WO1995013363A1

WO1995013363A1 - Hematopoietic stem cells from swine cord blood and uses thereof

Info

Publication number: WO1995013363A1
Application number: PCT/US1994/012522
Authority: WO
Inventors: David W. Emery; Christian A. Leguern; David H. Sachs
Original assignee: The General Hospital Corporation
Priority date: 1993-11-10
Filing date: 1994-11-01
Publication date: 1995-05-18
Also published as: AU8130294A

Abstract

In general, the invention features a method of purifying hematopoietic stem cells from swine, e.g., miniature swine, cord blood. The method includes collecting swine cord blood and purifying the hematopoietic stem cells from at least one other component of the swine cord blood. The swine cord blood hematopoietic stem cells can be used in methods of inducing tolerance in recipient mammals, e.g., humans, of a first species, to grafts obtained from the swine.

Description

HEMATOPOIETIC STEM CELLS FROM SWINE CORD BLOOD AND USES

THEREOF

. Background of the Invention This invention relates to the induction of immunological tolerance, tissue transplantation, and the reconstitution of the immune system.

Organ procurement currently poses one of the major problems in organ transplantation, as the number of patients requiring transplants far exceeds the number of organs available. Xenotransplantation may provide a solution to this problem. Phylogenetically, non-human primates are the most closely related species to humans and might therefore represent the first choice as donors. In 1969, Reetsma et al., achieved the first successful kidney human xenograft from a chimpanzee (Reetsma, K. et al., 1964, Ann. Surg. Jϋ0:384). However, the potential utilization of primate donors is limited by insufficient numbers, legal and ethical considerations, and the potential for transmitting dangerous viral diseases. Swine represent one of the few large animal species in which breeding characteristics make genetic experiments possible, making it possible to develop MHC homozygous lines of miniature swine. Miniature swine can be maintained at maximum adult weights of 200 to 300 lbs and are anatomically and physiologically close to humans. Therefore the organs of miniature swine might be appropriate for use as xenografts for human beings of all ages.

Tolerance to self major histocompatibility (MHC) antigens occurs during T cell maturation in the thymus (McDuffie et al., 1988, J. Immunol. 141:1840). It has been known since the landmark experiments of Billingham, Brent and Medawar (Billingham et al., 1953, Nat. 122:603) that exposure to the immune system to allogeneic MHC antigens during ontogeny can cause the immune system to allogeneic MHC antigens during ontogeny can cause the immune system to lose reactivity to those antigens, thus leaving the animal specifically tolerant into adult life. Ever since that time, transplantation immunologists have sought means of inducing tolerance in adult animals by production of lymphohematopoietic chimeras. The induction of tolerance across MHC barriers in adult mice by whole body irradiation (WBI) and bone marrow transplantation (BMT) has been studied extensively in murine models (Rayfield et al., 1983, Transplan. 3j>:183; Mayumi et al., 1989, J. Exp. Med. 162:213; Sykes et al., 1988, Immunol. Today 9:23). This approach has also recently been extended to the miniature swine large animal model, in which it was demonstrated that bone marrow transplants across MHC barriers led to the induction of long-term, specific transplantation tolerance to kidney grafts from donors MHC matched to the bone marrow donors (Guzzetta et al., 1991, Transplan. 51:862).

The use of MHC mismatched BMT as a means of inducing tolerance to organ grafts can be accompanied by several major disadvantages: the preparative regimen for allogeneic BMT involves lethal irradiation, with its inherent risks and toxicities; clinical applicability is limited by the fact that most potential recipients do not have an appropriate MHC-matched donor, and BMT across MHC barriers causes severe graft-vs-host-disease (GVHD). Removing the T lymphocytes in allogeneic bone marrow inocula (Rodt et al., 1971, Eur. J. Immunol. 4:25) to prevent GVHD is associated with increased rates of engraftment failure (Martin et al., 1988, Bone Marrow Transplant 1:445; O'Reilly et al., 1985, Transplant. Proc. 17:455; Soderling et al., 1985, J. Immunol. 115:941). While these drawbacks are generally considered acceptable for the treatment of otherwise lethal malignant diseases (e.g., leukemia), they would severely limit the application of this methodology as a preparative regimen for organ transplantation, in which non-specific immunosuppressive agents, while not without major complications, are effective.

Use of a relatively non-toxic, non-myeloablative preparative regimen for bone marrow engraftment and specific transplantation tolerance has been applied to the concordant rat to mouse species combination (Sharabi, Y. et al., 1990, J. Exp. Med. 122:195-202). The treatment involved administration of monoclonal antibodies to eliminate mature T cell subsets (CD4 and CD8) as well as NK cells (NKl.l). These monoclonal antibodies permitted engraftment of xenogeneic bone marrow after only a sub-lethal (300 rads) dose of WBI and a local dose of 700 rads thymic irradiation. The resulting lymphoid reconstitution was superior to that of previously mixed xenogeneic chimeras prepared by lethal irradiation and reconstitution with mixtures of T cell-depleted syngeneic and xenogeneic bone marrow (Sharabi, Y., et al., 1990, J Exp. Med. 172:195-202; Ildstad, et al., 1984, Nature

107:168-170) as recipients did not suffer toxic effects from the preparative regimen. In addition, attempts have been made to lengthen the survival of skin allografts in primates and man by intravenously administering a polyclonal preparation of horse anti-human antithymocyte globulin (ATG). The ATG was injected simultaneously with and on days immediately following grafting (Cosimi, A.B., et al., 1970. Surgery. (58.54-61).

In discordant species combinations, the humoral (antibody mediated) component of the immune system poses a major barrier. When primarily vascularized organs are grafted between discordant species, natural antibodies that recognize determinants expressed on the surfaces of vascular endothelial cells cause rejection of the organ within minutes of vascular anastomosis, due to activation of the complement and coagulation cascades (Hammer, C, et al., 1973, Eur. Sug. Res. 5:162; Hardy, M.A. et al, 1984, in S. Slavin, ed. Elsevier, B.V., p. 515). In attempts to prolong cardiac xenografts from pig donors, pre-existing natural antibodies have been absorbed from the blood of recipient primates by hemoperfusion of a donor-specific kidney (Cooper, D.K.C., et al. 1988, J Heart Transplan. 2:238-246; Fischel, R. J., et al., 1990, Transplant. Proc. 22: 1077).

There have been previous reports of the use of cell lines transfected with allogeneic class I and class II genes to selectively modify the immune response to subsequent tissue grafts bearing the foreign gene (Madsen et al., 1989, Transplant. Proc. 21:477). Graft prolongation by this technique was not permanent, and the mechanism is unclear. Several laboratories have demonstrated the utility of retroviral mediated gene transfer for the introduction of new genetic material into totipotent hematopoietic stem cells of mice. In general, these protocols involve the transduction of bone marrow by recombinant retroviral vectors ex vivo, with the subsequent reintroduction of the treated cells into myeloablated recipients (for review, see Dick et al., 1986, Trends in Genetics 2: 165).

Summary of the Invention In general, the invention features, a method of purifying hematopoietic stem cells from swine umbilical cord blood. The method includes collecting swine umbilical cord blood and isolating the hematopoietic stem cells from at least one other component of the swine cord blood.

In preferred embodiments: the swine cord blood is miniature swine cord blood; the stem cells are isolated from red blood cells; and the swine hematopoietic stem cells are purified by density gradient centrifugation, e.g., by density gradient sedimentation on any of the following gradient materials: Ficoll-Isopaque, Metrizoate-Ficoll, metrizamide, colloidal silica, or albumin.

In other preferred embodiments: the swine hematopoietic cells are purified using a chromatographic technique, e.g., an affinity chromatographic technique, e.g., an immunoaffinity chromatographic technique. The immunoaffinity technique can be based on antibodies having an affinity for the stem cells or on antibodies having an affinity for a component to be purified away from the stem cells. An antibody can be fixed to a substrate and swine cord blood contacted with the substrate. In the case of antibodies with an affinity for stem cells, the stem cells adhere to the antibody fixed on the substrate and other components of the swine cord blood can be washed away. In the case of antibodies with an affinity for a component of the swine cord blood other than hematopoietic stem cells, the component adheres to the antibody fixed on the substrate and the swine cord blood hematopoietic stem cells can be washed away and collected for use in the methods described herein.

In other preferred embodiments, the stem cells are separated from another component, e.g., red blood cells, by lysing, e.g., hypotonically or isotonically lysing, the other component. The lysed component is then separated, e.g., by washing, from the stem cells. In preferred embodiments: the hematopoietic stem cells from swine cord blood are substantially free of red blood cells, e.g., more than 50 percent, preferably more than 75 percent, more preferably more than 90 percent, and most preferably more than 95 percent of the red blood cells are removed from the swine cord blood; the stem cell preparation is at least 80 percent, more preferably 90 or 95 percent (by weight or number) mononuclear white blood cells.

In another aspect, the invention features, a purified preparation of cord blood hematopoietic stem cells. In preferred embodiments: the hematopoietic stem cells from swine cord blood are substantially free of red blood cells, e.g., more than 50 percent, preferably more than 75 percent, more preferably more than 90 percent, and most preferably more than 95 percent of the red blood cells are removed from the swine cord blood; the stem cell preparation is at least 80 percent, more preferably 90 or 95 percent (by weight or number) mononuclear white blood cells.

In another aspect, the invention features, hematopoietic stem cells purified from swine cord blood according to the method described herein, e.g., purified by collecting swine cord blood and separating the hematopoietic stem cells from at least one other component of the swine cord blood.

In preferred embodiments: the hematopoietic stem cells from swine cord blood are substantially free of red blood cells, e.g., more than 50 percent, preferably more than 75 percent, more preferably more than 90 percent, and most preferably more than 95 percent of the red blood cells are removed from the swine cord blood; the stem cell preparation is at least 80 percent, more preferably 90 or 95 percent (by weight or number) mononuclear white blood cells.

In another aspect, the invention features, a method of inducing tolerance in a recipient mammal, e.g., a primate, e.g., a human, of a first species to a xenograft obtained from a mammal of a second species, e.g., a concordant or preferably a discordant species, e.g., a miniature swine. The method includes: prior to or simultaneous with transplantation of the graft, introducing into the recipient mammal hematopoietic stem cells, e.g., cord blood hematopoietic stem cells, bone marrow cells, or fetal liver or spleen cells, of the second species; (preferably, the hematopoietic stem cells home to a site in the recipient mammal); and (optionally) prior to introducing the hematopoietic stem cells into the recipient mammal, inhibiting or preventing natural killer (NK) cell-mediated rejection by, e.g., eliminating NK cells of the recipient by, e.g., introducing into the recipient mammal an antibody capable of binding to NK cells of the recipient mammal. As will be explained in more detail below, the hematopoietic cells prepare the recipient for the graft that follows, by inducing tolerance at both the B-cell and T-cell levels. Preferably, hematopoietic cells are cord blood hematopoietic stem cells, fetal liver or spleen, or bone marrow cells, including immature cells (i.e., undifferentiated hematopoietic stem cells; these desired cells can be separated out of the bone marrow prior to administration), or a complex bone marrow sample including such cells can be used.

One source of anti-NK antibody is anti-human thymocyte polyclonal anti-serum. As is discussed below preferably, a second, anti-mature T cell antibody can be administered as well, which lyses T cells as well as NK cells. Lysing T cells is advantageous for both bone marrow and xenograft survival. Anti-T cell antibodies are present, along with anti-NK antibodies, in anti-thymocyte anti-serum. Repeated doses of anti-NK or anti-T cell antibody may be preferable. Monoclonal preparations can be used in the methods of the invention. Preferred embodiments include: the step of introducing into the recipient mammal, donor species-specific stromal tissue, preferably hematopoietic stromal tissue, e.g., fetal liver or thymus; and the step of prior to hematopoietic stem cell transplantation eliminating mature host T cell activity, e.g., by introducing into the recipient mammal an antibody capable of binding to mature T cells of the recipient mammal.

Preferred embodiments include those in which: the same mammal of the second species is the donor of both the graft and the hematopoietic cells; the donor mammal is a swine, e.g., a miniature swine; the introduction is by intravenous injection; and the antibody is an anti-human thymocyte polyclonal anti-serum, obtained, e.g., from a horse or pig. Preferred embodiments include: the step of prior to hematopoietic stem cell transplantation, irradiating the recipient mammal with low dose, e.g., between about 100 and 400 rads, whole body irradiation; and the step of prior to hematopoietic stem cell transplantation, irradiating the recipient mammal with, e.g., about 700 rads, of thymic irradiation. Preferred embodiments include: the step of prior to hematopoietic stem cell transplantation, absorbing natural antibodies from the blood of the recipient mammal, e.g., by contacting the blood with donor antigen, e.g. by hemoperfusing an organ, e.g., a liver or a kidney, obtained from a mammal of the second species.

In preferred embodiments: the hematopoietic stem cell is an cord blood hematopoietic stem cell; the hematopoietic stem cell is a genetically engineered cell; the hematopoietic stem cell has been engineered to express a growth factor receptor specific for a growth factor produced by the recipient mammal, e.g., when the recipient is a human, the stem cell is engineered to express a human growth factor receptor, e.g., interleukin-3 receptor, granulocyte-macrophage colony stimulating factor receptor, stem cell factor receptor, or leukemia inhibitory factor receptor; the stem cell has been engineered to express a growth factor, e.g., a cytokine, specific for receptors of the donor hematopoietic stem cells, e.g., when the donor is swine, any of swine interleukin-10, a swine analog of human interleukin-3, a swine analog of human granulocyte-macrophage colony stimulating factor, a swine analog of human stem cell factor, or a swine analog of human leukemia inhibitory factor.

In other preferred embodiments: the hematopoietic stem cell is engineered to express growth factor receptors specific for growth factors produced by the recipient mammal, or donor specific growth factors, or both, by inserting DNA encoding a growth factor receptor, a growth factor, or both, into the hematopoietic stem cell, e.g., by transduction, preferably by a retrovirus, more preferably by a Moloney-based retrovirus; the hematopoietic stem cell is engineered to express a growth factor at a level which is higher than the wild type level for that cell.

In another aspect, the invention features, a method of inducing tolerance in a recipient primate, e.g., a human, of a first species to a xenograft obtained from a mammal, e.g., a primate, of a second, e.g., a concordant or preferably discordant, species, e.g., a swine. The method includes: (optionally) introducing into the recipient primate donor species-specific stromal tissue; introducing into the recipient primate hematopoietic stem cells of the second species, e.g., cord blood hematopoietic stem cells, bone marrow cells or fetal liver or spleen cells, (preferably the hematopoietic stem cells home to a site in the recipient primate); and (preferably) inhibiting or preventing NK cell-mediated rejection of the graft by, e.g., eliminating NK cells of the recipient by, e.g., introducing into the recipient mammal an antibody capable of binding to NK cells of the recipient primate.

Preferred embodiments include those in which: the stromal tissue is introduced simultaneously with, or prior to, the hematopoietic stem cells; the hematopoietic stem cells are introduced simultaneously with, or prior to, the antibody; the stromal tissue is introduced simultaneously with, or prior to, the hematopoietic stem cells, and the hematopoietic stem cells are introduced simultaneously with, or prior to, the antibody.

Preferred embodiments include: the step of prior to hematopoietic stem cell transplantation eliminating mature host T cell activity, e.g., by introducing into the recipient mammal an antibody capable of binding to mature T cells of the recipient mammal.

Preferred embodiments include those in which: the same mammal of the second species is the donor of both the graft and the hematopoietic cells; the donor mammal is a swine, e.g., a miniature swine; the introduction is by intravenous injection; and the antibody is an anti-human thymocyte polyclonal anti-serum, obtained, e.g., from a horse or pig. Preferred embodiments include: the step of prior to hematopoietic stem cell transplantation, irradiating the recipient mammal with low dose, e.g., between about 100 and 400 rads, whole body irradiation; and the step of prior to hematopoietic stem cell transplantation, irradiating the recipient mammal with, e.g., about 700 rads, of thymic irradiation.

Preferred embodiments include: the step of prior to hematopoietic stem cell transplantation, absorbing natural antibodies from the blood of the recipient mammal, e.g., by contacting the blood with donor antigen, e.g., by hemoperfusing an organ, e.g., a liver or a kidney, obtained from a mammal of the second species. In preferred embodiments: the hematopoietic stem cell is an cord blood hematopoietic stem cell; the hematopoietic stem cell is a genetically engineered cell; the hematopoietic stem cell has been engineered to express a growth factor receptor specific for a growth factor produced by the recipient mammal, e.g., when the recipient is a human, the stem cell is engineered to express a human growth factor receptor, e.g., interleukin-3 receptor, granulocyte-macrophage colony stimulating factor receptor, stem cell factor receptor, or leukemia inhibitory factor receptor; the stem cell has been engineered to express a growth factor, e.g., a cytokine, specific for receptors of the donor hematopoietic stem cells, e.g., when the donor is swine, any of swine interleukin-10, a swine analog of human interleukin-3, a swine analog of human granulocyte-macrophage colony stimulating factor, a swine analog of human stem cell factor, or a swine analog of human leukemia inhibitory factor.

In other preferred embodiments: the hematopoietic stem cell is engineered to express growth factor receptors specific for growth factors produced by the recipient mammal, or donor specific growth factors, or both, by inserting DNA encoding a growth factor receptor, a growth factor, or both, into the hematopoietic stem cell, e.g., by transduction, preferably by a retrovirus, more preferably by a Moloney-based retrovirus; the hematopoietic stem cell is engineered to express a growth factor at a level which is higher than the wild type level for that cell. In another aspect, the invention features, a method of inducing tolerance in a recipient primate, e.g., a human, to a xenograft obtained from a mammal of a second species, e.g., a swine. The method includes: (optionally) introducing into the recipient primate donor species-specific hematopoietic stromal tissue; introducing into the recipient primate hematopoietic stem cells, e.g., cord blood hematopoietic stem cells, bone marrow cells or fetal liver or spleen cells, of the second species (preferably the hematopoietic stem cells home to a site in the recipient primate); and (optionally) introducing into the recipient primate a graft obtained from the mammal. Preferably the graft is obtained from a different organ than the hematopoietic stem cells.

Preferred embodiments include those in which: the stromal tissue is introduced simultaneously with, or prior to, the hematopoietic stem cells; the hematopoietic stem cells are introduced simultaneously with, or prior to, the graft; the stromal tissue is introduced simultaneously with, or prior to, the hematopoietic stem cells, and the hematopoietic stem cells are introduced simultaneously with, or prior to, the antibody.

Preferred embodiments include those in which: the same mammal of the second species is the donor of both the graft and the hematopoietic cells; the donor mammal is a swine, e.g., a miniature swine; the introduction is by intravenous injection; and the antibody is an anti-human thymocyte polyclonal anti-serum, obtained, e.g., from a horse or pig. Preferred embodiments include: the step of prior to hematopoietic stem cell transplantation, irradiating the recipient mammal with low dose, e.g., between about 100 and 400 rads, whole body irradiation; and the step of prior to hematopoietic stem cell transplantation, irradiating the recipient mammal with, e.g., about 700, rads of thymic irradiation.

In other preferred embodiments: the hematopoietic stem cell is engineered to express growth factor receptors specific for growth factors produced by the recipient mammal, or donor specific growth factors, or both, by inserting DNA encoding a growth factor receptor, a growth factor, or both, into the hematopoietic stem cell, e.g., by transduction, preferably by a retrovirus, more preferably by a Moloney-based retrovirus; the hematopoietic stem cell is engineered to express a growth factor at a level which is higher than the wild type level for that cell. Preferred embodiments include those in which: the primate is a cynomolgus monkey; the primate is a human; the stromal tissue is fetal liver; the stromal tissue is thymus; the mammal is a swine; e.g., a miniature swine; the graft is a liver; the graft is a kidney.

In another aspect, the invention features, a method of inducing tolerance in a recipient primate, e.g., a human, of a first species to a tissue obtained from a mammal, e.g., a swine, e.g., a miniature swine, of a second species. The method includes: introducing into the recipient primate donor species-specific hematopoietic stromal tissue; introducing into the recipient primate hematopoietic stem cells, e.g., preferably swine cord blood hematopoietic stem cells, bone marrow cells or fetal liver or spleen cells, or the second species (preferably the hematopoietic stem cells home to a site in the recipient primate); and introducing into the recipient primate a graft obtained from the mammal.

Preferred embodiments include those in which: the stromal tissue is introduced simultaneously with, or prior to, the hematopoietic stem cells; the hematopoietic stem cells are introduced simultaneously with, or prior to, the graft; and the stromal tissue is introduced simultaneously with, or prior to, the hematopoietic stem cells. Preferred embodiments include those in which: the same mammal of the second species is the donor of both the graft and the hematopoietic cells; the donor mammal is a swine, e.g., a miniature swine; the introduction is by intravenous injection; and the antibody is an anti-human thymocyte polyclonal anti-serum, obtained, e.g., from a horse or pig. Preferred embodiments include: the step of prior to hematopoietic stem cell transplantation, irradiating the recipient mammal with low dose, e.g., between about 100 and 400 rads, whole body irradiation; and the step of prior to hematopoietic stem cell transplantation, irradiating the recipient mammal with, e.g., about 700, rads of thymic irradiation.

Preferred embodiments include: the step of prior to hematopoietic stem cell transplantation, absorbing natural antibodies from the blood of the recipient mammal, e.g., by contacting the blood with donor antigen, e.g., by hemoperfusing an organ, e.g., a liver or a kidney, obtained from a mammal of the second species. In preferred embodiments: the hematopoietic stem cell is an cord blood hematopoietic stem cell; the hematopoietic stem cell is a genetically engineered cell; the hematopoietic stem cell has been engineered to express a growth factor receptor specific for a growth factor produced by the recipient mammal, e.g., when the recipient is a human, the stem cell is engineered to express a human growth factor receptor, e.g., interleukin-3 receptor, granulocyte-macrophage colony stimulating factor receptor, stem cell factor receptor, or leukemia inhibitory factor receptor; the stem cell has been engineered to express a growth factor, e.g., a cytokine, specific for receptors of the donor hematopoietic stem cells, e.g., when the donor is swine, any of interleukin-10, a swine analog of human interleukin-3, a swine analog of human granulocyte-macrophage colony stimulating factor, a swine analog of human stem cell factor, or a swine analog of human leukemia inhibitory factor.

In another aspect, the invention features, a method of promoting the repopulation of bone marrow of a recipient mammal, e.g., a primate, e.g., a human, of a first species, with hematopoietic stem cells, e.g., cord blood hematopoietic stem cells, from a second species e.g., a swine. The method includes: introducing hematopoietic stem cells into a recipient mammal such that the hematopoietic stem cells promote the repopulation of the bone marrow of the recipient mammal.

In preferred embodiments the method includes; inhibiting or preventing natural killer (NK) cell-mediated rejection of the stem cells by, e.g., eliminating NK cells of the recipient by, e.g., introducing into the recipient mammal an antibody capable of binding to NK cells of the recipient mammal; the step of introducing into the recipient mammal, donor species- specific stromal tissue, preferably hematopoietic stromal tissue, e.g., fetal liver or thymus; the step of eliminating or reducing mature host T cell activity, e.g., by introducing into the recipient mammal an antibody capable of binding to mature T cells of the recipient mammal.

Preferred embodiments include those in which; the donor is a miniature swine; the introduction of stem cells is by intravenous injection; and the antibody is an anti-human thymocyte polyclonal anti-serum, obtained, e.g., from a horse or pig.

Preferred embodiments include: the step of prior to hematopoietic stem cell transplantation, irradiating the recipient mammal with low dose, e.g., between about 100 and 400 rads, whole body irradiation; and the step of prior to hematopoietic stem cell transplantation, irradiating the recipient mammal with, e.g., about 700 rads, of thymic irradiation.

Preferred embodiments include: the step of prior to hematopoietic stem cell transplantation, absorbing natural antibodies from the blood of the recipient mammal, e.g., by contacting the blood with donor antigen, e.g. by hemoperfusing an organ, e.g., a liver or a kidney, obtained from the donor species. In preferred embodiments: the hematopoietic stem cell is an cord blood hematopoietic stem cell; the hematopoietic stem cell is a genetically engineered cell; the hematopoietic stem cell has been engineered to express a growth factor receptor specific for a growth factor produced by the recipient mammal, e.g., when the recipient is a human, the stem cell is engineered to express a human growth factor receptor, e.g., interleukin-3 receptor, granulocyte-macrophage colony stimulating factor receptor, stem cell factor receptor, or leukemia inhibitory factor receptor; the stem cell has been engineered to express a growth factor, e.g., a cytokine, specific for receptors of the donor hematopoietic stem cells, e.g., when the donor is swine, any of swine interleukin-10, a swine analog of human interleukin-3, a swine analog of human granulocyte-macrophage colony stimulating factor, a swine analog of human stem cell factor, or a swine analog of human leukemia inhibitory factor.

In another aspect, the invention features, a method of promoting the engraftment and hematopoietic activity of a hematopoietic stem cell, preferably an cord blood hematopoietic stem cell of a first (donor) species, e.g. a swine, e.g., a miniature swine, in a recipient mammal, e.g., a primate, e.g., a human, of a second species. The method includes: inserting DNA encoding a growth factor receptor specific for a recipient mammal growth factor into a hematopoietic stem cell, e.g., a swine cord blood stem cell; introducing the hematopoietic stem cell containing the DNA into a recipient mammal (which produces a growth factor specific for the growth factor receptor).

In preferred embodiments the method includes; inhibiting or preventing natural killer (NK) cell-mediated rejection of the stem cells by, e.g., eliminating NK cells of the recipient by, e.g., introducing into the recipient mammal an antibody capable of binding to NK cells of the recipient mammal; the step of introducing into the recipient mammal, donor species- specific stromal tissue, preferably hematopoietic stromal tissue, e.g., fetal liver or thymus; the step of eliminating or reducing mature host T cell activity, e.g., by introducing into the recipient mammal an antibody capable of binding to mature T cells of the recipient mammal. Preferred embodiments include those in which; the donor mammal is a miniature swine; the introduction of stem cells is by intravenous injection; and the antibody is an anti-human thymocyte polyclonal anti-serum, obtained, e.g., from a horse or pig.

Preferred embodiments include: the step of prior to hematopoietic stem cell transplantation, absorbing natural antibodies from the blood of the recipient mammal, e.g., by contacting the blood with donor antigen, e.g. by hemoperfusing an organ, e.g., a liver or a kidney, obtained from a mammal of the second species.

In preferred embodiments: the transplanted stem cell gives rise to a donor specific T cell; the recipient mammal is a human and the growth factor receptor is a human growth factor receptor; the human growth factor receptor is selected from the group consisting of interleukin-3 receptor, granulocyte-macrophage colony stimulating factor receptor, stem cell factor receptor, and leukemia inhibitory factor receptor.

Preferred embodiments include those in which: the DNA is inserted into the cell by transduction, e.g., by a retrovirus, e.g., by a Moloney-based retrovirus; and the DNA is expressed in stem cells and/or peripheral blood cells of the recipient 14, preferably 30, more preferably 60, and most preferably 120 days, after the DNA is introduced into the recipient.

In preferred embodiments: the hematopoietic stem cell is engineered to express growth factor receptors specific for growth factors produced by the recipient mammal by inserting DNA encoding the growth factor receptors specific for growth factors produced by the recipient mammal into the hematopoietic stem cell, e.g., by transduction, preferably by a retrovirus, more preferably by a Moloney-based retrovirus; the hematopoietic stem cell is engineered to express a growth factor at a level which is higher than the wild type level for that cell.

In another aspect, the invention features, a method of promoting the engraftment and hematopoietic activity of a hematopoietic stem cell, preferably an cord blood hematopoietic stem cell, of a first (donor) species, e.g. a swine, e.g., a miniature swine, in a recipient mammal, e.g., a primate, e.g., a human, of a second species. The method includes: inserting DNA encoding a donor growth factor, e.g., a cytokine, into a hematopoietic stem cell e.g., a swine cord blood hematopoietic stem cell which expresses receptors specific for the swine cytokine, and introducing the hematopoietic stem cell containing the DNA into a recipient mammal.

Preferred embodiments include those in which: the swine cytokine is selected from the group consisting of swine interleukin-10, a swine analog of human interleukin-3, a swine analog of human granulocyte-macrophage colony stimulating factor, a swine analog of human stem cell factor, and a swine analog of human leukemia inhibitory factor. Preferred embodiments include those in which: the DNA is inserted into the cell by transduction, e.g., by a retrovirus, e.g., by a Moloney-based retrovirus; and the DNA is expressed in stem cells and/or peripheral blood cells of the recipient 14, preferably 30, more preferably 60, and most preferably 120 days, after the DNA is introduced into the recipient. In preferred embodiments the method includes; inhibiting or preventing natural killer

(NK) cell-mediated rejection of the stem cells by, e.g., eliminating NK cells of the recipient by, e.g., introducing into the recipient mammal an antibody capable of binding to NK cells of the recipient mammal; the step of introducing into the recipient mammal, donor species- specific stromal tissue, preferably hematopoietic stromal tissue, e.g., fetal liver or thymus; the step of eliminating or reducing mature host T cell activity, e.g., by introducing into the recipient mammal an antibody capable of binding to mature T cells of the recipient mammal.

Preferred embodiments include those in which; the donor mammal is a miniature swine; the introduction of stem cells is by intravenous injection; and the antibody is an anti-human thymocyte polyclonal anti-serum, obtained, e.g., from a horse or pig. Preferred embodiments include: the step of prior to hematopoietic stem cell transplantation, irradiating the recipient mammal with low dose, e.g., between about 100 and 400 rads, whole body irradiation; and the step of prior to hematopoietic stem cell transplantation, irradiating the recipient mammal with, e.g., about 700 rads, of thymic irradiation. Preferred embodiments include: the step of prior to hematopoietic stem cell transplantation, absorbing natural antibodies from the blood of the recipient mammal, e.g., by contacting the blood with donor antigen, e.g. by hemoperfusing an organ, e.g., a liver or a kidney, obtained from a mammal of the second species.

In other preferred embodiments: the hematopoietic stem cell is engineered to express growth factor receptors specific for growth factors produced by the recipient mammal by inserting DNA encoding the growth factor receptors specific for growth factors produced by the recipient mammal into the hematopoietic stem cell, e.g., by transduction, preferably by a retrovirus, more preferably by a Moloney-based retrovirus; the hematopoietic stem cell is engineered to express a growth factor at a level which is higher than the wild type level for that cell.

In another aspect, the invention features, hematopoietic stem cells from swine cord blood which expresses a human growth factor receptor, e.g., any of interleukin-3 receptor, granulocyte-macrophage colony stimulating factor receptor, stem cell factor receptor, leukemia inhibitory factor receptor.

In another aspect, the invention features, hematopoietic stem cells from swine cord blood which, preferably, expresses a swine growth factor receptor, and which have been genetically engineered to express a swine growth factor specific for a swine growth factor receptor, e.g., swine interleukin-10, a swine analog of human interleukin-3, a swine analog of human granulocyte-macrophage colony stimulating factor, a swine analog of human stem cell factor, or a swine analog of human leukemia inhibitory factor. Preferably, the cell expresses the growth factor at a level which is greater than the wild type level for this cell. "Tolerance", as used herein, refers to the inhibition of a graft recipient's ability to mount an immune response which would otherwise occur, e.g., in response to the introduction of a nonself MHC antigen into the recipient. Tolerance can involve humoral, cellular, or both humoral and cellular responses. The concept of tolerance includes both complete and partial tolerance. In other words, as used herein, tolerance include any degree of inhibition of a graft recipient's ability to mount an immune response.

"A discordant species combination", as used herein, refers to two species in which hyperacute rejection occurs when vascular organs are grafted. Generally, discordant species are from different orders, while concordant species are from the same order. For example, rats and mice are non-discordant species, i.e. their MHC antigens are substantially similar, and they are members of the same order, rodentia.

"Purifying hematopoietic stem cells from swine cord blood", as used herein, refers to removal of unwanted components of swine cord blood such that the concentration of swine cord blood hematopoietic stem cells in the swine cord blood preparation after purification is greater that the concentration of swine cord blood hematopoietic stem cells in the swine cord blood preparation prior to purification and the concentration of at least one unwanted component in the swine cord blood preparation after purification is less than the concentration of the unwanted component in the swine cord blood preparation prior to purification. Unwanted components include components of swine cord blood other than hematopoietic stem cells e.g., red blood cells. It should be understood that the extent of the purification of the swine cord blood hematopoietic stem cells can depend on the intended use of the stem cells.

"Promoting the engraftment and hematopoietic activity of a hematopoietic stem cell from swine cord blood", as used herein, refers to increasing the ability (e.g., by genetically engineering the swine cord hematopoietic stem cells such that they express growth factor receptors specific for growth factors produced by a recipient species and/or such that they express swine growth factors, e.g., cytokines) of swine blood hematopoietic cells to establish hematopoietic stem cell colonies upon transplantation into a recipient species.

"Promoting the repopulation of bone marrow of a recipient mammal with hematopoietic stem cells from swine cord blood", as used herein, refers to replacing and/or supplementing bone marrow of a recipient mammal with swine cord blood hematopoietic stem cells such that the swine cord blood hematopoietic stem cells establish hematopoietic stem cell colonies upon transplantation into the recipient mammal.

"Hematopoietic stem cell", as used herein, refers to a cell that is capable of developing into mature myeloid and/or lymphoid cells.

"Miniature swine", as used herein, refers to partially inbred miniature swine.

"Graft", as used herein, refers to a body part, organ, tissue, cells, or portions thereof.

"Stromal tissue", as used herein, refers to the supporting tissue or matrix of an organ, as distinguished from its functional elements or parenchyma. "Bone marrow hematopoietic stem cell", as used herein, refers to bone marrow cell which is capable of developing into mature myeloid and/or lymphoid cells.

"MHC antigen", as used herein, refers to a protein product of one or more MHC genes; the term includes fragments or analogs of products of MHC genes which can evoke an immune response in a recipient organism. Examples of MHC antigens include the products (and fragments or analogs thereof) of the human MHC genes, i.e., the HLA genes. MHC antigens in swine, e.g., miniature swine, include the products (and fragments and analogs thereof) of the SLA genes, e.g., of the DRB gene.

Methods of the invention avoid the undesirable side effects of broad spectrum immune suppressants which are often used in transplantation. Drugs such as Prednisone, Imuran, CyA, and, most recently, FK506, have all had an important impact on the field of transplantation. However, all of these drugs cause nonspecific suppression of the immune system, and therefore must be titrated carefully to avoid rejection while not completely eliminating immune function. Patients must stay on chronic immunosuppressive therapy for the remainder of their lives, facing the major complications of too much or too little immunosuppression, infection and rejection, respectively.

Tolerance to transplantation antigens can be achieved through induction of lymphohematopoietic chimerism by bone transplantation (BMT). However, successful BMT across MHC barriers has two major risks: if mature T cells are not removed from the bone marrow inoculum the recipient may develop severe graft versus host disease (GVHD); removal of these cells often leads to failure of engraftment. Methods of the invention, which induce specific tolerance by reconstitution of the recipients bone marrow with autologous (as opposed to allogeneic or heterologous) bone marrow cells, allow tolerance to be conferred with minimal risk of GVHD and with minimal need to remove T cells from the marrow inoculum.

The invention provides an alternative and convenient source, e.g. swine cord blood, of hematopoietic stem cells for transplantation into a recipient species. The swine cord blood hematopoietic stem cells can be used in a method of inducing tolerance in a recipient mammal, e.g., a primate, of a first species, to a graft obtained from a second species, e.g., a swine. In addition the invention promotes the reconstitution of a graft recipient's bone marrow with swine cord blood hematopoietic stem cells which express growth factor receptors specific for growth factors produced by the recipient and/or which express donor, e.g., swine, growth factors, e.g., cytokines. Expression of growth factors specific for recipient growth factors promotes engraftment and hematopoietic activity of the hematopoietic stem cells from swine cord blood in the recipient. Thus, the swine cord blood hematopoietic stem cells are useful in investigations in hematopoiesis as well as in the methods of inducing tolerance or restoring immune function.

Furthermore, it appears that swine cord blood hematopoietic stem cells are less dependent on cytokines for engraftment in a recipient than are hematopoietic stem cells from other sources, e.g., bone marrow cells. Therefore, hematopoietic stem cells can most likely engraft in a recipient more readily than hematopoietic stem cells from other sources. In addition, hematopoietic stem cells from swine cord blood are most likely more easily transduced, e.g. by retroviral transduction, than are hematopoietic stem cells from other sources.

Other features and advantages of the invention will be apparent from the following detailed description, and from the claims.

Detailed Description The table and drawings are first briefly described. Table

Table I shows the relative frequency of the respective progenitors in bone marrow (2 experiments), fetal liver (2 experiments), and cord blood (1 experiment). Drawings

Fig. 1 is a diagram of the GS4.5 retroviral construct.

Fig. 2 is a diagram of the GS4.5 proviral genome and the expected transcripts.

Fig. 3 is a representation of flow cytometry profile of transduced cells. Fig. 4 is a diagram of transduction assay.

Fig. 5 is a diagram of genetic maps of the C57BL/10, B10.AKM, and B10.MBR strains.

Fig. 6 is a diagram of the FACS profile of spleen cells from a recipient of transduced bone marrow. Fig. 7 is a graph of survival versus time in skin graft experiments.

Fig. 8 is a diagram of FACS analysis of thymocytes from graft rejectors, receptors, and controls.

Fig. 9 is a diagram of the N2-B19-H2b vector.

Fig. 10 is a map of swine interleukin-10.

Purification and Characterization of Hematopoietic Stem Cells from Swine Cord Blood

Swine cord blood was collected sterily in heparin following delivery by Cesarean section or natural birth. Hematopoietic stem cells were isolated from the swine cord blood by density gradient centrifugation using a Ficol gradient (LSM, Organon Teknika Corp.) and washed once in Hanks buffered saline prior to plating. Alternative methods by which hematopoietic stem cells can be purified from swine cord blood include gelatin sedimentation, density gradient centrifugation using other gradient materials, chromatography, e.g., affinity chromatography, e.g., immunoaffinity chromatography, or lysis and removal of red blood cells, e.g., by hypotonic lysis or lysis using isotonic ammonium chloride.

Gelatin sedimentation is generally performed by generating a 3 percent gelatin solution of swine cord blood and allowing the solution to gel, e.g., allowing the solution to sit overnight. The red blood cells sediment to the bottom of the gelatine solution while the hematopoietic stem cells remain within the gelatin solution. The hematopoietic stem cells can then be removed from the gelatin solution without contaminating red blood cells.

Examples of gradient materials that can be used in density gradient centrifugation to purify hematopoietic stem cells include Ficoll-Isopaque, Metrizoate-Ficoll, metrizamide, colloidal silica, and albumin. Klaus, G.G.B. ed. Lymphocytes: A Practical Approach (IRL Press, Washington, D.C., 1987). When the swine cord blood layered onto one of the above- described gradients and subject to centrifugation, the hematopoietic stem cells will localize in a specific layer that can then be removed from the gradient.

Immunoaffinity chromatography can also be used to purify hematopoietic stem cells from swine cord blood. Immunoaffinity purification generally consists of three steps: preparation of an antibody-matrix, binding of an antigen to the antibody-matrix, and elution of the antigen. See Harlow and Lane, Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory, New York 1988) 511-552. In the first step, either monoclonal antibodies or affinity-purified polyclonal antibodies against hematopoietic stem cells can be covalently attached to a solid-phase matrix. An example of covalent attachment of the antibody to the solid-phase matrix is linkage of the antibody to protein A beads. See Harlow and Lane, Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory, New York 1988) 521- 523. After the preparation of the antibody-solid phase matrix, the antigen (e.g., hematopoietic stem cells) is bound to the antibody and contaminating molecules are removed by washing. In the final step, the antigen-antibody interaction is broken by treating the immune complexes with strong elution conditions, adding a saturating amount of a small compound (e.g. the peptide comprising the epitope recognized by the antibody used in the column) that mimics the binding site, and/or treating with an agent which induces an allosteric change that releases the antigen, to release the antigen into the eluate. Optimal conditions for binding the antigen to the column, washing the column to remove contaminants, and eluting the purified antigen can be determined using conventional parameters as the starting point and testing the effect of varying the parameters.

Lysis and removal of red blood cells is a commonly practiced technique by those of ordinary skill in the art. Klaus, G.G.B. ed. Lymphocytes: A Practical Approach (IRL Press, Washington, D.C., 1987). Common methods of lysing red blood cells include hypotonic lysis and lysis using isotonic ammonium chloride solution.

The above-described methods can be used alone or in combination with other of the above-described methods or in combination with other chromatographic techniques to obtain the desired purity of the hematopoietic cells. It should be understood that the extent of the purification of the solution can depend on the intended use of the swine cord blood hematopoietic stem cells.

Long Term Culture Initiation Assay

Feeder layers were established by plating 2.5 x 10^ freshly explanted swine bone marrow cells in 60 mm adherent tissue culture dishes with 8 ml of myeloid long-term culture medium purchases from the Terry Fox Laboratory Media Preparation Service (Vancouver, British Columbia). This product consists of Iscove's Modified Dulbecco's media (IMDM) containing 2 mM L-glutamine, 0.2 mM i-inositol, 2 μM folic acid, 12.5% each horse and fetal bovine serum (pre-screened lots), and was supplemented with 10^~6 M hydrocortisone 21-hemisuccinate (Sigma) immediately prior to use as directed. Cultures are then maintained at 33°C and passaged once a week by replacing half of the medium and non-adherent cells after gentle agitation with fresh medium. After 3-4 weeks, the non-adherent cells are removed, the remaining adherent layer is irradiated (1200 rads), and the plates are seeded with 1-2 x 10? cells to be tested. After 3-4 more weeks, in culture as described above, all of the cells are harvested and assayed for myeloid colony formation. Myeloid Colony Assays

Single cell suspensions were prepared in IMDM containing 30% defined fetal bovine serum, 2mM L-glutamine, 10"4 M β-mercaptoethanol, antibiotics, growth factors, and 0.8% methylcellulose (Terry Fox Laboratory, Vancouver), plated as 1.1 ml aliquots in 35 mm suspension culture dishes (in duplicate), and incubated at 37°C. Growth factor preparations included conditioned medium from swine lymphocytes stimulated with phytohemagglutinin for 7 days (PHA-LCM), and recombinant human erythropoietin.

Isolation of Bone Marrow Cells from Miniature Swine

Bone marrow cells from miniature swine were harvested by direct surgical curettage, passaged through nylon mesh, and depleted of contaminating erythrocytes with ACK lysing buffer (B& B Research Labs)

Isolation of Fetal Liver Cells from Miniature Swine

Fetuses were obtained by Cesarean section from the pregnant sows at 45-69 days of gestation. The date of conception was estimated by observed estrus or mating, and confirmed by ultrasound examination of the fetuses. The crown rump length of the fetuses was between 9 and 15 cm. The liver was stored in ice cold RPMI 1640 medium during collection, and then a single cell suspension was prepared with a tissue homogenizer in medium HDG199 and filtered through sterile No. 100 nylon mesh (Tetko Nitex, McGraw Park, IL).

Comparison of Relative Frequency of Myeloid Progenitors in Bone Marrow Cells. Fetal Liver Cells, and Cord Blood Cells Bone marrow cells, fetal liver cells, and cord blood cells from miniature swine were prepared as above and plated for either mature myeloid progenitors (colony forming unit granulocyte/ macrophage, CFU-GM) using PHA-LCM alone, or relatively immature progenitors (colonies containing several lineages including erythrocytes, CFU-Mix) using PHA-LCM and erythropoietin. Table 1 shows the relative frequency of the respective progenitors in bone marrow (2 experiments), fetal liver (2 experiments), and cord blood (1 experiment).

Table I Alternative Sources of Swine Stem Cells

Source CFU-GM / 10⁵- CFU-Mix 7 10⁵-

Bone Marrow 50 6

46 5 Fetal Liver 100 37

75 29

Cord Blood 40 1

Characterization of Hematopoietic Stem Cells Isolated from Swine Cord Blood Two assays can be used to further characterize the hematopoietic stem cells isolated from swine cord blood. As an in vitro assay, the ability of swine bone marrow, fetal liver, and cord blood to initiate long-term hematopoiesis on pre-established swine bone marrow stromal layers using the long-term bone marrow culture conditions will be compared. The readout for active hematopoiesis will be the continuous production of CFU-GM. The in vivo assay will be to titrate the number of infused cells necessary to reconstitute swine lethally irradiated with two doses of 500 rads of total body irradiation.

Xenograft Transplantation

The following procedure was designed to lengthen the time an implanted organ (a xenograft) survives in a xenogeneic host prior to rejection. The organ can be any organ, e.g., a liver, e.g., a kidney, e.g., a heart. The two main strategies are elimination of natural antibodies by organ perfusion, and transplantation of tolerance-inducing bone marrow. Thus, preparation of the recipient for transplantation includes any or all of the following steps. Preferably they are carried out in the following sequence.

First, a preparation of horse anti-human thymocyte globulin (ATG) is intravenously injected into the recipient. The antibody preparation eliminates mature T cells and natural killer cells. If not eliminated, mature T cells would promote rejection of both the bone marrow transplant and, after sensitization, the xenograft itself. Of equal importance, the ATG preparation also eliminates natural killer (NK) cells. NK cells probably have no effect on the implanted organ, but would act immediately to reject the newly introduced bone marrow. Anti-human ATG obtained from any mammalian host can also be used, e.g., ATG produced in pigs, although thus far preparations of pig ATG have been of lower titer than horse-derived ATG. ATG is superior to anti-NK monoclonal antibodies, as the latter are generally not lytic to all host NK cells, while the polyclonal mixture in ATG is capable of lysing all host NK cells. Anti-NK monoclonal antibodies can, however, be used. The presence of donor antigen in the host thymus during the time when host T cells are regenerating post-transplant is critical for tolerizing host T cells. If donor hematopoietic stem cells are not able to become established in the host thymus and induce tolerance before host T cells regenerate repeated doses of anti-recipient T cell antibodies may be necessary throughout the nonmyeloablative regimen. Continuous depletion of host T cells may be required for several weeks. Alternatively, e.g., if this approach is not successful, and tolerance (as measured by donor skin graft acceptance, specific cellular hyporesponsiveness in vitro, and humoral tolerance) is not induced in these animals, the approach can be modified to include host thymectomy. In thymectomized recipients, host T cells do not have an opportunity to differentiate in a host thymus, but must differentiate in the donor thymus. If this is not possible, then the animal has to rely on donor T cells developing in the donor thymus for immunocompetence. Immunocompetence can be measured by the ability to reject a non-donor type allogeneic donor skin graft, and to survive in a pathogen-containing environment.

It may also be necessary or desirable to splenectomize the recipient in order to avoid anemia. Second, the recipient is administered low dose radiation in order to create hematopoietic space for newly injected bone marrow cells. A sublethal dose of between 100 rads and 400 rads whole body radiation, plus 700 rads of local thymic radiation, has been found effective for this purpose.

Third, natural antibodies are absorbed from the recipient's blood by hemoperfusion of a liver of the donor species. Pre-formed natural antibodies (nAb) are the primary agents of graft rejection. Natural antibodies bind to xenogeneic endothelial cells and are primarily of the IgM class. These antibodies are independent of any known previous exposure to antigens of the xenogeneic donor. B cells that produce these natural antibodies tend to be T cell-independent, and are normally tolerized to self antigen by exposure to these antigens during development. The mechanism by which newly developing B cells are tolerized is unknown. The liver is a more effective absorber of natural antibodies than the kidney.

The fourth step in the non-myeloablative procedure is to implant donor stromal tissue, preferably obtained from fetal liver, thymus, and/or fetal spleen, into the recipient, preferably in the kidney capsule. Stem cell engraftment and hematopoiesis across disparate species barriers is enhanced by providing a hematopoietic stromal environment from the donor species. The stromal matrix supplies species-specific factors that are required for interactions between hematopoietic cells and their stromal environment, such as hematopoietic growth factors, adhesion molecules, and their ligands.

As liver is the major site of hematopoiesis in the fetus, fetal liver can also serve as an alternative to bone marrow as a source of hematopoietic stem cells. The thymus is the major site of T cell maturation. Each organ includes an organ specific stromal matrix that can support differentiation of the respective undifferentiated stem cells implanted into the host. Although adult thymus may be used, fetal tissue obtained sufficiently early in gestation is preferred because it is free from mature T lymphocytes which can cause GVHD. Fetal tissues also tend to survive better than adult tissues when transplanted. As an added precaution against GVHD, thymic stromal tissue can be irradiated prior to transplantation, e.g., irradiated at 1000 rads. As an alternative or an adjunct to implantation, fetal liver cells can be administered in fluid suspension. Finally, cord blood hematopoietic stem cells, or another source of hematopoietic stem cells, e.g., bone marrow cells (BMC) or a fetal liver suspension, of the donor are injected into the recipient. Donor BMC home to appropriate sites of the recipient and grow contiguously with remaining host cells and proliferate, forming a chimeric lymphohernatopoietic population. By this process, newly forming B cells (and the antibodies they produce) are exposed to donor antigens, so that the transplant will be recognized as self. Tolerance to the donor is also observed at the T cell level in animals in which hematopoietic stem cell, e.g., stem cells, engraftment has been achieved. The hematopoietic cells can be genetically engineered to improve their ability to engraft and give rise to myeloid and/or lymphoid cells. For example, incompatibility between donor cells and host growth factors can be minimized by engineering the donor stem cells to express recipient growth factor receptors and/or donor cytokines. When an organ graft is placed in such a recipient several months after bone marrow chimerism has been induced, natural antibody against the donor will have disappeared, and the graft should be accepted by both the humoral and the cellular arms of the immune system. This approach has the added advantage of permitting organ transplantation to be performed sufficiently long following transplant of hematopoietic cells, e.g., cord blood hematopoietic stem cells, e.g., a fetal liver suspension, that normal health and immunocompetence will have been restored at the time of organ transplantation. The use of xenogeneic donors allows the possibility of using bone marrow cells and organs from the same animal, or from genetically matched animals.

While any of these procedures may aid the survival of an implanted organ, best results are achieved when all steps are used in combination. Methods of the invention can be used to confer tolerance to allogeneic grafts, e.g., wherein both the graft donor and the recipient are humans, and to xenogeneic grafts, e.g., wherein the graft donor is a nonhuman animal, e.g., a swine, e.g., a miniature swine, and the graft recipient is a primate, e.g., a human.

In the case of xenogeneic grafts, the donor of the implant and the individual that supplies either the tolerance-inducing hematopoietic cells or the liver to be perfused should be the same individual or should be as closely related as possible. For example, it is preferable to derive implant tissue from a colony of donors that is highly inbred.

Detailed Protocol

In the following protocol for preparing a cynomolgus monkey for receipt of a kidney from a miniature swine donor, zero time is defined as the moment that the arterial and venous cannulas of the recipient are connected to the liver to be perfused. On day -l a commercial preparation (Upjohn) of horse anti-human anti-thymocyte globulin (ATG) is injected into the recipient. ATG eliminates mature T cells and natural killer cells that would otherwise cause rejection of the bone marrow cells used to induce tolerance. The recipient is anesthetized, an IV catheter is inserted into the recipient, and 6 ml of heparinized whole blood are removed before injection. The ATG preparation is then injected (50 mg/kg) intravenously. Six ml samples of heparinized whole blood are drawn for testing at time points of 30 min., 24 hrs and 48 hrs. Blood samples are analyzed for the effect of antibody treatment on natural killer cell activity (testing on K562 targets) and by FACS analysis for lymphocyte subpopulations, including CD4, CD8, CD3, CDllb, and CD 16. Preliminary data from both assays indicate that both groups of cells are eliminated by the administration of ATG. If mature T cells and NK cells are not eliminated, ATG can be re-administered at later times in the procedure, both before and after organ transplantation.

Sublethal irradiation is administered to the recipient between days -1 and -8. Irradiation is necessary to eliminate enough of the recipient's endogenous BMC to stimulate hematopoiesis of the newly introduced foreign BMC. Sublethal total body irradiation is sufficient to permit engraftment with minimal toxic effects to the recipient.

Whole body radiation (150 Rads) was administered to cynomolgus monkey recipients from a bilateral (TRBC) cobalt teletherapy unit at 10 Rads/min. Local irradiation of the thymus (700 Rads) was also employed in order to facilitate engraftment. Natural antibodies are a primary cause of organ rejection. To remove natural antibodies from the recipient's circulation prior to transplantation, on day 0 an operative absorption of natural antibodies (nAB) is performed, using a miniature swine liver, as follows. At -90 minutes the swine donor is anesthetized, and the liver prepared for removal by standard operative procedures. At -60 minutes the recipient monkey is anesthetized. A peripheral IV catheter is inserted, and a 6 ml sample of whole blood is drawn. Through mid-line incision, the abdominal aorta and the vena cava are isolated. Silastic cannulas containing side ports for blood sampling are inserted into the blood vessels.

At -30 minutes the liver is perfused in situ until it turns pale, and then removed from the swine donor and placed into cold Ringers Lactate. The liver is kept cold until just prior to reperfusion in the monkey. A liver biopsy is taken. At -10 minutes the liver is perfused with warm albumin solution until the liver is warm (37 degrees).

At 0 time the arterial and venous cannulas of the recipient are connected to the portal vein and vena cava of the donor liver and perfusion is begun. Liver biopsies are taken at 30 minutes and 60 minutes, respectively. Samples of recipient blood are also drawn for serum at 30 minutes and 60 minutes respectively. At 60 minutes the liver is disconnected from the cannulas and the recipient's large blood vessels are repaired. The liver, having served its function of absorbing harmful natural antibodies from the recipient monkey, is discarded. Additional blood samples for serum are drawn from the recipient at 2, 24, and 48 hours. When this procedure was performed on two sequential perfusions of swine livers, the second liver showed no evidence of mild ischemic changes during perfusion. At the end of a 30 minute perfusion the second liver looked grossly normal and appeared to be functioning, as evidenced by a darkening of the venous outflow blood compared to the arterial inflow blood in the two adjacent cannulas. Tissue sections from the livers were normal, but immunofluorescent stains showed IgM on endothelial cells. Serum samples showed a decrease in natural antibodies.

To promote long-term survival of the implanted organ through T-cell and B-cell mediated tolerance, donor bone marrow cells are administered to the recipient to form chimeric bone marrow. The presence of donor antigens in the bone marrow allows newly developing B cells, and newly sensitized T cells, to recognize antigens of the donor as self, and thereby induces tolerance for the implanted organ from the donor. To stabilize the donor BMC, donor stromal tissue, in the form of tissue slices of fetal liver, thymus, and/or fetal spleen are transplanted under the kidney capsule of the recipient. Stromal tissue is preferably implanted simultaneously with, or prior to, administration of hematopoietic stem cells, e.g., BMC, or a fetal liver cell suspension.

To follow chimerism, two color flow cytometry can be used. This assay uses monoclonal antibodies to distinguish between donor class I major histocompatibility antigens and leukocyte common antigens versus recipient class I major histocompatibility antigens. BMC can in turn be injected either simultaneously with, or preceding, organ transplant. Bone marrow is harvested and injected intravenously (7.5 x 10^/kg) as previously described (Pennington et al., 1988, Transplantation 45:21-26). Should natural antibodies be found to recur before tolerance is induced, and should these antibodies cause damage to the graft, the protocol can be modified to permit sufficient time following BMT for humoral tolerance to be established prior to organ grafting.

The approaches described above are designed to synergistically prevent the problem of transplant rejection. When a kidney is implanted into a cynomolgus monkey following liver absorption of natural antibodies, without use of bone marrow transplantation to induce tolerance, renal functions continued for 1-2 days before rejection of the kidney. When four steps of the procedure were performed (absorption of natural antibodies by liver perfusion, administration of ATG, sublethal irradiation and bone marrow infusion, followed by implant of a porcine kidney into a primate recipient), the kidney survived 7 days before rejection. Despite rejection of the transplanted organ, the recipient remained healthy.

When swine fetal liver and thymic stromal tissue were implanted under the kidney capsule of two sublethally irradiated SCID mice, 25-50% of peripheral blood leukocytes were of donor lineage two weeks post-transplantation. A significant degree of chimerism was not detected in a third animal receiving fetal liver without thymus. These procedures did not employ any chemical immunosuppressants.

Transformation of bone marrow cells

Genes, e.g., MHC genes, genes encoding receptors for growth factors specific to the recipient, or genes encoding donor cytokines, can be introduced into bone marrow cells by any methods which allows expression of these genes at a level and for a period sufficient to confer tolerance or to improve engraftment, hematopoietic activity, or repopulation. These methods include e.g., transfection, electroporation, particle gun bombardment, and transduction by viral vectors, e.g., by retroviruses.

Recombinant retroviruses are a preferred delivery system. They have been developed extensively over the past few years as vehicles for gene transfer, see e.g., Eglitis et al., 1988, Adv. Exp. Med. Biol. 241 :19. The most straightforward retroviral vector construct is one in which the structural genes of the virus are replaced by a single gene which is then transcribed under the control of regulatory elements contained in the viral long terminal repeat (LTR). A variety of single-gene- vector backbones have been used, including the Moloney murine leukemia virus (MoMuLV). Retroviral vectors which permit multiple insertions of different genes such as a gene for a selectable marker and a second gene of interest, under the control of an internal promoter can be derived from this type of backbone, see e.g., Gilboa, 1988, Adv. Exp. Med. Biol. 249:29.

The elements of the construction of vectors for the expression of a protein product, e.g., the choice of promoters is known to those skilled in the art. The most efficient expression from retroviral vectors is observed when "strong" promoters are used to control transcription, such as the SV 40 promoter or LTR promoters, reviewed in Chang et al., 1989, Int. J. Cell Cloning 2:264. These promoters are constitutive and do not generally permit tissue-specific expression. However, in the case of class I genes, which are normally expressed in all tissues, ubiquitous expression is acceptable for functional purposes. Housekeeping gene promoters, e.g., the thymidine kinase promoter, are appropriate promoters for the expression of class II genes.

The use of efficient packaging cell lines can increase both the efficiency and the spectrum of infectivity of the produced recombinant virions, see miller, 1990, Human Gene Therapy 1:5. Murine retroviral vectors have been useful for transferring genes efficiently into murine embryonic, see e.g., Wagner et al., 1985, EMBO J. 4:663; Griedley et al., 1987 Trends Genet. 1:162, and hematopoietic stem cells, see e.g., Lemischka et al., 1986, Cell 45:917-927; Dick et al, 1986, Trends in Genetics 2:165-170.

A recent improvement in retroviral technology which permits attainment of much higher viral titers than were previously possible involves amplification by consecutive transfer between ecotropic and amphotrophic packaging cell lines, the so-called "ping-pong" method, see e.g., Kozak et al., 1990, J. Virol. 64:3500-3508; Bodine et al., 1989, Prog. Clin Biol. Res. 112:589-600.

Transduction efficiencies can be enhanced by pre-selection of infected marrow prior to introduction into recipients, enriching for those bone marrow cells expressing high levels of the selectable gene, see e.g., Dick et al., 1985, Cell 42:71-79; Keller et al., 1985, Nature 118:149-154. In addition, recent techniques for increasing viral titers permit the use of virus- containing supernatants rather than direct incubation with virus-producing cell lines to attain efficient transduction, see e.g., Bodine et al., 1989, Prog. Clin Biol. Res. 319:589-600. Because replication of cellular DNA is required for integration of retroviral vectors into the host genome, it may be desirable to increase the frequency at which target stem cells which are actively cycling e.g., by inducing target cells to divide by treatment in vitro with growth factors, see e.g., Lemischka et al., 1986, Cell 45:917-927, a combination of IL-3 and IL-6 apparently being the most efficacious, see e.g., Bodine et al., 1989, Proc. Natl. Acad. Sci. 8^:8897-8901, or to expose the recipient to 5-fluorouracil, see e.g., Mori et al., 1984, Jpn. J. Clin. Oncol. 14 Suppl 1:457-463, prior to marrow harvest, see e.g., Lemischka et al., 1986 Cell 45:917-927; Chang et al, 1989, Int. J. Cell Cloning 2:264-280.

N2A or other Moloney-based vectors are preferred retroviral vectors for transducing human bone marrow cells.

Example 1 : Sustained expression of a swine class II gene in murine bone marrow hematopoietic cells by retroviral-mediated gene transfer

Overview The efficacy of a gene transfer approach to the induction of transplantation tolerance in miniature swine model was shown by using double-copy retroviral vectors engineered to express a drug-resistance marker (neomycin) and a swine class II DRB cDNA. Infectious particles containing these vectors were produced at a titer of >1 x 10^ G418- resistant colony-forming units/ml using both ecotropic and amphotropic packaging cell lines. Flow cytometric analysis of DRA-transfected murine fibroblasts subsequently transduced with virus-containing supernatants demonstrated that the transferred sequences were sufficient to produce DR surface expression. Cocultivation of murine bone marrow with high-titer producer lines leads to the transduction of 40% of granulocyte/macrophage colony- forming units (CFU-GM) as determined by the frequency of colony formation under G418 selection. After nearly 5 weeks in long-term bone marrow culture, virus-exposed marrow still contained G418-resistant CFU-GM at a frequency of 25%. In addition, virtually all of the transduced and selected colonies contained DRB-specific transcripts. These results show that a significant proportion of very primitive myelopoietic precursor cells can be transduced with the DRB recombinant vector and that vector sequences are expressed in the differentiated progeny of these cells. These experiments are described in detail below.

Construction and Screening of SLA-DRB Recombinant Retroviruses

As in man, Lee et al., 1982, Nature 229:750-752, Das et al., 1983, Proc. Natl. Acad. Sci. USA £03543-3547, the sequence of the swine DRA gene is minimally polymorphic. Therefore, transduction of allogeneic DRB cDNAs into bone marrow cells should be sufficient to allow expression of allogeneic class II DR molecules on cells committed to express this antigen.

Details of retroviral constructs are given in Fig. 1. Two types of retroviral constructs, GS4.4 and GS4.5, were prepared. The diagram in Fig. 1 depicts the Gs4.5 retroviral construct. The arrows in Fig. 1 indicate the directions of transcription. In GS4.5, the orientation of DRB cDNA transcription is the same as viral transcription. In GS4.4 (not shown), the TK promoter and the DRB cDNA were inserted into the 3' LTR of N2A in the reverse orientation of transcription with respect to viral transcription and the simian virus 40 3' RNA processing signal was added. pBSt refers to Bluescript vector sequence (Stratagene). The thymidine kinase (TK) promoter was contained within the 215-base-pair (bp) Pvu II-Pst I fragment from the herpes simplex virus TK gene, McKnight, 1980 Nucleic Acids Res. :5949-5964. The simian virus 40 3' RNA processing signal was contained within the 142- bp Hpa I-Sma I fragment from the pBLCAT3 plasmid, Luckow et al., (1987) Nucleic Acids Res. 15:5490-5497, (see Fig. 1). Sequence analysis of the junctions of the promoter, the class II cDNA, and the vector sequences confirmed that the elements of the constructs were properly ligated.

These retroviral constructs were transfected into the amphotrophic packaging cell line PA317, and transfectants were selected in G418-containing medium. A total of 24 and 36 clones, transfected, respectively, with the GS4.4 and GS4.5 recombinant plasmids, were tested by PEG precipitation of culture supernatants and slot-blot analysis of viral RNA. Of these, 8 and 12 clones were found, respectively, to be positive for DRB, although the DRB signal was consistently weaker for the GS4.4-derived clones. Analysis of genomic and spliced transcripts from GS4.5 cells by dot-blot analysis of PEG-precipitated particles revealed heterogeneity among viral transcripts in various clones transfected by GS4.5. In one experiment, two clones contained DRB⁺/Neo⁺ viral RNA, two contained DRB⁺/Neo" RNA, two contained DRB7Neo⁺ RNA, and one showed no class II or Neo signal. G418-resistance (G418^1") titer determination of supernatants from DRB-positive clones confirmed that the average titer produced by GS4.5-tansfected clones (lO^-lO⁴ CFU/ml) was significantly higher than that of the GS4.4- transfected clones (lO^-lO^ CFU/ml). Further transduction experiments were, therefore, conducted with the best clone, named GS4.5 C4, which produced an initial G418^r titer of 3 x 10⁴ CFU/ml.

Plasmid preparation, cloning procedures, DNA sequencing, RNA preparations, Northern blots, and RNA slot blots were performed by standard methods, Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual 2nd Ed. (Cold Spring Harbor Lab., Cold Spring Harbor). Final Washes of blots were carried out in 0.1 x SSPE (1 x SSPE = 0.18 M NaCl/10 mM sodium phosphate, pH 7.5/1 mM EDTA) at 60°C for 30 min.

The packaging cell lines PA317, Miller et al, 1986, Mol Cell Biol. 6:2895-2902, GP+E-86, Markowitz et al., 1988, J Virol 6.2:1120-1124, psiCRIP, Danos et al., 1988, Proc. Natl. Acad. Sci USA 85:6460-6464, and their derivatives were maintained at 37°C in Dulbecco's modified Eagle's medium (DMEM; GIBCO) with 10% (vol/vol) fetal bovine serum (CELLect Silver; Flow Laboratories) supplemented with 0.1 mM nonessential amino acids (Whittaker Bioproducts), antibiotics penicillin (5 units/ml), and streptomycin (5 μg/ml).

Improvement of the Viral Titer of the C4 Clone Since recent data indicated that the supernatants containing high retroviral titers were the best candidates for transducing bone marrow cells, Bodine et al., 1990, Proc. Natl. Acad. Sci USA 2:3738-3742, the titer of the C4 producer clone was increased by "ping-pong" amplification, Bestwick et al., 1988, Proc. Natl Acad. Sci. USA £5:5404-5408. Supernatant from nearly confluent C4 cultures was used to transduce GP+E-86 ecotropic packaging cells and G418 selection was applied. Forty-eight clones were isolated and screened by PEG precipitation for production of viral particles. Supernatants from 18 of these clones were DRB-positive by dot-blot analysis of viral Ran and had G418^r titers between 0.5 and 3.5 x 10⁴ CFU/ml). One positive clone was then amplified by the ping-pong technique with the amphotropic hygromycin-resistant packaging line psiCRIP. Supernatants from 48 hygromycin-resistant clones were examined for presence of DRB-positive viral RNA by PEG precipitation and their G418^r titers were determined. All of the clones were positive by dot- blot analysis with the DRB probes and produced titers between 1 x 10^ and 1 x 10⁷ CFU/ml. Amphotropic clone GS4.5 A4, which produced highest titer, was tested for the presence of helper virus by the S + L-assay. No replication-competent helper virus was detected.

Amplification of virus titer was achieved by the ping-pong technique. Since there is evidence that psiCRIP packaging cells are less prone to produce helper virus than PA317 when using certain types of vectors, Miller, 1990, Hum. Gene Therapy 1:5-14, DRB recombinant virions were prepared using the psiCRIP/ GP-E-86 producer combination. Titer values > 1 x 10⁷ CFU/ml with no detectable amphotropic helper viruses were obtained, confirming that this strategy produced safe viral particles suitable for in vivo experiments.

Northern blot analysis of GS4.5-producing clones C4, A9 and A4, each derived form a different packaging cell line, showed a conserved hybridization pattern. RNA species corresponding to the full-length viral genome, the spliced Neo transcript, and the DRB transcription unit were observed with additional RNA species. High molecular size species observed in these experiments may constitute a read-through transcript starting from the TK promoter and ending in the other long terminal repeat (LTR). In contrast to many of the virion-producer clones obtained by transfection that presented erratic DRB transcripts, those obtained by transduction showed stable DRB hybridization patterns suggesting that no recombination events occurred during the amplification procedure.

Retroviral titers were determined as follows. Replication-defective retroviral particles were produced from packaging cell lines initially transfected with recombinant construct using the standard calcium phosphate precipitation method, Wigler et al., 1978, Cell 14:725- 733. Retrovirus production was estimated by the drug-resistance titer (G418-resistant colony-forming units/ml, CFU/ml) as described, Bodine et al., 1990, Proc. Natl. Acad. Sci.

USA 82:3738-3742. Except for the psiCRIP line, G418 (GIBCO) selection was carried out in active component at 500 μg/ml for 10-12 days. Replication-competent helper virus titer was assayed on PG4 feline cells by the S+L" method, Bassen et al., \91\, Nature 229:564-566. PEG precipitation of viral particles was performed as follows. Virions contained in 1 ml of culture supernatant were precipitated with 0.5ml of 30% (wt/vol) polyethylene glycol (PEG) for 30 min. at 4°C. After centrifugation, the pellets were treated with a mixture of RNase inhibitors (vanadyl ribonuclease complex, BRL), phenol/chloroform-extracted, and ethanol-precipitated. Pellets were then resuspended in 15.7% (vol/vol) formaldehyde and serial dilutions were dotted onto nitrocellulose membrane.

Analysis of DRB Transcription in Packaging Cell

To test for accurate transcription of the introduced DRB cDNA within the different producer clones, Northern blots containing RNAs isolated from these clones were hybridized with the DRB and Neo probes. Fig. 2 depicts the structure of the provirus genome and the expected sizes of transcripts initiated from either the viral LTR or the TK promoters. Each of the three GS4.5-containing clones, which were derived from PA317 (clone C4), GP + E-86 (clone A9), and psiCRIP (clone A4) cells, showed DRB-positive transcripts. As reported, Hantzopoulos et al., 1989, Proc. Natl. Acad. Sci. USA £6:3519-3523, the unspliced genomic RNA (band a) and the spliced Neo transcript (band b) were observed. In addition, a transcript uniquely hybridizable with the DRB probe was detected that corresponds to the size predicted (1700 bases, band c) for the DRB cDNA transcription unit

Surface Expression of the SLA-DR Antigen on Transduced Fibroblasts

An in vitro assay was developed to examine surface expression of the SLA-DR antigen on murine fibroblasts. Flow cytometry (FCM) profiled shown in Fig. 3 demonstrate that G418^r titers of 3 x 10⁴ (clone C4) were sufficient to promote expression of the DR antigen on the cell surface of transduced DRA transfectants. In Fig. 3 solid lines indicate DR cell surface expression (anti-DR antibody binding) (22% and 75% of the bulk population of cells 3 days after transduction with GS4.5 C4, (B) and GS4.5 A4 (C), respectively); dashed lines indicate anti-mouse class I antibody binding (positive control); dotted lines indicate anti-pig CD8 antibody binding (negative control). Twenty-two percent of the bulk population of transduced cells were DR-positive and subclones maintained class II expression for more than 5 months. The increase in titer (clone A4) correlated with an increase in the number cells transduced (75% of the transduced population was DR-positive) and with the brightness of the DR signal.

The class II transduction assay was performed as diagrammed in Fig. 4. NIH 3T3 cells were transfected with the SLA-DRA ^" cDNA inserted in a plasmid expression vector, Okayama et al., 1982, Mol Cell Biol. 2:161-170. Approximately 3 x 10⁴ cells of a stable DRa transfectant (clone 11/12.2F) that expressed a high level of DRA mRNA were then transduced overnight with 1 ml of DRB-containing retroviral supernatant. Cells were subsequently cultivated in fresh DMEM supplemented with 10% fetal bovine serum and antibiotics for 2 additional days and examined for cell surface expression of the DR antigen by FCM analysis.

The class II transduction assay described here provides a fast and simple method to test both expression and functional titer of retroviral of retroviral constructs. By using cells transfected with DRA, the need for lengthy double selection after transduction by two separated vectors, Yang et al., 1987, Mol. Cell Biol. 2:3923-3928; 2154, is obviated. Cell- surface expression of DR heterodimers was demonstrated by FCM analysis 3 days after sequences were sufficient to produce significant level of DR β chain. More importantly, this test allows determination of "functional" titers based on the expression of the gene of interest rather than on that of the independently regulated drug-resistance marker.

The SLA-DRB probe was an EcoRI cDNA fragment containing the complete coding sequence of the DR β chain, Gustafsson et al., 1990, Proc. Natl. Acad. Sci USA £2:9798- 9802. The neomycin phosphotransferase gene (Neo) probe was the Bel I-Xho I fragment of the N2A retroviral plasmid, Hantzopoulos et al., Proc. Natl. Acad. Sci. USA 86:3519-3523.

Expression of Porcine DRB cDNA Transduced into Murine Bone Marrow Progenitor Cells The efficacy with which myeloid clonogenic precursors were transduced was determined by assaying for CFU-GM with and without a selecting amount of G418 after exposure of bone marrow cells to GS4.5-derived virions. Comparison of the number of colonies that formed in the presence and absence of the drug, for two experiments, indicated that s 0% of the initial population of myeloid progenitor cells were transduced. The frequency of G418^r CFU-GM was again determined after a sample of the transduced marrow was expanded under long-term culture conditions for 33 days. Twenty-five percent of the progenitors present after 33 days in culture still gave rise to colonies under G418 selection. Colonies of cells arisen from CFU-GM were examined for the presence of DRB-specific transcripts by converting RNA into cDNA and then performing PCR amplification as described herein and in Shafer et al, 1991 Proc. Natl. Acad. Sci USA ££:9670. A 360-bp DRB-specific product was detected in five of six G418-selected colonies from freshly transduced marrow, whereas all six colonies similarly derived from transduced progenitors present after 33 days in culture were positive. An additional band of 100 bp observed in some of the samples probably reflects the stochastic nature of nonspecific priming events. DRB-specific transcripts were also detected in the bulk population of drug-resistant colonies and in producer cells but were not detected in controls such as a bulk population of untransduced colonies, fibroblasts used to provide carrier RNA, and a bulk population of transduced colonies processed as above but without reverse transcriptase. These latter data demonstrate that the PCR signal was dependent on the synthesis of cDNA, excluding the possibility that provirus, rather than viral message, was responsible for the amplified fragment.

Recent improvements including modifications of the virus design, increase of viral titers, use of growth factors to stimulate precursor cells, and selection of stem cells prior to transduction have been shown to improve long-term expression of transduced genes in the hematopoietic compartment, Bodine et al., 1990 Proc. Natl. Acad. Sci USA £2:3738-3742; Bodine et al., 1989, Proc. Natl. Acad. Sci USA £6:8897-8901; Wilson et al., 1990, Proc. Natl. Acad. Sci USA £2:439-443; Kang et al., 1990, Proc. Natl. Acad. Sci USA £2:9803-9807; Bender et al., 1989, Mol Cell. Biol. 2:1426-1434. The experiments herein show the applicability of the retroviral gene-transfer technique in achieving expression of maj or histocompatibility complex class II genes transferred into hematopoietic cells. To determine the efficiency with which developmentally primitive hematopoietic cells were transduced, the frequency of G416^r CFU-GM was assessed after expanding infected marrow cells kept for 33 days in long-term cultures. Expression of the exogenous DRB cDNA was also monitored in cells derived from transduced CFU-GM present either immediately after infection or after an extended culture period. Virtually all of the colonies individually tested were positive for DRB-specific transcript, suggesting that the DRB recombinant vector is suitable for expression in murine hematopoietic cells.

Bone marrow cells were obtained from the femora of 6- to 12-week old female C57BL/10 mice and were prepared as described, Ildstad et al., 1984, Nature 102:168-170.

Methylcellulose colony assays for granulocyte/macrophage colony-forming units (CFU-GM), Eaves et al., 1978, Blood 52:1196-1210, were performed as described using 5% (vol/vol) murine interleukin 3 culture supplement (Collaborative Research). Long-term Dexter-type bone marrow cultures were initiated in 60-mm culture dishes with 2 x 1 nucleated cells, Eaves et al., 1987, CRC Crit. Rev. Oncol. Hematol. 2: 125-138.

Bone marrow cells were transduced essentially as described, Bodine et al., 1989, Proc. Natl. Acad. Sci. USA £6:8897-8901. Briefly, bone marrow was harvested for 6- 12- week old female C57BL/10 donors that had been treated 2 days with 5-fluorouracil (150 mg/kg). Prestimulation was performed by incubating 1 x 10^ cells per ml for 2 days in long- term Dexter -type bone marrow culture medium to which was added 7.5% interleukin 6 (200 units/ml; gift from J. Jule National Institutes of Health, Bethesda, MD). Marrow cells were transduced for 48 hr by adding 5 x 10^ cells per 10-cm plate containing nearly confluent virus-producers, Polybrene (8 mg/ml), and the cytokines described above.

Detection of DRB-Specific Transcripts in CFU-Derived Colonies was performed as follows. Cells corresponding to individual CFU colonies and to colonies present on an entire plate (bulk) were first extracted from methylcellulose cultures by dilution in phosphate- buffered saline and centrifugation. These cells were then combined with 1 x 10" NIH 3T3 cells (to provide carrier RNA), and total RNA was prepared using the guanidine isothiocyanate/CsCl method. First-strand cDNA was prepared fro 20 μg of total RNA using the Invitrogen Red Module Kit. cDNA was then subjected to 50 cycles of PCR amplification in the presence of the SLA DRB-specific oligonucleotides 04 (5' - CCACAGGCCTGATCCCTAATGG) (SEQ ID NO.: 1) and 17 (5' - AGCATAGCAGGAGCCTTCTCATG) (SEQ ID NO.: 2) using the Cetus GenAmp kit as recommended (Perkin-Elmer/Cettis). Reaction products were visualized after electrophoresis on a 3% NuSieve agarose gel (FMC) by staining with ethidium bromide.

FCM analysis was performed with a FAC-SCAN II fluorescence-activated cell sorter

(Becton Dickenson) on cells stained with the anti-Dr monoclonal antibody 40D, Pierres et al.,

1980, Eur. J. Immunol. 10:950-957, an anti-H-2^d allo antiserum, or the anti-porcine CD8 monoclonal antibody 76-2-11, Pescovitz et al., 1985, J Exp. Med. 160:1495-1505, followed by fluorescein isothiocyanate-labeled goat anti-mouse antibodies (Boehringer Mannheim).

Example 2: Expression of Allogeneic Class II cDNA in Swine Bone Marrow Cells Transduced With A Recombinant Retrovirus A MHC gene (DRB) was transferred into clonogenic progenitor cells from swine using a recombinant retroviral vector (GS4.5) and a transduction protocol designed to be applicable in vivo. Both the selectable drug resistance gene and the allogeneic class II cDNA transferred by this vector were expressed in the progeny of these transduced progenitors. Expression of the Neo gene was monitored functionally by colony formation under G418 selection, while the presence of class II transcripts was detected by PCR analysis. With this latter method, the transcriptional expression of both endogenous and virally derived DRB genes in transduced and selected colonies were demonstrated.

Primary porcine fibroblasts were cultured with high titer viral supernatants, and then analyzed by northern blotting using probes specific for DRB and Neo. A specific transcript was observed which was uniquely hybridizable with the DRB probe and migrated at the position predicted (1700 bases) for the DRB cDNA transcription unit arising from the TK promoter and terminating at the LTR 3' RNA processing site.

To determine whether GS4.5 containing virions could transduce swine myelopoietic progenitor cells a colony assay adapted for swine CFU-GM was used. Transductions were carried out by incubating bone marrow from a donor of the SLA^C haplotype in high titer viral supernatant. Comparisons of the number of colonies which formed in the presence and absence of G418 for a total of 5 independent experiments indicated that 5% to 14% of CFU- GM were transduced.

Colonies of cells originating from transduced CFU-GM were examined for the presence of DRB-specific transcripts by converting RNA into cD A, and then performing PCR amplification. Utilizing a polymorphic Sau3 Al restriction site absent from the endogenous DRB^C gene, the presence of DRB^d-specific transcripts was unambiguously demonstrated. Gel electrophoresis of the PCR product demonstrated. Gel electrophoresis of the PCR product demonstrated that a 183/177 bp doublet indicative of the vector-derived DRB^d transcript was amplified in samples derived not only from pools of transduced and selected CFU-GM progeny, but also from at least 4 out of 6 individual colonies tested. A 360 bp PCR fragment, indicative of endogenous DRB^C transcripts, was also amplified not only as expected from PBL isolated from an SLA^C donor, but also from both of the pooled colony samples and a number of the individual colony samples.

Construction of the retrovirus GS4.5, and production of high titer viral supernatants was as described above. Detection of DRB-specific transcripts in CFU-derived colonies by PCR of cDNA were described above and as follows. Bone marrow from an SLA^C donor was exposed to GS4.5- containing virions, and G418 selected colonies were tested for the presence of DRB^C (endogenous) and DRB^d (vector derived) specific transcripts by PCR of cDNA followed by digestion with Sau3AI and agarose gel electrophoresis. Controls were as follows: template synthesized either in the presence or absence of reverse transcriptase; template derived from cells producing GS4.5-containing virions, from PBL isolated from SLA^C or SLA^d donors, and from untransduced producer cells used as carrier RNA. Transduction of bone marrow was performed as follows. Swine bone marrow was harvested as previously described (Pennington et al., 1988, Transplantation 45:21-26) and transductions were carried out by incubating marrow cells in high titer viral supernatants at an m.o.i. or 3-5 in the presence of 8 μg of polybrene per ml at 37°C for 5 hr. Myeloid progenitors were assayed by colony formation in methylcellulose cultures using PHA- stimulated swine lymphocyte conditioned medium as a source of growth factors. Selective medium contained 1.2 mg/ml active G418.

Transduced bone marrow was administered to a lethally irradiated miniature swine. At 5 weeks peripheral blood lymphocytes were analyzed by Southern, northern, and cell- surface FACS analyses. By all of these test there was evidence of presence of the transduced allogeneic class II gene in these cells and for expression of the product of this gene. In particular, northern analysis showed bands characteristic of the transcribed cDNA, and FACS analysis with a combination of alloantisera and monoclonal antibodies to DR showed presence of the transduced allele of DR beta on the surface of peripheral lymphocytes.

Example 3: Allogeneic Tolerance

Development of the B10.MBR - B10.AKM Strain Combination In an attempt to maintain strains which are truly congenic for the MHC, a program of continuous backcrossing of each congenic line to a common background partner strain was instituted more than 15 years ago. Backcross animals were intercrossed and appropriate progeny selected by serologic typing in order to reestablish each congenic line. Thus, C57BL/10 was used as one reference background strain and all other congenic lines on the BIO background were backcrossed once every six to ten generations to this C57BL/10 line. During the backcrossing of each congenic line to its pedigreed reference line, there is of course the chance for an intra-MHC recombination event to occur. Typing of the intercross (F2) generation serologically reveals such recombinant events, and when the recombinant provides a new haplotype of potential interest for genetic studies, it is outcrossed and then intercrossed to produce a homozygous new recombinant H-2 haplotype. One of the most valuable of such recombinants originating in this colony is the B10.MBR line, Sachs et al., 1979, J Immunol. 121:1965-1969, which was derived from a recombination event during the backcrossing of BIO. AKM to C57BL/10. Because this strain was the first to separate K^ from I* it has been used extensively in studies of H-2 immunogenetics. In addition, in combination with the parental B 10. AKM strain, the B 10.MBR offers the possibility of examining an isolated K gene as the only MHC difference between two strains. Thus, as illustrated in Fig. 5, introduction of the K^ gene into the BIO. AKM bone marrow stem cells, could theoretically lead to expression of all cell surface MHC antigens of the B10.MBR. Expression on bone marrow derived cell populations produces transplantation tolerance to the product of the transduced gene, and this tolerance can be tested by a tissue graft from the B10.MBR strain.

Reconstitution of Myeloablated Mice With Transduced Bone Marrow Eighty prospective donor BIO. AKM mice were treated with 150 mg/kg 5FU on day - 7. Bone marrow was harvested from these mice on day -5, treated with anti-CD4 and anti- CD8 monoclonal antibodies (mAbs) plus complement to remove mature T cells, and cultured for five days with N2-B19-H2b virus-containing supernatant (H2) from the psi-Crip packaging cell line. As a control, one-half of the marrow was cultivated with supernatant from control packaging cells not containing N2-B19-H2b (A2). On day zero, 45 BIO. AKM recipients received 10 Gy total body irradiation (TBI), followed by administration of various concentrations of cultured bone marrow cells (A2 or H2).

Kb expression

On day 13 several animals receiving the lowest doses of cultured bone marrow were sacrificed and individual spleen colonies were harvested and analyzed by PCR for the presence of N2-B19-H2b DNA. In addition, spleen cell suspensions were prepared and analyzed for cell surface expression of K^ by flow microfluorometry on a fluorescence- activated cell sorter (FACS). FACS analyses indicated that all animals receiving the H2- treated marrow showed some level of K^ expression above control straining with the non- reactive antibody. The results are shown in Fig. 6 which is a FACS profile of spleen cells from a recipient of transduced bone marrow: A=Anti K^b antibody; B=control antibody. Spleen cells from recipients of non-transduced marrow were also negative. In addition, the PCR analysis showed every colony examined to contain the transduced DNA. Animals were thereafter followed by FACS and PCR on peripheral blood lymphocytes (PBL). On day 28 and again on day 40, PCR analyses were positive. However, FACS analysis for cell-surface expression was variable, with PBL from most H2 animals showing only a slight shift of the entire peak for straining with anti-K^b, as compared to PBL from A2 animals stained with the same antibody, or as compared to PBL from H2 animals stained with the non-reactive HOPC antibody.

Allogeneic grafts

On day 40 skin from B10.MBR (K^b specific) and B10.BR (control, third party class I disparate) donors was grafted onto all animals. Graft survivals were scored daily by a blinded observer (i.e., readings were made without knowledge of which graft was from which donor strain) until rejection was complete. The survival times are shown in Fig. 7, and indicate marked specific prolongation of survival of the B10.MBR skin grafts on the recipients of K^b-transduced BMC (Fig 7B), but not on recipients of control marrow (Fig. 7A). One of the animals with a long-standing intact B10.MBR skin graft was sacrificed at day 114 and cell suspensions of its lymphoid tissues were examined by FACS and compared to similar suspensions of cells from an animals which had rejected its B10.MBR skin graft. A striking difference was noted in staining of thymus cells with an anti-K^b mAb. Cell suspensions were prepared and stained either with the anti-K" mAb 28-8-6 or the control antibody HOPC1. A subpopulation of thymus cells from the tolerant animal showed a marked shift toward increased staining with 28-8-6 compared to HOPC1, while there was essentially no change in the staining pattern of thymocytes from the animal which had lost its graft. Fig. 8 shows FACS analysis of thymocytes from skin graft rejector (Fig. 8A, B) and skin graft acceptor (Fig. 8C, D). Staining with control HOPC1 antibody (Fig. 8A, C) and with specific anti-K^b antibody (Fig. 8B, D). A similar comparison of staining patterns on bone marrow cells showed the presence of low level K^b expression on a cell population in the marrow of the tolerant mouse, but not of the mouse which had rejected its skin graft. These results indicate that a pluripotent stem cell or early progenitor cell population expressed K^b in the tolerant mouse but not in the rejector mouse, and that this BMC stem cell provided a continuous source of K^b antigen in the thymus on cells which are critical for the inactivation of developing thymocytes with K^b -reactive TCR. It is of interest to note that K^b expression was not detected on splenocytes of the tolerant mouse, and that, in general, splenocyte expression did not correlate with skin graft tolerance. Since the spleen contains T cells which mature in the thymus, these results suggest that either thymocytes lose expression of K^b as they mature, or that the K^b-bearing thymocytes of this animal were cells of a non- lymphoid lineage, such as macrophages.

Long-term expression

As discussed above, the BIO. AKM and B10.MBR congenic mouse strains are identical except in the MHC class I region. A recombinant retrovirus containing the class I gene from the B10.MBR strain rH-2K^b) linked to a B19 parvovirus promoter (B19-H K^b) and a neomycin resistance (neo¹^) gene was introduced into BIO. AKM (H-2K^b) marrow cells. As a control, a recombinant retrovirus containing only the neo^r gene was introduced into BIO. AKM marrow cells. The transduced marrow was injected into lethally irradiated AKM recipients pre-treated with an anti-CD8 monoclonal antibody. Twelve weeks post BMT, quantitative PCR was used to show that the B19-H-2K^b proviral sequences were present in 5%-30% of peripheral blood cells in all recipient animals. Reverse transcriptase PCR was used to demonstrate the B19-H-2K^b mRNA in RNA isolated from bone marrow and spleen of a subset of recipient animals.

Construction of the Kb-Retroviral Vector

The retroviral vectors used the Moloney murine leukemia virus based vector N2, Armenian et al., 1987, J. Viral. 62:1647-1650. The coding regions within this virus were deleted during its construction, and replaced with the selectable marker gene, neomycin phosphotransferase (Neo), which is transcribed from the viral LTR promoter, and provides drug resistance to G418. The conventional N2 virus was then further modified by insertion of a parvovirus-derived promoter, B 19, Liu et al., 1991 , J Virol. (In Press) , downstream from Neo, followed by 1.6 Kb of cDNA coding for the class I antigen H-2K to form the new recombinant virus N2-B19-H2B. Fig. 9 depicts the N2-B19-H26 retroviral vector: P=PstI; X=XhoI; H=HinDIII; E=EcoRI; B=BamHI. This latter cDNA was derived by Waneck et al. during the construction of an H-2^b cDNA library for other purposes, Waneck et al., 1987, J Exp. Med. 165:1358-1370.

Viral producer cell lines were developed using the packaging cell lines fro amphotropic (psi-Crip), Danos et al., 1988, Proc. Natl. Acad. Sci. £5:6460-6464, and ecotropic (psi-2), Sambrook et al., 1989, Molecular cloning: A laboratory manual. Cold

Spring Harbor Laboratory Press, Cold Spring Harbor, viral production. These cell lines have been specially designed to produce structural viral proteins for the recombinant defective virus to be produced. Viral production was achieved by transfecting psi-Crip with N2-B19- H2b. Both amphotropic and ecotropic producer cell lines were then co-cultivated allowing multiple integration events and high expression [i.e. the "ping-pong" technique see Bestwick et al., 1988 Proc. Natl. Acad. Sci. £5:5405-5408]. In this technique, co-cultivation overcomes viral antigen receptor blockage by endogenously secreted proteins since amphotropic and ecotropic viruses recognize different receptors. Ecotropic psi-2 viral producer clones were then selected which produced titers of G418 resistance on 3T3 cells of greater than 10⁷ cfu/ml.

In order to ensure that K^b was being expressed from the recombinant virus, transduced 3T3 cells were stained with a monoclonal antibody specific to this antigen and analyzed by flow microfluorometry. These experiments clearly demonstrated high level expression of virally derived K^b. Animals and husbandry were as follows. The B10.BMR strain, [Sachs et al., 1979, J Immunol. 121:1965-1969, was provided to the Jackson Laboratory, Bar Harbor, ME about 6 years ago, and specific pathogen-free stock animals of this strain are now available from that source. Upon arrival in animals should be transferred to autoclaved microisolator cages containing autoclaved feed and autoclaved acidified drinking water. Sterile animal handling procedures which are effective in maintaining animals free of pathogens so that interpretable survival studies can be performed should be used.

Bone marrow transplantation was performed as follows. Techniques for bone marrow transplantation in mice are known to those skilled in the art, see e.g., Sykes et al., 1988, J. Immunol. 140:2093-2911. Briefly, recipient BlO.Akm mice aged 12 to 16 weeks are lethally irradiated (1025R, 137Cs source, 1 lOR/min) and reconstituted within 8 hours with 2.6x10^ bone marrow cells, obtained from the tibiae and femora of sex-matched donors aged 6-14 weeks. Animals are housed in sterilized microisolator cages, and receive autoclaved food and autoclaved acidified drinking water. For these studies some modifications of this general technique are required, since the syngeneic bone marrow will have been transduced with an allogeneic gene, and since the bone marrow will come from FU-treated mice, which should have lower total cell counts but higher stem cell content than normal mice. The protocol is therefore as follows:

1. Donors will be treated with 5-Fluorouracil, 150 mg/kg iv. on day -7 in order to induce pluripotent stem cell to cycle.

2. Marrow will be harvested from donors on day -5, and T cell depleted with mAbs and complement.

3. Marrow will than be cultured for 5 days in supernatant from an ecotropic packaging cell line (B17H2Kb-18) which produces a high titer of non-infectious retroviral particles containing the K^b gene (see below). IL-3 and IL-6 will be added to the cultures.

4. On day 0, recipient B10.AKM mice will be lethally irradiated (10.25 Gy), and will be reconstituted with 2.5x10^ BMC transduced with the K^b gene. Control animals will be similarly treated, except that they will receive marrow exposed to supernatant from a similar ecotropic packaging line not exposed to a K^D-containing vector. The recipient may also be pre-treated with anti-CD8 monoclonal antibody. The recipient may also be pre-treated with anti-CD8 monoclonal antibody.

Cellular and serological assays are performed as follows.

Anti-class I Cell-Mediated Lympholysis (CML) Assay: Spleens are removed from BMT recipients and normal mice, red cells are lysed using ACK buffer, and a single cell suspension is prepared. Cells are filtered through 100-mesh nylon, washed, and resuspended at 4xlθ6/ml in complete medium consisting of RPM 1640 with 10% fetal calf serum, 0.025mM 2-mercaptoethanol, .01M Hepes buffer, .09mM nonessential amino acids, ImM sodium pyruvate, 2mM glutamine, lOOU/ml penicillin and 100 μg/ml streptomycin. 90 μl of responder cells are added to Costar 96- well round-bottomed plates along with irradiated (30 Gy) stimulator splenocytes. Cultures are set up in two rows of 3 replicates each, and after 5 days of incubation in 6% CO2 at 37°C, twofold serial dilutions are prepared from the second row of triplicates, so that cytolytic capacity can be examined at a total of 5 different responder :target ratios, ^lcr-labelled 2-day concanavalin A-induced lymphoblasts are then added at 10⁴ blasts per well and incubated for 4 hr at 37°C, 6% CO2. Plates are harvested using the Titertek supernatant collection system (Skatron, Inc., Sterling, VA) and 51Q- release is determined using an automated gamma counter. Cytolytic capacity is measured directly in the original cell culture plated, so that the measurement is based on the number of live cells present at the end of the 5-day incubation period. This methodology has been developed and used successfully in this laboratory for several years for analysis of spleen cell responses from individual animals [Sykes, M., et al., 1988 J. Immunol. 140:2903-2911]. Percent specific lysis is calculated using the formula:

% Specific Lysis = Experimental release - Spontaneous release X 100% Maximum release - Spontaneous release

Limiting dilution analyses: Responder and stimulator (6x10^, 30 Gy irradiated) cells are cocultured for 7 days in complete medium containing 13% TCGF (lectin-inactivated splenocytes) in 96-well plates. Wells containing 10⁵ (24 wells), 3x10⁴ (30 wells), 3000 (30 wells), 1000 (30 wells), 300 (30 wells), and 100 (30 wells) responder cells are prepared.

Three thousand ^lCr-labelled con A blasts are added to each well on day 7, and 4 hour 51 - release is measured. Wells are considered positive if 51Cr release is 3 standard deviations greater than the mean 51Q- release in 24 wells containing stimulator cells only plus similar numbers of target cells. The Poisson distribution is used to determine the frequency of precursor CTL's which recognize each target, and statistical analysis is performed by the CHI square method of Taswell, Taswell, 1981, J Immunol. 126:1614.

Flow microfluorometry: One-color and two color flow cytometry will be performed, and percentages of cells expressing a particular phenotype will be determined from 2- color data, as previously described in detail Sykes, 1990, J. Immunol. 145:3209-3215. The Lysis II software program (Becton Dickinson) will be used for distinguishing granulocytes from lymphocytes by gating on the basis of forward angle and 90° light scatter. Cell sorting will be performed on a Coulter Epics Elite cell sorter. Cell suspensions for flow cytometry: PBL, BMC thymocyte, splenocyte, and lymph node suspensions will be prepared as previously described, Sykes, M. et al., 1988, J. Immunol. 140:2903-2911; Sykes, M. 1990, J. Immunol. 145:3209-3215; Sharabi, Y. et al., 1990, J. Exp. Med. 172:195-202. Whole peripheral white blood cell suspensions (including granulocytes) will be prepared by centrifugation of heparinized blood for 2 minutes at 14,000 RPM in an Eppendorf centrifuge, followed by aspiration of the buffy coat layer. These cells will be transferred to a 15 ml. conical tube and washed. Red blood cells (RBC) contaminating the remaining pellet will be lysed by exposure for 5 seconds to 4.5 ml of distilled H2O followed by rescue with 0.5 ml of lOx PBS. Cell staining: One-color and two-color staining will be performed as we have previously described, Sykes, M., 1990, J Immunol. 145:3209-3215; Sykes et al., 1988, J. Immunol. 141:2282-2288. Culture supernatant of rat anti-mouse RcτR mAb 2.4G2,

Unkeless, J.C., 1979, J Exp. Med. 150:580-596, will be used for blocking of non-specific staining due to FcτR binding, whenever only direct staining is used. The following mAbs are sued: biotinylated murine K^b-specific IgG2_a mAb 28-8-6, Ozato et al., 1981, J. Immunol. 126:317-321, and control murine IgG2_a mAb HOPC1 (with ^no known specific binding to murine antigens) are prepared by purification on a protein A-Sepharose column, and are biotinylated by standard procedures used in out laboratory: rat anti-MACl mAb Ml/70, Springer et al, 1979, Eur. J. Immunol. 2:301, is used as culture supernatant, and will be stained by mouse anti-rat IgG-specific mAb MAR18.5; FITC-labelled rat-anti-mouse granulocyte antibody Grl is purchased from Pharmingen; FITC-labeled rat-anti-mouse IgM mAb is purchased from Zymed; FITC-labeled rant-anti-mouse Thy 1.2 mAb will be purchased from Becton-Dickinson; FITC-labeled mouse-anti-human CD# mAb Leu4 (Becton Dickenson) is used as a directly FITC labeled negative control antibody.

Thymic tissue immunofluorescense: The tissue is incubated in LI 5 medium for 24 hours to reduce background staining, and is then cut and embedded in O.C.T. compound for freezing in Isopentane. Frozen sections are prepared (thickness 4 μm) on a cryostat, dried, fixed in acetone, then washed in PBS. The first antibody incubation (with 28-8-6) is performed in the presence of 2% normal mouse serum, in order to saturate Fc receptors. After 45 minutes, the slides are washed 4 times, and FITC-conjugated secondary reagent (monoclonal rat-anti-mouse IgG2a-FITC, purchased from Pandex) is added. After 43 minutes' incubation with the secondary reagent, four washes are performed and the tissue is mounted. Sections are examined under a fluorescence microscope by an observer who is unaware of the group of animals from which the tissue was obtained.

Bone Marrow Manipulations and Assays were performed as follows: Transduction of murine bone marrow stem cells: The methodology used for transduction of bone marrow cells has been described previously, Karlsson et al., 1988, Proc. Natl. Acad. Sci. £5:6062-6066. Bone marrow is harvested from 6-12 week old female B10. AKM donors treated 2 days previously with 150 mg/kg 5-FU. Following T cell depletion (see above), the marrow is divided and 10⁷ cells per 10 cm plate are cultured for 5 days in the presence of 8 μg of Polybrene per ml, 10% FCS, 0.6% IL-3-containing supernatant, 0.6% IL-6-containing supernatant, and fresh supernatants from B19H2K^b or N2 cells. IL-3- and IL-6-containing supernatant is 48 hour supernatant of COS 7 cells transfected with the murine rIL-3 gene-containing plasmid pCD-IL-3 or with the murine rlL- 6 gene-containing plasmid PCD-IL-6, respectively (both plasmids provided by DR. Frank Lee, DNAX Corp.). IL-3 -containing supernatants are tittered by testing proliferation of the IL-3-dependent line TI 165 as the indicator cell line. We will also test the effect of murine SCF on bone marrow transduction, as recently described, Zsebo et al., 1990, Cell 23: 125-201.

The virus-containing supernatants are refreshed on a daily basis by harvesting the non-adherent layer of each plate, pelleting the cells, and resuspending in freshly harvested filtered virus-containing B19H2K^b or N2 supernatant with additives. After 5 days, the non- adherent and adherent BMC are harvested, washed, and resuspended at 2.5x1 O^/ml in Medium 199 with Hepes buffer and Gentamycin plus Heparin 10 U/Ml. One ml of this suspension is injected i.f. to irradiated mice.

Murine CFU-GM assay: To test for the bone marrow progenitor cells known as CFU- GM (colony forming unit-granulocyte/macrophage), bone marrow cells are suspended in plating medium consisting of IMDM medium containing 30% defined fetal bovine serum (FBS) (HyClone, Logan, UT), 10"⁴ M β-mercaptoethanol, antibiotics, 5% v/v murine 11-3 culture supplement (Collaborative Research Inc., Bedford, MA) and 0.8% methylcellulose (achieved by adding 36% b/b of a commercially prepared solution purchased from the Terry Fox Laboratory, Vancouver). 1.1 ml of this suspension is then dispensed into 35 mm tissue culture plates (in duplicate), and placed in a 37°C incubator. The resulting CFU-GM derived colonies are enumerated microscopically after 5-7 days. Transduced CFU-GM are selected by including 0.9 μg/ml active G418 in the culture medium. The transduction frequency is then determined by the ratio of CFU-GM which form colonies in the presence and in the absence of the drug.

Molecular methods were as follows:

Construction of N2-B19-H2b vector: This vector was constructed staring from the original retroviral vector N2, Eglitis et al., 1985, Science 210:1395-1398, as modified by Shimada to include an additional BamHI site immediately 3' of the Xhol site. It includes the K^b cDNA previously cloned in the vector pBG367, as described by G. Waneck, Waneck et al., 1987, J Exp. Med. 165:1358-1370. This gene has been placed under control of the B19 promoter, a highly efficient parvo virus derived promoter, Liu et al., 1991, J. Virol. [In Press:] to produce the N2-B19-H2b construct.

Southern blot analysis can be performed on DNA extracted from PBL, thymocyte, BMC, splenocyte or lymph node cell suspensions using standard methods, Ausubel et al., 1989, Current protocols in molecular biology. John Wiley & Sons, New York, and probing will be performed with the fragment of K^b cDNA released from pBG367 by EcoRI. The genomic DNA will be cut with enzymes capable of distinguishing the transduced K^b from other class I genes of the B10. AKM strain. From known sequences it would appear that EcoRI may be satisfactory for this purpose, since it should liberate a 1.6 kb band from the transduced K^b cDNA, which is distinct from both the expected endogenous K^ and D^Q class I bands of B10.AKM, Arnold et al., 1984, Nucl. Acids Res. 12:9473-9485; Lee et al., J. Exp. Med. 168:1719-1739. However, to assure that there is no confusion with bands liberated from other class I and class I-like genes we will test several enzymes first on DNA from BIO. AKM and choose appropriate restriction enzyme combinations.

PCR analysis of DNA can be performed using primers previously shown to be effective in our preliminary studies (see Fig. 4): 5' primer 5'-GGCCCACACTCGCTGAGGTATTTCGTC-3' (covers 5' end of αl exon) (Seq. ID No. 3)

3* primer: 5'GCCAGAGATCACCTGAATAGTGTGA-3' (covers 5' end of α2 exon) (Seq. ID No. 4)

DNA is subjected to 25 cycles of PCR amplification using these specific oligonucleotides and the Cetus GeneAmp kit (Perkin Elmer Cetus, Norwalk, CT) according to the manufacturer's directions. In addition, β2]pdCrp will be included in the PCR reaction in order to visualize products by autoradiography following electrophoresis.

RNA can be isolated from 5x10" to 5xl0⁷ cells using the guanidine isothiocyanate and CsCl methods, Chirgwin et al., 1979, Biochem. JL£:529405308, wand will be used for northern analyses, RNase protection analyses, and for PCR analyses of products formed by reverse transcriptase. For situations in which less then 5x10" cells are available, for example following tail bleedings of individual mice, we will utilize the QuickPrep mRNA Purification Kit (Amgen) as a miniaturized RNA preparation procedure.

Northern analyses can be carried out using standard methods, Ausubel et al., 1989, Current protocols in molecular biology John Wiley & Sons, New York, and the same K^b cDNA-derived probe. Vector-derived K^b mRNA is larger than endogenous class I transcripts (2.5 kb vs. 1.6 kb) due to the inclusion of vector sequences between the 3' end of the cDNA and the poly-adenylation site in the viral 3' LTR. It should therefore be easy to distinguish the vector-derive K^b mRNA from endogenous transcripts that might cross-hybridize with a K^b mRNA from endogenous transcripts that might cross-hybridize with a K^b cDNA probe. We will also utilize probes derived from unique non-K^b sequences of the transcript (e.g., from B19 or N2 derived vector sequences).

RNAse protection analyses are more sensitive than standard blots, yet still quantitative. Procedures based on published methods, Sambrook et al., 1989, Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, will be used to derive riboprobes. Briefly, the K^b cDNA will be cloned into a plasmid vector containing the T3 and T7 RNA polymerase promoter sequences (bluescript or Bluescribe plasmids from Stratagene). Using appropriate polymerase and 32p. nucleotides, transcription of the insert will be initiated and the radioactive K^b RNA will be purified. This probe followed by treatment with ribonuclease. Presence of RNA will be assessed by electrophoresis on a sequencing gel.

PCR following reverse transcriptase treatment of RNA will be used as a highly sensitive procedure for detecting the K^b transcript. Appropriate primers will be designed in order to specifically amplify retroviral derived transcripts (one primer covering the 5'UT region of the construct and a second derived from the cDNA sequence). Briefly, RNA will be prepared from 5 μg of total RNA using the Superscript preamplification system (BRL/Life Technologies, Inc., Gaithersburg, MD).. PCR amplifications will be conducted for 50 cycles, Hansen et al., J. Immunol. 118:1403-1408. using the Cetus GeneAmp Kit (Perkin Elmer Cetus, Norwalk, CT). Reaction products will be visualized following electrophoresis on a 3% NuSieve agarose gel (FMC BioProducts, Rockland, ME).

Other Embodiments

Other embodiments are within the following claims. For example, implanted grafts may consist of organs such as liver, kidney, heart; body parts such as bone or skeletal matrix; tissue such as skin, intestines, endocrine glands; or progenitor stem cells of various types.

The methods of the invention may be employed with other mammalian recipients (e.g., rhesus monkeys, humans) and may use other mammalian donors (e.g., primates, swine, sheep, dogs).

The methods of the invention may be employed in combination, as described, or in part.

The method of introducing bone marrow cells may be altered, particularly by (1) increasing the time interval between injecting hematopoietic stem cells and implanting the graft; (2) increasing or decreasing the amount of hematopoietic stem cells injected; (3) varying the number of hematopoietic stem cell injections; (4) varying the method of delivery of hematopoietic stem cells; (5) varying the tissue source of hematopoietic stem cells, e.g., a fetal liver cell suspension may be used; or (6) varying the donor source of hematopoietic stem cells. Although hematopoietic stem cells derived from the graft donor are preferable, hematopoietic stem cells may be obtained from other individuals or species, or from genetically-engineered inbred donor strains, or from in vitro cell culture.

Methods of preparing the recipient for transplant of hematopoietic stem cells may be varied. For instance, the recipient may undergo a splenectomy or a thymectomy. The latter would preferably by administered prior to the nonmyeloablative regimen, e.g., at day -14. Hemoperfusion of natural antibodies may: (1) make use of other vascular organs, e.g., liver, kidney, intestines; (2) make use of multiple sequential organs; (3) vary the length of time each organ is perfused; (4) vary the donor of the perfused organ. Irradiation of the recipient may make use of: (1) varying the absorbed dose of whole body radiation below the sublethal range; (2) targeting different body parts (e.g., thymus, spleen); (3) varying the rate of irradiation (e.g., 10 rads/min, 15 rads/min); or (4) varying the time interval between irradiation and transplant of hematopoietic stem cells; any time interval between 1 and 14 days can be used, and certain advantages may flow from use of a time interval of 4-7 days. Antibodies introduced prior to hematopoietic cell transplant may be varied by: (1) using monoclonal antibodies to T cell subsets or NK cells (e.g., anti-NKHlA- as described by United States Patent No. 4,772,552 to Hercend, et al., hereby incorporated by reference); (2) preparing anti-human ATG in other mammalian hosts (e.g., monkey, pig, rabbit, dog); or (3) using anti-monkey ATG prepared in any of the above mentioned hosts. As an alternative or adjunct to hemoperfusion, host antibodies can be depleted by administration of an excess of hematopoietic cells.

Stromal tissue introduced prior to hematopoietic cell transplant, e.g., BMT, may be varied by: (1) administering the fetal liver and thymus tissue as a fluid cell suspension; (2) administering fetal liver or thymus stromal tissue but not both; (3) placing a stromal implant into other encapsulated, well-vascularized sites; or (4) using adult thymus or fetal spleen as a source of stromal tissue.

Other methods for the induction of tolerance, the reconstitution of an animal's immune system, the repopulation of an animal's hematopoietic system, or the induction of stem cell chimerism can be combined with the methods described herein. For example, methods described herein can be combined with one or more of the methods described in: Sachs, USSN 08/126,122, filed September 23, 1993, entitled "Specific Tolerance in

Transplantation" (which, inter alia, describes methods of inducing tolerance to transplanted tissues with genetically engineered stem cells), hereby incorporated by reference; Sachs et al., USSN 07/838,595, filed February 19, 1992, entitled "Induced Tolerance to Xenografts" (which describes, inter alia, methods of inducing tolerance to tissues by stem cell transplantation), hereby incorporated by reference; Sachs, USSN 08/129,608, filed September 29, 1993 entitled "T Cell Help Deficiency Induced Tolerance" (which describes, inter alia, methods of inducing tolerance to foreign antigens), hereby incorporated by reference; Sykes, USSN 08/062,946, filed May 17, 1993, entitled "Xenograft Thymus" (which discloses, inter alia, methods of reconstituting an animal's immune system), hereby incorporated by reference; Sachs et al., USSN 08/114,072, filed August 30, 1993, entitled "Interleukin- 10 and Immunosuppression" (which discloses, inter alia, the sequence of swine interleukin- 10 and methods of its use), hereby incorporated by reference.

The sequence of swine interleukin- 10 is shown in Fig. 10 (SEQ ID NO:5). Other embodiments are within the following claims. What is claimed is: SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANTS:

(A) NAME: The General Hospital Corporation

(B) STREET: 55 Fruit Street

(C) CITY: Boston (D) STATE: Massachusetts

(E) COUNTRY: USA

(F) POSTAL CODE (ZIP) : 02114

(G) TELEPHONE: (617) 726-8608 (H) TELEFAX: (617) 726-1668

(ii) TITLE OF INVENTION: Hematopoietic Stem Cells from Swine

Cord Blood and Uses Thereof

(iii) NUMBER OF SEQUENCES: 5

(iv) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: ASCII

(v) CURRENT APPLICATION DATA:

(A) APPLICATION NO. PCT/US94/

(vi) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: US 08/150,739

(B) FILING DATE: 10-NOV-1993

(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: US 07/838,595

(B) FILING DATE: 19-FEB-1992

(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: US 07/817,761

(B) FILING DATE: 8-JAN-1992

(C) CLASSIFICATION:

(ix) ATTORNEY/AGENT INFORMATION:

(A) NAME: Paul Louis Myers

(B) REGISTRATION NUMBER: 35,965 (C) REFERENCE/DOCKET NUMBER: MGP-022PC

(x) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: (617) 227-7400

(B) TELEFAX: (617) 227-5941

(2) INFORMATION FOR SEQ ID NO:l: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 22 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

CCACAGGCCT GATCCCTAAT GG 22

(2) INFORMATION FOR SEQ ID NO:2 :

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2 : AGCATAGCAG GAGCCTTCTC ATG 23

(2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: GGCCCACACT CGCTGAGGTA TTTCGTC 27

(2) INFORMATION FOR SEQ ID N0:4:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 base pairs (B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: GCCAGAGATC ACCTGAATAG TGTGA 25 (2) INFORMATION FOR SEQ ID NO:5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1365 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

GGCACGAGCA GGGGCTTGCC CTTGCAAAAC CAAACCACAA GTCCGACTCA ACGAAGAAGG 60 CACAGCTCTA CC ATG CCC AGC TCA GCA CTG CTC TAT TGC CTG ATC TTC 108

Met Pro Ser Ser Ala Leu Leu Tyr Cys Leu lie Phe 1 5 10

CTG GCA GGG GTG GCA GCC AGC ATT AAG TCT GAG AAC AGC TGC ATC CAC 156 Leu Ala Gly Val Ala Ala Ser lie Lys Ser Glu Asn Ser Cys lie His 15 20 25

TTC CCA ACC AGC CTG CCC CAC ATG CTC CGG GAA CTC CGA GCT GCC TTC 204

Phe Pro Thr Ser Leu Pro His Met Leu Arg Glu Leu Arg Ala Ala Phe 30 35 40

GGC CCA GTG AAG AGT TTC TTT CAA ACG AAG GAC CAG ATG GGC GAC TTG 252

Gly Pro Val Lys Ser Phe Phe Gin Thr Lys Asp Gin Met Gly Asp Leu 45 50 55 60

TTG CTG ACC GGG TCT CAG CTG GAG GAC TTT AAG GGT TAC CTG GGT TGC 300

Leu Leu Thr Gly Ser Gin Leu Glu Asp Phe Lys Gly Tyr Leu Gly Cys 65 70 75 CAA GCC TTG TCA GAG ATG ATC CAG TTT TAC CTG GAA GAC GTA ATG CCG 348

Gin Ala Leu Ser Glu Met lie Gin Phe Tyr Leu Glu Asp Val Met Pro 80 85 90

AAG GCA GAG AGT GAT GGG GAG GAT ATC AAG GAG CAC GTG AAC TCC CTG 396 Lys Ala Glu Ser Asp Gly Glu Asp lie Lys Glu His Val Asn Ser Leu 95 100 105

GGG GAG AAG CTG AAG ACC CTC AGG CTG AGG CTG CGG CGC TGT CAT CAA 444

Gly Glu Lys Leu Lys Thr Leu Arg Leu Arg Leu Arg Arg Cys His Gin 110 115 120

TTT CTG CCC TGT GAA AAC AAG AGC AAG GCC GTG GAG GAG GTG AAG AGT 492

Phe Leu Pro Cys Glu Asn Lys Ser Lys Ala Val Glu Glu Val Lys Ser 125 130 135 140

GCC TTT AGC AAG CTC CAA GAG AGG GGT CTC TAC AAA GCC ATG GGT GAG 540

Ala Phe Ser Lys Leu Gin Glu Arg Gly Leu Tyr Lys Ala Met Gly Glu 145 150 155 TTT GAC ATC TTC ATC AAC TAC ATA GAA GCC TAC ATG ACG ATG AAG ATG 588

Phe Asp lie Phe lie Asn Tyr lie Glu Ala Tyr Met Thr Met Lys Met 160 165 170

AGG AAG AAC TGAAGCATTC TAGGGAAACC AAAGAAAAAC CTTCCAGGAT 637 Arg Lys Asn 175

GACGACTCTA CTAAACTCTA GGATACAAAT TGGAGACTTT CAAAATCTGC TCCAAGGTTC 697

CCGGGGAGCA GAACCAGCAC CCTGGGAAAC CCTGCTGTAC CTCTCCCCTG AGATATTTAT 757

TACCTCTGAT ACCTCAGCTC CCATTTCTAT TTATTTACCG AGCCTCTCTG TGAACTATTT 817 AGAAGAAGAA CAGTATTATA CTTTTTTCAG TATTTATTAT TTTCACCTGT GTTTAAGCTT 877

TCCATAGGGT GTGCCCTATG GTGTTCAACT GTTTTAAGAG AAATTGTAAG TTATATAAGG 937

GGGGAAAAAA TGTTCCTTCA GGAGCCAACT GCAGCTTCCA TTCCAAGCCT ACCCACCCGG 997

GAAAGCTAGT GGGCTATTTG TCCTGACTGC CTCCCACTTT CTCTTGTCCC TGGGCTGGGG 1057

CTTCCGGAGT GTGACAAAGT CGTTTACACT CATAGGAAGA GAAACTAGGG AGCCCCTTTG 1117 ACAGCTAATA TTCCGGTGGC CCTGAGGGAT TCCCCTGACC TCATTCCCCA AACACTTCAT 1177

TCTTGAAAGC TGTGGCCAGC TTGTTATTTA AAACAACCTA AAATTGGTTC TAATAGAACT 1237

CGGTTTTAAC TAGAAGCAAT TCAATTCCTC TGGGAATGTT ACATTGTTTG TCTGTCTTCA 1297

TAGCAGATTT TAATTTTGAA TAAATAAATG GTCTTATTCA AAAAAAAAAA AAAAAAAAAA 1357

AAAAAAAA 1365

Claims

1. A method of purifying hematopoietic stem cells from s ine cord blood, said method comprising: collecting swine cord blood; and isolating said hematopoietic stem cells from at least one other component of the swine cord blood.

2. The method of claim 1, wherein said hematopoietic stem cells are purified by density gradient centrifugation.

3. The method of claim 1 , wherein said hematopoietic cells are purified using a chromatographic technique.

4. The method of claim 3 , wherein said chromatographic technique is an immunoaffinity chromatographic technique.

5. The method of claim 1, wherein said at least one other component of the swine cord blood comprises red blood cells.

6. The method of claim 5, wherein said swine hematopoietic stem cells are purified from said red blood cells by hypotonically lysing said red blood cells.

7. Hematopoietic stem cells purified from swine cord blood according to the method of claim 1.

8. Hematopoietic stem cells from swine cord blood, said cells being substantially free of red blood cells.

9. A method of inducing tolerance in a recipient mammal of a first species to a xenograft obtained from a swine, said method comprising: prior to or simultaneous with transplantation of said xenograft, introducing into the recipient mammal swine cord blood hematopoietic stem cells; and prior to introducing said swine hematopoietic stem cells into said mammal, inhibiting or preventing natural killer cell-mediated rejection of said xenograft.

10. The method of claim 9, wherein the inhibition or prevention of natural killer cell-mediated rejection of said xenograft is accomplished by introducing an antibody capable of binding to natural killer cells of said recipient mammal into said recipient mammal.

11. The method of claim 9, wherein the swine cord blood hematopoietic stem cells express growth factor receptors specific for growth factors produced by the recipient mammal.

12. The method of claim 9, wherein the swine cord blood hematopoietic stem cells express swine cytokines.

13. The method of claim 9, further comprising, introducing into the recipient mammal swine-specific stromal tissue.

14. The method of claim 9, further comprising, prior to swine cord blood hematopoietic stem cell transplantation, introducing into the recipient mammal an antibody capable of binding to mature T cells of said recipient mammal.

15. The method of claim 9, further comprising the step prior to hematopoietic stem cell transplantation, irradiating the recipient mammal with low dose whole body irradiation.

16. The method of claim 9, further comprising the step prior to hematopoietic stem cell transplantation, irradiating the recipient mammal with thymic irradiation.

17. The method of claim 9, further comprising the step prior to bone marrow transplantation, absorbing natural antibodies from the blood of said recipient mammal.

18. A method of inducing tolerance in a recipient primate of a first species to a xenograft obtained from a swine, said method comprising: introducing into the recipient primate swine-specific stromal tissue; introducing into the recipient primate hematopoietic stem cells from swine cord blood; and inhibiting or preventing natural killer cell-mediated rejection of said graft.

19. The method of claim 18, wherein said swine cord blood hematopoietic stem cells express growth factor receptors specific for growth factors produced by the recipient primate.

20. The method of claim 18, wherein said swine cord blood hematopoietic stem cells express a swine cytokine

21. A method of inducing tolerance in a recipient primate of a first species to a xenograft obtained from a swine, said method comprising: introducing into the recipient primate donor swine-specific hematopoietic stromal tissue, introducing into the recipient primate swine cord blood hematopoietic stem cells; and introducing into said recipient primate a xenograft obtained from said mammal, wherein said xenograft is obtained from a different organ than said swine hematopoietic stem cells.

22. The method of claim 21 , wherein said recipient primate is a human and said swine cord blood hematopoietic stem cells express a growth factor receptor specific for a human growth factor.

23. The method of claim 21 , wherein said swine cord blood hematopoietic stem cells express a swine cytokine.

24. The method of claim 21 , wherein said primate is a human.

25. A method of inducing tolerance in a recipient primate of a first species to a graft obtained from a swine, said method comprising: introducing into the recipient primate donor swine-specific hematopoietic stromal tissue; introducing into the recipient primate hematopoietic stem cells from swine cord blood; and introducing into said recipient primate a graft obtained from said swine.

26. A method of promoting repopulation of bone marrow of a recipient mammal with hematopoietic stem cells from swine cord blood, said method comprising: introducing hematopoietic stem cells from swine cord blood into a recipient mammal such that said hematopoietic stem cells promote repopulation of the bone marrow of said recipient mammal.

27. A method of promoting the engraftment and hematopoietic activity of a hematopoietic stem cell from swine cord blood in a recipient mammal, said method comprising: inserting DNA encoding a growth factor receptor specific for a recipient mammal growth factor into a hematopoietic stem cell from swine cord blood; and introducing said hematopoietic stem cell containing said DNA into a recipient mammal which produces a growth factor specific for said growth factor receptor.

28. The method of claim 27, wherein said recipient mammal is a human and said growth factor receptor is a human growth factor receptor.

29. The method of claim 26, wherein said human growth factor receptor is selected from the group consisting of interleukin-3 receptor, granulocyte-macrophage colony stimulating factor receptor, stem cell factor receptor, and leukemia inhibitory factor receptor.

30. A method of promoting the engraftment and hematopoietic activity of a hematopoietic stem cell from swine cord blood in a recipient mammal, said method comprising: inserting DNA encoding a swine cytokine into swine cord blood hematopoietic stem cell from swine cord blood which expresses a receptor for said swine cytokine; and introducing said swine blood cord blood hematopoietic stem cells containing said DNA into a recipient mammal such that said hematopoietic stem cell expresses said DNA.

31. The method of claim 30, wherein said swine cytokine is selected from the group consisting of swine interleukin- 10, swine analog of human interleukin-3, swine analog of human granulocyte-macrophage colony stimulating factor, swine analog of human stem cell factor, and swine analog of human leukemia inhibitory factor. .

32. Hematopoietic stem cells from swine cord blood which express a human growth factor receptor.

33. Hematopoietic stem cells from swine cord blood which express swine cytokine receptors and which express a swine cytokine specific for said cytokine receptors.