WO1995011981A1

WO1995011981A1 - Cultivation process and constructs for use therein

Info

Publication number: WO1995011981A1
Application number: PCT/AU1994/000628
Authority: WO
Inventors: Gang Ping Xue
Original assignee: Commonwealth Scientific And Industrial Research Organisation
Priority date: 1993-10-26
Filing date: 1994-10-17
Publication date: 1995-05-04

Abstract

A cultivation process including steps (i) recombinant E. coli cells which include a promoter coupled to a gene which encodes a recombinant protein wherein said promoter is normally inducible by IPTG in a cultivation vessel during a growth phase at temperatures from room temperature to 32 °C wherein the recombinant protein is (a) expressed at a low level and (b) is substantially non-toxic to E. coli whereby inclusion bodies are not formed in step (ii) hereinafter; and (ii) initiating an induction phase by application of heat to the cultivation vessel in step (i) so as to enhance the level of production of the recombinant protein.

Description

TITLE "CULTIVATION PROCESS AND CONSTRUCTS FOR USE THEREIN"

FIELD OF INVENTION THIS INVENTION relates to a cultivation process and in particular a fermentation process for the production of recombinant proteins and in particular enzymes from continuous propagation of recombinant or transformed E. coli cells in a suitable cultivation vessel such as a bioreactor. The invention also provides constructs for use in the cultivation process .

BACKGROUND ART A conventional fermentation process for the production of recombinant enzymes from recombinant or transformed E. coli cells harbouring an expression plasmid involves three stages - ie. (i) preparation of inocula wherein a recombinant E. coli culture is added to a fermentation broth wherein the broth may be incubated in a cultivation vessel preferably at relatively low temperatures (e.g. 30-32°C) for a considerable period of time (e.g. 7-10 hours), (ii) inoculating a fermenter with the inoculum obtained from the cultivation medium in step (i), (iii) maintaining the fermentation through a growth cycle where the fermentation is carried out aerobically under continuous aeration or agitation and (iv) initiation of an induction cycle by addition of an inducer such as isopropyl thiogalactoside (IPTG). Addition of the inducer means that expression of the recombinant protein can be greatly increased by the "switching on" of an IPTG inducible promoter (e.g. lacz or tac promoters) incorporated in the transformed E. col i cells while maintaining the fermentation temperature at 30-37°C during the induction cycle. In an alternative conventional fermentation process use was made of promoters such as ΛP, or ΛP_K coupled to a recombinant protein which may be induced or "switched on" to initiate the induction cycle by a temperature shift such as by elevating the temperature to 42°C to initiate the induction cycle.

A relevant reference in this regard is "Parameters Influencing the Productivity of Recombinant E. col i Cultivations" by Friehs and Reardon in Advances in Biochemical Engineering Technology Vol 48 Springer Verlag (1991 ). This reference points out that the synthesis of a protein starts with the promoter which initiates transcription and thus is a rate limiting process for mRNA synthesis. Comparisons of more than 100 promoters of E. col i have shown that there are two regions of conserved DNA sequences located 10 and 35 base pairs upstream from the transcription initiation site which strongly influence the strength of a promoter which in turn determines the rate of transcription initiation. [Hawley et al . (1983) Nuc. Acd Res. 11:2237].

Due to the importance of the promoter strength on the productivity of a recombinant cultivation, genetic engineering is widely used to enhance the strength. The sequence of well known promoters such as lac UV5 have been changed and the effects on promoter strength examined in Kobayashi et al . (1990) Nuc Acd Res 18:7367. New sequences are often tested in order to find especially strong promoters like λP, and ΛP_R from the bacteriophage lambda.

While it is important to use strong promoters in the production of recombinant proteins, regulation of these promoters is essential since constitutive overproduction of heterologous proteins leads to decreases in growth rate, plasmid stability and culture viability. Some promoters are regulated by the interaction of a repressor protein with the operator (a region downstream from the promoter). The most well known operators are those from the lac operon and from bacteriophage λ . An overview of regulated promoters in E. col i is provided in Table 1 of the aforementioned Friehs and Reardon reference. A major difference between typical bacterial cultivations and those involving recombinant E. coli is the technique of separating growth and production or induction phases. The method takes advantage of regulated promoters to achieve high cell densities in the growth phase (when the promoter is "off" and the metabolic burden on the host cell is slight) and then high rates of heterologous protein production in the induction phase (following induction to turn the promoter "on" ) .

For industrial bioprocesses low cost induction systems are desirable. Some processes have proven to be relatively expensive. For example, the widely used lac promoter system is induced with IPTG, an expensive compound.

The thermo-induction of λP_L and λP_R promoters for maximum production of recombinant protein usually requires a rapid rise of temperature of the culture from 28-30°C to 42°C, which is easy to achieve in a small scale of fermentation, but presents a problem in a large industrial scale. The temperature rise of a large volume of culture from 28-30°C to 42°C is difficult to achieve in a short time. Therefore, the potentially high yield of recombinant protein production achievable by the thermo-induction system based on the λP_L and λP_R promoters is difficult to obtain in a large scale fermentation. Furthermore, Brandes et al . (1993, Process Biochem. 28, 161-169) compared two expression systems, a thermo-induction system based on the AP_K promoter and a chemical-induction system based on the P_lΛr promoter. In a small-scale experiment using shake flasks or 1.5- litre stirred-tank reactors the yield of the recombinant protein with the thermo-induction system based on the λP_u promoter was 5 times higher than that of the chemical-induction system based on the P_LA(. promoter. In contrast, in an experiment using a 60- litre reactor, the yield of the recombinant protein with the heat-induced ΛP_R promoter was four times lower than that achieved with the IPTG-induced P_lAC promoter.

SUMMARY OF THE INVENTION It therefore is an object of the invention to provide a cultivation process which may at least to some extent ameliorate the disadvantages of the prior art discussed above.

The cultivation process of the invention includes the following steps:

(i) recombinant E. col i cells harbouring an expression plasmid which include a promoter coupled to a gene encoding a recombinant protein wherein said promoter is normally inducible by IPTG in a cultivation vessel during a growth phase at temperatures from room temperature to 32°C wherein the recombinant protein is (a) expressed at a low level and (b) is substantially non-toxic to E. col i whereby inclusion bodies are not formed in step (ii) hereinafter; and

(ii) initiating an induction phase by application of heat to the culture in step (i) so as to enhance the level of production of the recombinant protein.

In step (i) the recombinant E. col i cell may be suitably transformed by use of a plasmid containing the promoter coupled to the gene and this may be accomplished in any suitable manner. A suitable plasmid may be selected from pUC, pGEX, pBTac2 or any other plasmid which may function as an expression vector. Thus a synthetic construct may normally be made wherein the gene encoding the protein of interest coupled to an IPTG inducible promoter is inserted into a plasmid as described above by suitable techniques using restriction enzymes and oligonucleotide linkers.

The protein of interest is suitably an enzyme which may be a fibre degrading enzyme or lignocellulolytic enzyme inclusive of xylanases and cellulases which are preferably from a fungus of anaerobic origin as described in Patent Specification WO 93/25671 (ie PCT/AU93/00294 which subject matter is incorporated herein by reference). However it will be appreciated that the protein of interest is a non-toxic or substantially non-toxic protein to E. col i . Thus the protein can be any protein substantially non toxic to E. col i such as enzymes, hormones, antigens and antibodies which do not produce inclusion bodies during the heat induction phase.

The gene encoding the enzyme may then be coupled to a suitable promoter which is IPTG inducible. The coupling of the coding region sequence of a gene to the promoter may be accomplished in any suitable manner such as by ligation using an appropriate oligonucleotide.

Thereafter the coding region sequence of the gene and the promoter may be inserted into a suitable plasmid such as those described above.

Any suitable strain of E. col i may be used in the cultivation process inclusive of N4830-1 , pop2163, TAP56 or JM83.

The E. col i cells may then be transformed with the expression plasmid by any suitable transformation technique prior to the E. coli recombinant cells being subjected to the cultivation process described above. During the screening for transformants many isolates may be screened for clones with highest level of expression of the desired protein.

The growth stage of the cultivation process may be carried out at any appropriate temperature from room temperature up to 32°C. The temperature of 30- 32°C is preferred.

The induction stage in the absence of inducer may then take place over the range 40-42°C. Preferably in the cultivation process of the invention a suitable inoculum may be initially prepared by propagation of the recombinant E. col i cells in a suitable cultivation vessel at a temperature of 30-32°C and a time of around 6-10 hours. Subsequently the inoculum may be added to a fermentor having a suitable carbon source, nitrogen source, mineral salts and trace elements. For the industrial scale fermentation, cell density, glucose and acetic acid concentration may be monitored so as to ensure that the levels of glucose and acetic acid should be as low as possible during the fermentation.

The promoters used in the process of the invention are IPTG inducible and may be selected from lac series promoters such as lacZ, trc and tac . Examples of other IPTG inducible promoters are mentioned in the Friehs and Reardon reference discussed above.

DESCRIPTION OF THE PREFERRED EMBODIMENT Suitable constructs for use with the process of the invention include pASXP93.2 and pASXP93.4 which may be formed from a xylanase cDNA referred to hereinafter. Such a construct may be obtained by insertion of the xylanase cDNA into the pBTac, vector which is obtainable from Boehringer Mannheim. EXAMPLE 1

Construction of pASXP93.1 and PASXP93.2 pNPX30 plasmid (see Fig. 15) was isolated as described in Patent Specification WO 93/25671 and subsequently digested with Rsal and used as a DNA template for PCR amplification using two oligonucleotide primers (5'- CGGAATTCATGGCTAGCAATGGTAAAAAGTTTACTG and 5' - ATACGTAAGCTTAACGAGGAGCGGCAGAGGTGG) .

The first PCR amplified fragment after removal of the oligonucleotide primers was used as a DNA template for the second PCR amplification using two oligonucleotide primers

5'TAAGTTAACTTTAAGGAGGA(A/T)A(A/T)A(A/C)A(A/T)

ATGGCTAGCAATGGT and 5'-ATACGTAAGCTTAACGAGGAGCGGCAGAGGTGG) .

The PCR amplified fragments were incubated with T4 DNA polymerase to blunt the ends and ligated with Hpal-digested pPL-lambda vector (Pharmacia). The ligated DNA was transformed into E. col i strain Pop 2163 or TAP 56, plated on LB agar plates containing 0.1% xylan and grown at 30°C overnight and then at 42°C for 3-5 hours. About 500 transformants were screened for production of large xylan-clearing zones using a congo-red staining method (Teather and Wood, Applied and Environmental Microbiology 43, 777-780, 1982). Two clones, which consistently produced the largest size xylan-clearing zones after colony purifications and screening three times, were further characterised by restriction mapping and sequence data and designated as pASXP93.1 and pASXP93.2 as shown in Figures 1-2 and Figures 3-4, respectively. The restriction map of pASXP93.2 shows an unexpected pattern as it is different from the restriction pattern of pPL-lambda vector, but it is similar to pBTac2 vector. It is most likely that the pASXP93.2 plasmid was from contamination of the recombinant xylanase plasmid previously constructed in the pBTac2 vector. DNA sequencing confirmed that pASXP93.2 was the same construct as pNX-Tac previously described in Patent Specification WO 93/25671. EXAMPLE 2 Construction of PASXP93.3 pPL-lambda vector (Pharmacia) was digested with Sspl and religated to produce the pTL4.3 vector from which the pL promoter was removed.

The pTL4.3 vector was digested with BamHI and

Styl, blunt-ended with Klenow, and fractionated on

0.8% agarose gel. The 3.3Kb fragment was recovered from the gel and religated to produce the pTL3.3 vector.

The pTL3.3 vector was digested with Sspl and Seal and fractionated on 0.8% agarose gel for isolation of 3.0Kb fragment. The 3.0Kb fragment from the pTL3.3 vector was ligated with the 1.1Kb Seal and Sphl (blunted-ends) fragment containing pSCIOI Par element from pPL452 vector (from Dr Nick Dixon, Australian National University), which was digested with Seal and Sphl and blunt-ended with Klenow, to produce pTLp4.1. The sequence of pSC101 was reported by Miller e t al . , (Gene 24, 309-315, 1983) .

The pTLp4.1 vector was digested with Xhol , blunt- ended with Klenow and ligated with 1.2Kb HindiI I-BamHI fragment containing Λ.PL promoter, synthetic RBS and the genetically modified N. pa triciarum xylanase cDNA from pASXP93.1 which was digested with Hinlll and BamHI followed by Klenow treatment. The ligated DNA was transformed into E. coli strain Pop2163 or TAP56. Screening for xylanase-positive clones was described as above. The clone which produced the largest size xylanase-clearing zones was further characterised by restriction mapping and sequence data and designated as pASXP93.3 (Figures 5-6). EXAMPLE 3 Construction of PASXP93.4

The 0.95kb Sphl-Hindlll fragment (ends were blunted with Klenow) from pASXP93.2 containing the Tac promoter and modified N. pa tri ciarum xylanase cDNA was ligated with Xhol-digested pTLP4.1 (ends were blunted with Klenow). The ligated DNA was transformed into E. coli strain Pop2163. Xylanase-positive clones were screened as described above and characterised by restriction mapping and sequence data and designated as pASXP93.4 (Figures 7-8). All four constructs contain the same coding region sequence of the genetically modified N. pa triciarum xylanase cDNA. EXAMPLE 4

Construction of PNPCD2

The Pvull/Bglll fragment of N. pa tri ciarum cellulase cDNA ( celD) containing the sequence coding for the second catalytic domain and the partial sequence of the third catalytic domain (Xue e t al . , 1992, Journal of General Microbiology 138, 2397-2403) was cloned into the Smal site of pGEM-7Zf(+). The fragment coding for the partial sequence of the third catalytic domain was then deleted by Exonuclease III. The resulting plasmid, designated pCNP4. , contains the coding sequence of the catalytic domain II of celD. pCNP4.4 was digested with BamHI and Apal, followed by blunting ends using Klenow, and fractionated in an agarose gel. The 1.2kb BamHl/Apal fragment containing the celD domain II sequence was then ligated with the vector sequence of pASXP93.2 digested with Nhel and Hindlll (Nhel and Hindlll ends were blunted using Klenow). The resulting plasmid with the ..correct orientation of the coding sequence to the Tac promoter expresses a functional cellulase in E. coli designated pNPCD2 (FIG. 9). EXAMPLE 5

Construction of mutants of PASXP93.2 (this construct is the same as pNX-Tac described in PCT/AU93/00294) The N-terminal deletion mutant, pASXP93.2a plasmid, was generated from pNX-Tac by PCR-mediated m u t a g e n e s i s u s i n g a s e n s e ( 5'TATGGCTAGCCAACATAAGGGTGTCA) and an antisense primer (5'ATACGTAAGCTTAACGAGGAGCGGCAGAGGTGG) . The amplified DNA was digested with Nhel and Hindl l l and ligated into the vector sequence of pNX-Tac digested with Nhel and Hindll l . The resulting plasmid, pASXP93.2a, had a deletion of 12 amino acids from the fourth codon of the N-terminal coding sequence of pASXP93.2 xylanase (Fig. 10).

For construction of the pASXP93.2b plasmid, the pNX-Tac DNA was digested with Nhel , followed by filling-in and then digested with Hindl l l . The 0.7kb Nhel-Hindl l l fragment containing the xylanase cDNA was ligated with the pBTac2 vector previously digested with BamHI (the BamHI ends filled in) and Hindl l l . The resulting plasmid, pASXP93.2b, was a pASXP93.2 mutant with the addition of GAT as the second codon (Fig. 10).

The C-terminal deletion mutant, pASXP93.2c plasmid, was constructed by PCR- ediated mutagenesis u s i n g a s e n s e p r i m e r (5'CGGAATTCATGGCTAGCAATGGTAAAAAGTTTACTG) and an antisense primer ( 5' CGACAAGCTTAGGTGACATCAGCAAC) corresponding to the coding sequence of the pASXP93.2 xylanase upstream of the last 20 amino acids from the C-terminus. The amplified DNA was digested with EcoRI and Hindl l l and ligated into the vector sequence of pNX-Tac previously digested with EcoRI and Hindl l l . The resulting plasmid, pASXP93.2c, was a mutant of pASXP93.2 with a deletion of 20 amino acids from the C-terminus. EXAMPLE 6

Importance of modification of the N-terminal coding sequences in pASXP93.1. PASXP93.2, PASXP93.3 and PASXP93.4 xylanases for high-level expression in E. coli .

It has become increasingly apparent that the rate of translational initiation is not only dependent on the Shine-Dalgarno (SD) sequence and the optimal spacer sequence between SD and the translational initiation codon, but also heavily dependent on the N- ter inal coding sequence of the protein (de Boer and Hui, 1990 in Gene Expression Technology edited by Goeddel e t al . , pp . 1 03- 1 1 5 ) .

In an attempt to improve the expression level of the recombinant fungal xylanase in E. col i , the N- terminal coding sequence of the xylanase in pASXP93.1, pASXP93.2, pASXP93.3 and pASXP93.4 constructs was modified by addition of the sequence, 5'ATGGCTAGC, where the ATG serves as a translation initiation codon (see Figures 2, 4, 6 and 8). It is known that the sequence GCT is one of the most abundant second codons used in E. col i genes and can be used to enhance translation rates of some proteins if the addition of extra amino acid residues does not affect biological function of the protein of interest (Gold and Stor o, 1990 in Gene Expression Technology edited by Goeddel et al . , pp. 89-103) .

To test whether the N-terminal coding sequence or the preferred second codon of the currently modified xylanase favours high-level expression, we used the pASXP93.2 xylanase construct (this construct is the same construct as pNX-Tac described in PCT/AU93/00294 ) as a model. Two mutants (pASXP93.2a and pASXP93.2b) at the N-terminus of the pASXP93.2 xylanase were made (FIG. 10). In the pASXP93.2a construct, twelve amino acids, starting from the fourth codon at the N- terminus of the protein, were deleted. The pASXP93.2b mutant was constructed by utilisation of the second codon (GAT) provided in the pBTac2 vector instead of GCT which was used as the second codon in pASXP93.2. This mutation was used to test the effect of the second codon on the expression level of the Domain II xylanase. As shown in Fig. 11, the pASXP93.2 xylanase produced in E. col i strain XL1-Blue harbouring pASXP93.2 plasmid was expressed at a very high level under IPTG induction conditions, accounting for about 25% of total cellular protein, as analysed by gel scanning with a densitometer. A marked reduction (more than 5-fold reduction) in the expression level of xylanase was seen in both mutants (Fig. 11 ), while a deletion of 20 amino acids from the C-terminus of Domain II xylanase (pASXP93.2c) did not affect the expression level (Fig. 11 ). This confirms our assumption that the main factor governing the high- level expression of the Domain II xylanase is the presence of a favourable N-terminal sequence in the pASXP93.2 xylanase. It is well recognised that the efficiency of translation initiation of a mRNA can be dramatically influenced by the ability of the N- terminal coding sequence to form the secondary structure in the translation initiation region, since the secondary structure affects the accessibility of ribosomes to this region (Wikstrom et al . , 1992, J. Mol. Biol. 224, 949-966). It has been shown that there is an inverse correlation between the expression levels of several genes in E. col i and the degree of secondary structure of mRNAs present in the translational initiation region (Schauder and McCarthy, 1989, Gene 78, 59-72; de Smit and van Duin, 1990, Proc. Natl. Acad. Sci., USA 87, 7668-7672). Furthermore, the N-terminal coding sequence can influence gene expression independently of secondary structure effects (Tessier et al . , 1984, Nucl. Acids Res. 12, 7663-7675; de Boer and Hui, 1990, in Gene Expression Technology edited by Goeddel et al . , pp. 103-115). It is apparent from this experiment that the second codon (GCT) is the preferred codon, but is not adequate, for high-level expression of the Domain II xylanase. Obviously, the N-terminal sequence, other than the second codon, of the currently modified xylanase also plays a role in the high-level expression of this xylanase in E. col i .

When analysing the expression level of the Domain II xylanase construct, we also analysed the expression level of the Domain I construct, pNXS-Tac, described in PCT/AU93/00294. SDS-PAGE analysis revealed that the expression level of the xylanase in the pNXS-Tac construct was very low, as there was no protein band corresponding to the expected molecular mass of the Domain I xylanase (25.8kDa) visible in the gel (Fig. 12). The N-terminal coding sequence (within 15 amino acids) of the Domain II xylanase in pASXP93.1-4 constructs may be used to replace that of the catalytic domain I construct (pNXS-Tac described in Patent Specification PCT/AU93/00294) , which could result in enhanced expression of the Domain I xylanase in E. col i to a comparable level to the Domain II xylanase constructs as described herein. This assumption is supported by the following evidence: (1 ) the coding sequence of the xylanases described herein is highly homologous with that of pNXS-Tac (see Fig. 13); (2) the coding sequence difference between the Domain I and Domain II xylanases in these constructs is mainly located at the N-terminal and C- terminal coding sequences (Fig. 13) and (3) the C- terminal coding sequence of the Domain II xylanase did not influence its expression level, as demonstrated with the pASXP93.2c construct. EXAMPLE 7 The fermentation procedures for the production of the recombinant xylanase from pASXP93.1. PASXP93.2, PASXP93.3 and pASXP93.4 clones.

The E. col i harbouring pASXP93.1, pASXP93.2, pASXP93.3 and pASXP93.4 plas ids can be cultivated in any suitable media for ^* E. coli initially at 30°C (normally < 32°C) for the period of cell growth and then induced by raising the medium temperature to 42°C (40-42°C) for high level production of the xylanase.

For higher yield of xylanase production from pASXP93.2 and pASXP93.4, glycerol is a preferred carbon source during the induction period of fermentation. However, glucose can be used in feed- batch procedures to achieve a similar high yield. Any feed-batch procedures such as reviewed by Yee and Blanch (Bio-technology 10, 1550-1556, 1992) can be used for high cell density fermentation. These procedures produce high xylanase yield per litre of culture.

The preferable E. col i strains for pASXP93.1 and pASXP93.3 plasmids are those strains containing the temperature-sensitive cl857 repressor such as POP2163, TAP56 and N4830-1. The preferable E. col i strains for pASXP93.2 and pASXP93.4 plasmids using temperature control for xylanase production as described above are POP2163, TAP56, N4830-1 and JM83. However most E. coli strains without over production of Lad are suitable for pASXP93.2 and pASXP93.4 for production of the recombinant xylanase. EXAMPLE 8

The specific activity of the recombinant xylanase from PASXP93.1, PASXP93.2. PASXP93.3 and PASXP93.4.

The high levels of xylanase production from pASXP93.1, pASXP93.2, pASXP93.3 and pASXP93.4 are shown in Table 1. In particular the pASXP93.2 construct produced about 2000 times higher xylanase activity than pNPX21 (previously called pNXI ) which has a specific activity of 2.1U/mg protein when the activity was measured at 50°C and pH7.0. The achievement of this high activity of the xylanase produced from these constructs is mainly attributed to the DNA truncation and modification of the N-terminus of the original N. pa tri ciarum xylanase as well as the use of the strong promoter, strong transcription terminator and optimal RBS for high levels of the xylanase expression. The Par element in pASXP93.2 and pASXP93.4 increases the stability of the plasmids in the E. col i cells. EXAMPLE 9

Thermo-induction of the recombinant protein production using Tac—promoter expression system.

Conventional methods for the recombinant protein production for Lac, Trc and Tac promoter expression system is to use IPTG as a inducer. Because IPTG is a very expensive compound, it is not normally economical for the use in industrial fermentations for the production of recombinant proteins. However, Tac and Trc are strong promoters and can yield the high expression levels.

An economic induction method for the production of recombinant protein from Tac-promoter expression system is described herein. The present method involves the cell growth in any suitable media for E. coli such as described by Curless et al . (Biotechnology and Bioengineering 41, 221-230, 1993) at 30°C (normally <32°C) and subsequently raising growth temperature to 42°C (39-42°C) for enhanced productions of recombinant protein.

A several-fold increase in the expression level of the xylanase from the pASXP93.2 and pASXP93.4 clones, when the cultures grew at 42°C, was observed, compared to the growth at 30°C without the use of IPTG.

Theoretically, this induction system can be applied to the production of many recombinant proteins from IPTG inducible promoters, (such as Tac, Trc and lac) based expression systems. The yield of a recombinant xylanase expression based on the Tac promoter by the thermo-induction procedure described herein is actually higher than that using the λP, promoter even in fermentation using shake flasks (Table 1, pASXP93.2 in TAP56 vs pASXP93.1 in TAP56). Fig 14 shows that high level expression of the xylanase produced in E. col i strain Pop2163 under thermo-induction conditions in a 10-litre fermentor without the addition of IPTG. Thus in contrast to the findings of Brandes e t al . , { hoc . ci t . ) , it is clearly hereby demonstrated that expression level of the modified xylanase using the Tac promoter and thermo- induction procedure even in a large scale of fermentation is at least comparable to the level obtained by chemical induction using the same construct (Figures 12 and 14) In addition, the rapid raising of the culture temperature is not required when the tac promoter is used for the control the expression of the xylanase. In the 10-litre fermentation experiment demonstrated in Fig. 14, it took about half an hour for the culture temperature to reach to 42°C from 30°C by applying heat through the heating element.

The mechanism of this type of induction is not clear. It may be due to the enhanced rate of transcription or translation. Further study is required to elucidate the induction mechanism. For a small scale cultivation, the recombinant E. coli cells were grown in MTG medium in shaking flasks at 30°C overnight. The overnight cultures were diluted by addition of 3 volumes of MTG medium and grown at 42°C for 4 hours. For a large scale fermentation, the cultivation procedure commonly employed for thermo-induction of recombinant protein expression in E. col i can be adopted such as the procedure described in Curless et al . , Biotechnology and Bioengineering _.38 1082-1090 (1991 ). The cells were harvested by centrifugation and lysed by suspending in 50mM Tris-Cl, pH8/lmm EDTA/lysozyme (0.5mg/ml), followed by freeze-and-thaw. The crude enzyme preparations were used for xylanase assay at 50°C in 25mM Na-citrate, pH7/50mM NaCl containing 1% Oat Spelt Xylan.

MTG medium described above has a composition as follows: 3g/L yeast extract, 1 Og tryptone, 15g Na₂HP0₄.12H,0, 3g KH₂P0₄, 1g NH₄C1, 1g MgS07H₂0, 0.15g CaCl₂, 4g glucose, 10ml glycerol, 5mg thiamine, 0.025mg Biotin, 2mg ZnS0.7H₂0, 16.2 mg FeCl_?, 10 mg MnS0₄.H₂0, 1 mg CuCl₂, 2 mg CoS0₄.7H₂0, 0.5mg HB0₃, 10 mg Alcl₃.6H,0 per litre, pH7.2. EXAMPLE 10

Another example of thermo-induction of recombinant protein using the Tac promoter demonstrated herein is pNPCD2, in which the celD Domain II cellulase is under control of the Tac promoter. As shown in Table 2, the cellulase yield of the pNPCD2 construct when the culture was induced at 42°C was about two and a half times higher than that grown at 29°C. Addition of IPTG to the culture grown at 42°C did not improve the cellulase production. In fact, the cellulase yield using the thermo-induction procedure is higher than IPTG induction.

Constructs pASXP93.1, pASXP93.2, pASXP93.3, pASXP93.4 and pNPX30 were deposited at the Australian Government Analytical Research Laboratories on October 21, 1993 under accession numbers N93/42415, N93/42416, N93/42417, N93/42418 and N93/42419 respectively.

The invention also includes within its scope the DNA sequences shown in FIGS 2, 6 and 8 as well as DNA sequences substantially homologous thereto (ie. sequences having greater than 70% homology over a length of 100 nucleotides or longer. The term "substantially homologous thereto" may also include within its scope DNA sequences showing cross hybridisation with the DNA sequences shown in FIGS 2, 6 and 8 under standard hybridization conditions. TABLE 1

PLASMID STRAIN XYLANASE ACTIVITY (u/mg protein) pASXP93.1 TAP56 1598 pASXP93.2 TAP56 2370 pASXP93.3 TAP56 1756 pASXP93.4 POP2163 1750

TABLE 2

E. coli Growth Induction IPTG Cellulase strain temperature temperature ( ImM) activity (U/mg protein )

Pop2163 29°C 29°C -_ 8.8

Pop2163 29°C 40°C - 17.1

Pop2163 29°C 42°C - 23.4

Pop2163 29°C 37°C + 20.1

TAP56 29°C 29°C -_ 11.2

TAP56 29°C 40°C - 22.5

TAP56 29°C 42°C - 24.9

TAP56 29°C 37°C + 16.4

TAP56 29°C 42°C + 18.9

TABLE LEGENDS Table 1.

Comparison of the specific activity of the recombinant xylanase from E. col i harbouring pASXP93.1 (λP, ) , pASXP93.2 (Tac), pASXP93.3 (λP_L) and pASXP93.4 (Tac) using shake flasks. Expression of the recombinant xylanases was incuded by thermo-induction. Xylanase activity was measured in a buffer containing 25 mm Na- citrate (pH7), 50 mm NaCl and 1% Oat Spelt Xylan at 50°C for 30 min. The reducing sugars released from xylan was determined according to the method described by Lever (Anal. Biochem. 47, 273-279, 1972).

Table 2.

Effect of induction methods on the cellulase activity of the pNPCD2 construct under the control the Tac promoter

The recombinant cellulases were prepared from E. col i strain TAP56 or Pop2163 harbouring the pNPCD2 plasmid. The recombinant E. col i cells were grown at the temperature indicated in the Table in shake flasks.

Expression of the recombinant cellulase was induced by either addition of IPTG or rising the temperature. The cellulase activity was determined using p- nitrophenyl cellobioside as a substrate. FIGURE LEGENDS Figure 1

The map of pASXP93.1 plasmid. Figure 2 The nucleotide sequence of the entire expression unit of genetically-engineered xylanase gene (including ΛPL promoter, synthetic ribosomal-binding site and translational initiation region, modified xylanase- coding region, translational stop and tLI transcription terminator) in pASXP93.1 clone and the deduced amino acid sequence of the xylanase. Figure 3

The map of pASXP93.2 plasmid. Figure 4 The nucleotide sequence of the entire expression unit of genetically-engineered xylanase gene (including Tac promoter, ribosomal-binding site and translational initiation region, modified xylanase-coding region, translational stop and rrnB Tl and T2 transcription terminators) in pASXP93.2 clone and the deduced amino acid sequence of the xylanase. Figure 5

The map of pASXP93.3 plasmid. Figure 6 The nucleotide sequence of the entire expression unit of genetically-engineered xylanase gene (including PL promoter, synthetic ribosomal-binding site and translational initiation region, modified xylanase- coding region, translational stop and tLI transcription terminator) in pASXP93.3 clone and the deduced amino acid sequence of the xylanase. Figure 7 The map of pASXP93.4 plasmid. Figure 8

The nucleotide sequence of the entire expression unit of genetically-engineered xylanase gene (including Tac promoter, ribosomal-binding site and translational initiation region, modified xylanase-coding region, translational stop and tLI transcription terminator) in pASXP93.4 clone and the deduced amino acid sequence of the xylanase. Figure 9 The map of pNPC2 plasmid. Figure 10

N-terminal coding sequences of pASXP93.2 xylanase mutants. The first 20 codons of the xylanase and the corresponding part of the coding sequence in its mutants are shown. Figure 11

SDS-PAGE analysis of expression levels of the xylanases of pASXP93.2 mutants. The total cell lysates prepared from E. col i strain XLI-Blue harbouring the xylanase plasmids were subjected to a gradient SDS-PAGE gel (10-15%). The expression of the recombinant xylanases was induced by the addition of IPTG and grown at 30°C. Lane 1, pBTac2; Lane 2, pASXP93.2; Lane 3, pASXP93.2a; Lane 4, pASXP93.2b; Lane 5, pASXP93.2c; Lane 6, molecular weight marker. Figure 12

Comparative analysis of expression levels of the xylanases of pASXP93.2 and pNXS-Tac . The total cell lysates prepared from E. col i strain XLI-Blue harbouring the xylanase plasmids were subjected to a gradient SDS-PAGE gel (10-15%). The expression of the recombinant xylanases was induced by the addition of IPTG and grown at 30°C. Lane 1, molecular weight marker; Lane 2, pBTac2; Lane 3, pNXS-Tac; Lane 4, pASXP93.2. Figure 13 Comparison of the coding region sequences between the modified Domain I xylanase (D1 ) in pNXS-Tac and the modified Domain II xylanase (D2) in pASXP93.1-4 constructs . Figure 1 SDS-PAGE analysis of the expression level of the xylanase produced in E. coli strain Pop 2136 harbouring the pASXP93.2 plasmid by the thermo- induction procedure in a 10-litre fermentation. The total cell lysates were subjected to a gradient SDS- PAGE gel (10-15%). Lane 1, pASXP93.2; Lane 2, molecular weight marker; Lane 3, pBTac2. The xylanase protein band (26kDa) is indicated. Figure 1 5

Restriction maps of pNPX30 xylanase cDNA isolated from Neocallimastix pa tri ciarum cDNA library. Abbreviations for restriction enzymes: B,BstXI;E,EcoRI;H,HpaI;K,KpnI;P, PvuII;S, SacI;Sc, Seal ; X,XhoI.

Claims

CLAIMS :

A cultivation process including the following steps:

(i) recombinant E. coli cells which include a promoter coupled to a gene which encodes a recombinant protein wherein said promoter is normally inducible by IPTG in a cultivation vessel during a growth phase at temperatures from room temperature to 32°C wherein the recombinant protein is (a) expressed at a low level and (b) is substantially non-toxic to E. col i whereby inclusion bodies are not formed in step (ii) hereinafter; and (ii) initiating an induction phase by application of heat to the cultivation vessel in step

(i) so as to enhance the level of production of the recombinant protein.

2. A process as claimed in claim 1 wherein the recombinant protein is selected from xylanases and cellulases.

3. A process as claimed in claim 2 wherein the recombinant protein is a xylanase or cellulase derived from a fungus of anaerobic origin.

4. A process as claimed in claim 1 wherein said recombinant E. col i cells are derived from pop2163 or TAP56 strains.

5. A process as claimed in claim 1 wherein the IPTG inducible promoters are selected from LacZ, trc and tac.

6. pASXP93.1 construct having a structure as defined herein in Figure 1.

7. pASXP93.1 construct having a DNA sequence as described herein in Figure 2 and DNA sequences substantially homologous thereto.

8. pASXP93.3 construct having the structure as defined herein in Figure 5.

9. pASXP93.3 construct having a DNA sequence as described herein in Figure 6 and DNA sequences substantially homologous thereto.

10. pASXP93.4 construct having the structure as defined herein in Figure 7.

11. pASXP93.4 construct having a DNA sequence as described herein in Figure 8 and DNA sequences substantially homologous thereto.

12. pNPCD2 having a structure as shown in Figure 9.

13. Construct pASXP93.1 deposited at the Australian

Government Analytical Laboratories on October 21 , 1993 under accession number N93/42415.

14. Construct pASXP93.2 deposited at the Australian

Government Analytical Laboratories on October 21 , 1993 under accession number N93/42416.

15. Construct pASXP93.3 deposited at the Australian Government Analytical Laboratories on October 21 , 1993 under accession number N93/4241 .

16. Construct pASXP93.4 deposited at the Australian Government Analytical Laboratories on October 21 , 1993 under accession number N93/42418.

17. Construct pNPX30 deposited at the Australian Government Analytical Laboratories on October 21 , 1993 under accession number N93/42419.

18. A DNA construct having a λPL promoter, RBS region, xylanase coding region and a terminator region .

19. A DNA construct as claimed in claim 20 wherein the RBS region is a synthetic RBS region which is TAAGTTAACTTTAAGGA(T)AA(T)AA(C)AA(T) .

20. A DNA construct as claimed in claim 20 wherein the xylanase coding region is derived from the pNPX30 plasmid.

21. A DNA construct as claimed in claim 20 wherein the terminator region is tL1.

22. A DNA construct having a Tac promoter, a Shine- Delgarno sequence, a xylanase coding region and a terminator region.

23. A DNA construct as claimed in claim 24 wherein the xylanase coding region is derived from pNPX30 plasmid .

24. A DNA construct as claimed in claim 24 wherein the terminator region is T1T2.