte schließen sich an (In dem ersten dieser Waschschritte kann man eine DAPI-Färbung durchführen). Zum Schluß erfolgt das Eindeckein der Gläschen mit einer 0,3 % Propylgallat-Lösung in Glycerin. Diese so behandelten Proben sind jetzt mehrere Monate lang ohne nennenswerte Verluste der Fluoreszenzintensität einsetzbar.  The cells are washed once with 1 x PBS (without divalent cations) and fixed for 10 min with a 1% paraformaldehyde solution (in 1 x PBS). The cells are then permeabilized for 30 min with a 0.5% Triton x-100 solution (in 1 x PBS). The primary antibody solution, diluted in 1 × PBS / 1% BSA, is then incubated for two hours at room temperature or overnight at 4 ° C. Unbound primary antibody is washed three times for 10 min with 1 x PBS / 0.05% Tween 20 and a fluorescent dye-labeled secondary antibody / protein A is incubated in the appropriate dilutions with the cells for 30 min. A further three washing steps follow (in the first of these washing steps you can carry out a DAPI staining). Finally, cover the jars with a 0.3% propyl gallate solution in glycerin. These samples treated in this way can now be used for several months without any significant loss in fluorescence intensity.
Eine weitere Klasse von humanen Primärzellen, die das α-Protein endozytieren und im Nukleus akkumulieren können sind Lymphozyten und Makrophagen. Dies konnte mit mononukleären Teilen (MNZ) aus Vollblut verschiedener Spender gezeigt werden. Die MNZ werden, wie in Beispiel 6 beschrieben, über eine Dichtegradientenzentrifugation isoliert, in kaltemAnother class of human primary cells that can endocytate the α protein and accumulate in the nucleus are lymphocytes and macrophages. This could be demonstrated with mononuclear parts (MNZ) from whole blood from different donors. The MNZ are as described in Example 6 density gradient centrifugation isolated, in cold
RPMI-Medium resuspendiert und gezählt. Zwischen 5 x 105 und 1 x 106 MNZ können für ein Aufnahmeexperiment eingesetzt werden. Nach einer einstündigen Inkubation der Zellen mit serumfreiem RPMI Medium erfolgt der Uptake des α-Proteins analog der Prozedur, wie für die Cornea Zellen beschrieben. Je nach dem Immunstatus der Spender konnte man in der Immunfluoreszenz vor allem bei Subpopulationen der rundkernigen Lymphozyten oder bei nahezu allen Zellen eine Aufnahme und Kernakkumulation erkennen. Der in Beispiel 8 dargestellte immunsuppressive Effekt des α-Proteins könnte durch die hier beschriebene Endozytosefähigkeit erklärt werden. Nach sehr kurzer Inkubationszeit mit α-Protein (weniger als 1,5 Stunden) sind nur wenige Zellen mit Kernakkumulation zu finden. Hier kann man aber bei vielen Zellen eine stark ausgeprägte Oberflächenfluoreszenz feststellen. Genau wie die Hemmung der antigeninduzierten T-Zell Proliferation durch das Tat- Protein kann der immunsuppressive Effekt des α-Proteins auch auf Bindung an und Hemmung des CD26 Aktivierungsmarkers von T-Zellen beruhen (Gutheil et al., 1994). Die autokatalytische Prozessierung des IgA-Protease Polyproteins findet in der extrazellulären Umgebung statt. Dieser Prozeß ist konzentrationsabhängig und wird vor allem bei Überexpression im heterologen Escherichia coli System beobachtet. Solch hohe Konzentrationen werden in vivo bei IgA-Protease positiven Stämmen wohl nicht erreicht. RPMI medium resuspended and counted. Between 5 x 10 5 and 1 x 10 6 MNZ can be used for a recording experiment. After incubation of the cells with serum-free RPMI medium for one hour, the uptake of the α-protein is carried out analogously to the procedure as described for the cornea cells. Depending on the immune status of the donors, one could recognize in the immunofluorescence especially in subpopulations of the round-nucleus lymphocytes or in almost all cells an uptake and nuclear accumulation. The immunosuppressive effect of the α protein shown in Example 8 could be explained by the endocytosis ability described here. After a very short incubation period with α-protein (less than 1.5 hours), only a few cells with nuclear accumulation can be found. Here, however, a pronounced surface fluorescence can be found in many cells. Just like the inhibition of antigen-induced T cell proliferation by the Tat protein, the immunosuppressive effect of the α protein can also be based on binding and inhibition of the CD26 activation marker of T cells (Gutheil et al., 1994). The autocatalytic processing of the IgA protease polyprotein takes place in the extracellular environment. This process is concentration-dependent and is observed above all in the case of overexpression in the heterologous Escherichia coli system. Such high concentrations are probably not reached in vivo in IgA protease positive strains.
Diese Beobachtung läßt die Schlußfolgerung zu, daß sich ein weiterer Wirkort der proteolytischen Aktivität innerhalb von Wirtszellen befindet. Möglicherweise gelangt eine intermediäre Form des Polyproteins über die Carrierfunktion des α- Proteins in Zielzellen und kann aufgrund von veränderten zellulären Bedingungen auf dem Weg zum Kern abgekoppelt werden. Beispiele hierfür geben die im Aufbau und Organisation ähnlichen Retroviren. Bei diesen wurde bis heute die Proteolyse verschiedener Zytoskelett- und Regulationselemente gezeigt (Reviere et al., 1991). Beispiel 8 This observation leads to the conclusion that another site of proteolytic activity is located within host cells. An intermediate form of the polyprotein may reach target cells via the carrier function of the α-protein and may be decoupled on the way to the nucleus due to changed cellular conditions. Examples of this are the retroviruses, which are similar in structure and organization. The proteolysis of various cytoskeletal and regulatory elements has been shown in these to date (Reviere et al., 1991). Example 8
Suppression der T-Zellantwort durch α-Protein  Suppression of the T cell response by α protein
Die T-Zellen sind direkt als zytotoxische T-Zellen an der Abwehr von Viren und Mikroorganismen beteiligt bzw. regulieren als sog. T-Helferzellen durch die Bildung und Sekretion von Zytokinen die zellulären und humoralen Immunreaktionen. Mikroorganismen, die wie Neisserien den menschlichen Wirt infizieren und kolonisieren, müssen koevolutiv Fähigkeiten entwickelt haben, das Immunsystem des Wirtes zu beeinflussen. Dabei erscheint die Regulation der spezifischen Immunantwort von besonderer Bedeutung zu sein. Für die Manipulation dieser Regulation gibt es einige interessante Beispiele. So inhibieren Mycobakterien die Antigenprozessierung oder beeinflußen Staphylokokken und Salmonellen die Antigenpräsentation; in beiden Fällen führt dies letztlich zu einer verminderten T-Zell Reaktion (Marrack and Kappler, 1994; Pryjma et al., 1994). Ein weiteres Beispiel von Immunsup- pression wurde erstmals 1989 mit dem retroviralen Tat-Protein festgestellt (Viscidi et al.,1989; Meyaard et al., 1992). In der üblichen Funktion reguliert dieses Protein die Transkription von viralen Genen. Neuere Studien konnten jedoch zeigen, daß das Tat-Protein auch die antigenspezifische T-Zellproliferation zu hemmen vermag, ohne jedoch die poly- klonale Aktivierung von T-Zellen generell zu beeinflußen (Viscidi et al., 1989). Auf die strukturelle Ähnlichkeit des bakteriellen α-Proteins mit dem viralen Tat-Protein wird noch in Beispiel 12 ausführlich eingegangen. Basierend auf dieser Übereinstimmung sollte in folgender Studie geprüft werden, inwieweit auch das α-Protein eine spezifische Inhibition der T-Zellreaktion bewirken kann. Dazu wurden MNZ aus Vollblut eines Tuberkulin-positiven Spenders, wie in Beispiel 6 beschrieben, isoliert. Als Teil des Experiments wurden zusätzlich die Monozyten durch Plastikadhärenz (1 Stunde, 37°C , 5 % CO2, serumfrei) partiell entfernt. Die so bezeichneten Non-adhärenten Zellen (NAZ) enthielten weniger als 2 % Monozyten. MNZ bzw. NAZ wurden auf eine Konzentra tion 1 x 106 Zellen/ml eingestellt und unter serumfreien Bedingungen mit dem α-Protein (5 μg/ml in RPMI) lh bei 37°C vorinkubiert. Die Inkubation der Zellen mit Zellkulturmedium ohne α-Protein wurde parallel als Kontrolle verwendet. Danach wurden die Zellen in Flachbodenmikrotiterplatten (0,5 x 105 c/Vertiefung; Volumen 200 μl) mit RPMI + 10 % hitzeinaktiviertem fötalem Kälberserum weiterkultiviert. Die T-Zellen wurden mit dem Lektin PHA (l μg/ml) bzw. dem Antigen Tuberkulin, PPD (10 μg/ml) stimuliert, das unter den unten angegebenen Kulturbedingungen eine spezifische und starke Reaktion bereits nach 4 Kulturtagen garantiert (Lorenzen, 1992). Nach 3 Tagen Kultur wurden die Zellen mit 3H-Thymidin (0,2 mCi/Vertiefung) markiert, 18 Stunden später geerntet und mit Hilfe der Liquidszintillationszählung im LKB-betaplate Counter gemessen. Die Auswertung dieses Experiments ist in der Tabelle V wiedergegeben. The T cells are directly involved in the defense against viruses and microorganisms as cytotoxic T cells or regulate the cellular and humoral immune reactions as so-called T helper cells through the formation and secretion of cytokines. Microorganisms that, like Neisseries, infect and colonize the human host must have developed coevolutive skills to affect the host's immune system. The regulation of the specific immune response appears to be of particular importance. There are some interesting examples of the manipulation of this regulation. For example, mycobacteria inhibit antigen processing or influence staphylococci and salmonella in antigen presentation; in both cases, this ultimately leads to a reduced T cell response (Marrack and Kappler, 1994; Pryjma et al., 1994). Another example of immune suppression was first identified in 1989 with the retroviral Tat protein (Viscidi et al., 1989; Meyaard et al., 1992). In its normal function, this protein regulates the transcription of viral genes. However, recent studies have shown that the Tat protein can also inhibit antigen-specific T cell proliferation, but without generally influencing the polyclonal activation of T cells (Viscidi et al., 1989). The structural similarity of the bacterial α protein with the viral Tat protein is discussed in detail in Example 12. Based on this agreement, the following study should examine to what extent the α-protein can also cause a specific inhibition of the T cell reaction. For this purpose, MNZ were isolated from whole blood from a tuberculin-positive donor, as described in Example 6. As part of the experiment, the monocytes were also partially removed by plastic adherence (1 hour, 37 ° C, 5% CO 2 , serum-free). The so-called non-adherent cells (NAZ) contained less than 2% monocytes. MNZ and NAZ were on a concentra tion 1 x 10 6 cells / ml and preincubated under serum-free conditions with the α-protein (5 μg / ml in RPMI) at 37 ° C. The incubation of the cells with cell culture medium without α-protein was used in parallel as a control. The cells were then further cultivated in flat-bottom microtiter plates (0.5 x 10 5 c / well; volume 200 μl) with RPMI + 10% heat-inactivated fetal calf serum. The T cells were stimulated with the lectin PHA (1 μg / ml) or the antigen tuberculin, PPD (10 μg / ml), which guarantees a specific and strong reaction after 4 days of culture under the culture conditions specified below (Lorenzen, 1992 ). After 3 days of culture, the cells were labeled with 3 H-thymidine (0.2 mCi / well), harvested 18 hours later and measured using the liquid scintillation counter in the LKB-beta counter. The evaluation of this experiment is shown in Table V.
Tabelle V Table V
Effekt von α-Protein auf die Proliferation von T-Zellen. Effect of α-protein on T cell proliferation.
Mononukleäre Zellen (MNZ) bzw. nonadhärente Lymphozyten (NAZ) wurden für 1 h mit α-Protein oder mit Medium vorbehandelt. Anschließend werden sie mit 10 μg/ml Tuberkulin PPD (= Purified Protein Derivative) oder 1 μg/ml PHA (= Phytohämagglutinin) in RPMI + 10% FKS stimuliert. Die Proliferation kann nach 4 Kulturtagen durch den Einbau von Tritium markiertem Thymidin bestimmt und als cpm x 1000 angegeben werden  Mononuclear cells (MNZ) or non-adherent lymphocytes (NAZ) were pretreated for 1 h with α-protein or with medium. They are then stimulated with 10 μg / ml tuberculin PPD (= Purified Protein Derivative) or 1 μg / ml PHA (= phytohemagglutinin) in RPMI + 10% FCS. The proliferation can be determined after 4 days of culture by incorporating tritiated thymidine and given as cpm x 1000
Figure imgf000068_0001
Die Ergebnisse sind Mittelwerte, die sich aus Dreifachbestimmungen errechnen. Die PPD-induzierte T-Zellproliferation ist nach Behandlung mit α-Protein in beiden Ansätzen deutlich verringert, während die polyklonale Aktivierung mit PHA nicht signifikant gehemmt wurde. Dieser Versuch zeigt, daß das neisseriale α-Protein nicht nur biochemische und zellbiologische Ähnlichkeiten mit dem Tat-Protein aufweist, sondern auch immunphysiologisch ähnliche Eigenschaften besitzt. Insbesondere die ähnliche Wirkung auf T-Zellen, bei der selektiv die Proliferation antigenspezifischer T-Zellen gehemmt wird, legt den Schluß nahe, daß dieser biologische Effekt möglicherweise auf den bei beiden Proteinen festgestellten Kerntransport innerhalb der eukaroyntischen Zellen beruht (siehe Beispiel 7). Eine derartige Suppression bestimmter antigenspezifischer T-Zellklone könnte z.B. durch Ausschaltung suppressiver T-Zellen oder bestimmter Zytokinproduzierender T-Zellen, das Gleichgewicht des immunologischen Netzwerkes stören und letztlich auch zur Entstehung und Aufrechterhaltung von Autoimmunkrankheiten wie RA beitragen.
Figure imgf000068_0001
The results are averages calculated from triplicate determinations. PPD-induced T cell proliferation was significantly reduced in both approaches after treatment with α-protein, while polyclonal activation with PHA was not significantly inhibited. This experiment shows that the neisserial α protein not only has biochemical and cell biological similarities to the Tat protein, but also has immunophysiologically similar properties. In particular, the similar effect on T cells, in which the proliferation of antigen-specific T cells is selectively inhibited, suggests that this biological effect may be due to the nuclear transport found for both proteins within the eukaryotic cells (see Example 7). Such suppression of certain antigen-specific T cell clones could, for example, by disrupting suppressive T cells or certain cytokine-producing T cells, disrupt the balance of the immunological network and ultimately also contribute to the development and maintenance of autoimmune diseases such as RA.
Beispiel 9 Example 9
Schnittstellen von IgA-Protease in menschlichen Proteinen - Fehlsteuerung der Immunantwort.  Interfaces of IgA protease in human proteins - misregistration of the immune response.
Die bisher bekannten Substrate der IgA-Protease sind das menschliche Immunglobulin A und das Vorläuferprotein der IgA-Protease selbst. Das heißt, die IgA-Protease entfaltet eine autokatalytische Aktivität, um aus dem IPP die verschiedenen funktionellen Einheiten herauszuschneiden. Aus den erhaltenen Spaltprodukten können die dabei erkannten und geschnittenen Aminsosäuresequenzen bestimmt werden (Klauser et al., 1993; Plaut et al., 1975). Sie lassen sich vereinfacht durch das Schema Y-P-|-X-P beschreiben. Die Hydrolyse der Peptidbindung durch die IgA-Protease erfolgt innerhalb dieser linearen Erkennungssequenz, wobei die Präsenz dieser Sequenz hinreichend ist für eine spezifische Spaltung durch das Enzym (Pohlner et al., 1992). Die bisher bekannten und verwirklichten Variationen der Erkennungsequenz sind in Tabelle VI gezeigt. The known substrates of the IgA protease are human immunoglobulin A and the precursor protein of the IgA protease itself. This means that the IgA protease exhibits an auto-catalytic activity in order to cut out the various functional units from the IPP. The amino acid sequences recognized and cut can be determined from the cleavage products obtained (Klauser et al., 1993; Plaut et al., 1975). They can be simply described using the scheme YP- | -XP. The hydrolysis of the peptide bond by the IgA protease takes place within this linear recognition sequence, the presence of this sequence being sufficient for a specific cleavage by the enzyme (Pohlner et al., 1992). The known and realized variations of the recognition sequence are shown in Table VI.
Tabelle Vl Auf stellung der Schnittstellen von Iga-Protease und der Proteine in denen diese erkannt werden ( Pohlner et al . , 1992 ) . Table VI Position of the interfaces of Iga protease and the proteins in which these are recognized (Pohlner et al., 1992).
Die bi sher bekannten Substrate der IgA- Protease sind das Immunglobulin A des Menschen und die j eweiligen IgA- Protease Vorläuferproteine selbst . Aus der Zusammenstellung der gespaltenen Sequenzen ergibt sich als allgemeingültiges Spaltmotiv der IgA- Protease "YP | XP" , wobei ( I ) die hydrolysierte Bindung symbolisiert .  The known substrates of the IgA protease are human immunoglobulin A and the respective IgA protease precursor proteins themselves. The combination of the cleaved sequences results in the generally applicable cleavage motif of the IgA protease "YP | XP", where (I) symbolizes the hydrolyzed bond.
Figure imgf000070_0001
Figure imgf000070_0001
Die durch Computer-gestützte Vergleiche erhaltenen Sequenzdaten zeigen, daß ein Anteil von 7 Prozent aller menschlichen Proteine eine potentielle IgA-Protease-Schnittstelle trägt, wovon eine Auswahl interessanter Beispiele in Abbildung 9 dargestellt ist. Bei einer überaschend hohen Anzahl der gefundenen menschlichen Proteine mit IgA-Protease- Schnittstellen handelt es sich um Transkriptionsfaktoren oder um zelluläre Rezeptoren. Es erscheint plausibel, daß durch die Aktivität der IgA-Protease beim Wirtsorganismus ein extrazellulärer Rezeptoranteil abgespalten wird und so eine korrekte Signalerkennung nicht mehr möglich ist. Andererseits könnte durch Abspaltung eines intrazellulären Re zeptoranteils die Signalweitergabe verhindert werden. BeideThe sequence data obtained by computer-aided comparisons show that a proportion of 7 percent of all human proteins carry a potential IgA protease interface, a selection of interesting examples being shown in FIG. 9. The surprisingly high number of human proteins found with IgA protease cleavage sites are transcription factors or cellular receptors. It seems plausible that the activity of the IgA protease in the host organism cleaves an extracellular receptor component and that correct signal detection is no longer possible. On the other hand, an intracellular Re share of the signal can be prevented. Both
Fälle hätten konsequenterweise eine Fehlsteuerung der Immunantwort zur Folge. Eine regulatorische Fehlsteuerung von Zellen auf DNA-Ebene wäre durch die Spaltung eines Trankriptionsfaktors wie NF-kappa-B (Figur 9) zu erklären. Die Bildung von immunogenen Proteinen oder auch die für die Immunantwort wichtige Proliferation bestimmter Zellen könnte somit verhindert werden oder außer Kontrolle geraten. Cases would consequently result in a malfunction of the immune response. A regulatory misregistration of cells at the DNA level could be explained by the cleavage of a transcription factor such as NF-kappa-B (FIG. 9). The formation of immunogenic proteins or the proliferation of certain cells which is important for the immune response could thus be prevented or get out of control.
Die durch Datenbankvergleiche in menschlichen Proteinen gefundenen IgA-Protease-Schnittstellen werden tatsächlich von dem Enzym erkannt und geschnitten, wie anhand des Leukozyten Oberflächenmarker CD8 gezeigt werden konnte (Pohlner et al., 1992). Zu diesem Zweck wurde ein 205 Aminosäuren langes Fragment von CD8, das die potentielle IgA-Protease-Schnittstelle enthielt (Figur 9), mit einem N-terminalen Teil der MS2 Polymerase fusioniert und in E . coli exprimiert. Das gereinigte Fusionsprodukt wurde durch die IgA-Protease gespalten. Die N-terminale Peptidsequenzierung zeigte schließlich, daß die IgA-Protease-Sequenz innerhalb des Bereiches von CD8, wie vorhergesagt, erkannt und hydrolysiert worden war. The IgA protease cleavage sites found in human proteins through database comparisons are actually recognized and cut by the enzyme, as was shown by the leukocyte surface marker CD8 (Pohlner et al., 1992). For this purpose, a 205 amino acid fragment of CD8, which contained the potential IgA protease cleavage site (FIG. 9), was fused with an N-terminal part of the MS2 polymerase and was converted into E. coli expressed. The purified fusion product was cleaved by the IgA protease. Finally, N-terminal peptide sequencing showed that the IgA protease sequence had been recognized and hydrolyzed within the CD8 region as predicted.
Beispiel 10 Example 10
Erzeugung kryptischer Selbstepitope  Generation of cryptic self-epitopes
Eine Möglichkeit, wie es infolge einer Neisserien-Infektion zu einer Fehlsteuerung des Immunsystems kommen kann, ist die Elimination regulatorischer oder sensorischer Proteinen durch die Aktivität der IgA-Protease (Beispiel 9). Eine weitere Möglichkeit besteht in der Entstehung von Spaltprodukten aus Wirtsproteinen, die als verändertes Selbst oder Fremdpeptid erkannt werden und so die Immunantwort in eine falsche Richtung lenken. One way in which malfunction of the immune system can occur as a result of a Neisserie infection is the elimination of regulatory or sensory proteins by the activity of the IgA protease (Example 9). Another possibility is the formation of cleavage products from host proteins, which are recognized as modified self or foreign peptide and thus steer the immune response in the wrong direction.
Während über die Eigenschaften der Antigen, die von MHC- Klasse I präsentiert werden, schon recht detaillierte Vorstellungen existieren (Falk et al., 1991), sind die Kenntnisse über gemeinsame Eigenschaften von präsentierten Pepti den an MHC-Klasse II Moleküle, zu der auch der mit RA in Verbindung gebrachte Subtyp DR4 gehört, noch sehr vage (Rötzschke and Falk, 1994). Nicht einmal die Länge dieser Petide erwies sich bisher als einheitlich, wobei jedoch die überwiegende Anzahl aus 14-16 Aminosäuren bestand. While there are already quite detailed ideas about the properties of the antigen presented by MHC class I (Falk et al., 1991), the knowledge about common properties of presented peptides is of MHC class II molecules, to which the subtype DR4 associated with RA belongs, is still very vague (Rötzschke and Falk, 1994). Not even the length of these petids has been shown to be uniform, but the majority consisted of 14-16 amino acids.
Die Pool-Sequenzierung von MHC-Klasse II gebundenen Peptiden ergab, daß ein Anteil von über 30 % der natürlichen Liganden an Position 2, vom Aminoende her betrachtet, ein Prolin besitzt (Rotzschke and Falk, 1994). Auch am Carboxy-Ende läßt sich ein gehäuftes Auftreten von Prolin nachweisen. Die terminale Anhäufung von Prolin-Resten ist möglicherweise auf die reduzierte Abbaubarkeit einer solchen Aminosäuresequenz durch Exoproteasen zurückzuführen. Dies ist also eher eine Folge der Prozessierung und steht nicht im Zusammenhang mit der Bindung an ein bestimmtes MHC-Molekül. Zwischen den terminalen Prolinen befindet sich eine Kernregion von etwa 9 Aminosäuren Länge, über die die spezifische Bindung erfolgt. Diese Bindung wird durch hydrophobe Aminosäuren vermittelt, die sich gehäuft an den Positionen 1, 4, 6 und 9 des Peptidkerns befinden, die auch als hydrophobe Ankerpositionen bezeichnet werden. Ein MHC-Klasse II präsentiertes Antigen besteht also aus einem prozessierten Peptid mit flankierenden Prolin-Resten, das ein zentrales Kernepitop mit definierten hydrophoben Ankerpositionen enthält (Figur 10). Die Eigenschaft an zweiter Position ein Prolin zu tragen, ist jedoch nicht nur auf MHC-Klasse II präsentierte Peptide beschränkt. Auch eine Reihe von Peptiden, die mit verschiedenen MHC- Klasse I Allelen assoziiert sind, zeigen an Postion 2 ein gehäuftes Auftreten von Prolin (Engelhard, 1994). Pool sequencing of MHC class II bound peptides showed that a portion of over 30% of the natural ligands at position 2, viewed from the amino end, has a proline (Rotzschke and Falk, 1994). A frequent occurrence of proline can also be detected at the carboxy end. The terminal accumulation of proline residues may be due to the reduced degradability of such an amino acid sequence by exoproteases. So this is more a result of processing and is not related to binding to a particular MHC molecule. Between the terminal prolines there is a core region of about 9 amino acids in length, through which the specific binding takes place. This binding is mediated by hydrophobic amino acids, which are frequently located at positions 1, 4, 6 and 9 of the peptide core, which are also referred to as hydrophobic anchor positions. An MHC class II antigen thus consists of a processed peptide with flanking proline residues, which contains a central core epitope with defined hydrophobic anchor positions (FIG. 10). However, the ability to carry a proline in the second position is not limited to peptides presented in MHC class II. A number of peptides which are associated with various MHC class I alleles also show an increased occurrence of proline at position 2 (Engelhard, 1994).
Aus Tabelle VI wird deutlich, daß eine Vereinheitlichung der bisher bekannten Schnittstellen der IgA-Protease zu dem Motiv X-P-Y-P führt, wobei X entweder Prolin oder Prolin-Alanin, Prolin-Serin bzw. Prolin-Threonin-Dipeptide symbolisiert. Die Spaltung erfolgt jedoch immer im Anschluß an das zweite Prolin, so daß eines der beiden entstehenden Spaltprodukte an Position 2 immer Prolin trägt. Damit ist eine erste Übereinstimmung von IgA-Protease Produkten mit MHC- Klasse II präsentierten Peptiden gegeben. Innerhalb der Proteine des Menschen, die Spaltstellen der IgA-Protease besitzen, gibt es Beispiele, die darüberhinaus die oben beschriebenen allgemeinen Kriterien für MHC-Klasse II präsentierte Antigene weitestgehend erfüllen (Figur 10). Daraus folgt, daß durch die Aktivität der IgA-Protease Wirtsproteine so prozessiert werden können, daß sie sich zur Präsentation durch MHC-Klasse II eignen. Diese als Folge der enzymatischen Aktivität der IgA-Protease entstehenden Selbstpeptide werden aufgrund einer fehlenden und vorher auch nicht notwendigen Toleranz als fremd erkannt und es kommt zu einer T- Zellreaktion gegen körpereigene Proteine. From Table VI it is clear that a standardization of the previously known interfaces of the IgA protease leads to the motif XPYP, where X symbolizes either proline or proline alanine, proline serine or proline threonine dipeptides. However, the cleavage always follows the second proline, so that one of the two resulting cleavage products always carries proline at position 2. This is the first agreement between IgA protease products and MHC Class II presented peptides. Within the proteins of humans which have cleavage sites of the IgA protease, there are examples which moreover largely meet the general criteria described above for MHC class II antigens (FIG. 10). It follows that the activity of the IgA protease allows host proteins to be processed in such a way that they are suitable for presentation by MHC class II. These self-peptides, which arise as a result of the enzymatic activity of the IgA protease, are recognized as foreign due to a lack of tolerance which was not previously necessary and a T-cell reaction against the body's own proteins occurs.
Beispiel 11 Example 11
Sequenzhomologie des β-Core mit Aspartyl-Proteasen Sequence homology of the β core with aspartyl proteases
Die IgA-Protease wird als Teil eines Precursor-Moleküls (IPP) gebildet. Die Translokation durch die äußere Membran erfolgt mit Hilfe des C-terminalen Anteils des Precursors, dem β-Core. Während die IgA-Protease sich als Polyprotein autokatalytisch abspaltet und extrazellulär weiter reift verbleibt der β-Core in der Membran (Pohlner et al., 1987). The IgA protease is formed as part of a precursor molecule (IPP). The translocation through the outer membrane takes place with the help of the C-terminal part of the precursor, the β-core. While the IgA protease splits off autocatalytically as a polyprotein and matures further extracellularly, the β core remains in the membrane (Pohlner et al., 1987).
Die Anordnung von verschiedenen funktioneilen Domänen auf einem Proteinstrang und die sequentielle Prozessierung in distinkte Proteine erinnert sehr an die Organisation viraler Elemente (Kräusslich et al., 1989). Sowohl für das Virus-Assembly aber auch für die Proteolyse inaktiver Hormonvorläufer werden Aspartyl-Proteasen benötigt (Dougherty et al., 1993). Vier verschiedene Klassen von Proteinasen sind bisher beschrieben worden:  The arrangement of different functional domains on a protein strand and the sequential processing into distinct proteins is very reminiscent of the organization of viral elements (Kräusslich et al., 1989). Aspartyl proteases are required both for virus assembly and for proteolysis of inactive hormone precursors (Dougherty et al., 1993). Four different classes of proteinases have been described so far:
Cystein-, Serin-, Metallo- und Aspartyl-Proteasen. Je nachdem welche Aminosäuresequenz im aktiven Zentrums vorkommt, werden proteolytische Enzyme den genannten vier Klassen zugeordnet. Auffällig für Aspartyl-Proteasen ist die geringe Anzahl der konservierten Reste, die notwendig sind, um katalytisch aktiv zu sein (Miller et al., 1989). Eine Sequenzanalyse des β-Core mit verschiedenen viralen Enzymen zeigt in dem oben genannten Bereich eine hohe Homologie (Figur 7). Sogar der Abstand zu einem weiteren konservierten Bereich, wahrscheinlich einem Teil der zur Strukturbildung beiträgt, ist genau gleich. Weiterhin bemerkenswert ist die hohe Variabilität außerhalb der konservierten Bereiche. Auch bei nahe verwandten Viren, wie HIV-l und HIV-2, treten hier sehr viele nichtidentische/ nichtähnliche Aminosäurereste auf. Zusammenfassend kann man sagen, daß der ß-Core hinreichende SequenzInformationen besitzt, um eine funktionelle und membranständige Aspartyl-Protease zu repräsentieren. Cysteine, serine, metallo and aspartyl proteases. Depending on which amino acid sequence occurs in the active center, proteolytic enzymes are assigned to the four classes mentioned. What is striking for aspartyl proteases is the small number of conserved residues which are necessary in order to be catalytically active (Miller et al., 1989). A sequence analysis of the β core with various viral enzymes shows a high degree of homology in the area mentioned above (FIG. 7). Even the distance to another conserved area, probably a part that contributes to the structure formation, is exactly the same. The high variability outside the conserved areas is also remarkable. A large number of non-identical / non-similar amino acid residues also occur here in closely related viruses such as HIV-1 and HIV-2. In summary, it can be said that the β-core has sufficient sequence information to represent a functional and membrane-bound aspartyl protease.
Die Familie der viralen Aspartyl-Proteasen weist eine weitere Gemeinsamkeit auf. Dies ist die unspezifische Erkennungssequenz, die gespalten wird (Dougherty et al. 1993). Damit nicht alle Proteine in der Umgebung unkontrolliert gespalten werden, können intrazelluläre Veränderungen ein Mechanismus zur Regulation sein. Aspartyl-Proteasen besitzen ein pH Optimum im sauren Bereich. In Phagozyten wird sich wahrscheinlich die Wirkung einer bakteriellen Aspartyl-Protease voll entfalten und zum Überleben des intrazellulären Bakteriums beitragen. Zusätzlich zum aktiven Kampf des Pathogens gegen zelluläre Abwehrmechanismen können mit der Protease wechselwirkende Peptide veränderte antigene Eigenschaften aufweisen, die wiederum - MHC - präsentiert - zu einem autoreaktiven Immunsystem führen (Anomasin et al., 1990).  The family of viral aspartyl proteases has another thing in common. This is the non-specific recognition sequence that is cleaved (Dougherty et al. 1993). So that not all proteins in the environment are cleaved uncontrollably, intracellular changes can be a mechanism for regulation. Aspartyl proteases have a pH optimum in the acidic range. In phagocytes, the effects of a bacterial aspartyl protease are likely to develop fully and contribute to the survival of the intracellular bacterium. In addition to the pathogen's active fight against cellular defense mechanisms, peptides interacting with the protease can have altered antigenic properties which, in turn - as presented by MHC - lead to an autoreactive immune system (Anomasin et al., 1990).
Beispiel 12 Example 12
Strukturelle und funktioneile Homologien des α-Proteins zum retroviralen TAT-Protein  Structural and functional homologies of the α protein with the retroviral TAT protein
Innerhalb der Retroviren stellen die Lentiviren eine eigene Familie dar. Zu den Lentiviren gehören HIV, HTLV und tierpathogene Arten, die ebenfalls Immunschwächekrankheiten hervorrufen. Das Genom der Lentiviren läßt sich in drei codierende Bereiche einteilen: gag codiert die strukturellen Pro teine der inneren Hülle, env die Glykoproteine der äußeren Membran und pol Enzyme, die zur Virusreplikation notwendig sind, wie die Reverse Transkriptase, Endonuklease und eine Protease. Zusätzlich zu diesen strukturellen Genen sind regulatorische Gene, wie das tat-Gen, vorhanden, die sich bei den einzelnen Viren dieser Gruppe unterscheiden können. Die Transkription viraler Gene wird durch das tat-Genprodukt, das Tat-Protein, aktiviert. Durch die Kernlokalisationsse- quenz wird nach der Synthese im Zytoplasma der gerichtete Transport in den Nukleus gewährleistet. Dort wird durch die Bindung des Tat-Proteins an die TAR ( transactivation responsive elements) innerhalb der LTR {long terminal repeats) der Virus-DNA die Transkription aktiviert, was schließlich zur Ausschleusung infektiöser Viruspartikel führt. Lentiviruses are a separate family within retroviruses. Lentiviruses include HIV, HTLV and animal pathogenic species, which also cause immune deficiency diseases. The genome of the lentiviruses can be divided into three coding areas: gag codes the structural pro teine of the inner envelope, env the glycoproteins of the outer membrane and pol enzymes which are necessary for virus replication, such as the reverse transcriptase, endonuclease and a protease. In addition to these structural genes, there are regulatory genes, such as the tat gene, which can differ in the individual viruses in this group. The transcription of viral genes is activated by the tat gene product, the tat protein. After the synthesis in the cytoplasm, the directional transport into the nucleus is ensured by the core localization sequence. There, the binding of the Tat protein to the TAR (transactivation responsive elements) within the LTR (long terminal repeats) of the virus DNA activates the transcription, which ultimately leads to the removal of infectious virus particles.
Sequenzanalysen der IPP von N . gonhorroeae zeigten, daß das α-Protein, eine dem Tat-Protein ähnliche Kernlokalisations- sequenz trägt (siehe Beispiel 1). Diese Kernlokalisationsse- quenz ist funktioneil, da das α-Protein oder Fusionsproteine, die diese Sequenz des α-Proteins tragen, in den Nukleus transportiert werden (siehe Beipiel 7). Weitere strukturelle Änlichkeiten sind in der nachfolgenden Tabelle aufgeführt:  Sequence analysis of the IPP of N. Gonhorroeae showed that the α protein carries a nuclear localization sequence similar to the Tat protein (see Example 1). This core localization sequence is functional since the α protein or fusion proteins which carry this sequence of the α protein are transported into the nucleus (see Example 7). Further structural similarities are listed in the table below:
Figure imgf000075_0001
Figure imgf000075_0001
Anhand eines eukaryontischen Zellsystems wird die Funktion des α-Proteins als Transkriptionsfaktor untersucht. Diese Zellen tragen ein Genkonstrukt bestehend aus LTR des HIV oder anderer Retroviren in Verbindung mit einem Reporter- Gen, wie z.B. CAT oder Luciferase. Gelangt das α-Protein in den Kern dieser Zellen und werden die LTR aktiviert, führt dies in diesem Fall zur Expression der Chloramphenicol-Acetyltransferase (CAT), deren Aktivität spezifisch nachweisbar ist. The function of the α protein as a transcription factor is investigated using a eukaryotic cell system. This Cells carry a gene construct consisting of LTR from HIV or other retroviruses in connection with a reporter gene, such as CAT or luciferase. If the α-protein gets into the nucleus of these cells and the LTR are activated, this leads to the expression of chloramphenicol acetyltransferase (CAT), the activity of which is specifically detectable.
Eine Aktivität des α-Proteins als Transkriptionsfaktor könnte sich als wichtig erweisen im Hinblick auf die Aktivierung von ERSs. Das eukaryotische Genom trägt normalerweise zwischen 5 und 10 % sogenannte retrotransposable ERSs (endogenous retroviral sequences ) . Diese ERSs stellen einen wichtigen Faktor im Bereich der Reorganisation des eukaryotischen Genoms dar, unbekannt ist jedoch, wie diese retroviralen Elemente in die eukaryotische DNA gelangt sind. Gesichert ist zumindest, daß humane ERSs per se defekte provirale Elemente darstellen, die nicht mehr zur Virusproduktion in der Lage sind. Insgesamt repräsentieren diese Elemente jedoch ein großes Reservoir an viralen Genen, die durch Mutationen oder Rekombinationen mit exogenen Retroviren oder auch anderen Faktoren, wie z.b. auf endogene LTR wirkende Tanskriptionsfaktoren, aktiviert werden können (Perl et al., 1993). So ist HRES ein dem HTLV-ähnliches endogenes retrovirales Element, das funktioneile Transkriptionselemente, darunter LTR, beinhaltet und somit zur Proteinexpression befähigt ist (Banki et al., 1992). Bei Patienten mit Autoimmunkrankheiten wie z. B. Multiple Sklerose, SJörgen's Syndrom und Lupus Erythematosus wurde festgestellt, daß Auto-Antikörper gegen das HRES vorhanden waren, d.h. HRES kann als Autoantigen fungieren.  Activity of the α protein as a transcription factor could prove to be important with regard to the activation of ERSs. The eukaryotic genome normally carries between 5 and 10% so-called retrotransposable ERSs (endogenous retroviral sequences). These ERSs are an important factor in the reorganization of the eukaryotic genome, but it is unknown how these retroviral elements got into the eukaryotic DNA. At least it is certain that human ERSs per se are defective proviral elements that are no longer able to produce viruses. Overall, however, these elements represent a large reservoir of viral genes that are caused by mutations or recombinations with exogenous retroviruses or other factors such as e.g. transcription factors acting on endogenous LTR can be activated (Perl et al., 1993). HRES is an endogenous retroviral element similar to HTLV, which contains functional transcription elements, including LTR, and is thus capable of protein expression (Banki et al., 1992). In patients with autoimmune diseases such as B. Multiple sclerosis, SJörgen's syndrome and lupus erythematosus were found to have auto-antibodies to HRES, i.e. HRES can act as an autoantigen.
Zusätzlich konnte bei Mäusen gezeigt werden, daß ERSs sogenannte Superantigene codieren und hierdurch Autoimmunantworten auslösen können (Krieg et al., 1990). Superantigene sind in der Lage, unabhängig von der antigenen Spezifität einer T-Zelle, an die Vβ-Kette des TCR und an den MHC II-Komplex einer antigenpräsentierenden Zelle zu binden und lösen somit eine Immunreaktion aus. Bei Patienten mit RA wurde in der Synovialflüssigkeit die Expansion Vβ-spezifischer T-Zellen festgestellt. Es wird angenommen, daß diese Expansion Vβ- spezifischer T-Zellen durch Superantigene ausgelöst wurde (Paliard et al., 1991). Neue Hinweise auf die Pathogenese Rheumatoider Arthritis ergaben elektronenmikroskopische Untersuchungen synovialer Zellen. Hier wurden bisher nicht bekannte Retrovirus-ähnliche Partikel festgestellt. Eine Erklärung hierfür würde die LTR-abhängige Aktivierung endogener retroviraler Elemente bieten, die zur Expression virusähnlicher Partikel führen könnte (Keyszer et al., 1994). In addition, it was shown in mice that ERSs encode so-called superantigens and can thereby trigger autoimmune responses (Krieg et al., 1990). Regardless of the antigenic specificity of a T cell, superantigens are able to bind to the V β chain of the TCR and to the MHC II complex of an antigen presenting cell and thus trigger an immune reaction. Patients with RA have been reported in the Synovial fluid detected the expansion of V β- specific T cells. This expansion of Vβ-specific T cells is believed to have been triggered by superantigens (Paliard et al., 1991). New evidence for the pathogenesis of rheumatoid arthritis was provided by electron microscopic examinations of synovial cells. Previously unknown retrovirus-like particles were found here. An explanation for this would be the LTR-dependent activation of endogenous retroviral elements, which could lead to the expression of virus-like particles (Keyszer et al., 1994).
Somit ist die Funktion des α-Proteins nicht nur im Hinblick auf die LTR-Aktivierung virusinfizierter Zellen interessant, sondern auch im Hinblick auf die mögliche Funktion als Transkriptionsfaktor von ERSs, die für die Entstehung von Autoimmunkrankheiten verantwortlich sein können. Da ca. 50 % der Bevölkerung im Laufe ihres Lebens immer wieder asymptomatische Träger von N . meningitidis sind, und daher eine Exposition mit α-Protein gegeben ist, könnte die aktivierende Funktion des α-Proteins auf die LTR endogener retroviraler Elemente einen Zusammenhang zu häufig auftretenden Autoimmunkrankheiten, wie RA, aufzeigen.  The function of the α protein is therefore interesting not only with regard to the LTR activation of virus-infected cells, but also with regard to the possible function as a transcription factor of ERSs, which can be responsible for the development of autoimmune diseases. Since approx. 50% of the population repeatedly asymptomatic carriers of N. meningitidis, and therefore exposure to α-protein is present, the activating function of the α-protein on the LTR of endogenous retroviral elements could indicate a connection to common autoimmune diseases such as RA.
Beispiel 15 Example 15
Opa-vermittelte Adhäsion an Proteoglykan Rezeptoren Grandpa-mediated adhesion to proteoglycan receptors
Die erste Kontaktaufnahme humanpathogener Neisserien mit der Wirtszelle geschieht über Oberflächenstrukturen der Bakterienzelle, den Pili. Die enge Adhäsion der Bakterienzelle an die Wirtszellmembran, die schließlich zur Invasion in die Wirtszelle führt, wird auf bakterieller Seite über Opa-Proteine der äußeren Membran vermittelt. Zusätzlich spielen Opa-Proteine bei der Ausprägung der Gewebespezifität eine zentrale Rolle (Kupsch et al., 1993). Die spezifische Adhäsion an Epithelzellen wird durch Opa50 vermittelt, die Proteine Opa51-60 hingegen, sind für die Adhäsion an periphere Blutlymphozyten verantwortlich. Über die Rezeptoren auf Sei ten der Wirtszellen und die molekularen Mechanismen dieser Zellspezifität der Neisserien ist wenig bekannt. Um die zellulären Komponenten zu charakterisieren wurde mittels bestimmter proteolytischer Enzyme und Inhibitoren die Opa-vermittelte Adhäsion und Invasion an epitheliale Zellen inhibiert. Hierzu wurden die Epithelzellen vor der Infektion mit Neisserien und folgenden Zusätzen behandelt: The first contact of human-pathogenic Neisseries with the host cell takes place via surface structures of the bacterial cell, the pili. The close adhesion of the bacterial cell to the host cell membrane, which ultimately leads to invasion into the host cell, is mediated on the bacterial side via opa proteins of the outer membrane. In addition, grandpa proteins play a central role in the expression of tissue specificity (Kupsch et al., 1993). The specific adhesion to epithelial cells is mediated by Opa 50 , the proteins Opa 51-60, however, are responsible for the adhesion to peripheral blood lymphocytes. About the receptors on Sei Little is known about the host cells and the molecular mechanisms of this cell specificity of the Neisseries. In order to characterize the cellular components, the opa-mediated adhesion and invasion to epithelial cells was inhibited by means of certain proteolytic enzymes and inhibitors. For this purpose, the epithelial cells were treated with Neisseries and the following additives before infection:
Figure imgf000079_0001
Figure imgf000079_0001
Hieraus folgt, daß der zelluläre Rezeptor für die Opa-vermittelte Adhäsion ein membranständiges Heparansulfatproteoglykan darstellt. Zelloberflächen-Proteoglykane sind eine große Familie hoch-polymorpher Glykoproteine, die entsprechend des jeweiligen Core-Proteins, der Zusammensetzung der am Core anhängenden Glykosaminoglykanseitenketten und der Verankerung in der Zellmembran in verschiedene Gruppen eingeteilt werden: in die Syndekane, Betaglykane und CD-44 (Bernfield et al., 1992). Hinweise auf die Struktur des Heparansulfatproteoglykan-Rezeptors für die Opa-vermittelte Adhäsion gaben folgende Ansätze: Über die Behandlung mit Trypsin konnte eine 150-200 kD große Ektodomäne isoliert werden. Weiterhin war es möglich, isolierte Proteoglykane aktiv in Phospholipidbilayervesikeln zu rekonstituieren, d.h. es muß eine hydrophobe Transmembran-Domäne vorliegen. Anhand dieser Resultate läßt sich der zelluläre Opa-Rezeptor der Familie der Syndekane zuordnen. Syndekane zeichnen sich durch ein Core-Protein aus, das aus einer großen extrazellulären Domäne mit einer Vielzahl möglicher Glykosaminoglykan- Bindungsstellen, einer hochkonservierten, hydrophoben Transmembran-Domäne und einem kurzen Carboxy-terminalen zytoplasmatischen Teil besteht. It follows that the cellular receptor for grandpa-mediated adhesion is a membrane-bound heparan sulfate proteoglycan. Cell surface proteoglycans are a large family of highly polymorphic glycoproteins, which are divided into different groups according to the respective core protein, the composition of the glycosaminoglycan side chains attached to the core and the anchorage in the cell membrane: the syndecans, beta-glycans and CD-44 (Bernfield et al., 1992). The following approaches indicated the structure of the heparan sulfate proteoglycan receptor for grandpa-mediated adhesion: Treatment with trypsin enabled a 150-200 kD ectodomain to be isolated. Furthermore, it was possible to actively reconstitute isolated proteoglycans in phospholipid bilayer vesicles, i.e. there must be a hydrophobic transmembrane domain. Based on these results, the cellular grandpa receptor can be assigned to the syndecane family. Syndecans are characterized by a core protein that consists of a large extracellular domain with a large number of possible glycosaminoglycan binding sites, a highly conserved, hydrophobic transmembrane domain and a short carboxy-terminal cytoplasmic part.
Versuche mit Neisserien-Mutanten zeigten, daß die Proteoglykan-abhängige Adhäsion über ein bestimmtes Opa-Protein vermittelt wird (van Putten et al., 1994). Wurden Neisserienstämme verwendet, die jeweils nur ein Opa-Protein produzieren, war nur die Mutante, die das Invasion-assozi- ierte Opa-Protein (opa50) exprimierte, dazu in der Lage, an die isolierte Ektodomäne des Proteoglykans von Epithelzellen zu binden. Die Epithelzellen des Urogenitaltraktes und der Cornea, die natürlichen Habitate von Neisserien, exprimieren Syndecan-1, d.h. auch in vivo wird die Invasion von Epithelzellen über die Bindung von Opa50 an zelluläres Syndekan-1 vermittelt. Die Interaktion von bakteriellem Opa50-Protein und zellulärem Syndekan-1 nimmt somit eine Schlüsselrolle im Infektionsverlauf ein. Diese spezifische Wechselwirkung zwischen pathogenem Organismus und seiner Wirtszelle bietet verschiedene Ansätze zur Entwicklung von Arzneimitteln. Zum einen können Teile des Opa50-Proteins als Impfstoffe eingesetzt werden, die zur Bildung von spezifischen Antikörpern gegen die adhäsive Domäne von Opa50 führen, somit die Adhäsion und Invasion von Neisserien verhindern, und dadurch vor einer Infektion schützen. Zum anderen ist die Gabe kompetitiver Inhibitoren denkbar, die die Infektion mit Neisserien ebenfalls durch Inhibition der Adhäsion verhindern. Experiments with Neisseries mutants showed that the proteoglycan-dependent adhesion is mediated by a certain grandpa protein (van Putten et al., 1994). When Neisserie strains were used that each produce only one grandpa protein, only the mutant that expressed the invasion-associated grandpa protein (grandpa 50 ) was able to bind to the isolated ectodomain of the proteoglycan of epithelial cells. The epithelial cells of the urogenital tract and the cornea, the natural habitats of Neisseries, express Syndecan-1, ie the invasion of epithelial cells is also mediated in vivo via the binding of Grandpa 50 to cellular Syndekan-1. The interaction of bacterial Opa 50 protein and cellular Syndekan-1 thus plays a key role in the course of the infection. This specific interaction between the pathogenic organism and its host cell offers different approaches to drug development. On the one hand, parts of the Opa 50 protein can be used as vaccines, which lead to the formation of specific antibodies against the adhesive domain of Opa 50 , thus preventing the adhesion and invasion of Neisseries, and thereby protecting them from infection. On the other hand, it is conceivable to give competitive inhibitors which also prevent infection with Neisseries by inhibiting the adhesion.
Jedoch sind Arzneimittel gegen Neisserien-Infektionen nicht nur wichtig im Hinblick auf primäre Krankheitssymptome, sondern vor allem in Hinblick auf sekundäre Spätschäden, wie die Entwicklung von Autoimmunkrankheiten; d.h. Vakzine gegen Neissereien könnten auch Vakzine gegen bestimmte Autoimmunkrankheiten wie z. B. die Rheumatoide Arthritis bedeuten.  However, drugs for Neisseries infections are not only important with regard to primary symptoms of the disease, but especially with regard to secondary late damage, such as the development of autoimmune diseases; i.e. Vaccine against Neisserei could also vaccine against certain autoimmune diseases such as. B. mean rheumatoid arthritis.
Beispiel 17 Example 17
Immundiagnostik Immunodiagnostics
Die immunogenen Eigenschaften der hier verwendeten Link- und neisserialen γ-Peptide, die sich in eindrucksvoller Weise an der Stimulation von peripheren mononukleären Zellen aus Rheumapatienten zeigte (Beispiel 6), eröffnen auch interessante Anwendungsmöglichkeiten als Immundiagnostika. Aufgrund der antigenen Eigenschaften des 7-Peptids ist es denkbar, daß infolge einer Infektion mit Neisserien auch Peptid-spezifische "Memory" T-Zellen gebildet werden, die demnach bei Verwendung des entsprechenden Peptides im sensitiven T-Zellproliferationstest nachgewiesen werden könnten. The immunogenic properties of the link- and neisserial γ-peptides used here, which were impressively demonstrated by the stimulation of peripheral mononuclear cells from rheumatism patients (example 6), also open up interesting applications as immunodiagnostics. Due to the antigenic properties of the 7-peptide, it is conceivable that peptide-specific "memory" T cells are also formed as a result of infection with Neisseries, which could therefore be detected in the sensitive T cell proliferation test when the corresponding peptide is used.
Unter der Annahme des molekularen Mimikry zwischen dem neisserialen 7-Peptid und dem Link-Peptid, entständen bei Spendern mit entsprechender genetischer Disposition des MHC (z.B HLA DR4DW4, HLA DR1) auch kreuzreaktive, potentiell autoaggressive T-Zellen, die dann auch mit dem Link-Peptid reagieren könnten. Diese T-Zellen verursachten auf Grund ihrer geringen Zahl und ihrer fehlenden "Hoιrting"-Mechanismen, aber möglicherweise auch durch aktive Immunsuppression zunächst keine Erkrankung. Dennoch könnten, als Folge einerAssuming the molecular mimicry between the neisserial 7-peptide and the link peptide, donors with a corresponding genetic disposition of the MHC (e.g. HLA DR4DW4, HLA DR1) would also develop cross-reactive, potentially auto-aggressive T cells, which then also contain the link Peptide could react. These T cells caused due to their small number and their lack of "hearing" mechanisms, but possibly also by active immunosuppression initially no disease. Nevertheless, as a result of one
Sekundärinfektion, bei dem z.B. durch Superantigene eine große Population von T-Zellklonen reaktiviert werden, auch derartige kreuzreaktiven T-Zellpopulationen zur Vermehrung angeregt werden, eine kritische Anzahl überschreiten und die Befähigung erlangen, ihr pathogenes Potential zu entfalten. In diesem Zusammenhang sollten sich unter bestimmten Umständen bereits früher, vor der eigentlichen Manifestation der Erkrankung, peptidspezifische T-Zellen im peripheren Blut von gesunden Spendern, die den entsprechenden MHC-Haplotyp exprimieren, nachweisen lassen. Diese T-Zellen werden dann in vitro, ähnlich wie die T-Zellen der RA-Patienten (Beispiel 6), durch die Antigene zur Proliferation stimuliert. Die Proliferation wird analog den Bedingungen unter Beispiel 6 mittels 3H-Thymidineinbau während der DNA-Synthese gemessen. In der Tat wurde unter 15 verschiedenen, äußerlich gesunden Blutspendern eine Person gefunden, dessen PBMC sowohl mit dem Link-Peptid wie auch mit dem 7-Peptid reagierten. Der Stimulation-Index für das Link-Peptid betrug nach 7 Tagen und 10 Tagen (+IL-2) : 6; für das γ-Peptid: 2 (7 Tage nur γ-Peptid) bzw. 8 (10 Tage 7-Peptid + IL-2), sowie für das Kontrollantigen Tetanustoxoid: 7. Interessanterweise leidet dieser Spender an leichten rheumatischen Beschwerden ohne jedoch eine Arthritis bereits zu diesem Zeitpunkt entwickelt zu haben. Dies und der bis jetzt noch unbekannte MHC-Subtyp lassen die Schlußfolgerung zu, daß mit Hilfe der Peptid-spezifischen Proliferation von T-Zellen ein Risiko für eine eventuell zu einem späteren Zeitpunkt auftretende Entwicklung von RA eingeschätzt werden kann und entsprechende Gegenmaßnahmen, die im Zusammenhang mit diesem Patentanspruch stehen, ergriffen werden könnten. Secondary infection, in which, for example, a large population of T cell clones are reactivated by superantigens, such cross-reactive T cell populations are also stimulated to multiply, exceed a critical number and acquire the ability to develop their pathogenic potential. In this context, peptide-specific T cells in the peripheral blood of healthy donors expressing the corresponding MHC haplotype should be detected earlier, before the actual manifestation of the disease. These T cells are then stimulated in vitro by the antigens for proliferation, similar to the T cells of the RA patients (Example 6). The proliferation is measured analogously to the conditions under Example 6 by means of 3 H-thymidine incorporation during the DNA synthesis. In fact, one person was found among 15 different, externally healthy blood donors whose PBMC reacted with both the link peptide and the 7 peptide. The stimulation index for the link peptide after 7 days and 10 days (+ IL-2) was 6; for the γ-peptide: 2 (7 days only γ-peptide) or 8 (10 days 7-peptide + IL-2), as well as for the control antigen tetanus toxoid: 7. Interestingly, this donor suffers from mild rheumatic complaints without arthritis to have already developed at this point. This and the hitherto unknown MHC subtype allow the conclusion that the peptide-specific proliferation of T cells can be used to assess a risk of developing RA at a later date and appropriate countermeasures that are related stand with this claim, could be taken.
Beispiel 18 Example 18
Sequenzhomologien des IPP mit viralen Genprodukten Sequence homologies of IPP with viral gene products
Bei Retroviren entstehen eine Reihe funktioneller Proteine durch Spaltung eines Vorlauferproteins, wobei die dafür ver antwortliche Protease ein Bestandteil des Vorläufers Polyproteins ist (Kräusslich et al., 1989). Darin besteht also eine strukturelle Ähnlichkeit zwischen retroviralen Elementen und dem IgA-Protease-Precursor. Um Ähnlichkeiten auch auf Ebene der Primärstruktur nachzuweisen, wurden Sequenzvergleiche des IPP mit Genprodukten von Retroviren unter Verwendung der Wisconsin Sequence Analysis Package von GCG (Genetics Computer Group Inc.) durchgeführt. Zu diesem Zweck wurde zunächst eine Datenbank mit dem Namen Retrovirus angelegt, in der die Aminosäurensequenzen der bis zu diesem Zeitpunkt in der Swissprot-Datenbank abgelegten retroviralen Elemente zusammengeführt wurden. In einem anderen Ansatz wurden die Nukleotidsequenzen von 53 verschiedenen Retrovirusgenomen in einer Datenbank mit dem Namen Virus zusammengefaßt und mit Hilfe des Computers in allen möglichen Leserahmen translatiert. Mit Hilfe der Fasta facility (Pearson and Lipman; 1988) und unter Verwendung des Algorithmus von Wilbur und Lipman (1977) wurde in diesen Datenbanken nach Ähnlichkeiten zu den funktioneilen Einheiten des IPP von Neisseria gonorrhoeae MSll gesucht. Die größte Übereinstimmung zeigte sich beim Vergleich des α-Proteins mit dem Polyprotein des tomatoe ringspot virus . Hier waren in einem Bereich, der den Aminosäuren 179-232 des Polyproteins entsprach, 54 % der Aminosäuren an den identischen Positionen konserviert. Eine weitere unerwartet hohe Sequenzhomologie ließ sich zwischen der Aminosäuresequenz des 7-Peptids und eines Nef-Proteins des HIV-1 (Accessionnummer: P04603) finden. Hier waren von 25 Aminosäuren 36 % identisch konserviert und darüberhinaus 44 % mit ähnlichen Eigenschaften erhalten, wodurch sich eine Ähnlichkeit dieser Sequenzabschnitte von insgesamt 80 % ergab. Desweiteren zeigten sich Sequenzhomologien zwischen dem ß-Core und dem Env-Protein verschiedener Retroviren, aber auch wie in Beispiel 11 dargestellt zur retroviralen Aspartylprotease. Das α-Protein zeigte Homologien zu verschiedenen Polyprotein-Vorläufern und zum Tat-Protein, auch über den Bereich des Kerntranslationssignals hinaus. Ebenso zeigte das 7-Peptid Homologien zu einer Reihe von NEF-Proteinen und einem Polyprotein desIn retroviruses, a number of functional proteins are formed by cleaving a precursor protein, the ver The protease responsible is a component of the precursor polyprotein (Kräusslich et al., 1989). So there is a structural similarity between retroviral elements and the IgA protease precursor. In order to demonstrate similarities also at the level of the primary structure, sequence comparisons of the IPP with gene products of retroviruses were carried out using the Wisconsin Sequence Analysis Package from GCG (Genetics Computer Group Inc.). For this purpose, a database called Retrovirus was first created, in which the amino acid sequences of the retroviral elements previously stored in the Swissprot database were merged. In another approach, the nucleotide sequences of 53 different retrovirus genomes were summarized in a database called Virus and translated into all possible reading frames using the computer. With the help of the Fasta facility (Pearson and Lipman; 1988) and using the algorithm of Wilbur and Lipman (1977), similarities to the functional units of the IPP of Neisseria gonorrhoeae MSII were searched in these databases. The greatest agreement was found when comparing the α protein with the polyprotein of the tomatoe ringspot virus. Here, in an area corresponding to amino acids 179-232 of the polyprotein, 54% of the amino acids were conserved at the identical positions. Another unexpectedly high sequence homology was found between the amino acid sequence of the 7-peptide and a Nef protein of HIV-1 (accession number: P04603). Here 36% of 25 amino acids were conserved identically and 44% with similar properties were preserved, which resulted in a total similarity of these sequence segments of 80%. Furthermore, sequence homologies between the β-core and the Env protein of various retroviruses were found, but also as shown in Example 11 for the retroviral aspartyl protease. The α-protein showed homologies to various polyprotein precursors and to the Tat protein, also beyond the range of the nuclear translation signal. The 7-peptide also showed homologies to a number of NEF proteins and a polyprotein from
Grapewine Fanleaf Virus (GFLV) Eine Eigenschaft nahezu aller gefunden Sequenzhomologien des IPP mit retroviralen Proteinen war, daß sich die konservierten identischen Aminosäuren in Bereichen befanden, die lokal konzentriert sind und zusätzlich eine hohe Anzahl von ähnlichen Aminosäuren aufweisen. Somit konnten also Sequenzabschnitte von hoher Ähnlichkeit gefunden werden, die von Bereichen ohne Sequenzübereinstimmungen umgeben waren. Eine solche Clusterung der Sequenzhomologien wäre erklärbar durch eine Enstehung oder eine Veränderung des IPP infolge von Rekombination mit retroviralen Elementen. Grapewine Fanleaf Virus (GFLV) A characteristic of almost all found sequence homologies of IPP with retroviral proteins was that the conserved identical amino acids were in areas that are locally concentrated and additionally have a high number of similar amino acids. Thus, sequence sections of high similarity could be found, which were surrounded by areas without sequence matches. Such a clustering of the sequence homologies could be explained by an origin or a change in the IPP as a result of recombination with retroviral elements.
Beispiel 19 Example 19
Stimulierung des viralen SV-40 Promotors Stimulation of the SV-40 viral promoter
Eine wichtige funktionelle Aktivität des α-Proteins läßt sich durch folgendes Experiment ableiten. In Kotransfekti- onsstudien, wobei ein Plasmid das α-Protein kodiert und das zweite Plasmid den Neomyzin-Resistenzmarker enthält, konnte erstmals eine Wirkung des α-Proteins auf Transkriptionsebene beobachtetwerden. Nach der Transfektion beider Vektoren in die Maus L(TK-) Fibroblastenzellinie waren alle auf Antibiotikaresistenz selektionierten Klone auch α-Protein positiv (Langenberg, 1993). Obwohl das α-Protein kodierende Plasmid nur in gleicher Menge mit dem Selektionsmarkerplasmid kotransfiziert wurde (1-5 mg Quiagen-DNA) war jeder Neomyzin- resistente Klon aber auch α-Protein positiv. Unsere Vermutung geht dahin, daß das a-Protein, da es in diesem System konstitutiv expremiert wird, die Transkription vom SV-40 Promotor, der die Antibiotika-Resistenz kontrolliert, verstärkt. Im Bereich des SV-40 Promotors befinden sich mehrere Sequenzen, von denen die Transkription aktiviert werden kann (McKnight and Tjian, 1986). Zelluläre Proteine, wie die Transkriptionsfaktoren SP1 und CTF, binden hier in sequenzspezifischer Art und Weise. Aber auch Faktoren, die die Transkription indirekt durch Bindung an Transkriptionsfakto ren beeinflussen sind bekannt. Das große T-Antigen des SV-40 Virus aktiviert zum Beispiel den viralen späten Promotor durch Bindung/Modifizierung eines Wirtsproteins. Ähnliche Transaktivierungseffekte konnten für das HIV Tat-Protein gezeigt werden (Kessler and Mathews, 1991). An important functional activity of the α-protein can be derived from the following experiment. In cotransfection studies, in which one plasmid encodes the α protein and the second plasmid contains the neomycin resistance marker, an effect of the α protein on the transcription level was observed for the first time. After the transfection of both vectors into the mouse L (TK) fibroblast cell line, all clones selected for antibiotic resistance were also α-protein positive (Langenberg, 1993). Although the α-protein coding plasmid was co-transfected with the selection marker plasmid only in the same amount (1-5 mg Quiagen DNA), each neomycin-resistant clone was also α-protein positive. Our assumption is that since the a protein is constitutively expressed in this system, it increases transcription from the SV-40 promoter, which controls antibiotic resistance. In the area of the SV-40 promoter there are several sequences from which the transcription can be activated (McKnight and Tjian, 1986). Cellular proteins, such as the transcription factors SP1 and CTF, bind here in a sequence-specific manner. But also factors that indirectly affect the transcription by binding to the transcription factor influence are known. For example, the SV-40 virus large T antigen activates the late viral promoter by binding / modifying a host protein. Similar transactivation effects could be shown for the HIV Tat protein (Kessler and Mathews, 1991).
Beispiel 20 Example 20
Induzierung eines "Germinal vesicle breakdown" (GVBD) in reifen Xenopus Oozyten durch die IgA-Protease Aktivität.  Induction of a "Germinal vesicle breakdown" (GVBD) in mature Xenopus oocytes by the IgA protease activity.
Mikroinjektion in Xenopus laeviε Oozyten ist eine häufig verwendete Methode, um Wirkmechanismen von einzelnen Proteinen zu analysieren. Man verwendet für solche Studien meist sogenannte Stadium VI Oozyten, die in ihrer Reifung bis zur Einleitung der ersten meiotischen Teilung fortgeschritten sind. Eine solche vollständig gewachsene Eizelle ist an der Grenze zwischen G2 und M-Phase im Zellzyklus gestoppt (Ford, 1985). Durch die Wirkung von Hormonen, zum Beispiel Progesteron, wird diese Arretierung im Entwicklungsprozeß in vivo aufgehoben und in der Oozyte läuft die Meiose I bis zur Metaphase der Meiose II ab, in welcher die Eizelle dann bis zur Befruchtung bleibt (Merriam, 1971). Die in diesem Beispiel beschriebenen Injektionen von IGA-Protease führten in den Stadium VI Oozyten zu folgenden phänotypischen Veränderungen (Rauber, 1991). Die Oozyten bekamen circa 3 Stunden nach den Injektionen einen sichtbaren, hellen Fleck im dunklen animalen Pol. Nach längerer Inkubation veränderte sich ihre charakteristische Hell-Dunkel Färbung zu einem Flecken- oder Streifenmuster und schließlich starben sie ab. Gleichzeitig konnte man sehen, daß nach dreistündiger Inkubation keine scharfe Trennung zwischen Nukleus und Zytoplasma vorhanden war; statt dessen hatte der Kern eine veränderte ovale bis langgestreckte Form und lag innen an der Zytoplasmamembran im dunklen Pol. Derartige Veränderungen werden in der Literatur als "Germinal vesicle breakdown" beschrieben, der auftritt wenn der Entwicklungsstopp der Stadium VI Oozyten durch Hormonwirkung aufgehoben wird. Durch den Einsatz eines spezifischen Inhibitors der IgA-Protease konnte gezeigt werden, daß der GVBD durch die proteolytische Aktivität der IgA-Protease hervorgerufen wird. Das synthetische Peptid R-boroPro-OH mit einem modifiziertem Prolin (Prolylboronat) lagert sich im aktiven Zentrum ein (Bachovchin et al., 1990). Durch die Imitation eines Substrat-Übergangzustandes bleibt der Inhibitor fest gebunden wird aber praktisch nicht gespalten. Nach Vorinkubation der IGA-Protease mit dem Peptidinhibitor und anschließender In- jektion in die Oozyten konnte kein GVBD beobachtet werden. Die Injektionen von IGA-Protease und Protease-Inhibitor Molekülen in Oozyten des Krallenfrosches wurde folgendermaßen durchgeführt: Das Ovar, oder je nach Menge der benötigten Oozyten nur Teile davon, wurde in MBS-H Puffer (88 mM NaCl, 1 mM KCl, 2,4 mM NaHCO3, 0,8 mM MgSO4, 0,33 mM Ca(NO3)2, 0,41 mM CaCl2, 10 mM Hepes pH 7.4, supplementiert mit je 10 mg/ml Benzylpenecillin und Streptomyzin) gewaschen, mit zwei Pinzetten zerkleinert und durch Zugabe von Kollagenase (2 mg/ml) so lange inkubiert bis mehr als 90 % der Oozyten vereinzelt waren. Anschließend wurden die Oozyten nochmals zur Entfernung der Kollagenase in MBS-H Puffer gewaschen. Alle Injektionsexperimente wurden auf einer temperierten Stahlplatte (20°C) durchgeführt. Die Injektionsapparatur bestand aus einer Hamilton-Spritze, die über einen Secura Perfusor mit einem konstantem Vorschub betrieben werden konnte und einer ausgezogenen Glaskpillare, die in einem Mikromanipulator eingepaßt war. Über einen Teflonschlauch war die Kapillare mit der Spritze verbunden, dieser war zur Druckübertragung mit einem inerten Öl gefüllt. Microinjection into Xenopus laeviε oocytes is a frequently used method to analyze mechanisms of action of individual proteins. For such studies, so-called stage VI oocytes are used, which have matured until the first meiotic division has started. Such a fully grown egg cell has stopped at the boundary between G2 and M phase in the cell cycle (Ford, 1985). Through the action of hormones, for example progesterone, this arrest is released in the development process in vivo and in the oocyte, meiosis I proceeds to the metaphase of meiosis II, in which the egg cell then remains until fertilization (Merriam, 1971). The injections of IGA protease described in this example led to the following phenotypic changes in stage VI oocytes (Rauber, 1991). About 3 hours after the injections, the oocytes got a visible, bright spot in the dark, animal pole. After a longer incubation, their characteristic light-dark coloration changed to a stain or stripe pattern and finally they died. At the same time, one could see that after three hours of incubation there was no sharp separation between nucleus and cytoplasm; instead, the nucleus had a changed oval to elongated shape and was located on the inside of the cytoplasmic membrane in the dark pole. Such changes are described in the literature as a "Germinal vesicle breakdown", which occurs when the developmental arrest of stage VI oocytes is abolished by hormone effects. By the use of a specific inhibitor of the IgA protease could be shown that the GVBD is caused by the proteolytic activity of the IgA protease. The synthetic peptide R-boroPro-OH with a modified proline (prolylboronate) is embedded in the active center (Bachovchin et al., 1990). By imitating a substrate transition state, the inhibitor remains firmly bound but is practically not split. No GVBD was observed after preincubation of the IGA protease with the peptide inhibitor and subsequent injection into the oocytes. The injections of IGA protease and protease inhibitor molecules in oocytes of the clawed frog were carried out as follows: The ovary, or only parts of it, depending on the amount of the oocytes required, was in MBS-H buffer (88 mM NaCl, 1 mM KCl, 2, 4 mM NaHCO 3 , 0.8 mM MgSO 4 , 0.33 mM Ca (NO 3 ) 2, 0.41 mM CaCl 2 , 10 mM Hepes pH 7.4, supplemented with 10 mg / ml benzylpenecillin and streptomycin), washed with crushed two forceps and incubated by adding collagenase (2 mg / ml) until more than 90% of the oocytes were isolated. The oocytes were then washed again in MBS-H buffer to remove the collagenase. All injection experiments were carried out on a tempered steel plate (20 ° C). The injection apparatus consisted of a Hamilton syringe which could be operated with a constant feed via a Secura perfusor and an extended glass capillary which was fitted in a micromanipulator. The capillary was connected to the syringe via a Teflon tube, which was filled with an inert oil for pressure transmission.
Die großen und kontrastreichen Stadium VI Oozyten wurden in den Vertiefungen einer Glasplatte unter MBS-H Puffer so ausgerichtet, daß in sie in den hellen Pol injiziert werden konnte, ohne den Kern in der dunklen Hälfte zu verletzen. Mit Hilfe von Microladern, dünn ausgezogenen Pipettenspitzen (Eppendorf), wurden circa 10 ml Proteinlösung in Intrazellulärpuffer (50 mM Tris-Cl pH 7.5, 2 mM CaCl2, 0,1 % NP-40 ) vom hinteren Ende her in die Kanüle geladen, und diese luft blasenfrei in die Apparatur eingepaßt. Dann wurden bei einem konstantem Ausstrom von 10 nl/s Aliquots von 50 nl pro Oozyte injiziert. Nach der jeweiligen Inkubationszeit von 3 bis 12 Stunden wurden die Oozyten in 5 % TCA fixiert und bis zur weiteren Verwendung aufbewahrt. The large and high-contrast Stage VI oocytes were aligned in the wells of a glass plate under MBS-H buffer so that they could be injected into the light pole without damaging the core in the dark half. Using microladers, thinly extended pipette tips (Eppendorf), approx. 10 ml protein solution in intracellular buffer (50 mM Tris-Cl pH 7.5, 2 mM CaCl 2 , 0.1% NP-40) was loaded into the cannula from the rear end, and this runs fitted bubble-free into the apparatus. Then aliquots of 50 nl per oocyte were injected at a constant outflow of 10 nl / s. After the respective incubation period of 3 to 12 hours, the oocytes were fixed in 5% TCA and kept until further use.
Figure imgf000088_0001
Figure imgf000088_0001
Beispiel 21 Example 21
Menschliches naso-pharyngeales Gewebe stellt ein weiteres Zielgewebe für die spezifische Aufnahme und Kernlokalisation des alpha-Proteins dar.  Human nasopharyngeal tissue is another target tissue for the specific uptake and nuclear localization of the alpha protein.
Wie in Beispiel 7 beschrieben, besitzt das von Neisserien sekretierte alpha-Protein funktioneile Kernlokalisationsse- quenzen. Wird das alpha-Protein von transfizierten Zellen exprimiert, so reichert es sich spezifisch im Kern an. Zusätzlich ist das alpha-Protein jedoch dazu in der Lage, von außen in Zellen einzudringen und anschließend im Kern zu akkumulieren. Dies geschieht allerdings nur in ganz bestimmten Zellen von Primärkulturen bestimmter humaner Gewebe. Auffallend ist hierbei, daß es sich um Gewebe handelt, die gleichzeitig auch Zielgewebe für die Infektion mit Neisserien darstellen. Wie in Beispiel 7 beschrieben, zeigt ein bestimmtes "Subset" von Zellen aus primären Zellkulturen humaner Cornea und ein bestimmtes "Subset" humaner mononukleärer Blutzellen Aufnahme von außen und Kernlokalisation des alpha-Proteins. Ein weiteres Zielgewebe stellt Gewebe aus dem humanen naso-pharyngealen Bereich dar. Zu Aufnahmeversuchen mit dem alpha-Protein werden hierbei chirurgisch entfernte Nasen-Polypen verwendet, die, um die natürliche Mikroflora zu entfernen, primär mit Antibiotika-haltigem Medium (DMEM, 250 E/ml Penizillin/Streptomycin, 5 μg/ml Fungi- zone, 25 mM Hepes, 100 μg/ml Gentamycin, 50 mg/ml Nystatin) behandelt werden. Hierzu wird das Gewebe in diesem Medium von anhängendem Fett und Bindegewebe befreit und anschließend in ca 2 mm2 große Stücke zerlegt. Danach wird frisches Medium dazugegeben und die Gewebestücke über Nacht bei 37°C inkubiert. Am darauffolgenden Tag wird dieses Medium durch Zugabe von frischem Antibiotika-Medium, dem 10 % FCS zugesetzt wurde, ersetzt. Am folgenden Tag wird das Antibiotika-Medium entfernt und die Gewebestücke einzeln auf mikroskopische Deckgläser in Gewebekulturplatten mit 24 Vertiefungen gesetzt. Sobald sich die Gewebestücke festgesetzt haben (nach 5h bis über Nacht bei 37°C im Inkubator), wird Kulturmedium (DMEM/Ham's F12 1:1, 10 % FCS, 1 % Penicillin/Strepomycin, 1 % Fungizone, 2.5 % Hepes, 0.4 % Methyl- cellulose) dazugegeben. Diese Kulturen werden ca. 1-2 Wochen mit Medienwechsel 2x pro Woche inkubiert. Sind die Deckgläser zu mindestens 20 % mit Zellen bewachsen, werden sie zu den Versuchen verwendet. Der Nachweis der alpha-Protein-Aufnähme und Kernlokalisation wird anschließend, wie in Beispiel 7 im Fall der Primärkultur aus Cornea beschrieben, durchgeführt. Es zeigt sich dann, daß auch in diesem Fall, wie in Primärkulturen der Cornea, nur ein ganz bestimmtes "Subset" der Zellen dazu in der Lage ist, das alpha-Protein von außen aufzunehmen und im Kern zu akkumulieren. Auch hier, wie im Fall der Primärkulturen aus der Cornea, findet keine Kernlokalisation mehr statt, sobald der Zellverband durch Passagieren aufgetrennt wird. As described in Example 7, the alpha protein secreted by Neisserien has functional core localization sequences. If the alpha protein is expressed by transfected cells, it accumulates specifically in the nucleus. In addition, however, the alpha protein is able to penetrate cells from outside and then accumulate in the nucleus. However, this only happens in very specific cells of primary cultures of certain human tissues. It is striking that these are tissues that are also target tissues for infection with Neisseries. As described in Example 7, a certain "subset" of cells from primary cell cultures of human cornea and a certain "subset" of human mononuclear blood cells show external uptake and nuclear localization of the alpha protein. Another target tissue is tissue from the human nasopharyngeal area. Surgical removal of the nasal polyps, which are used to remove the natural microflora, primarily with a medium containing antibiotics (DMEM, 250 E / ml penicillin / streptomycin, 5 μg / ml fungi zone, 25 mM Hepes, 100 μg / ml gentamycin, 50 mg / ml nystatin). For this purpose, the tissue in this medium is freed from attached fat and connective tissue and then broken down into pieces of approximately 2 mm 2 . Then fresh medium is added and the tissue pieces are incubated at 37 ° C. overnight. The following day, this medium is replaced by the addition of fresh antibiotic medium to which 10% FCS has been added. The following day, the antibiotic medium is removed and the tissue pieces are placed individually on microscopic cover glasses in tissue culture plates with 24 wells. As soon as the tissue pieces have settled (after 5 hours until overnight at 37 ° C in the incubator), Culture medium (DMEM / Ham's F12 1: 1, 10% FCS, 1% penicillin / strepomycin, 1% fungizone, 2.5% Hepes, 0.4% methyl cellulose) was added. These cultures are incubated approx. 1-2 weeks with changing media twice a week. If at least 20% of the cover glasses are covered with cells, they are used for the experiments. The detection of the alpha protein uptake and nuclear localization is then carried out as described in Example 7 in the case of the primary culture from cornea. It then turns out that in this case too, as in primary corneal cultures, only a very specific "subset" of the cells is able to absorb the alpha protein from outside and to accumulate in the nucleus. Here too, as in the case of primary cultures from the cornea, nuclear localization no longer takes place as soon as the cell structure is separated by passengers.
Beispiel 22 Example 22
Einzelne synthetische Peptide definieren verschiedene funktioneile Bereiche des alpha-Proteins.  Individual synthetic peptides define different functional areas of the alpha protein.
Das alpha-Protein wird, wie in den Beispielen 7 und 21 beschrieben, von vielen Zellen aufgenommen, jedoch dann in Vesikeln degradiert. Bei einigen wenigen Zellen bestimmter Gewebe führt die spezifische Aufnahme zur Akkumulation im Kern, was auf einen spezifischen Aufnahmemechanismus schließen läßt, der von einem ganz bestimmten Zelltypus/- status abhängig ist. As described in Examples 7 and 21, the alpha protein is taken up by many cells, but then degraded in vesicles. In a few cells of certain tissues, the specific uptake leads to accumulation in the nucleus, which suggests a specific uptake mechanism that depends on a very specific cell type / status.
Die Eingrenzung funktioneller Bereiche des alpha-Proteins wurde anhand folgender definierter synthetischer Peptide durchgeführt:  The functional regions of the alpha protein were narrowed down using the following defined synthetic peptides:
Verwendete alpha-Proteine: Alpha proteins used:
- alpha 1 aus Stamm Neisseria gonorrhoeae MS11  alpha 1 from strain Neisseria gonorrhoeae MS11
- alpha 2 aus Stamm Neisseria gonorrhoeae R16  - alpha 2 from strain Neisseria gonorrhoeae R16
- schwarz unterlegte Bereiche: Kernlokalisationssequenzen; da an verschiedenen Stellen im Protein lokalisiert, nummeriert zur Unterscheidung: Nr. 1,- black areas: Core localization sequences; localized at different places in the protein, numbered for differentiation: No. 1,
2, 3 und 4 2, 3 and 4
- Wellenlinie: alpha-helikale Bereiche  - Wavy line: alpha-helical areas
Figure imgf000091_0003
Figure imgf000091_0003
Peptide : Peptides:
Peptid A: aus MS11  Peptide A: from MS11
Aminosäure 1 - 32 (siehe Abbildung)  Amino acid 1 - 32 (see illustration)
Länge: 32 Aminosäuren  Length: 32 amino acids
FITC-gekoppelt  FITC coupled
Sequenz: SPQANQAEEALRQQAKAEQVKRQQAAEAEKVA  Sequence: SPQANQAEEALRQQAKAEQVKRQQAAEAEKVA
Peptid B: aus R16 Peptide B: from R16
Aminosäuren 52 - 92 (siehe Abbildung)  Amino acids 52 - 92 (see illustration)
Länge: 41 Aminosäuren  Length: 41 amino acids
FITC-gekoppelt  FITC coupled
Sequenz :
Figure imgf000091_0001
Sequence:
Figure imgf000091_0001
Kernlokalisaionssequenzen Nr. 1 und 2  Core localization sequences No. 1 and 2
Peptid C: aus MSll Peptide C: from MSll
Aminosäuren 60 - 101 (siehe Abbildung) Amino acids 60 - 101 (see illustration)
Länge: 41 Aminosäuren Length: 41 amino acids
FITC-gekoppelt FITC coupled
Figure imgf000091_0002
q ASHQANAgPKRRRRHAILPR
Figure imgf000091_0002
q ASHQANAgPKRRRRHAILPR
Kernlokalisationssequenz Nr. 4 Peptid D: aus R16 Core localization sequence No. 4 Peptide D: from R16
Aminosäuren 139 - 178  Amino acids 139-178
Länge 40 Aminosäuren  40 amino acids in length
FITC-gekoppelt FITC coupled
Figure imgf000092_0002
Figure imgf000092_0002
Kernlokalisationssequenz Nr. 3  Core localization sequence No. 3
Struktur: Structure:
alpha-Protein MS11: R16 alpha protein MS11: R16
Die Rahmen repräsentieren die Kernlokalisationssequenzen.  The frames represent the core localization sequences.
Figure imgf000092_0001
Figure imgf000092_0001
Die Aufnahme und Lokalisation der Peptide A-D in primären Zellkulturen aus humaner Cornea wurde auf die gleiche Weise durchgeführt wie mit dem kompletten alpha-Protein (siehe Beispiele 7 und 21). Dementsprechend wurden folgende Resultate ausschließlich in den gleichen Zellen beobachtet, die auch Zielzellen für das komplette alpha-Protein darstellen.  The uptake and localization of the peptides A-D in primary cell cultures from human cornea was carried out in the same way as with the complete alpha protein (see Examples 7 and 21). Accordingly, the following results were observed only in the same cells, which are also target cells for the complete alpha protein.
Ergebnisse: Results:
Peptid A: aus MS11, ohne Kernlokalisationssequenz  Peptide A: from MS11, without core localization sequence
→ kein positives Signal in der Immunfluoreszenz → no positive signal in immunofluorescence
→ keine Kernlokalisation → no core localization
→ keine Bindung an Zellen oder Matrix Peptid C: aus MSll, Kernlokalisationssequenz Nr. 4→ no binding to cells or matrix Peptide C: from MSII, nuclear localization sequence No. 4
→ Spezifische Bindung an die Zelloberfläche bestimmter Zellen → Specific binding to the cell surface of certain cells
→ Kernlokalisation  → Core location
Peptid B: aus R16, Kernlokalisationssequenzen Nr. 1 und 2 Peptide B: from R16, nuclear localization sequences No. 1 and 2
→ Spezifische Bindung an die über bestimmten Zeil en liegende extrazelluläre Matrix  → Specific binding to the extracellular matrix lying over certain cells
→ Kernlokalisation  → Core location
Peptid D: aus R16, Kernlokalisationssequenz Nr. 3 Peptide D: from R16, core localization sequence No. 3
→ Spezifische Bindung an die Zelloberfläche bestimmer Zellen  → Specific binding to the cell surface of certain cells
→ Kernlokalisation Diese Ergebnisse lassen zwei Schlußfolgerungen zu:  → Core localization These results allow two conclusions to be drawn:
1. (siehe Peptide A und C): Spezifische Matrixfaktoren vermitteln die rezeptorspezifische Bindung, die zur Kernlokalisation führt.  1. (see peptides A and C): Specific matrix factors mediate the receptor-specific binding that leads to nuclear localization.
2. (siehe Peptide B und D): Bestimmte Zellen exprimieren einen spezifischen Rezeptor (dessen Expression eventuell abhängig von bestimmten Matrixfaktoren beeinflußt wird), der zur Aufnahme und Akkumulierung des alpha-Proteins im Kern führt.  2. (see peptides B and D): Certain cells express a specific receptor (the expression of which may be influenced depending on certain matrix factors), which leads to the uptake and accumulation of the alpha protein in the nucleus.
Beispiel 23 Example 23
Die spezifische Transportfunktion des alpha-Proteins  The specific transport function of the alpha protein
Wie in den Beispielen 7, 21 und 22 beschrieben, dringt das alpha-Protein nur in bestimmte Zellen bestimmter Gewebe in den Kern vor. Diese spezifische Funktion läßt sich verwenden, um in diese Zellen ganz gezielt entweder DNA, Proteine oder andere Substanzen über Kopplung mit dem alpha-Protein oder mit einzelnen Peptiden aus dem alpha-Protein einzubringen. Z. B. wird ein Peptid aus dem alpha-Protein (siehe Beispiel 22) mit Polylysin gekoppelt. An Polylysin bindet sehr effektiv DNA (Wagner et al., 1990). Auf diese Weise wird der Vektor pSV3neo (Berg, 1982), der die SV40 Large T-Region codiert, spezifisch in kernlokalisation-positive Zellen eingebracht. Die Expression des SV40 Large T führt zur Immortalisierung der Zellen und somit zur Generierung einer Zellinie. As described in Examples 7, 21 and 22, the alpha protein only penetrates into the nucleus in certain cells of certain tissues. This specific function can be used to selectively introduce either DNA, proteins or other substances into these cells via coupling with the alpha protein or with individual peptides from the alpha protein. For example, a peptide from the alpha protein (see Example 22) is coupled with polylysine. DNA binds very effectively to polylysine (Wagner et al., 1990). In this way, the vector pSV3neo (Berg, 1982), which encodes the SV40 Large T region, is specifically introduced into nuclear localization-positive cells. The expression of the SV40 Large T leads to the immortalization of the cells and thus to the generation of a cell line.
Zitierte Literatur Literature cited
Atlan et al. (1994) Res. Immunol. 145: 165-183  Atlan et al. (1994) Res. Immunol. 145: 165-183
Altschul et al. (1990) J. Mol. Biol 215: 403-410  Altschul et al. (1990) J. Mol. Biol 215: 403-410
Anomasarin et al. (1990) J. Vir. 64: 3179-3184  Anomasarin et al. (1990) J. Vir. 64: 3179-3184
Argow et al. (1989) Clin. Exp. Imm. : 190-197  Argow et al. (1989) Clin. Exp. Imm.: 190-197
Bachovclrin et al. (1990) J. Biol. Chem. 256: 3738-3743 Bachovclrin et al. (1990) J. Biol. Chem. 256: 3738-3743
Banki et al., (1992) PNAS 89: 1939-1943 Banki et al., (1992) PNAS 89: 1939-1943
Benz and Schmidt, (1989), Inf. Imm. 57: 1506-1511  Benz and Schmidt, (1989) Inf. Imm. 57: 1506-1511
Berg, (1982) J. Mol. Appl. Genet. 1: 327-341  Berg, (1982) J. Mol. Appl. Genet. 1: 327-341
Bernfield et al., (1992) Annu. Rev. Cell Biol. 8, 365-393 Bernfield et al., (1992) Annu. Rev. Cell Biol. 8, 365-393
Bläß (1994) BioEngineering 2/94, 10. Jahrgang., pp. 42-45Bläß (1994) BioEngineering 2/94, 10th year., Pp. 42-45
Böyum et al., (1968) Scand.J. Clin. Lab. Invest. 97: 77-89Böyum et al., (1968) Scand.J. Clin. Lab. Invest. 97: 77-89
Dougan et al., (1991) Mol. Mic. 5: 409-417 Dougan et al., (1991) Mol. Mic. 5: 409-417
Dougherty et al., (1993) Microbiol .Rev. 57: 781-822  Dougherty et al., (1993) Microbiol. Rev. 57: 781-822
Engelhard, (1994) Curr Biol 6: 13-23  Engelhard, (1994) Curr Biol 6: 13-23
Facius and Meyer, (1993) Mol. Microbiol. 10: 699-712  Facius and Meyer, (1993) Mol. Microbiol. 10: 699-712
Falk et al., (1994) Immunogen. 38: 161-162  Falk et al., (1994) Immunogen. 38: 161-162
Falk et al., (1991) Nature 351: 291-296  Falk et al., (1991) Nature 351: 291-296
Frankel and Pabo, (1988), Cell 55: 1189-1193  Frankel and Pabo, (1988) Cell 55: 1189-1193
Gorga et al., (1987) J. Biol. Chem. 262: 16087  Gorga et al., (1987) J. Biol. Chem. 262: 16087
Halter, (1993) Diplomarbeit an der Universität Tübingen Halter, (1993) Diploma thesis at the University of Tübingen
Held et al., (1993) J. Exp. Med. 177: 359-366 Held et al., (1993) J. Exp. Med. 177: 359-366
Herrmann und Kalden (1994) J. Virol. Methods 46: 333-348 Herrmann and Kalden (1994) J. Virol. Methods 46: 333-348
Itescu et al., (1990) Ann. Intern. Med. 112: 3-10 Itescu et al., (1990) Ann. Intern. Med. 112: 3-10
Jacob, McDevitt and Talar (Ed.), (1991), Academic Press, San  Jacob, McDevitt and Talar (Ed.), (1991), Academic Press, San
Diego: 7-31  Diego: 7-31
Kaibacher et al., (1992) J. Chromatogr. 548: 343 Kaibacher et al., (1992) J. Chromatogr. 548: 343
Keyszer et al., (1994) Stern Cells, 12, 75 - 86 Keyszer et al., (1994) Stern Cells, 12, 75-86
Kimura et al., (1992) Tissue Antigens 40: 5-12 Kimura et al., (1992) Tissue Antigens 40: 5-12
Klauser et al., (1993) BioEssays 15:799-805 Klauser et al., (1993) BioEssays 15: 799-805
Kräusslich et al., (1989) PNAS 87:807-811 Krausslich et al., (1989) PNAS 87: 807-811
Krieg et al., (1990) J. Clin. Invest. 86: 809-816 Krieg et al., (1990) J. Clin. Invest. 86: 809-816
Kropshofer et al., (1993) PNAS 90: 403 Kropshofer et al., (1993) PNAS 90: 403
Kupsch et al., (1993) EMBO J. 12: 641-650 Kupsch et al., (1993) EMBO J. 12: 641-650
Lorenzen, (1992) Promotionsarbeit in Kiel Lorenzen, (1992) PhD thesis in Kiel
Marrack and Kappler, (1994) Cell 76: 323-332  Marrack and Kappler, (1994) Cell 76: 323-332
Martin et al., (1991) Biochem. J. 280: 679 Meuer and Meyer zum Büschenfelde, (1986) J. Immunol .142:Martin et al., (1991) Biochem. J. 280: 679 Meuer and Meyer zum Büschenfelde, (1986) J. Immunol .142:
4106-4112 4106-4112
Meyaard et al., (1992) Eur. J. Immunol. 22: 2729-2732 Meyaard et al., (1992) Eur. J. Immunol. 22: 2729-2732
Meyer et al., Deutsche Patentanmeldung P 43 36 530.2 Meyer et al., German patent application P 43 36 530.2
Miller et al., (1989) Nature 337: 576-577 Miller et al., (1989) Nature 337: 576-577
Mitchison (1993) Fundamental and Clinical Immunol. 1: 197-Mitchison (1993) Fundamental and Clinical Immunol. 1: 197-
200 200
Nakahama et al., (1986) Nucleic Acids Res . 14: 5843-5855 Normark und Jonsson, PCT-Anmeldung WO 92/13 871 Nakahama et al., (1986) Nucleic Acids Res. 14: 5843-5855 Normark and Jonsson, PCT application WO 92/13 871
Paliard et al., (1991) Science 253: 325 - 329 Paliard et al., (1991) Science 253: 325-329
Paruchuri et al., (1990) Proc. Natl. Acad. Sei. USA 87: 333-Paruchuri et al., (1990) Proc. Natl. Acad. Be. USA 87: 333-
337 337
Pearson and Lipman (1988) PNAS 85: 2444-2448 Pearson and Lipman (1988) PNAS 85: 2444-2448
Perkins et al., (1989) J. Mol. Biol. 206: 737 Perkins et al., (1989) J. Mol. Biol. 206: 737
Perl et al., (1993) Trends in Microbiol. 1: 153-156 Perl et al., (1993) Trends in Microbiol. 1: 153-156
Plaut et al., (1975) Science 190: 1103-1105 Plaut et al., (1975) Science 190: 1103-1105
Pohlner et al. (1993) Gene 130: 121 Pohlner et al. (1993) Gene 130: 121
Pohlner et al., (1992) Biotech. 10: 799-804 Pohlner et al., (1992) Biotech. 10: 799-804
Pohlner et al., (1987) Nature 325: 458-462. Pohlner et al., (1987) Nature 325: 458-462.
Pohlner et al., (1994) Manuscript in preparation Pohlner et al., (1994) Manuscript in preparation
Pryjma et al., (1994) Infect. Immun. 62: 1961-1967  Pryjma et al., (1994) Infect. Immune. 62: 1961-1967
Rheumatic Disease Clinics of North America 18: 741 Rheumatic Disease Clinics of North America 18: 741
Riviere et al., (1991) Nature 350: 625-626 Riviere et al., (1991) Nature 350: 625-626
Robertson und Meyer (1992) Trends Genet. 8: 422-427 Robertson and Meyer (1992) Trends Genet. 8: 422-427
Roudier et al., (1988) Scand J Immunology 27: 367-371 Roudier et al., (1988) Scand J Immunology 27: 367-371
Rotzschke and Falk, (1994) Curr. Biol 6: 45-51 Rotzschke and Falk, (1994) Curr. Biol 6: 45-51
Rudel T., (1994) Dissertation, Universität Tübingen Rudel T., (1994) Dissertation, University of Tübingen
Schmitt and Haas, (1993) Mol. Mic. 12: 307-319 Schmitt and Haas, (1993) Mol. Mic. 12: 307-319
Sinigaglia and Hammer, (1994) Curr. Immun. 6: 52-56 Sinigaglia and Hammer, (1994) Curr. Immune. 6: 52-56
Smith and Waterman, (1981) J. Mol. Biol 147: 195-197 Smith and Waterman, (1981) J. Mol. Biol 147: 195-197
Tisch et al. (1994) Behring Inst. Mitt. 94: 171-178 Tisch et al. (1994) Behring Inst. Mitt. 94: 171-178
van Putten, J.P.M. und Paul, S., zur Veröffentlichung eingereicht van Putten, J.P.M. and Paul, S., submitted for publication
Viscidi et al., (1989) Science 246: 1606-1608 Viscidi et al., (1989) Science 246: 1606-1608
de Vries et al., (1990) Springer de Vries et al., (1990) Springer
Wagner et al., (1990) Proc. Natl. Acad. Sei 87: 3410-3414 Wiesmüller et al., (1989) Vaccine 7: 29 Williams, R.C. (1992) In: Encyclopedia of Immunology, Hrg.Wagner et al., (1990) Proc. Natl. Acad. Sci 87: 3410-3414 Wiesmüller et al., (1989) Vaccine 7: 29 Williams, RC (1992) In: Encyclopedia of Immunology, ed.
Roitt und Delves, pp. 1339-1343 Roitt and Delves, pp. 1339-1343
Wiertz, J.H.J. (1993) Dissertation, ClP-gegevens KoninklijkeWiertz, J.H.J. (1993) Dissertation, ClP-gegevens Koninklijke
Bibliotheek, Den Haag, ISBN 90-393-0399-1 Bibliotheek, The Hague, ISBN 90-393-0399-1
Wordsworth et al., (1992) Am. J. Hum. Genet. 51: 585-591 Zhang et al. (1993) Science 261:1451-1454 Wordsworth et al., (1992) Am. J. Hum. Genet. 51: 585-591 Zhang et al. (1993) Science 261: 1451-1454

Claims

P a t e n t a n s p r ü c h e Patent claims
1. Arzneimittel zur Prophylaxe oder Behandlung von Autoimmunkrankheiten und/oder viralen Erkrankungen, dadurch gekennzeichnet, daß das Arzneimittel Stoffe oder Zellen enthält, die mit der natürlichen Funktion von bakteriellen Polyproteinen (BPPs) oder Bestandteilen davon oder mit den sie produzierenden Bakterien interferieren. 1. Medicament for the prophylaxis or treatment of autoimmune diseases and / or viral diseases, characterized in that the medicament contains substances or cells which interfere with the natural function of bacterial polyproteins (BPPs) or components thereof or with the bacteria producing them.
2. Arzneimittel nach Anspruch 1, dadurch gekennzeichnet, daß das Interferieren eine Inhibierung ist. 2. Medicament according to claim 1, characterized in that the interfering is an inhibition.
3. Arzneimittel nach Anspruch l oder 2, dadurch gekennzeichnet, daß die Stoffe oder Zellen umfassen: 3. Medicament according to claim 1 or 2, characterized in that the substances or cells comprise:
(a) bakterielle Polyproteine (BPPs) oder Bestandteile davon; (a) bacterial polyproteins (BPPs) or components thereof;
(b) immunkompetente Zellen oder immunologisch aktive Moleküle, die spezifisch sind für die BPPs oder die Bestandteile davon, für entsprechende homologe Peptide menschlicher Proteine, durch Wirkung der BPPs gebildete autoreaktive Peptide, durch die Wirkung der BPPs induzierte, von Viren bzw. endogenen Viren codierte Peptide oder zu derartigen viralen Peptiden homologe menschliche Peptide;  (b) immunocompetent cells or immunologically active molecules which are specific for the BPPs or the components thereof, for corresponding homologous peptides of human proteins, autoreactive peptides formed by the action of the BPPs, induced by the action of the BPPs, encoded by viruses or endogenous viruses Peptides or human peptides homologous to such viral peptides;
(c) nicht-pathogene oder nicht-pathogen gemachte Bakterien oder Bestandteile davon,  (c) non-pathogenic or non-pathogenic bacteria or components thereof,
(d) Infektionshemmer;  (d) anti-infectious agents;
(e) Stoffe, die die biologische Aktivität von BPPs inhi bieren ;  (e) substances that inhibit the biological activity of BPPs;
(f) Peptide oder Peptidanaloga, die Peptide aus MHC-Molekülen aufgrund einer hohen Bindungsaffinität verdrängen, deren Präsentation zu einer Autoimmunkrankheit führt.  (f) Peptides or peptide analogs that displace peptides from MHC molecules due to their high binding affinity, the presentation of which leads to an autoimmune disease.
(g) Stoffe, die die BPP- oder BPP-Bestandteil- induzierende Virusaktivierung inhibieren; oder (h) Stoffe, die die Virus-bedingten Autoimmunreaktionen inhibieren, wobei diese Reaktionen durch BPPs oder deren Bestandteile induziert werden. (g) substances that inhibit virus activation that induces BPP or BPP constituents; or (h) substances that inhibit the virus-induced autoimmune reactions, these reactions being induced by BPPs or their components.
4. Arzneimittel nach einem der Ansprüche 1 bis 3, dadurch gekennzeichnet, daß die Prophylaxe eine Immunisierung umfaßt. 4. Medicament according to one of claims 1 to 3, characterized in that the prophylaxis comprises an immunization.
5. Arzneimittel nach Anspruch 4, dadurch gekennzeichnet, daß die Immunisierung eine aktive Immunisierung ist. 5. Medicament according to claim 4, characterized in that the immunization is an active immunization.
6. Arzneimittel nach Anspruch 3, dadurch gekennzeichnet, daß die Immunisierung eine passive Immunisierung ist. 6. Medicament according to claim 3, characterized in that the immunization is a passive immunization.
7. Arzneimittel nach einem der Ansprüche 1 bis 6, dadurch gekennzeichnet, daß die Autoimmunkrankheit rheumatoide Arthritis ist. 7. Medicament according to one of claims 1 to 6, characterized in that the autoimmune disease is rheumatoid arthritis.
8. Arzneimittel nach einem der Ansprüche 1 bis 7, dadurch gekennzeichnet, daß die die BPP produzierenden Bakterien zur Gattung Neisseria gehören. 8. Medicament according to one of claims 1 to 7, characterized in that the bacteria producing the BPP belong to the genus Neisseria.
9. Arzneimittel der Ansprüche 1 bis 8, dadurch gekennzeichnet, daß die virale Erkrankungen durch HIV induziert wurde. 9. Medicament of claims 1 to 8, characterized in that the viral diseases have been induced by HIV.
10. Arzneimittel nach Anspruch 9, dadurch gekennzeichnet, daß die durch HIV induzierte Krankheit AIDS ist. 10. Medicament according to claim 9, characterized in that the HIV-induced disease is AIDS.
11. Arzneimittel nach Anspruch 5, wobei zur Immunisierung kapselspezifische Impfstoffe gegen Meningokokken-Infektionen verwendet werden. 11. Medicament according to claim 5, wherein capsule-specific vaccines against meningococcal infections are used for the immunization.
12. Arzneimittel nach Anspruch 5, wobei die Impfstoffe auf der Basis der Proteine der äußeren Membran von Bakterien der Gattung Neisseria hergestellt werden. 12. Medicament according to claim 5, wherein the vaccines are produced on the basis of the proteins of the outer membrane of bacteria of the genus Neisseria.
13. Arzneimittel nach Anspruch 12, wobei das Protein ein Porin ist. 13. Medicament according to claim 12, wherein the protein is a porin.
14. Arzneimittel nach Anspruch 5, wobei die Impfstoffe auf der Basis der Adhesine der Neisserien hergestellt werden. 14. Medicament according to claim 5, wherein the vaccines are produced on the basis of the Neisseries adhesins.
15. Arzneimittel nach Anspruch 14, wobei das Adhesin ein PilC-Protein ist. 15. Medicament according to claim 14, wherein the adhesive is a PilC protein.
16. Arzneimittel nach Anspruch 6, wobei die passive Immunisierung mit spezifischen Antikörpern oder T-Zellen erfolgt, die gegen Membrankomponenten oder Adhesinen von BPP-produzierenden Bakterien, vorzugsweise Neisserien gerichtet sind. 16. Medicament according to claim 6, wherein the passive immunization is carried out with specific antibodies or T cells which are directed against membrane components or adhesins of BPP-producing bacteria, preferably Neisseries.
17. Arzneimittel nach einem der Ansprüche 1 bis 3, wobei als Infektionshemmer Antibiotika oder Rezeptoranaloga zu Rezeptoren menschlicher Zellen, an die pathogene Bakterien binden können oder Liganden, die spezifisch für die Rezeptoren einer Bakterienoberfläche sind, kompetitive Peptide, oder nicht-pathogene oder attenuierte Neisserien sind. 17. Medicament according to one of claims 1 to 3, wherein antibiotics or receptor analogs to receptors of human cells to which pathogenic bacteria can bind or ligands which are specific for the receptors of a bacterial surface, competitive peptides or non-pathogenic or attenuated Neisseries as infection inhibitors are.
18. Arzneimittel nach Anspruch 17, wobei das kompetitive Peptid PilC ist. 18. Medicament according to claim 17, wherein the competitive peptide is PilC.
19. Arzneimittel nach einem der Ansprüche 1 bis 18, wobei das BPP IPP ist. 19. Medicament according to one of claims 1 to 18, wherein the BPP is IPP.
20. Arzneimittel nach Anspruch 19, wobei die IGA-Proteaseaktivität des IPP spezifisch gehemmt wird. 20. Medicament according to claim 19, wherein the IGA protease activity of the IPP is specifically inhibited.
21. Arzneimittel nach Anspruch 19, wobei die Aspartylproteaseaktivität der β-Domäne des IPP spezifisch gehemmt wird. 21. Medicament according to claim 19, wherein the aspartyl protease activity of the β-domain of the IPP is specifically inhibited.
22. Arzneimittel nach Anspruch 19, wobei die Aufnahme des α- Peptids in menschliche Zellen oder deren Nukleus gehemmt wird. 22. Medicament according to claim 19, wherein the uptake of the α-peptide in human cells or their nucleus is inhibited.
23. Arzneimittel nach einem der Ansprüche 1 bis 22, wobei die Folgen der Infektion durch BPP-bildende Bakterien durch Immunreaktion gegen BPP-bildende, insbesondere IPP bildende Zellen, BPP, insbesondere IPP oder deren Spaltprodukte inhibiert werden. 23. Medicament according to one of claims 1 to 22, wherein the consequences of infection by BPP-forming bacteria are inhibited by an immune reaction against BPP-forming, in particular IPP-forming cells, BPP, in particular IPP or their cleavage products.
24. Arzneimittel nach Anspruch 23, wobei IPP-spezifische Peptide-präsentierende Zellen von T-Zellen eliminiert werden. 24. Medicament according to claim 23, wherein IPP-specific peptide-presenting cells are eliminated from T cells.
25. Arzneimittel nach Anspruch 23, wobei IPP-spezifische Peptide-präsentierende Zellen von monoclonalen Antikörpern eliminiert werden. 25. Medicament according to claim 23, wherein IPP-specific peptide-presenting cells are eliminated by monoclonal antibodies.
26. Arzneimittel nach Anspruch 24, wobei antigenspezifische suppressive T-Zellen verwendet werden. 26. Medicament according to claim 24, wherein antigen-specific suppressive T cells are used.
27. Arzneimittel nach Anspruch 24, wobei anti-T-Zell- RezeptorAntikörper zum Ausschalten von T-Zellen, die eine Spezifität für BPPs oder Bestandteile davon, für entsprechende homologe Peptide menschlicher Proteine, durch Wirkung der BPP-Genprodukte gebildete autoreaktive Peptide, durch die Wirkung der BPP-Genprodukte induzierte, von Viren bzw. endogenen Viren codierte Peptide oder zu derartigen viralen Peptiden homologe menschliche Peptide aufweisen. 27. Medicament according to claim 24, wherein anti-T cell receptor antibodies for switching off T cells which have a specificity for BPPs or constituents thereof, for corresponding homologous peptides of human proteins, by the action of the BPP gene products, formed by the autoreactive peptides by which Effect of the BPP gene products induced peptides encoded by viruses or endogenous viruses, or human peptides homologous to such viral peptides.
28. Diagnostische Zusammensetzung für den Nachweis des ätiologischen Agens von Autoimmunkrankheiten und/oder viralen Erkrankungen und/oder für den Nachweis der Kontrolle der Wirkung von Arzneimittel enthaltend 28. Diagnostic composition for the detection of the etiological agent of autoimmune diseases and / or viral diseases and / or for the detection of the control of the action of drugs containing
(a) Oligonucleotide bzw. Primer, die für BPP codierende Gene spezifisch sind, (b) Antikörper, die spezifisch für BPPs oder Bestandteile davon oder BPP bildende Bakterien sind;(a) oligonucleotides or primers which are specific for genes coding for BPP, (b) antibodies specific for BPPs or constituents thereof or BPP-forming bacteria;
(c) Substrate, die zum Nachweis der biologischen Aktivität der BPPs eingesetzt werden können; und/oder (c) substrates that can be used to demonstrate the biological activity of the BPPs; and or
(d) Antigene, die von Antikörpern gemäß Merkmal (b) gebunden werden.  (d) Antigens that are bound by antibodies according to feature (b).
29. Diagnostische Zusammensetzung für den Nachweis und die Überwachung des Verlaufs von BPP-induzierten Autoimmunkrankheiten und/oder viralen Erkrankungen und/oder für den Nachweis der Kontrolle der Wirkung von Arzneimitteln, enthaltend 29. Diagnostic composition for the detection and monitoring of the course of BPP-induced autoimmune diseases and / or viral diseases and / or for the detection of the control of the action of drugs, containing
(a) Peptide, die autoreaktive immunkompetente Zellen spezifisch stimulieren,  (a) peptides that specifically stimulate autoreactive immunocompetent cells,
(b) Antikörper, die spezifisch sind für BPP-induzierte virale Antigene oder Viren;  (b) antibodies specific for BPP-induced viral antigens or viruses;
(c) Oligonucleotide bzw. Primer, die für BPP codierende Gene spezifisch sind;  (c) oligonucleotides or primers which are specific for genes coding for BPP;
(d) Antikörper, die für BPP-bildende Bakterien oder deren Antigene spezifisch sind;  (d) antibodies specific for BPP-forming bacteria or their antigens;
(e) Antigene, die von Antikörpern gemäß (b) oder (d) spezifisch gebunden werden; und/oder  (e) antigens which are specifically bound by antibodies according to (b) or (d); and or
(f) Substrate, die von viralen Genprodukten umgesetzt werden, wobei die viralen Genprodukte von BPPs induziert worden sind.  (f) substrates which are converted by viral gene products, the viral gene products being induced by BPPs.
30. Peptid, das ein Spaltprodukt eines IPP von Neisseria meningitidis ist und eine der in Figur 1 dargestellte Aminosäuresequenz aufweist. 30. Peptide which is a cleavage product of an IPP from Neisseria meningitidis and has an amino acid sequence shown in FIG. 1.
31. Peptid, das ein Spaltprodukt eines BPP, vorzugsweise eines IPP oder ein Fragment davon ist, oder ein menschliches Homologes dazu ist, wobei das BPP, vorzugsweise das IPP oder das Fragment davon oder das menschliche Homologe erhältlich ist durch Computergestützten Vergleich von BPP-, vorzugsweise IPP-Sequenzen mit Proteindatenbanken oder translatierten Nucleinsäuredatenbanken von menschlichen Sequenzen oder umgekehrt, wobei mindestens 6 Aminosäuren in einem Abschnitt von 10 Aminosäuren zwischen den Vergleichssequenzen identisch sind. 31. peptide which is a cleavage product of a BPP, preferably an IPP or a fragment thereof, or a human homologue thereto, the BPP, preferably the IPP or the fragment thereof or the human homologue being obtainable by computer-aided comparison of BPP-, preferably IPP sequences with protein databases or translated Nucleic acid databases of human sequences or vice versa, wherein at least 6 amino acids in a section of 10 amino acids are identical between the comparison sequences.
32. Peptid nach Anspruch 31, das eine in Tabelle VII, Fig. 32. Peptide according to claim 31, which has a in Table VII, Fig.
2, Fig. 3 oder Fig. 8 dargestellte Aminosäuresequenz aufweist.  2, 3 or 8 has the amino acid sequence shown.
33. Menschliches Peptid, das durch Einwirkung eines BPP, vorzugsweise eines IPP oder eines Spaltproduktes davon entsteht, ausgenommen die IgA1- Spaltprodukte. 33. Human peptide which is produced by the action of a BPP, preferably an IPP or a cleavage product thereof, with the exception of the IgA 1 cleavage products.
34. Virales Peptid, das durch Einwirkung eines BPP, vorzugsweise eines IPP oder eines Spaltproduktes davon entsteht. 34. Viral peptide which arises from the action of a BPP, preferably an IPP or a cleavage product thereof.
35. Peptid, das ein virales Peptid, das durch die Einwirkung eines BPP entstanden ist, oder ein menschliches Homologes dazu ist, wobei die virale Peptidsequenz durch Computer-gestützten Vergleich mit Proteindatenbanken oder translatierten Nucleinsäuredatenbanken von menschlichen Sequenzen oder umgekehrt erhältlich ist und wobei mindestens 6 Aminosäuren in einem Abschnitt von 10 Aminosäuren zwischen den Vergleichsequenzen identisch sind. 35. peptide, which is a viral peptide that is produced by the action of a BPP or a human homologue thereto, the viral peptide sequence being obtainable by computer-aided comparison with protein databases or translated nucleic acid databases from human sequences or vice versa, and wherein at least 6 Amino acids in a section of 10 amino acids are identical between the comparison sequences.
36. Peptid nach einem der Ansprüche 30 bis 35, das ein von einem Antikörper erkanntes Epitop darstellt. 36. A peptide according to any one of claims 30 to 35, which is an epitope recognized by an antibody.
37. Peptid nach einem der Ansprüche 30 bis 35, wobei das Peptid nach MHC-Präsentation von einer T-Zelle erkannt wird. 37. Peptide according to one of claims 30 to 35, wherein the peptide is recognized by a T cell after MHC presentation.
38. Verfahren zur Hemmung oder Aktivierung der Transkription viral codierter Polypeptide, dadurch gekennzeichnet, daß man Stoffe, vorzugsweise Biomoleküle, vorzugsweise Proteine, DNA, RNA oder Anti-Sense-RNA oder synthetisch hergestellte Moleküle, vorzugsweise therapeutisch wirksame Moleküle in eukaryontische, vorzugsweise menschliche Zellen oder deren Zellkern unter Verwendung eines IgA-o.-Proteins einschleust. 38. A method for inhibiting or activating the transcription of virally coded polypeptides, characterized in that substances, preferably biomolecules, are preferably Proteins, DNA, RNA or anti-sense RNA or synthetically produced molecules, preferably therapeutically effective molecules, are introduced into eukaryotic, preferably human cells or their cell nucleus using an IgA protein.
39. In vitro-Verfahren zur Clonierung und Vermehrung von menschlichen T-Zellen, deren T-Zellrezeptor MHC-präsentierte IPP-Fragmente spezifisch erkennt, wobei man die T-Zellen in Gegenwart von BPPs oder Bestandteilen davon, entsprechenden homologen Peptiden menschlicher Proteine, durch Wirkung eines BPPs gebildeten autoreaktiven Peptiden, durch die Wirkung eines BPPs aktivierten, von Viren bzw. endogenen Viren codierten Peptiden oder zu derartigen viralen Peptiden homologen menschlichen Peptiden unter üblichen Bedingungen stimuliert. 39. In vitro methods for cloning and multiplying human T cells, whose T cell receptor specifically recognizes MHC-presented IPP fragments, the T cells being present in the presence of BPPs or components thereof, corresponding homologous peptides of human proteins Effect of an auto-reactive peptide formed by BPP, stimulated by the action of a BPP-activated peptide encoded by viruses or endogenous viruses, or human peptides homologous to such viral peptides under normal conditions.
40. In vitro-Verfahren zur Clonierung und Vermehrung im- munsuppressiver T-Zellen, die T-Zellen supprimieren, welche in MHC-präsentierte abgeleitete Fragmente spezifisch erkennen, wobei man die T-Zellen in Gegenwart von BPPs oder Bestandteilen davon, entsprechenden homologen Peptiden menschlicher Proteine, durch Wirkung eines BPPs gebildeten autoreaktiven Peptiden, durch die Wirkung eines BPPs aktivierten, von Viren bzw. endogenen Viren codierten Peptiden oder zu derartigen viralen Peptiden homologen menschlichen Peptiden unter üblichen Bedingungen stimuliert. 40. In vitro methods for cloning and multiplying immunosuppressive T cells which suppress T cells which specifically recognize derived fragments presented in MHC, the T cells being in the presence of BPPs or constituents thereof, corresponding homologous peptides human proteins, auto-reactive peptides formed by the action of a BPP, peptides activated by the action of a BPP, encoded by viruses or endogenous viruses, or human peptides homologous to such viral peptides under normal conditions.
41. Verfahren zur Diagnose einer Autoimmunerkrankung oder einer Prädisposition dazu, vorzugsweise von rheumatoider Arthritis, dadurch gekennzeichnet, daß man in einem T- Zell-Proliferationstest ein IPP, ein Spaltprodukt eines ipp oder ein Fragment davon oder ein menschliches Homologes dazu auf Proliferation von reaktiven T-Zellen testet. 41. A method for diagnosing an autoimmune disease or a predisposition therefor, preferably rheumatoid arthritis, characterized in that in a T-cell proliferation test an IPP, a cleavage product of an ipp or a fragment thereof or a human homologue thereto for proliferation of reactive T Cells tests.
42. Verfahren nach Anspruch 41, dadurch gekennzeichnet, daß das Spaltprodukt oder Fragment davon, oder das menschliche Homologe dazu die in Tabelle VII dargestellte Aminosäuresequenz aufweist. 42. The method according to claim 41, characterized in that the cleavage product or fragment thereof, or the human homolog thereto, has the amino acid sequence shown in Table VII.
43. Verfahren zum Nachweis von BPPs oder der sie bildenden Bakterien, dadurch gekennzeichnet, daß man eine Polymerasekettenreaktion (PCR) mit für BPP-Gene spezifischen Primern durchführt, und das PCR-Produkt durch DNA- Sequenzanalyse oder andere übliche Verfahren wie Gelelektrophorese auf BPP-spezifische Sequenzen untersucht. 43. A method for the detection of BPPs or the bacteria forming them, characterized in that one carries out a polymerase chain reaction (PCR) with primers specific for BPP genes, and the PCR product by DNA sequence analysis or other conventional methods such as gel electrophoresis on BPP- specific sequences examined.
44. Verfahren zum Nachweis der BPP-abhängigen Aktivierung von Viren oder viralen Elementen, dadurch gekennzeichnet, daß man eine PCR mit für die viralen Gene spezifischen Primern durchführt, und das PCR-Produkt durch DNA-Sequenzanalyse oder andere übliche Verfahren wie Gelelektrophorese auf BPP-spezifische Sequenzen untersucht oder die Aktivität der viralen reversen Transkriptase oder anderer viraler Enzyme mißt. 44. A method for detecting the BPP-dependent activation of viruses or viral elements, characterized in that one carries out a PCR with primers specific for the viral genes, and the PCR product by DNA sequence analysis or other conventional methods such as gel electrophoresis on BPP- specific sequences are examined or the activity of the viral reverse transcriptase or other viral enzymes is measured.
45. Verwendung eines alpha-Proteins oder analogen Peptides für das Targeting biologisch wirksamer Substanzen in Zielzellen oder Zielgewebe. 45. Use of an alpha protein or analog peptide for targeting biologically active substances in target cells or target tissue.
46. Verwendung nach Anspruch 45, wobei die Zielzellen bestimmte Zellen des menschlichen Blutes darstellen. 46. Use according to claim 45, wherein the target cells represent certain cells of human blood.
47. Verwendung nach Anspruch 45, wobei die Zielzellen bestimmte Zellen der menschlichen Schleimhaut (z.B. des Nasopharynx) darstellen. 47. Use according to claim 45, wherein the target cells represent certain cells of the human mucosa (e.g. the nasopharynx).
PCT/EP1995/003726 1994-09-21 1995-09-21 Drug for the prevention and treatment of auto-immune and viral diseases, and diagnostic agents for detecting said diseases WO1996009395A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU36515/95A AU3651595A (en) 1994-09-21 1995-09-21 Drug for the prevention and treatment of auto-immune and viral diseases, and diagnostic agents for detecting said diseases

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DEP4433708.6 1994-09-21
DE4433708 1994-09-21

Publications (2)

Publication Number Publication Date
WO1996009395A2 true WO1996009395A2 (en) 1996-03-28
WO1996009395A3 WO1996009395A3 (en) 1996-07-18

Family

ID=6528818

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1995/003726 WO1996009395A2 (en) 1994-09-21 1995-09-21 Drug for the prevention and treatment of auto-immune and viral diseases, and diagnostic agents for detecting said diseases

Country Status (2)

Country Link
AU (1) AU3651595A (en)
WO (1) WO1996009395A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7667015B2 (en) 2001-04-10 2010-02-23 Agensys, Inc. Nucleic acid and corresponding protein entitled 151P3D4 useful in treatment and detection of cancer

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0254090A1 (en) * 1986-07-02 1988-01-27 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Process for recovering proteins by means of gene technology using gram-negative host cells
WO1990011367A1 (en) * 1989-03-17 1990-10-04 Mogens Kilian IMMUNOGLOBULIN A1 PROTEASES (IgA1 PROTEASES), METHOD OF GENE-TECHNOLOGICALLY PRODUCING THIS TYPE OF ENZYME AND VACCINES CONTAINING THE ENZYMES AND FRAGMENTS THEREOF FOR IMMUNIZING AGAINST BACTERIAL MENINGITIS AND OTHER DISEASES CAUSED BY IgA1 PROTEASE-PRODUCING BACTERIA
WO1991011520A1 (en) * 1990-02-03 1991-08-08 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. PROCESS FOR ENZYMATICAL CLEAVAGE OF RECOMBINANT PROTEINS BY MEANS OF IgA PROTEASES
EP0495398A1 (en) * 1991-01-11 1992-07-22 Roche Diagnostics GmbH Recombinant IgA-protease
WO1992013871A1 (en) * 1991-01-31 1992-08-20 Washington University Polypeptides and polynucleotides useful for the diagnosis and treatment of pathogenic neisseria
WO1992016643A1 (en) * 1991-03-14 1992-10-01 Imclone Systems Incorporated Recombinant hybrid porin epitopes
WO1994006421A1 (en) * 1992-09-16 1994-03-31 The University Of Tennessee Research Corporation Recombinant multivalent m protein vaccine

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0254090A1 (en) * 1986-07-02 1988-01-27 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Process for recovering proteins by means of gene technology using gram-negative host cells
WO1990011367A1 (en) * 1989-03-17 1990-10-04 Mogens Kilian IMMUNOGLOBULIN A1 PROTEASES (IgA1 PROTEASES), METHOD OF GENE-TECHNOLOGICALLY PRODUCING THIS TYPE OF ENZYME AND VACCINES CONTAINING THE ENZYMES AND FRAGMENTS THEREOF FOR IMMUNIZING AGAINST BACTERIAL MENINGITIS AND OTHER DISEASES CAUSED BY IgA1 PROTEASE-PRODUCING BACTERIA
WO1991011520A1 (en) * 1990-02-03 1991-08-08 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. PROCESS FOR ENZYMATICAL CLEAVAGE OF RECOMBINANT PROTEINS BY MEANS OF IgA PROTEASES
EP0495398A1 (en) * 1991-01-11 1992-07-22 Roche Diagnostics GmbH Recombinant IgA-protease
WO1992013871A1 (en) * 1991-01-31 1992-08-20 Washington University Polypeptides and polynucleotides useful for the diagnosis and treatment of pathogenic neisseria
WO1992016643A1 (en) * 1991-03-14 1992-10-01 Imclone Systems Incorporated Recombinant hybrid porin epitopes
WO1994006421A1 (en) * 1992-09-16 1994-03-31 The University Of Tennessee Research Corporation Recombinant multivalent m protein vaccine

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
BIO/TECHNOLOGY, Bd. 10, 1992, Seiten 799-804, XP002003043 POHLNER ET AL: "SEQUENCE-SPECIFIC CLEAVAGE OF PROTEIN FUSIONS USING A RECOMBINANT NEISSERIA TYPE 2 IGA PROTEASE" *
CLINICAL INFECTIOUS DISEASES, Bd. 20, Nr. S2, Juni 1995, Seiten S169-S171, XP002003047 ARZESE ET AL: "COMPARITIVE STUDIES OF THE IGA1 PROTEASE GENES FROM HAEMOPHILUS INFLUENZAE,NEISSERIA GONORRHOEAE,AND PREVOTELLA MELANINOGENICA" *
JOURNAL OF CELLULAR BIOCHEMISTRY,SUPPLEMENT 19A, 5. - 26.Januar 1995, Seite 248 XP002003048 LOMHOLT ET AL: "SIGNIFICANTLY DIFFERENT DEGREES OF ANTIGENIC HETEROGENEITY AMONG IGA1 PROTEASES SECRETED BY SPECIES OF STREPTOCOCCUS,NEISSERIA AND HAEMOPHILUS" *
JOURNAL OF CELLULAR BIOCHEMISTRY,SUPPLEMENT 19A, 5. - 26.Januar 1995, Seite 249 XP002003044 POULSEN ET AL: "PRIMARY STRUCTURE OF NEISSERIA MENINGITIDIS IGA1 PROTEASES IN RELATION TO CLEAVAGE SPECIFICITY" *
MOLECULAR MICROBIOLOGY, Bd. 15, Nr. 3, 1995, Seiten 495-506, XP002003045 LOMHOLT ET AL: "COMPARITIVE CHARACTERIZATION OF THE IGA GENE ENCODING IGA1 PROTEASE IN NEISSERIA MENINGITIDIS, NEISSERIA GONORRHOEAE AND HAEMOPHILUS INFLUENZAE" *
MOLECULAR MICROBIOLOGY, Bd. 17, Nr. 6, 1995, Seiten 1073-1083, XP002003046 POHLNER ET AL: "UPTAKE AND NUCLEAR TRANSPORT OF NEISSERIA IGA1 PROTEASE- ASSOCIATED ALPHA-PROTEINS IN HUMAN CELLS" *
NATURE, Bd. 325, 1987, Seiten 458-462, XP002003040 POHLNER ET AL: "GENE STRUCTURE AND EXTRACELLULAR SECRETION OF NEISSERIA GONORRHOEAE IGA PROTEASE" in der Anmeldung erw{hnt *
THE EMBO JOURNAL, Bd. 3, Nr. 7, 1984, Seiten 1595-1601, XP002003042 HALTER ET AL: "IGA PROTEASE OF NEISSERIA GONORRHOEAE: ISOLATION AND CHARACTERIZATION OF THE GENE AND ITS EXTRACELLULAR PRODUCT" *
THE EMBO JOURNAL, Bd. 9, Nr. 6, 1990, Seiten 1991-1999, XP002003041 KLAUSER ET AL: "EXTRACELLULAR TRANSPORT OF CHOLERA TOXIN B SUBUNIT USING NEISSERIA IGA PROTEASE BETA-DOMAIN:CONFORMATION- DEPENDENT OUTER MEMBRANE TRANSLOCATION" *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7667015B2 (en) 2001-04-10 2010-02-23 Agensys, Inc. Nucleic acid and corresponding protein entitled 151P3D4 useful in treatment and detection of cancer
US7960527B2 (en) 2001-04-10 2011-06-14 Agensys, Inc. Nucleic acid and corresponding protein entitled 151P3D4 useful in treatment and detection of cancer

Also Published As

Publication number Publication date
WO1996009395A3 (en) 1996-07-18
AU3651595A (en) 1996-04-09

Similar Documents

Publication Publication Date Title
DE69737969T2 (en) DNA VACCINATION TO INTRODUCE A SUPPRESSIVE T CELL RESPONSE
DE69333110T2 (en) WITH THE CYTOTOXIN OF HELICOBACTER PYLORI ASSOCIATED, IMMUNODOMINANT ANTIGEN USED IN VACCINE AND FOR DIAGNOSIS
DE69636487T2 (en) Compositions for immunotherapy and diagnosis of tuberculosis
DE69835031T2 (en) NEW ANTI-HIV IMMUNOGENES (TOXOIDS), METHOD OF MANUFACTURE AND USE FOR THE TREATMENT AND PREVENTION OF AIDS
US6098631A (en) Compositions and methods for treating autoimmune disease
DE69835766T2 (en) NEW PEPTIDE, APOEP1.B, COMPOSITIONS AND USES THEREOF
US5756449A (en) Peptide T and related peptides in the treatment of inflammation, including inflammatory bowel disease
DE60133287T2 (en) TUMOR ANTIGEN
JP3420245B2 (en) Peptide p277 analog and pharmaceutical composition for treating or diagnosing diabetes containing the same
KR100454554B1 (en) New Peptides, Compositions, Methods and Kits Derived from Human Heat Shock Protein 60 for Diabetes Treatment
DE69610295T3 (en) PHARMACEUTICAL COMPOSITIONS DERIVED FROM A RETROVIRAL REGULATORY PROTEIN, DETOXIFIED IMMUNOGENS, ANTIBODIES PROVIDED THEREFOR, METHODS FOR THE PRODUCTION THEREOF, AND PHARMACEUTICAL COMPOSITIONS CONTAINING SUCH IMMUNOGENS OR ANTIBODIES.
DE69827284T2 (en) Functional Fragments of the HIV-1 VPR Protein and Method of Use
May et al. Comparison of combination therapy regimens for treatment of human immunodeficiency virus-infected patients with disseminated bacteremia due to Mycobacterium avium
DE69637391T2 (en) MODIFIED MYELIN PROTEIN MOLECULES
US7914778B2 (en) Methods of treatment using IL-16 antagonist peptides
DE60028248T2 (en) A method of reducing the immunogenicity of staphylokinase by removing T-cell epitopes
WO2005068491A1 (en) Antitumoral and antiviral peptides
US6011014A (en) Peptide T and related peptides in the treatment of inflammation, including multiple sclerosis
EP0852623B1 (en) Nucleic acid molecules which code for proteins which mediate the adhesion of neisseria cells to human cells
WO1996009395A2 (en) Drug for the prevention and treatment of auto-immune and viral diseases, and diagnostic agents for detecting said diseases
AU718442B2 (en) Use of peptide T in the treatment of multiple sclerosis
WO1991018454A1 (en) Compositions capable of blocking cytotoxicity of viral regulatory proteins and neurotoxic symptoms associated with retroviral infection
KR100815888B1 (en) DNA Vaccines Encoding HIV Accessory Proteins
JPH10309194A (en) Topoisomerase i
US6964763B1 (en) Methods and compositions for inhibiting HIV infectivity and blocking chemokine activity

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AU CA JP US

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA