WO1994029346A1

WO1994029346A1 - IDENTIFICATION OF THE ADHESIN GENE FROM $i(M. PIRUM)

Info

Publication number: WO1994029346A1
Application number: PCT/FR1994/000651
Authority: WO
Inventors: Nam Tham To; Stéphane Ferris; Alain Blanchard; Luc Montagnier; Elmostafa Bahraoui
Original assignee: Institut Pasteur
Priority date: 1993-06-04
Filing date: 1994-06-02
Publication date: 1994-12-22
Also published as: FR2705970B1; FR2705970A1

Abstract

A nucleic acid corresponding to the M. pirum adhesin gene and characterized by the nucleotic sequence illustrated in figure 1, or any sequence derived from the latter obtained by degenerescence of the genetic code. The adhesin or fragment derived from the latter is useful as an immunogen in the prevention or treatment of M. pirum and/or HIV-induced infections.

Description

IDENTIFICATION OF THE M. PIRUM ADHESIN GENE

The present invention relates to the identification of the adhesin gene of Mycoplasma pirum and to the role of this adhesin in the pathogenic effect of this mycoplasma, as well as in the cytopathogenic effect of retroviruses, in particular of HIV, on monocytes. and T4 lymphocytes in 1 • man.

M. pirum is a mycoplasma whose natural host was previously unknown and had only been isolated from cell cultures (Del Giudice (1985)). Phylogenically, this species is closely related to mycoplasmas of the pneumoniae group (Weisburg (1989)).

Like most members of this group, M. pirum is characterized by an external structure or rostrum which has a specialized function in cell adhesion (Razin et al. (1992)).

The adhesins responsible for attachment have been identified for two human mycoplasmas: Mycoplasma pneumoniae and Mycoplasma genitalium (Inamine et al., 1989).

These adhesins are positioned on the surface of the cell. In M. pneumoniae, the main adhesin is a 170 Da polypeptide called "PI", and in M. genitalium a similar protein called "MgPa" has been characterized and has a molecular weight of 153 kDa.

The proteins Pi and MgPa are efficient immunogens and the antibodies directed against these adhesins are capable of inhibiting the adhesion of the corresponding mycoplasmas to the host cells.

The genes for these two proteins have been cloned and sequenced (Inamine et al, 1989); in addition, cross-hybridization has been obtained between these genes and the genetic DNA of another structural mycoplasma Semb _the ble, Mycoplasma gallisepticum (Dallo et al. _(1990)), suggesting at least partial homology between the genes encoding the adhesin of mycoplasma this family.

M. pirum was recently isolated from a culture of peripheral blood mononuclear cells (PBMCs), purified from the blood of a patient infected with the HIV virus (Montagnier et al. (1990)).

The cytopathic effect associated with HIV has been shown to be increased in the presence of different species of mycoplasma, in particular M. fermentans (Lemaître et al. (1992) and Lo (1992)), as well as M. pirum (Montagnier et al . (1990)).

In addition, the presence of M. pirum was directly detected without prior culture in PBMCs of HIV-positive patients using a PCR test (Grau et al. (1993)). This confirms the idea that M. pirum is a human parasite and thus becomes a probable candidate in the interaction with the HIV virus in the infection of T lymphocytes.

Furthermore, it has been shown, in particular in patent application EP-91919407.6, that antibodies directed against peptide sequences specific for the adhesins of M. pneumoniae or of M. genitalium were capable of inhibiting the infection of activated T lymphocytes or cells of a T lymphoid line with the prototype strain of HIV LAV _LAj or with the prototype strain of HIV2 _R00 . These same antibodies also recognize, in a weaker but specific way, a protein of similar size in the lysis extracts of M. pirum suggesting a homology between the adhesins of M. genitalium and M. pirum.

Finally, an increase in the infectiousness of the irradiated HIV virus has been shown by an extract from M. pirum (Montagnier et al. (1991)); when a soluble cellular extract of M. pirum is added in at the same time as cellular infection with the irradiated HIV virus, a partial restoration of infectivity could be observed.

This indicates that a component of M. pirum, possibly a protein of these mycoplasmas, can significantly increase the infectivity of such preparations of the virus.

A similar result could be obtained with a cytokine inducing viral expression, TNF (Tumor Necrosis Factor).

All of these results converge on the idea of the probable importance of the role played by mycoplasmas in increasing the expression of HIV by any mechanism, in particular by induction of cytokine.

In this context, the study of the gene coding for adhesin from the genome of M. pirum is particularly important for various reasons. a) Adhesin is a protein which plays an essential role in the fixing of the mycoplasma on infected cells or susceptible to be infected and perhaps even in its fusion with the cell membrane. b) M. pirum has been found in human carcinoma cells, but has no known host; as mentioned above, it has been isolated from AIDS patients. c) Certain mycoplasmas are known to be inducers of cytokine synthesis, thereby increasing the cytotoxic effect of macrophages on tumor cells.

Preliminary experiments have shown that M. pirum and M. fermentans seem to participate in this role of inducer of cytokine synthesis (Gougeon ML et al. (1992)). d) With the nucleotide sequences already known of the adhesin genes of M. pneumoniae and of M. genitalium, the identification of the adhesin gene of M. pirum could contribute in an essential way to the knowledge of the cytoadherence site of this adhesin and thereby have an important role in the infection of cells by the virus responsible for AIDS. e) The adhesin of M. pirum could constitute a good candidate for a vaccine preparation both against a cytopathic effect of M. pirum and also against a cytopathic effect of the HIV virus. f) This antigen, once known and obtained in large quantities, could be used in a serological test for the detection of antibodies in a patient's serum in an ELISA type test.

The present invention relates to the cloning and sequencing of a nucleic acid coding for the adhesin of M. pirum, characterized in that it consists of the nucleotide sequence represented in FIG. 1, or any sequences derived therefrom. obtained by degeneration - from the genetic code.

FIG. 1 represents the nucleotide sequence corresponding to the adhesin gene of M. pirum with translation into amino acids taking into account the codon TGA coding for tryptophan (trp or W) in mycoplasmas.

Any nucleic acid consisting of:

- either of a sequence derived from the sequence of FIG. 1 by addition, deletion or substitution of certain codons,

- either of a fragment of the sequence shown in FIG. 1, provided that said sequence or said fragment codes for a protein having cross immunological reactivity with the protein encoded by the nucleic acid represented in FIG. 1, also forms part of the present invention.

The nucleic acid as defined above codes for the adhesin of M. pirum and has between 40 and 60% of sequence homology with the nucleic acid coding for the adhesin of M. genitalium and between 37 and 55 % homology with the nucleic acid coding for the adhesin of M. pneumoniae.

RNA hybridizable with one of the sequences defined above also forms part of the invention.

The present invention also relates to any recombinant protein having properties of adhesion to membrane receptors of eukaryotic cells, characterized in that it contains an amino acid sequence encoded by one of the nucleic acid sequences defined above. .

Any recombinant protein according to the invention is characterized in that it has the properties of an M. pirum adhesin, and that it has between 45% and 60% similarity and between 25% and 50% of identity with adhesins of M. pneumoniae and M. genitalium.

When comparing two alignments of amino acid sequences of two proteins that one seeks to compare, the percentage of identity is defined as the number of identical amino acids relative to the total number of amino acids of the protein studied; and the percentage of similarity (or homology) is defined as the number of amino acids identical or belonging to the same class compared to the total number of amino acids of the protein studied.

These classes of amino acids are as follows: - "polar-neutral" including Gly, Ala, Val, Ile, Leu, Phe, Pro, Met; - "non-polar-neutral", including Ser, Thr, Tyr, Trp, Asn, Glu, Cys;

- "acids" including Asp and Glu;

- "basic" including Lys, Arg and His.

The recombinant protein of the invention is not recognized by antibodies formed against the following peptide:

GWSTPLVNLINGQ.

Also forming part of the invention is any peptide characterized in that it is included in a hydrophilic fragment of the protein defined above, which peptide is not recognized by antibodies formed against the peptide GWSTPLVNLINGQ, and which peptide is also capable of inducing the formation of antibodies alone or associated with a carrier molecule, which antibodies are capable of neutralizing an infection of T lymphocytes or human monocytes by M. pirum and of decreasing the cytopathogenic effect of retroviruses, in particular of HIV on these same T cells or human monocytes.

In particular, any peptide including 70 to 100% of the following sequences:

- HIDPKKMVDNYPNQWKSSQ located between positions 201 and 219 of the amino acid sequence shown in FIG. 1, and

- IGIPMAKHKKAIKVGFEL located between positions 1055 and 1072, or any similar sequence as defined above, is capable of inducing antibodies capable of neutralizing an infection of T lymphocytes or human monocytes by M. pirum and of reducing the effect. cytopathogen of retroviruses, in particular HIV, on these same T lymphocytes or human monocytes.

The present invention also relates to any monoclonal or polyclonal antibody against one of the protein or peptide sequences defined above. above and characterized in that it is capable of inhibiting the infectivity of human monocytes or T lymphocytes by M. pirum, whether in vitro in cell culture or in vivo in humans. This monoclonal or polyclonal antibody is also capable of inhibiting the infection of human lymphocytes in culture with the HIV virus.

The monoclonal or polyclonal antibody as defined above can be used for the production of pharmaceutical compositions for the prevention or treatment of infections of humans with the HIV virus when it is combined, in said composition, with a pharmaceutical vehicle acceptable.

Said pharmaceutical composition containing, as active principle, the antibody according to the invention is also included in the invention.

Also part of the invention is the use of a protein or a protein fragment having adhesion properties to the membranes of human monocytes or T lymphocytes, for the in vivo induction of antibodies having the property of 'inhibit an infection of said human monocytes or lymphocytes by M. pirum, or an infection of these same human T lymphocytes by the HIV virus.

Also part of the invention is the use of a recombinant protein or peptide as defined above for the detection in a biological fluid of an asymptomatic or sick person of the presence of antibodies against peptides originating from M. pirum.

Also part of the invention is any immunogenic composition against infection by M. pirum characterized in that it contains a protein or a peptide as defined above and finally said immunogenic composition is capable alone or in combination with other peptides or proteins immunogens to constitute an active principle of vaccine against the HIV virus.

Finally, the method of in vitro detection of the presence of antibodies against peptides originating from M. pirum in a biological medium capable of containing them, characterized by bringing this biological sample into contact with a protein or polypeptide and by detecting of an immunological reaction or the production of an immunological complex against this protein or polypeptide and antibodies contained in this biological sample, is an integral part of the invention.

Also part of the invention:

- a diagnostic reagent consisting of the protein or peptides according to the invention for detecting the possible presence of antibodies specific for M. pirum in a biological fluid;

- A probe to search for the possible presence of M. pirum in a sample, characterized in that it comprises all or part of a nucleic acid defined in the invention;

- A nucleic acid sequence characterized in that it codes for one of the peptide sequences defined in the invention.

DETAILED DESCRIPTION OF THE INVENTION

The detailed description which follows is given by way of example but in no way is it restrictive of the experimental technique used insofar as any method allowing the cloning and the identification of the gene coding for the adhesin of M. pirum or fragments thereof exhibiting the properties given above of binding to human cell membranes or of induction of antibodies capable of blocking this attachment also form part of the invention. We considered the localization of the adhesin gene of M. pirum, strain BER, isolated from a culture of purified monoclonal cells from a patient infected with the HIV1 virus. The culture of this mycoplasma is done in SP4 medium under the experimental conditions described in particular in Tully et al. (1977) and genomic DNA was purified according to standard procedures (Marmur, 1961).

Considering that the genes coding for polypeptides of the same function in the organisms of a species often have homologous nucleotide sequences, part of the nucleotide sequence of DNA corresponding to the known genes of the adhesin of M. pneumoniae and M. genitalium has been used in the identification of the adhesin gene of M. pirum. The 29NTS synthetic oligonucleotide probe of 29 nucleotides originating from the 3 'terminal region of the adhesin gene of M. genitalium (Inamine et al, 1989) was used and whose sequence is as follows: 5' TTGACCAAAGCAGTTGGTAGTGTCTTTAA 3 '. It has 28/29 nucleotides identical to those of the 3 'terminal region of the adhesin gene of M. pneumoniae (Inamine et al, 1988). It was chosen in this region because there is 72% sequence homology (Dallo et al, 1989), the highest rate of sequence homology found in the comparison of the nucleotide sequences of the adhesin genes of M. genitalium and M. pneumoniae.

- DNA cloning and sequencing

The molecular biology techniques used are described in Sambrook et al, 1989. On the EcoRI restriction profile of M. pirum transferred onto Hybond N membrane, 5 DNA fragments of different sizes were revealed by the 29NTS probe labeled with ³² P at 1 ^• 5 'terminal end under the following hybridization conditions: hybridization has been carried out _in a 6xSSC buffer medium, SxDenhardt's, 0.1% SDS, 100 mg / ml ssDNA at 42 ° C for 16 to 18 h, the membrane was then washed in 6xSSC, 0.1% SDS once 30 min at room temperature, once 1 h at 47 ° C and once 30 min at room temperature; the decisive washing temperature was increased to 55 ° C without completely detaching the 29NTS probe. They were cloned into pBlueScript vector plasmids (Stratagene La Jolla, CA). The recombinant plasmids were obtained after transformation of competent cells of Escherischia coli XLl-Blue. The DNA inserts of the recombinant plasmids were sequenced using the Sanger dideoxy method using the modified T7 DNA polymerase (Sequenase US Bayer Chemical Corp. Cleveland, OH).

- Analysis of DNA and polypeptide sequences.

All the analyzes and sequence comparisons were carried out using the software and their default values proposed by the GCG (Genetic Computer Group Inc., Madison, isconsin) (Devereux et al, 1984).

Taking into account that the stop codon TGA in bacteria codes for tryptophan in mycoplasmas (Jacobs, 1991), the use of this alignment research program has shown that the DNA fragment EcoRI of 7.3 Kb has a amino acid sequence, deduced from its nucleotide sequence, with the highest sequence homology scores with those of the genes of ^one adhesin of M. genitalium and M. pneumoniae. All the published sequences were obtained from the Genbank databases (Los Alo os, NM) of the European Molecular Biology Laboratory (Heidelberg - Germany).

With other synthetic oligonucleotides, a more in-depth sequence study of the EcoRI- fragment Spel 1.5 Kb, a subclone of the EcoRI fragment of 7.3 Kb, allowed the localization of an open reading frame of 973 bp corresponding to an NH ₂ - terminal end.

Two lines of E. coli transformed by the plasmids consisting of the vector p Bluescript SK (Stratagene) and a heterologous DNA fragment originating from the genome of M. pirum were deposited at the CNCM on June 2, 1993: it is the strain E. coli SKB1HE registered under No. 1-1314 and containing the 5 kbp fragment, itself containing the 3 * OH part of the gene coding for the C. terminal part of adhesin, and of the E. coli SKB31ES strain registered under No. 1-1315, and containing the 1.5 kbp fragment of the gene coding for the N-terminal part of adhesin.

An overlapping region of 87 nucleotides between these two parts of the gene is delimited by the EcoRI and HindIII sites. The size of the entire reading frame is therefore 3435 bp coding for a polypeptide of 126731 Daltons, of 1145 amino acids.

FIG. 2 summarizes the general strategy for cloning as explained above and for determining the 3435 bp sequence coding for the 1145 amino acids of the adhesin gene of M. pirum.

This gene has 41.4% and 37.2% similarity of nucleotide sequences, the corresponding amino acid sequence, 46.1% and 46.9% of similarity with the corresponding sequences of M. genitalium and M. pneumoniae respectively.

FIG. 3 indicates the percentages of homology between the nucleotide sequences of M. pirum with the nucleotide sequence of the adhesin of M. genitalium (FIG. 3A) with the nucleotide sequence of the adhesin of M. pneumoniae (FIG. 3B); FIGS. 3C AND 3D indicate the percentages of homology between the amino acid sequence of M. pirum compared to the s _ed accordingly of the M. genitalium adhesin (3C) and the amino acid sequence of the adhesin M. pneumoniae (3D). The program used used the Needleman and Wunsch algorithm which allows to find the alignment of the two complete sequences which optimize the number of concordances and minimize that of discordances. Alignment parameters with the GAP program recommended by Devereux et al, (1984) were thus used.

If the amino acid sequences are compared, a percentage of identity is observed between the amino acid sequence thus determined from the polynucleotide sequence with the respectively MgPa proteins of M. genitalium adhesin as well as the protein 26% M. pneumoniae PI.

The open reading frame coding for the PI protein supposed to be the adhesin of M. pirum was therefore found to be 3,434 bp (see Figure 1) with a G + C percentage of only 28%, compared to G + C% 53.5% for the adhesin of M. pneumoniae and 40% for the adhesin of M. genitalium (Dallo et al, 1989). This low G + C% of the M. pirum gene is in agreement with the extremely low G + C% for the entire genome of M. pirum (25.5%, Del Giudice et al, 1985). This basic composition is also reflected in the use of codons, in particular for tryptophan (Trp) insofar as for this amino acid there are 18 TGA triplets and no TGG triplet coding for tryptophan while in M. pneumoniae 17 of the 37 Trp residues are coded by TGG and in M. genitalium 12 of the 28 are coded by TGG. The percentage of codons with A or T in third position is extremely high: 91% compared to 65% for M. genitalium and 40% for M. pneumoniae.

- Analysis of the amino acid sequence of the Pl-like protein of M. pirum adhesin. In addition to the percentages of homology and identity between the amino acid sequences of the P-like protein of M. pirum with the PI protein of M. pneumoniae and the MgPa protein of M. genitalium the following observations can be made: a) three cysteine residues have been found in the adhesin Pl-like sequence of M. pirum which potentially can allow SS bonds; no cysteine residue was found in the sequences of M. pneumoniae and M. genitalium. b) the hydrophilicity and hydrophobicity profiles of the terminal NH ₂ and COOH regions of the three adhesin genes were compared and are presented in FIG. 4. FIG. 4A compares the hydrophobicity / hydrophilicity benefits of the terminal COOH fragments of M genitalium (a) M. pneumoniae (b) and M. pirum (c). FIG. 4B compares these same profits for the NH ₂ terminal regions between amino acids 1 to 80 for these same three species of mycoplasma. The observation of these figures clearly indicates that the profits are stackable showing a positively charged terminal amino acid sequence followed by a hydrophobic amino acid sequence. Finally, this quasi-identity between the hydrophilicity benefits suggests the presence of a signal peptide in the Pl-like protein of M. pirum in the same way as this sequence exists in the adhesins of M. pneumoniae and of M. genitalium. c) as for the protein Pl of M. pneumoniae and MgPa of M. genitalium the Pl-like protein of the adhesin of M. pirum has its terminal COOH part rich in prolines; indeed 9 of the 55 proline residues are grouped in the last 29 amino acids of the terminal COOH sequence, this terminal COOH region rich in prolines can contribute to the rigidity of this part of the molecule and can be considered as a good candidate for inducing the synthesis of specific antibodies.

- Im unoreactivity of anti-peptide antibodies vis-à-vis adhesin;

Two synthetic peptides mimicking the N-terminal and C-terminal regions of the Pl-like molecule of M. pirum were synthesized according to the solid phase technique of Merrifield, then purified by HPLC.

Ten mg of each peptide were then coupled to 6 mg of KLH (Keyhole Limpet Haemocyanin) by the glutaraldehyde method as described by Pfaff et al. (1982).

The immunization protocol is as follows: two New Zealand rabbits were immunized with each of the peptides by mixing 200 μg of peptide coupled to KLH with an equal volume of complete Freund's adjuvant, then injected intradermally on day 0.

This process was then repeated by subcutaneous injection with incomplete Freund's adjuvant on days 30, 60 and 90.

The rabbits are bled a week after each injection. _

The immunoreactivity of the anti-peptide antibodies was measured by an ELISA test: 96-hole plates (Nunc, Rotskild, Denmark) were covered for 2 h at 37 "C with 100 ng of synthetic peptide in 50 μl of PBS ( Phosphate Buffer Saline), pH 7.4 per well.

After saturation with 400 μl of PBS, 5% of skimmed milk, for 1 h at 37 ° C., then washing with PBS, 0.5% of milk, 0.01% of Tween 20, 50 μl of serial dilutions of serum were added.

After 2 h, at 37 ° C., the wells are rinsed and 50 μl of anti-rabbit antibodies labeled with peroxidase (dilution 1/5000) were added. After 1 h at 37 "C, then rinsing, 100 μl of orthophenylenediamine were added and incubated for 30 min at room temperature in the dark.

The reaction was stopped by adding 50 μl of 4 N sulfuric acid and the optical density ratio at 492 and 620 nm was determined.

FIG. 5 represents the optical density thus measured as a function of the dilution.

The symbols have the following meaning:

- empty triangles and squares: 2 rabbits immunized with the C-terminal peptide;

- solid circles: rabbit immunized with the N-terminal peptide;

- solid triangles and squares: pre-immune sera from rabbits used for immunization with the C-terminal peptide.

The results indicated in FIG. 5 indicate that only rabbits immunized with the C-terminal peptide produce specific antibodies against the corresponding peptide with a relatively high titer since a dilution of serum to 5000th always gives a positive result.

On the contrary, no anti-peptide antibody was detected in the serum of rabbits inoculated with the peptide corresponding to the N-terminal fraction.

In order to demonstrate that the recombinant Pl-like or adhesin gene of M. pirum actually codes for an expressed protein, we analyzed the ability of anti-peptide antibodies to specifically recognize the corresponding protein in a Western blot experiment.

- Western blot analysis:

The technology used was as follows:

A cell lysate Mr. pirum in SDS was analyzed by gel electrophoresis ^• SDS-polyacrylamide.

After electrotransfer on nitrocellulose membrane. saturation was obtained by incubating with 5% skimmed milk in PBS for 1 h at room temperature.

The membrane was then incubated for 2 h with the serum of immunized rabbits, then washed in PBS.

Peroxidase-labeled anti-rabbit antibodies were then added and incubated for 1 h.

Finally, the antigen-antibody complexes formed were detected by diaminobenzidine.

FIG. 6 represents the electrophoretic profile obtained by Western blot, after reaction of the cell lysate of M. pirum with rabbit sera under the following different conditions:

1. rabbit serum immunized with the C-terminal peptide and diluted 1/10;

2. rabbit serum immunized with the C-terminal peptide and diluted 1/100;

3. pre-immune rabbit serum immunized with the C-terminal peptide and diluted 1/10;

4. rabbit serum immunized with the C-terminal peptide and diluted 1/10, to which is added the immunogenic C-terminal peptide;

5. rabbit serum immunized with the C-terminal peptide and diluted 1/10, to which is added the immunogenic N-terminal peptide;

6. rabbit serum immunized with the N-terminal peptide is diluted 1/10;

7. pre-immune rabbit serum immunized with the N-terminal peptide is diluted 1/10.

The results of Figure 6 clearly indicate that the antibodies produced against the C-terminal peptide recognize a protein of relative molecular weight of 126 kDa, as determined by its electrophoretic mobility.

This recognition seems to be specific insofar as the pre-immune rabbit serum is not capable of detecting a positive reaction (FIG. 6, line 3) and also by the ability of the synthetic C-terminal, but not N-terminal peptide, to completely inhibit this interaction (line 4).

Furthermore, in agreement with the results of the ELISA tests, no positive reaction was detected when the rabbits were immunized with the N-terminal residues (lines 6 and 7).

These results clearly indicate that the terminal C region of the recombinant protein is an immunogen capable of inducing the formation of specific antibodies capable of interfering with the membrane attachment between the mycoplasma and the human cell.

- Measurement of the capacity of antibodies to inhibit the attachment of M. pirum to cells in culture:

The polyclonal antibodies were made, for example, by the method described above; the monoclonal antibodies are produced by the method of Kohler and Milstein (1975). The immunogenic peptides used are peptides including one or more of the 6 peptides described above or the whole protein.

The techniques used to measure the inhibition of the attachment of the mycoplasma to cells in culture by an antibody are described in the article by Chandler et al. (1982).

Briefly, the cells in culture are brought into contact with mycoplasmas or mycospheres of M. pirum and increasing amounts of biological fluid capable of containing antibodies, or of purified antibodies, are brought into contact with these cells. The inhibition of the attachment of mycoplasmas to cells is measured by the techniques described in the article by Chandler cited above.

The specificity of this inhibition can be demonstrated and clarified by the addition of purified adhesin of M. pirum or of peptides deduced from the sequence of this adhesin.

Studying the ability of body fluids or antibodies to inhibit the attachment of mycoplasmas to cultured cells can give a good indication of the type of cell that is a preferred target for M. pirum.

In addition, this test can give an indication of the antibodies which would be the best candidates to constitute an active principle in the production of pharmaceutical compositions for the prevention or the treatment of an infection by M. pirum.

Finally, this test can guide the choice of antibodies which will constitute the active principle in the production of pharmaceutical compositions for the prevention or treatment of infections by the HIV virus.

BIBLIOGRAPHICAL REFERENCES

Blanchard A. (1990). Sequencing of Ureaplasma urealyticum urease genes: use of a UGA tryptophan codon. olec. Microbiol. 4, 669-676.

Chandler DKF, Necklace A.. , Barile MF, Attachment of Mycoplasma pneumoniae to Hamster Trachéal Organ Cultures, Trachéal Outgrowth Monolayers, Human Erythrocytes, and WiDr Human Tissue Culture Cells. Affection and Immunity (1982) vol. 35, n ^β 3, p. 937-942.

- Dallo S.F., Chavoya A., Su C-J., Baseman J.B. 1989. DNA and protein homologies between the adhesins of Mycoplasma genitalium and Mycoplasma pneumoniae. Infect. Immun. 57: 1059-1065.

- Devereux, J., Haeberli, P., Smithies, O. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Research 12 (1): 387-395.

- Gougeon M.L., Garcia S., Guétard D., Olivier R., Dauguet C., Montagnier L., Apoptosis as a mechanism of cell death in peripheral lymphocytes from HIV-1 infected individuals. In: Janossy G., Autran B., Miedema F. eds. Immunology of HIV infection. Karger, Basel.

- Inamine J.M., Locchel S., Collier A.M., Barile M.F., Hu P-c. 1989. Nucleotide sequence of the MgPa (mgp) operon of Mycoplasma Genitalium and comparison to the PI (mpp) operon of Mycoplasma Pneumoniae. Gene 82: 259-267.

- Inamine J.M., Denny T., Loechel S., Schaper U., Huang C-h, Bott K.F., Hu P-c. 1988. Nucleotide sequence of the PI attach ent-protein gene of Mycoplasma pneumoniae. Gene 64: 217-229.

- Jacobs E. Mycoplasma Pneumoniae virulence factirs and the immune response. Rev. Med. Microbiol. 2: 83-90. - Katseni VL, Gilroy CB, Ryait BK, Ariyoshi K., Bieniasz PD, Weber JN and Taylor-Robinson D. Mycoplasma fermentans in individual seropositive and seronegative for HIV-1. Lancet 1993: 341: 271-273.

- Kόhler G., Milstein C. (1975). "Continuous cultures of fused cells secreting antibody of predefined specificity". Nature 256: 495-497.

- Lemaître L., Guétard D., Hénin Y., Montagnier L., Zerial A. Protective activity of tetracycline analogs against the cytopathic effect of the human immunodeficiency viruses in CEM cells. Res Virol 1990: 141: 5-16.

- Lemaître M., Hénin Y., Destouesse F., Ferrieux C., Montagnier L., Blanchard A. Rôle of mycoplasma infection in the cytopathic effect induced by human immunodeficiency virus type l in infected cell lines. Infect. Immun. 1992: 60: 742-748.

Lo S.C. Mycoplasmas in AIDS. In Maniloff J., McElhaney R.N., Finch L.R., Baseman J.B., eds. Mycoplasmas: molecular biology in pathogenesis. American Society for Microbiology, Washington, DC, 1992: 525-545.

- Marmur, J. 1961. A procedure for the isolation of deoxyribonucleic acid from microorganisms. J. Mol. Biol. 3: 208-218.

- Montagnier L., Blanchard A., Guétard D. et al. A possible role of mycoplasmas as co-factors in AIDS. In: M. Girard, L. Valette, eds. Retroviruses of human AIDS and related animal diseases: proceedings of the Colloque des Cent Gardes. M. Mérieux Foundation, Lyon, France. 1991: 9-17.

- Montagnier L., Berneman D., Guétard D., Blanchard A., Cha aret S., Rame V., Van Rietschoten J., Mabrouk K., Bahraoui E. (1990). Inhibition of infectivity of prototype HIV strains by directed antibodies against a mycoplasmed peptide sequence. CR Acad. Sci. Paris, 311: 425-430.

- Pfaff E., Mussgay M., Bohm H.O., Schulz G.E. and Schaller H. (1982). Antibodies against a preselected peptide recognize and neutralyse foot and mouth disease Virus. EMBO J. 1: 869-874.

- Sambrook J., Fritsch E.F., and T. Maniatis, 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

- Tully J.G., Whitcomb R.G., Clark H.F. and Williamson D.L. (1977). Pathogenic mycoplasmas: cultivation and vertebrate pathogenicity of a new spiroplasma. Science 195: 892-894.

Claims

1. Nucleic acid corresponding to the gene for adhesin and M. pirum, characterized in that it comprises the nucleotide sequence shown in Figure 1, or any sequence derived therefrom obtained by degeneration of the genetic code.

2. Nucleic acid according to claim 1 characterized in that it consists of:

- or of a fragment of the sequence represented in FIG. 1, provided that said sequence or said fragment codes for a protein having an immunological cross-reaction with the protein coded by the nucleic acid represented in FIG. 1.

3. Nucleic acid according to one of claims 1 or 2, characterized in that it codes for the adhesin of M. pirum and in that it has at least 40% homology with the nucleic acid coding for adhesin from M. genitalium and at least 37% homology with the nucleic acid coding for M. pneumoniae.

4. RNA characterized in that • it can be hybridized with one of the sequences defined in claims 1 to 3.

5. Recombinant protein having properties of adhesion to membrane receptors of eukaryotic cells, characterized in that it contains an amino acid sequence encoded by one of the nucleic acid sequences defined in claims 1 to 4.

6. Recombinant protein according to claim 5, characterized in that it is the adhesin of M. pirum and that its sequence has between 45% and 60% of similarity and between 25% and 50% identity with the adhesins of M. pneumoniae and M. genitalium and that it is not recognized by antibodies formed against the peptide:

GWSTPLVNLINGQ

7. Recombinant protein according to claim 5, characterized in that it contains 70 to 100% of one or both of the following peptides:

HIDPKKMVDNYPNQWKSSQ IGIPMAKHKKAIKVGFEL

8. Peptide whose amino acid sequence is included in the amino acid sequence contained in the recombinant protein of claim 5, characterized in:

- that it is not recognized by antibodies formed against the peptide GWSTPLVNLINGQ and

- that, alone or associated with a carrier molecule, it is capable of inducing the formation of antibodies capable of neutralizing an infection of human lymphocytes or monocytes by M. pirum.

9. Peptide according to claim 8, characterized in that it includes 70 to 100% of one or of the following two sequences:

HIDPKKMVDNYPNQWKSSQ IGIPMAKHKKAIKVGFEL

10. Monoclonal or polyclonal antibody against one of the protein or peptide sequences defined in one of claims 5 to 9, characterized in that it is capable of inhibiting the infection of human cells by M. pirum in vitro and / or in vivo.

11. Monoclonal or polyclonal antibody against one of the protein or peptide sequences defined in one of claims 5 to 9, characterized in that it is capable of inhibiting the infection of human T lymphocytes by the HIV virus. ₁ 2. Pharmaceutical composition having the capacity to inhibit the infection of human T lymphocytes in culture by the HIV virus containing the monoclonal or polyclonal antibody according to claim 11, as active ingredient.

13. Use of the monoclonal or polyclonal antibody according to claim 10, for the production of pharmaceutical compositions for the prevention or treatment of infection of humans by the HIV virus. ι

14. Use of a protein according to claims 5, 6 or 7 or of a fragment included in said protein, or a peptide according to claims 8 and 9, for the production of pharmaceutical compositions for 1 • in vivo induction of • antibodies having the property of inhibiting an infection of human cells by M. pirum.

15. Use of a protein according to claims 5, 6 or 7 or of a fragment included in said protein, or of a peptide according to claims 8 and 9, for the in vivo induction of antibodies having the property of '' inhibit infection of human T cells by the HIV virus.

16. Use of a protein according to one of claims 5, 6 or 7, or of a peptide according to claims 8 and 9, in the detection in a biological fluid of an asymptomatic or sick person, of the presence of antibodies against peptides originating from M. pirum.

17. Method for in vitro detection of the presence of antibodies against peptides originating from M. pirum in a biological medium capable of containing them, characterized by bringing this biological sample into contact with a protein according to one of claims 5 , 6 or 7 or polypeptide according to claims 8 or 9 and by the detection of a immunological reaction or the production of an immunological complex against this protein or polypeptide and the antibodies contained in this biological sample.

18. Immunogenic composition against infection against M. pirum, characterized in that it contains a protein according to one of claims 5 to 7 or a fragment thereof, or a peptide according to claims 8 or 9, or a mixture of these.

19. Immunogenic composition according to claim 18, characterized in that it is capable, alone or in combination with other immunogenic peptides or proteins, of constituting an active principle of vaccine against the HIV virus.

20. diagnostic reagent constituted by the protein or the peptides according to claims 5 to 9 to search for the possible presence of antibodies specific for M. pirum in a biological fluid.

21. Probe for searching for the possible presence of M. pirum in a sample, characterized in that it comprises all or part of a nucleic acid defined in one of claims l to 4.

22. Nucleic acid sequence characterized in that it codes for one of the peptidiejues sequences defined in one of claims 7 to 9.