WO1994025490A1 - Anticorps monoclonaux humains diriges contre des cytomegalovirus humains et procedes s'y rapportant - Google Patents

Anticorps monoclonaux humains diriges contre des cytomegalovirus humains et procedes s'y rapportant Download PDF

Info

Publication number
WO1994025490A1
WO1994025490A1 PCT/US1994/004705 US9404705W WO9425490A1 WO 1994025490 A1 WO1994025490 A1 WO 1994025490A1 US 9404705 W US9404705 W US 9404705W WO 9425490 A1 WO9425490 A1 WO 9425490A1
Authority
WO
WIPO (PCT)
Prior art keywords
monoclonal antibody
hcmv
seq
dna
sequence
Prior art date
Application number
PCT/US1994/004705
Other languages
English (en)
Inventor
Dennis R. Burton
Carlos Barbas
Roberto Burioni
Anthony Williamson
Original Assignee
The Scripps Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Scripps Research Institute filed Critical The Scripps Research Institute
Priority to AU67775/94A priority Critical patent/AU6777594A/en
Publication of WO1994025490A1 publication Critical patent/WO1994025490A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/081—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from DNA viruses
    • C07K16/085—Herpetoviridae, e.g. pseudorabies virus, Epstein-Barr virus
    • C07K16/089—Cytomegalovirus
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/735—Fusion polypeptide containing domain for protein-protein interaction containing a domain for self-assembly, e.g. a viral coat protein (includes phage display)

Definitions

  • the present invention relates generally to the field of immunology and specifically to human monoclonal antibodies which immunoreact with human cytomegalovirus.
  • HCMV Human cytomegalovirus
  • Immunodiagnostic methods are one of several approaches to detecting HCMV in tissues to facilitate prevention, cure or remediation of HCMV infection and
  • filamentous phage display vectors referred to as phagemids
  • the use of filamentous phage display vectors has been repeatedly shown to allow the efficient preparation of large libraries of monoclonal antibodies having diverse and novel immunospecificities.
  • the technology uses a filamentous phage coat protein membrane anchor domain as a means for linking gene-product and gene during the assembly stage of filamentous phage replication, and has been used for the cloning and expression of antibodies from combinatorial libraries. Kang et al, Proc. Natl. Acad. Sci.. USA. 88:4363-4366 (1991).
  • Combinatorial libraries of antibodies have been produced using both the cpVIII membrane anchor (Kang et al, supra) and the cpIII membrane anchor. Barbas et al, Proc. Natl. Acad. Sci.. USA. 88:7978-7982 (1991) .
  • the diversity of a filamentous phage-based combinatorial antibody library can be increased by shuffling of the heavy and light chain genes (Kang et al, Proc. Natl. Acad. Sci.. USA. 88:11120-11123, 1991) , by altering the CDR3 regions of the cloned heavy chain genes of the library (Barbas et al, Proc. Natl. Acad. Sci.. USA. 89:4457-4461, 1992), and by introducing random mutations into the library by error-prone polymerase chain reactions (PCR) . Gram et al, Proc. Natl. Acad. Sci.. USA. 89:3576-3580 (1992).
  • Filamentous phage display vectors have also been utilized to produce human monoclonal antibodies immunoreactive with hepatitis B virus (HBV) or HIV antigens. See, for example Zebedee et al, Proc. Natl. Acad. Sci.. USA. 89:3175-3179 (1992); and Burton et al, Proc. Natl. Acad. Sci.. USA. 88:10134-10137 (1991) , respectively.
  • HBV hepatitis B virus
  • the invention provides human monoclonal antibodies immunoreactive with HCMV, and also provides cell lines used to produce these monoclonal antibodies.
  • amino acid sequences which confer the unique immunospecific function to the antigen binding domain of a monoclonal antibody, and which can be used immunogenically to identify other antibodies that specifically bind HCMV.
  • the monoclonal antibodies of the invention find particular utility as reagents for the diagnosis or immunotherapy of HCMV-induced disease.
  • a major advantage of the monoclonal antibodies of the invention derives from the fact that they are encoded by a human polynucleotide sequence.
  • .in vivo use of the monoclonal antibodies of the invention for diagnosis or immunotherapy of HCMV-induced disease greatly reduces the problems of significant host immune response to the passively administered antibodies which is a problem commonly encountered when monoclonal antibodies of xenogeneic or chimeric derivation are utilized.
  • the invention contemplates a human monoclonal antibody capable of immunoreacting with human cytomegalovirus (HCMV) .
  • a preferred human monoclonal antibody has the binding specificity of a monoclonal antibody comprising a heavy chain immunoglobulin variable region amino acid residue sequence selected from the group consisting of SEQ ID NOs 74, 75 and 76, and conservative substitutions thereof.
  • Another preferred human monoclonal antibody has the binding specificity of a monoclonal antibody comprising a light chain immunoglobulin variable region amino acid residue sequence selected from the group consisting of SEQ ID NOs 77, 78 and 79, and conservative substitutions thereof.
  • the invention described a polynucleotide sequence encoding a heavy or light chain immunoglobulin variable region amino acid residue sequence portion of a human monoclonal antibody of this invention.
  • DNA expression vectors containing the polynucleotide, and host cells containing the vectors and polynucleotides of the invention.
  • the invention also contemplates a method of detecting human cytomegalovirus (HCMV) comprising contacting a sample suspected of containing HCMV with a diagnostically effective amount of the monoclonal antibody of this invention, and determining whether the monoclonal antibody immunoreacts with the sample.
  • the method can be practiced in vitro or in vivo, and may include a variety of methods for determining the presence of an immunoreaction product.
  • the invention describes a method for providing passive immunotherapy to human cytomegalovirus (HCMV) disease in a human, comprising administering to the human an immunotherapeutically effective amount of the monoclonal antibody of this invention.
  • the administration can be provided prophylactically, and by a parenteral administration.
  • Pharmaceutical compositions containing one or more of the different human monoclonal antibodies are described for use in the therapeutic methods of the invention.
  • Figure 1 illustrates the sequence of the double-stranded synthetic DNA inserted into Lambda Zap to produce a Lambda Hc2 expression vector.
  • the preparation of the double-stranded synthetic DNA insert is described in Example la2) .
  • the various features required for this vector to express the V H -coding DNA homologs include the Shine-Dalgarno ribosome binding site, a leader sequence to direct the expressed protein to the periplasm as described by Mouva et al., J. Biol. Che .. 255:27, 1980, and various restriction enzyme sites used to operatively link the V H homologs to the expression vector.
  • the V H expression vector sequence also contains a short nucleic acid sequence that codes for amino acids typically found in variable regions heavy chain (V H backbone) .
  • V H backbone is just upstream and in the proper reading as the V H DNA homologs that are operatively linked into the Xho I and Spe I cloning sites.
  • the sequences of the top and bottom strands of the double-stranded synthetic DNA insert are listed respectively in SEQ ID NO 1 and SEQ ID NO 2.
  • the ten amino acid sequence comprising the decapeptide tag is listed in SEQ ID NO 5.
  • the synthetic DNA insert is directionally ligated into Lambda Zap II digested with the restriction enzymes Not 1 and Xho I to form Lambda Hc2 expression vector.
  • Figure 2 illustrates the major features of the bacterial expression vector Lambda Hc2 (V H expression vector) .
  • the orientation of the insert in Lambda Zap II is shown.
  • the V H DNA homologs are inserted into the Xho I and Spe I cloning sites.
  • the read through transcription produces the decapeptide epitope (tag) that is located just 3' of the cloning site.
  • the amino acid residue sequence of the decapeptide tag and the Pel B leader sequence/spacer are respectively listed in SEQ ID NO 5 and 6.
  • Figure 3 illustrates the sequence of the double- stranded synthetic DNA inserted into Lambda Zap to produce a Lambda Lc2 expression vector.
  • the various features required for this vector to express the V L - coding DNA homologs are described in Figure 1.
  • the V L -coding DNA homologs are operatively linked into the Lc2 sequence at the Sac I and Xho I restriction sites.
  • the sequences of the top and bottom strands of the double-stranded synthetic DNA insert are listed respectively in SEQ ID NO 3 and SEQ ID NO 4.
  • the synthetic DNA insert is directionally ligated into Lambda Zap II digested with the restriction enzymes Sac I and Not I to form Lambda Lc2 expression vector.
  • Figure 4 illustrates the major features of the bacterial expression vector Lc2 (V L expression vector) .
  • the synthetic DNA sequence from Figure 3 is shown at the top along with the LacZ promoter from Lambda Zap II. The orientation of the insert in Lambda Zap II is shown.
  • the V L DNA homologs are inserted into the Sac I and Xho I cloning sites.
  • the amino acid residue sequence of the Pel B leader sequence/spacer is listed in SEQ ID NO 7.
  • Figure 5 illustrates the dicistronic expression vector, pComb, in the form of a phagemid expression vector.
  • Figure 6 illustrates, in two figures, Figure 6A and 6B, plasmid maps of the heavy (pTACOlH) and light chain (pTCOl) replicon-compatible chain-shuffling vectors, respectively. Both plasmids are very similar in the section containing the promoter and the cloning site.
  • tacPO tac promoter/operon
  • 5 histidine amino acid residue tag (histidine)5-tail 5 histidine amino acid residue tag (histidine)5-tail
  • fllG intergenic region of fl-phage
  • stu stuffer fragment ready for in-frame replacement by light and heavy chain, respectively
  • cat chloramphenicol transferase gene
  • bla b-lactamase gene
  • ori origin of replication.
  • the map is drawn approximately to scale.
  • Figure 7 illustrates the nucleotide sequences of the binary shuffling vectors in two Figures, 7A and 7B.
  • the construction and use of the vectors is described in Example 6.
  • Figure 7A the double-stranded nucleotide sequence of the multiple cloning site in light chain vector, pTCOl, is shown.
  • the sequences of the top and bottom nucleotide base strands are listed respectively in SEQ ID NO 8 and SEQ ID NO 9.
  • the amino acid residue sequence comprising the pelB leader ending in the Sac I restriction site is listed in SEQ ID NO 10.
  • Figure 7B the nucleotide sequence of the multiple cloning site in heavy chain vector, pTACOlH, is shown.
  • sequences of the top and bottom nucleotide base strands are listed respectively in SEQ ID NO 11 and SEQ ID NO 12.
  • amino acid residue sequence comprising the pelB leader ending in the Xho I restriction site is listed as SEQ ID NO 13.
  • amino acid residue sequence comprising the histidine tail is listed in SEQ ID NO 14.
  • Relevant restriction sites are underlined, tac promoter and ribosome binding site (rbs) are indicated by boxes.
  • Figure 8 shows the amino acid residue sequence of Fabs GL4, GL11, and GL18. The amino acid residue sequence was deduced from the nucleotide sequence which was determined as described in Example 5.
  • Figure 8A shows the heavy chain variable region amino acid residues while Figure 8B illustrates the light chain variable region amino acid residues.
  • the sequenced regions of each Fab listed from right to left are framework region 1 (FR1) , complementary determining region 1 (CDR1) , framework region 2 (FR2) , complementary determining region 2 (CDR2) , framework region 3 (FR3) , complementary determining region 3
  • CDR3 framework region 4
  • FR4 framework region 4
  • the amino acid sequence residues in the framework 1 and framework 4 regions of the light chains have not been determined and are therefore not shown.
  • the amino acid residue sequence of the heavy chain region of GL Fabs 11, 8, and 15 is identical and is shown in Figure 8A.
  • the amino acid residue sequence of the heavy chain region of GL Fabs 4 and 18 are identical.
  • the amino acid residue sequence of the CDR1, FR2, CDR2, FR3, and CDR3 regions of the light chain of GL Fabs 11, 8, and 15 is identical and is shown in Figure 8B.
  • Figure 9 is an autoradiogram which illustrates the results of specific immunoprecipitation of HCMV- infected cells with the Fabs 4, 5, 11, 14, and 34 and monoclonal antibodies which are specific for HCMV proteins as described in Example 6.
  • Lane 1 contains proteins of 200, 97, 65, and 46 kD in molecular weight. The molecular weights corresponding to these proteins are given in the left hand margin of the figure. No proteins are present in Lane 2.
  • Lanes 3, 4, 5, 6, and 8 contain the proteins immunoprecipitated with monoclonal antibodies gB, IE 1 and 2, ICP 36, ICP 8, and gH, respectively.
  • Lane 7 contains the proteins of a total cell lysate from the HCMV-infected cells.
  • Lanes 8, 9, 10, 12, 14, and 15 contain proteins which were immunoprecipitated with Fabs GL4, GL5, GL11, GL14, and GL 34, respectively.
  • Lanes 11 and 13 contain proteins which were immunoprecipitated with purified Fabs GL11 and GL14, respectively.
  • Amino Acid Residue An amino acid formed upon chemical digestion (hydrolysis) of a polypeptide at its peptide linkages.
  • the amino acid residues described herein are preferably in the "L” isomeric form. However, residues in the "D" isomeric form can be substituted for any L-amino acid residue, as long as the desired functional property is retained by the polypeptide.
  • NH 2 refers to the free amino group present at the amino terminus of a polypeptide.
  • COOH refers to the free carboxy group present at the carboxy terminus of a polypeptide.
  • amino acid residue sequences represented herein by formulae have a left- to-right orientation in the conventional direction of amino terminus to carboxy terminus.
  • amino acid residue is broadly defined to include the amino acids listed in the Table of Correspondence and modified and unusual amino acids, such as those listed in 37 CFR 1.822(b)(4), and incorporated herein by reference.
  • a dash at the beginning or end of an amino acid residue sequence indicates a peptide bond to a further sequence of one or more amino acid residues or a covalent bond to an amino-terminal group such as NH 2 or acetyl or to a carboxy-terminal group such as COOH.
  • rDNA Recombinant DNA
  • a recombinant DNA molecule is a hybrid DNA molecule comprising at least two nucleotide sequences not normally found together in nature. rDNA's not having a common biological origin, i.e., evolutionarily different, are said to be "heterologous”.
  • Vector a rDNA molecule capable of autonomous replication in a cell and to which a DNA segment, e.g., gene or polynucleotide, can be operatively linked so as to bring about replication of the attached segment.
  • a DNA segment e.g., gene or polynucleotide
  • Vectors capable of directing the expression of genes encoding for one or more polypeptides are referred to herein as "expression vectors”.
  • Particularly important vectors allow cloning of cDNA (complementary DNA) from mRNAs produced using reverse transcriptase.
  • a receptor is a molecule, such as a protein, glycoprotein and the like, that can specifically (non-randomly) bind to another molecule.
  • Antibody The term antibody in its various grammatical forms is used herein to refer to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antibody combining site or paratope. Exemplary antibody molecules are intact immunoglobulin molecules, substantially intact immunoglobulin molecules and portions of an immunoglobulin molecule, including those portions known in the art as Fab, Fab', F(ab') 2 and F(v) .
  • An antibody combining site is that structural portion of an antibody molecule comprised of a heavy and light chain variable and hypervariable regions that specifically binds (immunoreacts with) an antigen.
  • the term immunoreact in its various forms means specific binding between an antigenic determinant-containing molecule and a molecule containing an antibody combining site such as a whole antibody molecule or a portion thereof.
  • Monoclonal Antibody A monoclonal antibody in its various grammatical forms refers to a population of antibody molecules that contain only one species of antibody combining site capable of immunoreacting with a particular epitope. A monoclonal antibody thus typically displays a single binding affinity for any epitope with which it immunoreacts.
  • a monoclonal antibody may therefore contain an antibody molecule having a plurality of antibody combining sites, each immunospecific for a different epitope, e.g., a bispecific monoclonal antibody.
  • a monoclonal antibody was produced by immortalization of a clonally pure immunoglobulin secreting cell line, a monoclonally pure population of antibody molecules can also be prepared by the methods of the present invention.
  • Fusion Polypeptide A polypeptide comprised of at least two polypeptides and a linking sequence to operatively link the two polypeptides into one continuous polypeptide.
  • the two polypeptides linked in a fusion polypeptide are typically derived from two independent sources, and therefore a fusion polypeptide comprises two linked polypeptides not normally found linked in nature.
  • Upstream In the direction opposite to the direction of DNA transcription, and therefore going from 5' to 3' on the non-coding strand, or 3' to 5* on the mRNA.
  • Downstream Further along a DNA sequence in the direction of sequence transcription or read out, that is traveling in a 3'- to 5'-direction along the non- coding strand of the DNA or 5'- to 3'-direction along the RNA transcript.
  • Cistron Sequence of nucleotides in a DNA molecule coding for an amino acid residue sequence and including upstream and downstream DNA expression control elements.
  • Leader Polypeptide A short length of amino acid sequence at the amino end of a polypeptide, which carries or directs the polypeptide through the inner membrane and so ensures its eventual secretion into the periplasmic space and perhaps beyond.
  • the leader sequence peptide is commonly removed before the polypeptide becomes active.
  • Reading Frame Particular sequence of contiguous nucleotide triplets (codons) employed in translation. The reading frame depends on the location of the translation initiation codon.
  • the present invention relates to human mono ⁇ clonal antibodies which are specific for human cytomegalovirus (HCMV) . Also disclosed is an antibody having a specified amino acid sequence, which sequence - 15 -
  • HCMV-induced disease means any disease caused, directly or indirectly, by HCMV.
  • An example of a HCMV-induced disease is any of the numerous conditions associated generally with HCMV infection well known in the art, including but not limited to those described herein.
  • the present invention is directed to specific human monoclonal antibodies which are reactive with an HCMV antigen and cell lines which produce such antibodies.
  • the isolation of cell lines producing monoclonal antibodies of the invention is described in great detail further herein, and can be accomplished using the phagemid vector library methods described herein, and using routine screening techniques which permit determination of the elementary immunoreaction and/or neutralization patterns of the monoclonal antibody of interest.
  • routine screening techniques which permit determination of the elementary immunoreaction and/or neutralization patterns of the monoclonal antibody of interest.
  • a human monoclonal antibody has the same (i.e., equivalent) specificity as a human monoclonal antibody of this invention by ascertaining whether the former prevents the latter from binding to HCMV. If the human monoclonal antibody being tested competes with the human monoclonal antibody of the invention, as shown by a decrease in binding by the human monoclonal antibody of the invention in standard competition assays for binding, for example, to a solid phase HCMV antigen, then it is likely that the two monoclonal antibodies bind to the same, or a closely related, epitope on the antigen.
  • Still another way to determine whether a human monoclonal antibody has the specificity of a human monoclonal antibody of the invention is to pre- incubate the human monoclonal antibody of the invention with HCMV with which it is normally reactive, and then add the human monoclonal antibody being tested to determine if the human monoclonal antibody being tested is inhibited in its ability to bind HCMV. If the human monoclonal antibody being tested is inhibited then, in all likelihood, it has the same, or functionally equivalent, epitopic specificity as the monoclonal antibody of the invention. Screening of human monoclonal antibodies of the invention, can be also carried out utilizing HCMV neutralization assays and determining whether the monoclonal antibody neutralizes HCMV.
  • Virus neutralization can be measured by a variety of in vitro and in vivo methodologies. Exemplary methods described herein for determining the capacity for neutralization are the in vitro assays that measure inhibition of HCMV-induced syncytia formation, and assays that measure the inhibition of output of a preselected viral antigen from a cell infected with HCMV.
  • the immunospecificity of a human monoclonal antibody of this invention can be directed to epitopes that are shared across serotypes and/or strains of HCMV, or can be specific for a single strain of HCMV, depending upon the epitope.
  • the immunospecificity of an antibody, its HCMV- neutralizing capacity, and the attendant affinity the antibody exhibits for the epitope are defined by the epitope with which the antibody immunoreacts.
  • the epitope specificity is defined at least in part by the amino acid residue sequence of the variable region of the heavy chain of the immunoglobulin the antibody, and in part by the light chain variable region amino acid residue sequence.
  • a preferred human monoclonal antibody of this invention has the binding specificity of a monoclonal antibody comprising a heavy chain immunoglobulin variable region amino acid residue sequence selected from the group of sequences consisting of SEQ ID NOs 74, 75 and 76, and conservative substitutions thereof.
  • Another preferred human monoclonal antibody of this invention has the binding specificity of a monoclonal antibody having a light chain immunoglobulin variable region amino acid residue sequence selected from the group of sequences consisting of SEQ ID NOs 77, 78 and 79, and conservative substitutions thereof.
  • H:L new heavy and light chain pairs
  • Particularly preferred human monoclonal antibodies are those having the immunoreaction (binding) specificity of a monoclonal antibody having heavy and light chain immunoglobulin variable region amino acid residue sequences in pairs (H:L) selected from the group consisting of SEQ ID NOs 74/77, 75/78, 76/79 and 76/77, and conservative substitutions thereof.
  • the designation of two SEQ ID NOs together, e.g., 74/77 is to connote a H:L pair formed by the heavy and light chain, respectively, amino acid residue sequences shown in SEQ ID NO 74 and SEQ ID NO 77, respectively.
  • a human monoclonal antibody having the binding specificity of the monoclonal antibody produced by the E. coli microorganism deposited with the ATCC, as described further herein.
  • conservative variations include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as the substitution of arginine for lysine, glutamic for aspartic acids, or glutamine for asparagine, and the like.
  • conservative variation also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid provided that antibodies having the substituted polypeptide also immunoreact with HCMV.
  • another preferred embodiment of the invention relates to polynucleotides which encode the above noted heavy and/or light chain polypeptides and to polynucleotide sequences which are complementary to these polynucleotide sequences.
  • Complementary polynucleotide sequences include those sequences which hybridize to the polynucleotide sequences of the invention under stringent hybridization conditions.
  • a human antibody immunoreactive with an HCMV "early" antigen known as p65 is provided that is particularly useful in the diagnostic methods described herein.
  • HCMV p65 is believed to be an important antigen that arises early in the course of HCMV infection, and therefor is useful as a marker early on after infection to indicate active HCMV infection.
  • anti- idiotypic antibodies which can be used to screen human monoclonal antibodies to identify whether the antibody has the same binding specificity as a human monoclonal antibody of the invention and also used for active immunization (Herlyn et al.. Science, 232:100, 1986).
  • anti-idiotypic antibodies can be produced using well-known hybridoma techniques (Kohler et al.. Nature. 256:495, 1975).
  • An anti-idiotypic antibody is an antibody which recognizes unique determinants present on the human monoclonal antibody produced by the cell line of interest. These determinants are located in the hypervariable region of the antibody.
  • An anti-idiotypic antibody can be prepared by immunizing an animal with the monoclonal antibody of interest. The immunized animal will recognize and respond to the idiotypic determinants of the immunizing antibody and produce an antibody to these idiotypic determinants.
  • the anti-idiotypic antibodies of the immunized animal which are specific for the human monoclonal antibody of the invention produced by a cell line which was used to immunize the second animal, it is now possible to identify other clones with the same idiotype as the antibody of the hybridoma used for immunization.
  • Idiotypic identity between human monoclonal antibodies of two cell lines demonstrates that the two monoclonal antibodies are the same with respect to their recognition of the same epitopic determinant.
  • anti-idiotypic antibodies it is possible to identify other hybridomas expressing monoclonal antibodies having the same epitopic specificity.
  • anti-idiotype technology it is also possible to use the anti-idiotype technology to produce monoclonal antibodies which mimic an epitope.
  • an anti-idiotypic monoclonal antibody made to a first monoclonal antibody will have a binding domain in the hypervariable region which is the "image" of the epitope bound by the first monoclonal antibody.
  • the anti-idiotypic monoclonal antibody can be used for immunization, since the anti-idiotype monoclonal antibody binding domain effectively acts as an antigen.
  • the invention contemplates a truncated immunoglobulin molecule comprising a Fab fragment derived from a human monoclonal antibody of this invention.
  • the Fab fragment lacking Fc receptor, is soluble, and affords therapeutic advantages in serum half life, and diagnostic advantages in modes of using the soluble Fab fragment.
  • the preparation of a soluble Fab fragment is generally known in the immunological arts and can be accomplished by a variety of methods. A preferred method of producing a soluble Fab fragment is described herein.
  • the human monoclonal antibodies can also be used immunotherapeutically for HCMV disease.
  • immunotherapeutically or “immunotherapy” as used herein in conjunction with the monoclonal antibodies of the invention denotes both prophylactic as well as therapeutic administration.
  • the monoclonal antibodies can be administered to high-risk patients in order to lessen the likelihood and/or severity of HCMV-induced disease, administered to patients already evidencing active HCMV infection, or administered to patients at risk of HCMV infection.
  • Therapeutic Compositions The present invention therefore contemplates therapeutic compositions useful for practicing the therapeutic methods described herein.
  • Therapeutic compositions of the present invention contain a physiologically tolerable carrier together with at least one species of human monoclonal antibody that is capable of neutralizing HCMV as described herein, dissolved or dispersed therein as an active ingredient.
  • the therapeutic composition is not immunogenic when administered to a human patient for therapeutic purposes, unless that purpose is to induce an immune response, as described elsewhere herein.
  • compositions, carriers, diluents and reagents are used interchangeably and represent that the materials are capable of administration to or upon a human without the production of undesirable physiological effects such as nausea, dizziness, gastric upset and the like.
  • compositions that contains active ingredients dissolved or dispersed therein are well understood in the art.
  • compositions are prepared as sterile injectables either as liquid solutions or suspensions, aqueous or non-aqueous, however, solid forms suitable for solution, or suspensions, in liquid prior to use can also be prepared.
  • the preparation can also be emulsified.
  • the active ingredient can be mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient and in amounts suitable for use in the therapeutic methods described herein.
  • Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol or the like and combinations thereof.
  • the composition can contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents and the like which enhance the effectiveness of the active ingredient.
  • the therapeutic composition of the present invention can include pharmaceutically acceptable salts of the components therein.
  • Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the polypeptide) that are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, tartaric, mandelic and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine and the like.
  • Physiologically tolerable carriers are well known in the art.
  • Exemplary of liquid carriers are sterile aqueous solutions that contain no materials in addition to the active ingredients and water, or contain a buffer such as sodium phosphate at physiological pH value, physiological saline or both, such as phosphate-buffered saline.
  • aqueous carriers can contain more than one buffer salt, as well as salts such as sodium and potassium chlorides, dextrose,propylene glycon, polyethylene glycol and other solutes.
  • Liquid compositions can also contain liquid phases in addition to and to the exclusion of water.
  • additional liquid phases are glycerin, vegetable oils such as cottonseed oil, organic esters such as ethyl oleate, and water-oil emulsions.
  • a therapeutic composition contains an HCMV- neutralizing of a human monoclonal antibody of the present invention, typically an amount of at least 0.1 weight percent of antibody per weight of total therapeutic composition.
  • a weight percent is a ratio by weight of antibody to total composition.
  • 0.1 weight percent is 0.1 grams of antibody per 100 grams of total composition.
  • a human monoclonal antibody of the present invention may have the capacity to neutralize HCMV
  • the present disclosure provides for a method for neutralizing HCMV in vitro or in vivo. The method comprises contacting a sample believed to contain HCMV with a composition comprising a therapeutically effective amount of a human monoclonal antibody of this invention.
  • the method comprises administering to the patient a therapeutically effective amount of a physiologically tolerable composition containing a human monoclonal antibody of the invention.
  • a method for providing passive immunotherapy to HCMV disease in a human comprising administering to the human an immunotherapeutically effective amount of the monoclonal antibody of this invention.
  • a representative patient for practicing the present passive immunotherapeutic methods is any human exhibiting symptoms of HCMV-induced disease, including conditions believed to be caused by HCMV infection, and humans at risk of HCMV infection.
  • Patients at risk of infection by HCMV include babies of HCMV- infected pregnant mothers, recipients of transfusions or organ transplants, immunocompromised individuals, and the like risk situations.
  • the passive immunization method comprises administering a composition comprising more than one species of human monoclonal antibody of this invention, preferably directed to non-competing epitopes or to distinct strains of HCMV, as to afford increased effectiveness of the passive immunotherapy.
  • a therapeutically (immunotherapeutically) effective amount of a human monoclonal antibody is a predetermined amount calculated to achieve the desired effect, i.e., to neutralize the HCMV present in the sample or in the patient, and thereby decrease the amount of infectious HCMV in the sample or patient.
  • an effective amount can be measured by improvements in one or more symptoms associated with HCMV-induced disease occurring in the patient, or by serological decreases in HCMV antigens.
  • the dosage ranges for the administration of the monoclonal antibodies of the invention are those large enough to produce the desired effect in which the symptoms of the HCMV disease are ameliorated or the likelihood of infection decreased.
  • the dosage should not be so large as to cause adverse side effects, such as hyperviscosity syndromes, pulmonary edema, congestive heart failure, and the like.
  • the dosage will vary with the age, condition, sex and extent of the disease in the patient and can be determined by one of skill in the art.
  • the dosage can be adjusted by the individual physician in the event of any complication.
  • a therapeutically effective amount of an antibody of this invention is typically an amount of antibody such that when administered in a physiologically tolerable composition is sufficient to achieve a plasma concentration of from about 0.1 microgram (ug) per milliliter (ml) to about 100 ug/ml, preferably from about 1 ug/ml to about 5 ug/ml, and usually about 5 ug/ml.
  • the dosage can vary from about 0.1 mg/kg to about 300 mg/kg, preferably from about 0.2 mg/kg to about 200 mg/kg, most preferably from about 0.5 mg/kg to about 20 mg/kg, in one or more dose administrations daily, for one or several days.
  • the human monoclonal antibodies of the invention capable of neutralizing HCMV can be administered parenterally by injection, by gradual infusion over time, or by inhalation of an aerosol, to * ⁇ ame a few routes.
  • HCMV infection is typically systemic and therefore most often treated by intravenous administration of therapeutic compositions, other tissues and delivery means are contemplated where there is a likelihood that the tissue targeted contains infectious HCMV.
  • HCMV- neutralizing human monoclonal antibodies of the inven ⁇ tion can be administered intravenously, intraperitoneally, intramuscularly, subcutaneously, intranasally, intracavity, transdermally, as an aerosol by inhalation orally or nasally to the airways and lung tissues, and can be delivered by peristaltic means.
  • the therapeutic compositions containing a human monoclonal antibody of this invention are conventionally administered in a unit dose, for example.
  • unit dose when used in reference to a therapeutic composition of the present invention refers to physically discrete units suitable as unitary dosage for the subject, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required diluent; i.e., carrier, or vehicle.
  • compositions are administered in a manner compatible with the dosage formulation, and in a therapeutically effective amount.
  • quantity to be administered depends on the subject to be treated, capacity of the subject's system to utilize the active ingredient, and degree of therapeutic effect desired. Precise amounts of active ingredient required to be administered depend on the judgement of the practitioner and are peculiar to each individual.
  • suitable dosage ranges for systemic application are disclosed herein and depend on the route of administration. Suitable regimes for administration are also variable, but are typified by an initial administration followed by repeated doses at one or more hour intervals by a subsequent injection or other administration. Alternatively, continuous intravenous infusion sufficient to maintain concentrations in the blood in the ranges specified for in vivo therapies are contemplated.
  • the invention also relates to a method for preparing a medicament or pharmaceutical composition comprising an HCMV-neutralizing human monoclonal antibody of the invention, the medicament being used for immunotherapy of HCMV disease.
  • the method comprises well known step(s) of admixing the therapeutic antibody with one or more carriers, excipients and/or buffers of the composition in the ratios described herein.
  • a diagnostic method for detecting a monoclonal antibody in the subject's blood is useful to characterize the fate of the administered therapeutic composition.
  • the present invention contemplates various assay methods for determining the presence, and preferably amount, of HCMV or HCMV antigens in a tissue or sample such as a biological fluid or tissue sample using a human monoclonal antibody of this invention as an immunochemical reagent to form an immunoreaction product whose amount relates, either directly or indirectly, to the amount of HCMV in the sample.
  • the method generally comprises contacting a sample suspected to contain HCMV with a diagnostically effective amount of a monoclonal antibody of this invention under immunoreaction conditions, and determining whether the monoclonal antibody immunoreacts with any HCMV antigens in the sample.
  • immunoassays which can utilize monoclonal antibodies of the invention are competitive and non-competitive immunoassays in either a direct or indirect format.
  • immunoassays are the radioimmunoassay (RIA) , the sandwich
  • immunoassay immunometric assay
  • radio-immunoprecipitation (RIP) methods radio-immunoprecipitation methods
  • western blotting indirect immunofluorescence (IIF) assays
  • IIF indirect immunofluorescence
  • Detection of the antigens using the monoclonal antibodies of the invention can be done utilizing immunoassays which are run in either the forward, reverse, or simultaneous modes, including immunohistochemical assays on physiological samples in vivo or in vitro. Those of skill in the art will know, or can readily discern, other immunoassay formats without undue experimentation.
  • the monoclonal antibodies of the invention can be bound to many different carriers and used to detect the presence of HCMV.
  • carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, agaroses and magnetite.
  • the nature of the carrier can be either soluble or insoluble for purposes of the invention.
  • suitable carriers for binding monoclonal antibodies or will be able to ascertain such, using routine experimentation. There are many different labels and methods of labeling known to those of ordinary skill in the art.
  • Examples of the types of labels which can be used in the present invention include enzymes, radioisotopes, fluorescent compounds, colloidal metals, chemiluminescent compounds, and bio-luminescent com- pounds.
  • Those of ordinary skill in the art will know of other suitable labels for binding to the monoclonal antibodies of the invention, or will be able to ascertain such, using routine experimentation.
  • the binding of these labels to the monoclonal antibodies of the invention can be done using standard techniques common to those of ordinary skill in the art.
  • HCMV or HCMV antigens may be detected by the monoclonal antibodies of the invention when present in samples of biological fluids and tissues.
  • Any sample containing a detectable amount of HCMV can be used.
  • a sample can be a liquid such as urine, saliva, cerebrospinal fluid, blood, serum and the like, a suspension of cells, such as peripheral blood leukocytes (PBL), or a solid or semi-solid such as tissues, feces, and the like, or, alternatively, a solid tissue such as those commonly used in histological diagnosis.
  • PBL peripheral blood leukocytes
  • Another labeling technique which may result in greater sensitivity consists of coupling the antibodies to low molecular weight haptens. These haptens can then be specifically detected by means of a second reaction. For example, it is common to use haptens such as biotin, which reacts with avidin, or dinitrophenol, pyridoxal, or fluorescein, which can react with specific anti-hapten antibodies.
  • the monoclonal antibodies of the invention are suited for use in vitro, for example, in immunoassays in which they can be utilized in liquid phase or bound to a solid phase carrier for the detection of HCMV in samples, as described above.
  • the monoclonal antibodies in these immunoassays can be detectably labeled in various ways for in vitro use.
  • the detectably labeled human monoclonal antibody is given in a dose which is diagnostically effective.
  • diagnostically effective means that the amount of detectably labeled human monoclonal antibody is administered in sufficient quantity to enable detection of the site having the HCMV antigen for which the monoclonal antibodies are specific.
  • the concentration of detectably labeled human monoclonal antibody which is administered should be sufficient such that the binding to HCMV is detectable compared to the background. Further, it is desirable that the detectably labeled monoclonal antibody be rapidly cleared from the circulatory system in order to give the best target-to-background signal ratio.
  • the dosage of detectably labeled human monoclonal antibody for in vivo diagnosis will vary depending on such factors as age, sex, and extent of disease of the individual.
  • the dosage of human monoclonal antibody can vary from about 0.01 mg/m 2 to about 500 mg/m 2 , preferably 0.1 mg/m 2 to about 200 mg/m 2 , most preferably about 0.1 mg/m 2 to about 10 mg/m 2 .
  • Such dosages may vary, for example, depending on whether multiple injections are given, tissue, and other factors known to those of skill in the art.
  • the type of detection instrument available is a major factor in selecting a given radioisotope.
  • the radioisotope chosen must have a type of decay which is detectable for a given type of instrument. Still another important factor in selecting a radioisotope for in vivo diagnosis is that the half-life of the radioisotope be long enough so that it is still detectable at the time of maximum uptake by the target, but short enough so that deleterious radiation with respect to the host is minimized. Ideally, a radioisotope used for in vivo imaging will lack a particle emission, but produce a large number of photons in the 140-250 keV range, which may be readily detected by conventional gamma cameras.
  • radioisotopes may be bound to immunoglobulin either directly or indirectly by using an intermediate functional group.
  • Intermediate functional groups which often are used to bind radioisotopes which exist as metallic ions to immunoglobulins are the bifunctional chelating agents such as diethylenetriaminepentacetic acid (DTPA) and ethylenediaminetetraacetic acid (EDTA) and similar molecules.
  • DTPA diethylenetriaminepentacetic acid
  • EDTA ethylenediaminetetraacetic acid
  • metallic ions which can be bound to the monoclonal antibodies of the invention are 111 In, 97 Ru, 67 Ga, ⁇ Ga, 72 As, 8 Zr, and 201 T1.
  • the monoclonal antibodies of the invention can also be labeled with a paramagnetic isotope for purposes of in vivo diagnosis, as in magnetic resonance imaging (MRI) or electron spin resonance (ESR) .
  • MRI magnetic resonance imaging
  • ESR electron spin resonance
  • any conventional method for visualizing diagnostic imaging can be utilized.
  • gamma and positron emitting radioisotopes are used for camera imaging and paramagnetic isotopes for MRI.
  • Elements which are particularly useful in such techniques include 157 Gd, 55 Mn, 1o2 Dy, 52 Cr, and 56 Fe.
  • the human monoclonal antibodies of the invention can be used in vitro and in vivo to monitor the course of HCMV disease therapy. Thus, for example, by measuring the increase or decrease in the number of cells infected with HCMV or changes in the concentration of HCMV present in the body or in various body fluids, it would be possible to determine whether a particular therapeutic regimen aimed at ameliorating the HCMV disease is effective.
  • the invention provides a method for determining whether a human patient has neutralizing anti-human cytomegalovirus (HCMV) antibodies in their circulation.
  • the method detects whether circulating antibodies are present in the patient which are immunoreactive to a neutralizing epitope defined by a neutralizing antibody of the present invention. Determining whether a patient has HCMV-neutralizing antibodies, and particularly determining the immunospecificity of the neutralizing antibodies, if any, is useful to ascertain the condition of the patient, and particularly to identify whether administration of supplemental neutralizing antibodies, may be an efficacious therapy.
  • HCMV anti-human cytomegalovirus
  • the method comprises the steps of: a) contacting a blood sample from a patient with (i) a solid support containing HCMV antigens attached thereto and (ii) a diagnostically effective amount of the monoclonal antibody of this invention under competition immunoreaction admixture conditions sufficient for the monoclonal antibody to compete with any neutralizing HCMV antibodies in the sample for binding to the solid support antigen, and form bound antibody, and b) characterizing the bound antibody, and thereby determining the amount of neutralizing antibodies in the sample.
  • the blood sample can be in any of a variety of forms including whole blood, plasma or serum.
  • the HCMV antigen can be a whole HCMV virus lysate, or can be specific preselected antigen(s) known to immunoreact with the antibody to be detected. Attachment of antigen to a solid support is well known as described herein, and can be adsorbed or linked to any of the supports described. Competition immunoreaction conditions are time, temperature and buffer conditions compatible with immunoreaction, as is well known, in the presence of both the monoclonal antibody and the antibody to be detected (target antibody) .
  • the resulting immunoreacted antibody to the solid phase antigen will be the monoclonal antibody if no target antibody is present, and will be target antibody, or mixtures thereof, depending upon the concentration and affinity of the target antibody. Characterization of bound antibody can be conducted by any of a variety of methods. For example, depletion of labeled monoclonal antibody in the liquid phase indicates the amount of monoclonal antibody bound. Alternatively, the amount of monoclonal antibody bound may be detected. Again, detection can be directed at measuring the amount of target antibody that competes and is bound in the solid phase.
  • the invention contemplates methods for detecting the amount of administered antibody in a patient, ie, for monitoring the fate of administered antibody of this invention. The method is practiced as described above to detect target antibody in a patient.
  • the present invention also describes a diagnostic system, preferably in kit form, for assaying for the presence of HCMV in a sample according to the diagnostic methods described herein.
  • a diagnostic system includes, in an amount sufficient to perform at least one assay, a subject human monoclonal antibody, as a separately packaged reagent.
  • a diagnostic system is contemplated for assaying for the presence of an anti- HCMV monoclonal antibody in a body fluid sample such as for monitoring the fate of administered antibody.
  • the system includes, in an amount sufficient for at least one assay, a subject antibody as a control reagent, and preferably a preselected amount of HCMV antigen, each as separately packaged immunochemical reagents.
  • Instructions for use of the packaged reagent are also typically included.
  • Instructions for use typically include a tangible expression describing the reagent concentration or at least one assay method parameter such as the relative amounts of reagent and sample to be admixed, maintenance time periods for reagent/ sample admixtures, temperature, buffer conditions and the like.
  • a diagnostic system of the present invention can include a label or indicating means capable of signaling the formation of an immunocomplex containing a human monoclonal antibody of the present invention.
  • the word "complex” as used herein refers to the product of a specific binding reaction such as an antibody-antigen reaction. Exemplary complexes are immunoreaction products.
  • label and "indicating means” in their various grammatical forms refer to single atoms and molecules that are either directly or indirectly involved in the production of a detectable signal to indicate the presence of a complex. Any label or indicating means can be linked to or incorporated in an expressed protein, polypeptide, or antibody molecule that is part of an antibody or monoclonal antibody composition of the present invention, or used separately, and those atoms or molecules can be used alone or in conjunction with additional reagents. Such labels are themselves well- known in clinical diagnostic chemistry and constitute a part of this invention only insofar as they are utilized with otherwise novel proteins methods and/or systems.
  • the labeling means can be a fluorescent labeling agent that chemically binds to antibodies or antigens without denaturing them to form a fluorochrome (dye) that is a useful immunofluorescent tracer.
  • Suitable fluorescent labeling agents are fluorochromes such as fluorescein isocyanate (FIC) , fluorescein isothiocyanate (FITC) , 5-dimethylamine-l- naphthalenesulfonyl chloride (DANSC) , tetramethylrhodamine isothiocyanate (TRITC) , lissamine, rhodamine 8200 sulphonyl chloride (RB 200 SC) and the like.
  • fluorochromes such as fluorescein isocyanate (FIC) , fluorescein isothiocyanate (FITC) , 5-dimethylamine-l- naphthalenesulfonyl chloride (DANSC) , tetra
  • the indicating group is an enzyme, such as horseradish peroxidase (HRP) , glucose oxidase, or the like.
  • HRP horseradish peroxidase
  • glucose oxidase or the like.
  • additional reagents are required to visualize the fact that a receptor-ligand complex (immunoreactant) has formed.
  • additional reagents for HRP include hydrogen peroxide and an oxidation dye precursor such as diaminobenzidine.
  • An additional reagent useful with glucose oxidase is 2,2'-amino-di- (3-ethyl-benzthiazoline-G-sulfonic acid) (ABTS) .
  • Radioactive elements are also useful labeling agents and are used illustratively herein.
  • An exemplary radiolabeling agent is a radioactive element that produces gamma ray emissions. Elements which themselves emit gamma rays, such as ⁇ • ⁇ • I, 125 I, 18 I, 132 I and 51 Cr represent one class of gamma ray emission- producing radioactive element indicating groups. Particularly preferred is 125 I.
  • Another group of useful labeling means are those elements such as 1 C, 18 F, 15 0 and 13 N which themselves emit positrons. The positrons so emitted produce gamma rays upon encounters with electrons present in the animal's body. Also useful is a beta emitter, such 111 indium of 3 H.
  • labeling of, polypeptides and proteins is well known in the art.
  • antibody molecules produced by a hybridoma can be labeled by metabolic incorporation of radioisotope-containing amino acids provided as a component in the culture medium.
  • the techniques of protein conjugation or coupling through activated functional groups are particularly applicable. See, for example, Aurameas et al., Scand. J. Immunol.. Vol. 8 Suppl. 7:7-23 (1978), Rodwell et al., Biotech.. 3:889-894 (1984), and U.S. Pat. No.
  • the diagnostic systems can also include, preferably as a separate package, a specific binding agent.
  • a "specific binding agent” is a molecular entity capable of selectively binding a reagent species of the present invention or a complex containing such a species, but is not itself a polypeptide or antibody molecule composition of the present invention.
  • Exemplary specific binding agents are second antibody molecules, complement proteins or fragments thereof, S. aureus protein A, and the like.
  • the specific binding agent binds the reagent species when that species is present as part of a complex.
  • the specific binding agent is labeled.
  • the agent is typically used as an amplifying means or reagent.
  • the labeled specific binding agent is capable of specifically binding the amplifying means when the amplifying means is bound to a reagent species-containing complex.
  • the diagnostic kits of the present invention can be used in an "ELISA" format to detect the quantity of an APC inhibitor of this invention in a vascular fluid sample such as blood, serum, or plasma.
  • ELISA refers to an enzyme-linked immunosorbent assay that employs an antibody or antigen bound to a solid phase and an enzyme-antigen or enzyme-antibody conjugate to detect and quantify the amount of an antigen present in a sample.
  • a description of the ELISA technique is found in Chapter 22 of the 4th Edition of Basic and Clinical Immunology by D.P. Sites et al., published by Lange Medical Publications of Los Altos, CA in 1982 and in U.S. Patents No. 3,654,090; No. 3,850,752; and No. 4,016,043, which are all incorporated herein by reference.
  • a human monoclonal antibody of the present invention can be affixed to a solid matrix to form a solid support that comprises a package in the subject diagnostic systems.
  • a reagent is typically affixed to a solid matrix by adsorption from an aqueous medium although other modes of affixation applicable to proteins and polypeptides well known to those skilled in the art, can be used.
  • Useful solid matrices are also well known in the art. Such materials are water insoluble and include the cross-linked dextran available under the trademark SEPHADEX from Pharmacia Fine Chemicals (Piscataway, NJ) ; agarose; beads of polystyrene beads about 1 micron to about 5 millimeters in diameter available from Abbott Laboratories of North Chicago, IL; polyvinyl chloride, polystyrene, cross-linked polyacrylamide, nitrocellulose- or nylon-based webs such as sheets, strips or paddles; or tubes, plates or the wells of a microtiter plate such as those made from polystyrene or polyvinylchloride.
  • the reagent species, labeled specific binding agent or amplifying reagent of any diagnostic system described herein can be provided in solution, as a liquid dispersion or as a substantially dry power, e.g., in lyophilized form.
  • the indicating means is an enzyme
  • the enzyme's substrate can also be provided in a separate package of a system.
  • a solid support such as the before-described microtiter plate and one or more buffers can also be included as separately packaged elements in this diagnostic assay system.
  • the packaging materials discussed herein in relation to diagnostic systems are those customarily utilized in diagnostic systems.
  • a package refers to a solid matrix or material such as glass, plastic (e.g., polyethylene, polypropylene and polycarbonate) , paper, foil and the like capable of holding within fixed limits a diagnostic reagent such as a monoclonal antibody of the present invention.
  • a package can be a bottle, vial, plastic and plastic-foil laminated envelope or the like container used to contain a contemplated diagnostic reagent or it can be a microtiter plate well to which microgram quantities of a contemplated diagnostic reagent have been operatively affixed, i.e., linked so as to be capable of being immunologically bound by an antibody or polypeptide to be detected.
  • kits may comprise a carrier means being compartmentalized to receive in close confinement one or more container means such as vials, tubes, and the like, each of the container means comprising one of the separate elements to be used in the method.
  • container means such as vials, tubes, and the like
  • each of the container means comprising one of the separate elements to be used in the method.
  • one of the container means may comprise a human monoclonal antibody of the invention which is, or can be, detectably labeled.
  • the kit may also have containers containing any of the other above-recited immunochemical reagents used to practice the diagnostic methods.
  • the present invention describes methods for producing novel HCMV-immunoreactive human monoclonal antibodies (HuMab) , i.e., anti-HCMV HuMabs.
  • the methods are based generally on the use of combinatorial libraries of antibody molecules which can be produced from a variety of human sources, and include naive libraries, modified libraries, and libraries produced directly from human donors exhibiting an HCMV-specific immune response.
  • combinatorial library production and manipulation methods have been extensively described in the literature, and will not be reviewed in detail herein, except for those feature required to make and use unique embodiments of the present invention.
  • the methods generally involve the use of a filamentous phage (phagemid) surface expression vector system for cloning and expressing antibody species of the library.
  • phagemid filamentous phage
  • Various phagemid cloning systems to produce combinatorial libraries have been described by others. See, for example the preparation of combinatorial antibody libraries on phagemids as described by Kang et al., Proc. Natl. Acad. Sci.. USA. 88:4363-4366 (1991); Barbas et al., Proc. Natl. Acad. Sci.. USA.
  • the method involves preparing a phagemid library of human monoclonal antibodies by using donor immune cell messenger RNA from HCMV- infected donors.
  • the donors can be symptomatic of a HCMV infection, but the donor can also be assymptomatic, as the resulting library contains a substantially higher number of anti-HCMV human monoclonal antibodies.
  • the patient may optionally present substantial symptoms of one or more other diseases typically associated with symptomatic or assymptomatic HCMV infection, notably AIDS, as demonstrated by the library utilized herein.
  • the donor is naive relative to a conventional immune response to HCMV, i.e., the donor is not HCMV-infected, and yet antibodies in the donor cross-react with one or more HCMV antigens.
  • the library can be synthetic, or can be derived from a donor who has an immune response to other antigens.
  • the method for producing a human monoclonal antibody generally involves (1) preparing separate H and L chain-encoding gene libraries in cloning vectors using human immunoglobulin genes as a source for the libraries, (2) combining the H and L chain encoding gene libraries into a single dicistronic expression vector capable of expressing and assembling a heterodimeric antibody molecule, (3) expressing the assembled heterodimeric antibody molecule on the surface of a filamentous phage particle, (4) isolating the surface-expressed phage particle using immunoaffinity techniques such as panning of phage particles against a preselected antigen, thereby isolating one or more species of phagemid containing particular H and L chain-encoding genes and antibody molecules that immunoreact with the preselected antigen.
  • the resulting phagemid library can be manipulated to increase and/or alter the immunospecificities of the monoclonal antibodies of the library to produce and subsequently identify additional, desirable, human monoclonal antibodies of the present invention.
  • the heavy (H) chain and light (L) chain immunoglobulin molecule encoding genes can be randomly mixed (shuffled) to create new HL pairs in an assembled immunoglobulin molecule.
  • either or both the H and L chain encoding genes can be mutagenized in a complementarity determining region (CDR) of the variable region of the immunoglobulin polypeptide, and subsequently screened for desirable immunoreaction capabilities.
  • CDR complementarity determining region
  • the H and L genes can be cloned into separate, monocistronic expression vectors, referred to as a "binary" system described further herein.
  • step (2) above differs in that the combining of H and L chain encoding genes occurs by the co-introduction of the two binary plasmids into a single host cell for expression and assembly of a phagemid having the surface accessible antibody heterodimer molecule.
  • the shuffling can be accomplished with the binary expression vectors, each capable of expressing a single heavy or light chain encoding gene.
  • the antibody molecules are monoclonal because the cloning methods allow for the preparation of clonally pure species of antibody producing cell lines.
  • the monoclonal antibodies are human because the H and L chain encoding genes are derived from human immunoglobulin producing immune cells, such as spleen, thymus, bone marrow, and the like.
  • the resulting antibody library immunoreactive with a preselected HCMV antigen, be additionally screened for the presence of antibody species which have the capacity to neutralize HCMV in one or more of the assays described herein for determining neutralization capacity.
  • a preferred library of antibody molecules is first produced which binds to an HCMV antigen, and then is screened for the presence of HCMV-neutralizing antibodies as described herein.
  • nucleotide and corresponding amino acid residue sequence of the antibody molecule's H or L chain encoding gene is determined by nucleic acid sequencing.
  • the primary amino acid residue sequence information provides essential information regarding the antibody molecule's epitope reactivity.
  • Sequence comparisons of identified HCMV- immunoreactive monoclonal antibody variable chain region sequences are aligned based on sequence homology, and groups of related antibody molecules are identified in which heavy chain or light chain genes share substantial sequence homology.
  • the isolation of a particular vector capable of expressing an antibody of interest involves the introduction of the dicistronic expression vector into a host cell permissive for expression of filamentous phage genes and the assembly of phage particles. Where the binary vector system is used, both vectors are introduced in the host cell. Typically, the host is E. coli. Thereafter, a helper phage genome is introduced into the host cell containing the immunoglobulin expression vector(s) to provide the genetic complementation necessary to allow phage particles to be assembled. The resulting host cell is cultured to allow the introduced phage genes and immunoglobulin genes to be expressed, and for phage particles to be assembled and shed from the host cell.
  • the shed phage particles are then harvested (collected) from the host cell culture media and screened for desirable immunoreaction and neutralization properties. Typically, the harvested particles are "panned” for immunoreaction with a preselected antigen. The strongly immunoreactive particles are then collected, and individual species of particles are clonally isolated and further screened for HCMV neutralization. Phage which produce neutralizing antibodies are selected and used as a source of a human HCMV neutralizing monoclonal antibody of this invention.
  • Human monoclonal antibodies of this invention can also be produced by altering the nucleotide sequence of a polynucleotide sequence that encodes a heavy or light chain of a monoclonal antibody of this invention. For example, by site directed mutagenesis, one can alter the nucleotide sequence of an expression vector and thereby introduce changes in the resulting expressed amino acid residue sequence. Thus one can take the polynucleotide of SEQ ID NO 74, for example, and convert it into the polynucleotide of SEQ ID NO 76. Similarly, one can take a known polynucleotide and randomly alter it by random mutagenesis, reintroduce the altered polynucleotide into an expression system and subsequently screen the product H:L pair for anti-HCMV activity.
  • an immunoaffinity isolated antibody composition includes phage particles containing surface antibody
  • one embodiment involves the manipulation of the resulting cloned genes to truncate the immunoglobulin-coding gene such that a soluble Fab fragment is secreted by the host E. coli cell containing the phagemid vector rather than the production of a phagemid having surface antibody.
  • the resulting manipulated cloned immunoglobulin genes produce a soluble Fab which can be readily characterized in ELISA assays for epitope binding studies, in competition assays with known anti-HCMV antibody molecules, and in HCMV neutralization assays.
  • the solubilized Fab provides a reproducible and comparable antibody preparation for comparative and characterization studies.
  • soluble Fab The preparation of soluble Fab is generally described in the immunological arts, and can be conducted as described herein in the Examples, or as described by Burton et al. , Proc. Natl. Acad. Sci.. USA. 88:10134-10137 (1991).
  • the preparation of human monoclonal antibodies of this invention depends, in one embodiment, on the cloning and expression vectors used to prepare the combinatorial antibody libraries described herein.
  • the cloned immunoglobulin heavy and light chain genes can be shuttled between lambda vectors, phagemid vectors and plasmid vectors at various stages of the methods described herein.
  • the phagemid vectors produce fusion proteins that are expressed on the surface of an assembled filamentous phage particle.
  • a preferred phagemid vector of the present invention is a recombinant DNA (rDNA) molecule containing a nucleotide sequence that codes for and is capable of expressing a fusion polypeptide containing, in the direction of amino- to carboxy-terminus, (1) a prokaryotic secretion signal domain, (2) a heterologous polypeptide defining an immunoglobulin heavy or light chain variable region, and (3) a filamentous phage membrane anchor domain.
  • the vector includes DNA expression control sequences for expressing the fusion polypeptide, preferably prokaryotic control sequences.
  • the filamentous phage membrane anchor is preferably a domain of the cpIII or cpVIII coat protein capable of associating with the matrix of a filamentous phage particle, thereby incorporating the fusion polypeptide onto the phage surface.
  • the secretion signal is a leader peptide domain of a protein that targets the protein to the periplasmic membrane of gram negative bacteria.
  • a preferred secretion signal is a pelB secretion signal.
  • the predicted amino acid residue sequences of the secretion signal domain from two pelB gene product variants from Erwinia carotova are described in Lei et al.. Nature. 331:543-546 (1988).
  • the leader sequence of the pelB protein has previously been used as a secretion signal for fusion proteins. Better et al., Science. 240:1041-1043 (1988); Sastry et al., Proc. Natl. Acad. Sci.. USA. 86:5728-5732 (1989); and Mullinax et al., Proc. Natl. Acad. Sci.. USA. 87:8095-8099 (1990). Amino acid residue sequences for other secretion signal polypeptide domains from E. coli useful in this invention as described in Oliver, Escherichia coli and Salmonella Typhimurium. Neidhard, F.C. (ed.), American Society for Microbiology, Washington, D.C., 1:56-69 (1987).
  • Preferred membrane anchors for the vector are obtainable from filamentous phage M13, fl, fd, and equivalent filamentous phage.
  • Preferred membrane anchor domains are found in the coat proteins encoded by gene III and gene VIII.
  • the membrane anchor domain of a filamentous phage coat protein is a portion of the carboxy terminal region of the coat protein and includes a region of hydrophobic amino acid residues for spanning a lipid bilayer membrane, and a region of charged amino acid residues normally found at the cytoplasmic face of the membrane and extending away from the membrane.
  • gene VIII coat protein's membrane spanning region comprises residue Trp-26 through Lys-40, and the cytoplasmic region comprises the carboxy-terminal 11 residues from 41 to 52 (Ohkawa et al., J. Biol. Chem.. 256:9951-9958 (1981)).
  • An exemplary membrane anchor would consist of residues 26 to 40 of cpVIII.
  • the amino acid residue sequence of a preferred membrane anchor domain is derived from the M13 filamentous phage gene VIII coat protein (also designated cpVIII or CP 8) .
  • Gene VIII coat protein is present on a mature filamentous phage over the majority of the phage particle with typically about 2500 to 3000 copies of the coat protein.
  • amino acid residue sequence of another preferred membrane anchor domain is derived from the M13 filamentous phage gene III coat protein (also designated cpIII) .
  • Gene III coat protein is present on a mature filamentous phage at one end of the phage particle with typically about 4 to 6 copies of the coat protein.
  • DNA expression control sequences comprise a set of DNA expression signals for expressing a structural gene product and include both 5' and 3' elements, as is well known, operatively linked to the cistron such that the cistron is able to express a structural gene product.
  • the 5' control sequences define a promoter for initiating transcription and a ribosome binding site operatively linked at the 5* terminus of the upstream translatable DNA sequence.
  • the ribosome binding site includes an initiation codon (AUG) and a sequence 3-9 nucleotides long located 3-11 nucleotides upstream from the initiation codon (Shine et al.. Nature. 254:34 (1975).
  • the sequence, AGGAGGU which is called the Shine-Dalgarno (SD) sequence, is complementary to the 3' end of E. coli 16S rRNA.
  • Binding of the ribosome to mRNA and the sequence at the 3• end of the mRNA can be affected by several factors:
  • the vector utilized includes a prokaryotic origin of replication or replicon, i.e., a DNA sequence having the ability to direct autonomous replication and maintenance of the recombinant DNA molecule extra chromosomally in a prokaryotic host cell, such as a bacterial host cell, transformed therewith.
  • a prokaryotic origin of replication or replicon i.e., a DNA sequence having the ability to direct autonomous replication and maintenance of the recombinant DNA molecule extra chromosomally in a prokaryotic host cell, such as a bacterial host cell, transformed therewith.
  • a prokaryotic host cell such as a bacterial host cell, transformed therewith.
  • Such origins of replication are well known in the art.
  • Preferred origins of replication are those that are efficient in the host organism.
  • a preferred host cell is E. coli.
  • a preferred origin of replication is ColEl found in pBR322 and a variety of other common plasmids.
  • ColEl and pl5A replicon have been extensively utilized in molecular biology, are available on a variety of plasmids and are described at least by Sambrook et al., in "Molecular Cloning: a Laboratory Manual", 2nd edition, Cold Spring Harbor Laboratory Press (1989) .
  • Clearly ColEl and pl5A replicons are particularly preferred for use in one embodiment of the present invention where two "binary" plasmids are utilized because they each have the ability to direct the replication of plasmid in E. coli while the other replicon is present in a second plasmid in the same E ⁇ . coli cell.
  • ColEl and pl5A are non- interfering replicons that allow the maintenance of two plasmids in the same host (see, for example, Sambrook et al.. supra, at pages 1.3-1.4).
  • This feature is particularly important in the binary vectors embodiment of the present invention because a single host cell permissive for phage replication must support the independent and simultaneous replication of two separate vectors, namely a first vector for expressing a heavy chain polypeptide, and a second vector for expressing a light chain polypeptide.
  • those embodiments that include a prokaryotic replicon can also include a gene whose expression confers a selective advantage, such as drug resistance, to a bacterial host transformed therewith.
  • Typical bacterial drug resistance genes are those that confer resistance to ampicillin, tetracycline, neomycin/kanamycin or cholamphenicol.
  • Vectors typically also contain convenient restriction sites for insertion of translatable DNA sequences. Exemplary vectors are the plasmids pUC8, pUC9, pBR322, and pBR329 available from BioRad Laboratories, (Richmond, CA) and pPL and pKK223 available from Pharmacia, (Piscataway, NJ) .
  • a vector for expression of a monoclonal antibody of the invention on the surface of a filamentous phage particle is a recombinant DNA (rDNA) molecule adapted for receiving and expressing translatable first and second DNA sequences in the form of first and second polypeptides wherein one of the polypeptides is fused to a filamentous phage coat protein membrane anchor. That is, at least one of the polypeptides is a fusion polypeptide containing a filamentous phage membrane anchor domain, a prokaryotic secretion signal domain, and an immunoglobulin heavy or light chain variable domain.
  • rDNA recombinant DNA
  • a DNA expression vector for expressing a heterodimeric antibody molecule provides a system for independently cloning (inserting) the two translatable DNA sequences into two separate cassettes present in the vector, to form two separate cistrons for expressing the first and second polypeptides of the antibody molecule, or the ligand binding portions of the polypeptides that comprise the antibody molecule (i.e., the H and L variable regions of an immunoglobulin molecule) .
  • the DNA expression vector for expressing two cistrons is referred to as a dicistronic expression vector.
  • the vector comprises a first cassette that includes upstream and downstream translatable DNA sequences operatively linked via a sequence of nucleotides adapted for directional ligation to an insert DNA.
  • the upstream translatable sequence encodes the secretion signal as defined herein.
  • the downstream translatable sequence encodes the filamentous phage membrane anchor as defined herein.
  • the cassette preferably includes DNA expression control sequences for expressing the receptor polypeptide that is produced when an insert translatable DNA sequence (insert DNA) is directionally inserted into the cassette via the sequence of nucleotides adapted for directional ligation.
  • the filamentous phage membrane anchor is preferably a domain of the cpIII or cpVIII coat protein capable of binding the matrix of a filamentous phage particle, thereby incorporating the fusion polypeptide onto the phage surface.
  • the receptor expressing vector also contains a second cassette for expressing a second receptor polypeptide.
  • the second cassette includes a second translatable DNA sequence that encodes a secretion signal, as defined herein, operatively linked at its 3' terminus via a sequence of nucleotides adapted for directional ligation to a downstream DNA sequence of the vector that typically defines at least one stop codon in the reading frame of the cassette.
  • the second translatable DNA sequence is operatively linked at its 5' terminus to DNA expression control sequences forming the 5' elements.
  • the second cassette is capable, upon insertion of a translatable DNA sequence (insert DNA) , of expressing the second fusion polypeptide comprising a receptor of the secretion signal with a polypeptide coded by the insert DNA.
  • An upstream translatable DNA sequence encodes a prokaryotic secretion signal as described earlier.
  • the upstream translatable DNA sequence encoding the pelB secretion signal is a preferred DNA sequence for inclusion in a receptor expression vector.
  • a downstream translatable DNA sequence encodes a filamentous phage membrane anchor as described earlier.
  • a downstream translatable DNA sequence encodes an amino acid residue sequence that corresponds, and preferably is identical, to the membrane anchor domain of either a filamentous phage gene III or gene VIII coat polypeptide.
  • a cassette in a DNA expression vector of this invention is the region of the vector that forms, upon insertion of a translatable DNA sequence (insert DNA) , a sequence of nucleotides capable of expressing, in an appropriate host, a fusion polypeptide.
  • the expression-competent sequence of nucleotides is referred to as a cistron.
  • the cassette comprises DNA expression control elements operatively linked to the upstream and downstream translatable DNA sequences.
  • a cistron is formed when a translatable DNA sequence is directionally inserted (directionally ligated) between the upstream and downstream sequences via the sequence of nucleotides adapted for that purpose.
  • a DNA expression vector for expressing an antibody molecule provides a system for cloning translatable DNA sequences into the cassette portions of the vector to produce cistrons capable of expressing the first and second polypeptides, i.e., the heavy and light chains of a monoclonal antibody.
  • the term "vector” refers to a nucleic acid molecule capable of transporting between different genetic environments another nucleic acid to which it has been operatively linked.
  • Preferred vectors are those capable of autonomous replication and expression of structural gene products present in the DNA segments to which they are operatively linked.
  • Vectors therefore, preferably contain the replicons and selectable markers described earlier.
  • operatively linked means the sequences or segments have been covalently joined, preferably by conventional phosphodiester bonds, into one strand of DNA, whether in single or double stranded form.
  • the choice of vector to which transcription unit or a cassette of this invention is operatively linked depends directly, as is well known in the art, on the functional properties desired, e*>g « vector replication and protein expression, and the host cell to be transformed, these being limitations inherent in the art of constructing recombinant DNA molecules.
  • a sequence of nucleotides adapted for directional ligation is a region of the DNA expression vector that (1) operatively links for replication and transport the upstream and downstream translatable DNA sequences and (2) provides a site or means for directional ligation of a DNA sequence into the vector.
  • a directional polylinker is a sequence of nucleotides that defines two or more restriction endonuclease recognition sequences, or restriction sites. Upon restriction cleavage, the two sites yield cohesive termini to which a translatable DNA sequence can be ligated to the DNA expression vector.
  • the two restriction sites provide, upon restriction cleavage, cohesive termini that are non-complementary and thereby permit directional insertion of a translatable DNA sequence into the cassette.
  • the directional ligation means is provided by nucleotides present in the upstream translatable DNA sequence, downstream translatable DNA sequence, or both.
  • the sequence of nucleotides adapted for directional ligation comprises a sequence of nucleotides that defines multiple directional cloning means. Where the sequence of nucleotides adapted for directional ligation defines numerous restriction sites, it is referred to as a multiple cloning site.
  • a DNA expression vector is designed for convenient manipulation in the form of a filamentous phage particle encapsulating a genome according to the teachings of the present invention.
  • a DNA expression vector further contains a nucleotide sequence that defines a filamentous phage origin of replication such that the vector, upon presentation of the appropriate genetic complementation, can replicate as a filamentous phage in single stranded replicative form and be packaged into filamentous phage particles. This feature provides the ability of the DNA expression vector to be packaged into phage particles for subsequent segregation of the particle, and vector contained therein, away from other particles that comprise a population of phage particles.
  • a filamentous phage origin of replication is a region of the phage genome, as is well known, that defines sites for initiation of replication, termination of replication and packaging of the replicative form produced by replication (see, for example, Rasched et al., Microbiol. Rev.. 50:401-427 (1986); and Horiuchi, J. Mol. Biol.. 188:215-223 (1986)) .
  • a preferred filamentous phage origin of replication for use in the present invention is an M13, fl or fd phage origin of replication (Short et al., Nucl. Acids Res.. 16:7583-7600 (1988)).
  • Preferred DNA expression vectors for cloning and expression a human monoclonal antibody of this invention are the dicistronic expression vectors pCOMB ⁇ , pCOMB2-8, pCOMB3, pCOMB2-3 and pCOMB2-3' , described herein.
  • a particularly preferred vector of the present invention includes a polynucleotide sequence that encodes a heavy or light chain variable region of a human monoclonal antibody of the present invention.
  • vectors that include a nucleotide sequence that encodes a heavy or light chain amino acid residue sequence shown in SEQ ID NOs 74, 75, 76, 77, 78 and 79, that encodes a heavy or light chain having the binding specificity of those sequences shown in SEQ ID NOs 74, 75, 76, 77, 78 and 79, or that encodes a heavy or light chain having conservative substitutions relative to a sequence shown in SEQ ID NOs 74, 75, 76, 77, 78 and 79, and complementary polynucleotide sequences thereto.
  • polynucleotides are component parts of a DNA expression vector for producing a human monoclonal antibody heavy or light chain immunoglobulin variable region amino acid residue sequence
  • the invention also contemplates isolated polynucleotides that encode such heavy or light chain sequences.
  • the expression vector for producing a human monoclonal antibody of this invention is carried in a host cell compatible with expression of the antibody
  • the invention contemplates a host cell containing a vector or polynucleotide of this invention.
  • a preferred host cell is E. coli. as described herein.
  • Bacteriophage Lambda was selected as the starting point to develop an expression vector for three reasons. First, .in vitro packaging of phage DNA was the most efficient method of reintroducing DNA into host cells. Second, it was possible to detect protein expression at the level of single phage plaques. Finally, the screening of phage libraries typically involved less difficulty with nonspecific binding.
  • plasmid cloning vectors are only advantageous in the analysis of clones after they have been identified. This advantage was not lost in the present system because of the use of a dicistronic expression vector such as pComblll, thereby permitting a plasmid containing the heavy chain, light chain, or Fab expressing inserts to be excised.
  • Lambda ZapTM II is a derivative of the original Lambda Zap (ATCC # 40,298) that maintains all of the characteristics of the original Lambda Zap including 6 unique cloning sites, fusion protein expression, and the ability to rapidly excise the insert in the form of a phagemid (Bluescript SK-) , but lacks the SAM 100 mutation, allowing growth on many Non-Sup F strains, including XLl-Blue.
  • the Lambda is a derivative of the original Lambda Zap (ATCC # 40,298) that maintains all of the characteristics of the original Lambda Zap including 6 unique cloning sites, fusion protein expression, and the ability to rapidly excise the insert in the form of a phagemid (Bluescript SK-) , but lacks the SAM 100 mutation, allowing growth on many Non-Sup F strains, including XLl-Blue.
  • ZapTM II was constructed as described in Short et al., Nuc. Acids Res.. 16:7583-7600, (1988), by replacing the Lambda S gene contained in a 4254 base pair (bp) DNA fragment produced by digesting Lambda Zap with the restriction enzyme Nco I.
  • This 4254 bp DNA fragment was replaced with the 4254 bp DNA fragment containing the Lambda S gene isolated from Lambda gtlO (ATCC # 40,179) after digesting the vector with the restriction enzyme Nco I.
  • the 4254 bp DNA fragment isolated from lambda gtlO was ligated into the original Lambda Zap vector using T4 DNA ligase and standard protocols such as those described in Current Protocols in Molecular Biology. Ausubel et al., eds., John Wiley and Sons, NY, 1987, to form Lambda ZapTM II .
  • a vector designated Lambda Hc2 was constructed.
  • the vector provided the following: the capacity to place the V H -coding DNA homologs in the proper reading frame; a ribosome binding site as described by Shine et al.. Nature.
  • a leader sequence directing the expressed protein to the periplasmic space designated the pelB secretion signal
  • a polynucleotide sequence that coded for a known epitope (epitope tag) a polynucleotide sequence that coded for a known epitope (epitope tag) ; and also a polynucleotide that coded for a spacer protein between the V H -coding DNA homolog and the polynucleotide coding for the epitope tag.
  • Lambda Hc2 has been previously described by Huse et al.. Science. 246:1275-1281 (1989).
  • Polynucleotides N2, N3, N9-4, Nil, N10-5, N6, N7 and N8 were kinased by adding 1 ⁇ l of each polynucleotide 0.1 micrograms/microliter ( ⁇ g/ ⁇ l) and 20 units of T 4 polynucleotide kinase to a solution containing 70 mM Tris-HCl (Tris[hydroxymethyl] aminomethane hydrochloride) at pH 7.6, 10 mM MgCl 2 , 5 mM dithiothreitol (DTT) , 10 mM beta-mercaptoethanol, 500 micrograms per milliliter ( ⁇ g/ml) bovine serum albumin (BSA) .
  • Tris-HCl Tris[hydroxymethyl] aminomethane hydrochloride
  • DTT dithiothreitol
  • BSA bovine serum albumin
  • the solution was maintained at 37 degrees Celsius (37°C) for 30 minutes and the reaction stopped by maintaining the solution at 65°C for 10 minutes.
  • the two end polynucleotides 20 nanograms (ng) of polynucleotides Nl and polynucleotides N12, were added to the above kinasing reaction solution together with 1/10 volume of a solution containing 20 mM Tris-HCl at pH 7.4, 2 mM MgCl 2 and 50 mM NaCl.
  • This solution was heated to 70°C for 5 minutes and allowed to cool to room temperature, approximately 25°C, over 1.5 hours in a 500 ml beaker of water.
  • the end polynucleotides were kinased by mixing 52 ⁇ l of the above reaction, 4 ⁇ l of a solution containing 10 mM ATP and 5 units of T4 polynucleotide kinase. This solution was maintained at 37°C for 30 minutes and then the T4 polynucleotide kinase was inactivated by maintaining the solution at 65°C for 10 minutes.
  • the completed synthetic DNA insert was ligated directly into the Lambda ZapTM II vector described in Example lal) that had been previously digested with the restriction enzymes, Not I and Xho I.
  • the ligation mixture was packaged according to the manufacture's instructions using Gigapack II Gold packing extract available from Stratagene, La Jolla, California.
  • the packaged ligation mixture was plated on XLl-Blue cells (Stratagene) . Individual lambda plaques were cored and the inserts excised according to the in vivo excision protocol for Lambda ZapTM II provided by the manufacturer (Stratagene) .
  • Lambda Lc2 To express a plurality of V L -coding DNA homologs in an E. coli host cell, a vector designated Lambda Lc2 was constructed having the capacity to place the V L -coding DNA homologs in the proper reading frame, provided a ribosome binding site as described by Shine et al., Nature, 254:34 (1975), provided the pelB gene leader sequence secretion signal that has been previously used to successfully secrete Fab fragments in E. coli by Lei et al., J. Bac.. 169:4379 (1987) and Better et al., Science. 240:1041 (1988), and also provided a polynucleotide containing a restriction endonuclease site for cloning. Lambda Lc2 has been previously described by Huse et al., Science. 246:1275-1281 (1989).
  • a synthetic DNA sequence containing all of the above features was constructed by designing single stranded polynucleotide segments of 20-60 bases that would hybridize to each other and form the double stranded synthetic DNA sequence shown in Figure 3.
  • the sequence of each individual single-stranded polynucleotide segment (01-08) within the double stranded synthetic DNA sequence is shown in Table 2.
  • Polynucleotides 02, 03, 04, 05, 06 and 07 were kinased by adding 1 ⁇ l (0.1 ⁇ g/ ⁇ l) of each polynucleotide and 20 units of T 4 polynucleotide kinase to a solution containing 70 mM Tris-HCl at pH 7.6, 10 mM MgCl 2 , 5 mM DTT, 10 mM beta-mercaptoethanol, 500 ⁇ g/ml of BSA. The solution was maintained at 37°C for 30 minutes and the reaction stopped by maintaining the solution at 65°C for 10 minutes.
  • the individual polynucleotides were covalently linked to each other to stabilize the synthetic DNA insert by adding 40 ⁇ l of the above reaction to a solution containing 50 mM Tris-HCl at pH 7.5, 7 mM MgCl 2 , 1 mM DTT, 1 mM ATP and 10 units of T4 DNA ligase. This solution was maintained at 37°C for 30 minutes and then the T4 DNA ligase was inactivated by maintaining the solution at 65°C for 10 minutes.
  • the end polynucleotides were kinased by mixing 52 ⁇ l of the above reaction, 4 ⁇ l of a solution containing 10 mM ATP and 5 units of T4 polynucleotide kinase. This solution was maintained at 37°C for 30 minutes and then the T4 polynucleotide kinase was inactivated by maintaining the solution at 65°C for 10 minutes.
  • the completed synthetic DNA insert was ligated directly into the Lambda ZapTM II vector described in Example lal) that had been previously digested with the restriction enzymes Sac I and Xho I.
  • the ligation mixture was packaged according to the manufacture's instructions using Gigapack II Gold packing extract (Stratagene) .
  • the packaged ligation mixture was plated on XLl-Blue cells (Stratagene) .
  • Individual lambda plaques were cored and the inserts excised according to the in vivo excision protocol for Lambda ZapTM II provided by the manufacturer (Stratagene) . This in vivo excision protocol moved the cloned insert from the Lambda Lc2 vector into a plasmid phagemid vector allow for easy manipulation and sequencing.
  • a preferred vector for use in this invention is a derivative of Lambda Lc2 prepared above.
  • Lambda Lc2 contains a Spe I restriction site located 3 • to the EcoR I restriction site and 5' to the Shine-Dalgarno ribosome binding site as shown in the sequence in Figure 3 and in SEQ ID NO 3.
  • a Spe I restriction site is also present in Lambda Hc2 as shown in Figures 1 and 2 and in SEQ ID NO 1.
  • a combinatorial vector, designated pComb was constructed by combining portions of Lambda Hc2 and Lc2 together as described in Example la4) below.
  • the resultant combinatorial pComb vector contained two Spe I restriction sites, one provided by Lambda Hc2 and one provided by Lambda Lc2, with an EcoR I site in between.
  • DNA homologs having Spe I and EcoR I cohesive termini were successfully directionally ligated into a pComb expression vector previously digested with Spe I and EcoR I as described in Example lb below.
  • the proximity of the EcoR I restriction site to the 3' Spe I site, provided by the Lc2 vector inhibited the complete digestion of the 3' Spe I site.
  • digesting pComb with Spe I and EcoR I did not result in removal of the EcoR I site between the two Spe I sites.
  • Lambda Lc3 a derivative of Lambda Lc2 lacking the second or 3' Spe I site, designated Lambda Lc3, was produced by first digesting Lambda Lc2 with Spe I to form a linearized vector. The ends were filled in to form blunt ends which are ligated together to result in Lambda Lc3 lacking a Spe I site. Lambda Lc3 is a preferred vector for use in constructing a combinatorial vector as described below. 4) Preparation of pComb
  • Phagemids were excised from the expression vectors Lambda Hc2 or Lambda Lc2 using an in vivo excision protocol described above. Double stranded DNA was prepared from the phagemid-containing cells according to the methods described by Holmes et al., Anal. Biochem.. 114:193 (1981). The phagemids resulting from in vivo excision contained the same nucleotide sequences for antibody fragment cloning and expression as did the parent vectors, and are designated phagemid Hc2 and Lc2, corresponding to Lambda Hc2 and Lc2, respectively.
  • phagemid Hc2 was first digested with Sac I to remove the restriction site located 5' to the LacZ promoter. The linearized phagemid was then blunt ended with T4 polymerase and ligated to result in a Hc2 phagemid lacking a Sac I site.
  • the modified Hc2 phagemid and the Lc2 phagemid were then separately restriction digested with Sea I and EcoR I to result in a Hc2 fragment having from 5' to 3' Sea I, Not I, Xho I, Spe I and EcoR I restriction sites and a Lc2 fragment having from 5' to 3' EcoR I, Sac I, Xba I and Sac I restriction sites.
  • the linearized phagemids were then ligated together at their respective cohesive ends to form pComb, a circularized phagemid having a linear arrangement of restriction sites of Not I, Xho I, Spe I, EcoR I, Sac I, Xba I, Not I, Apa I and Sea I.
  • the ligated phagemid vector was then inserted into an appropriate bacterial host and transformants were selected on the antibiotic ampicillin.
  • the resulting ampicillin resistant combinatorial phagemid vector was designated pComb, the schematic organization of which is shown in Figure 5.
  • the resultant combinatorial vector, pComb consisted of a DNA molecule having two cassettes to express two fusion proteins and having nucleotide residue sequences for the following operatively linked elements listed in a 5' to 3' direction: a first cassette consisting of an inducible LacZ promoter upstream from the LacZ gene; a Not I restriction site; a ribosome binding site; a pelB leader; a spacer; a cloning region bordered by a 5' Xho and 3' Spe I restriction site; a decapeptide tag followed by expression control stop sequences; an EcoR I restriction site located 5' to a second cassette consisting of an expression control ribosome binding site; a pelB leader; a spacer region; a cloning region bordered by
  • a preferred combinatorial vector for use in this invention is constructed by combining portions of phagemid Hc2 and phagemid Lc3 as described above for preparing pComb.
  • the resultant combinatorial vector, pComb2 consists of a DNA molecule having two cassettes identical to pComb to express two fusion proteins identically to pComb except that a second Spe I restriction site in the second cassette is eliminated. b.
  • the pComblll Vector prepared above is a useful cloning vehicle for modification for the preparation of an expression vector for use in this invention. To that end, pComb was digested with EcoR I and Spe I followed by phosphatase treatment to produce linearized pComb.
  • a separate phagemid expression vector was constructed using sequences encoding bacteriophage cpIII membrane anchor domain.
  • a PCR product defining the DNA sequence encoding the filamentous phage coat protein, cpIII, membrane anchor containing a LacZ promotor region sequence 3' to the membrane anchor for expression of the light chain and Spe I and EcoR I cohesive termini was prepared from M13mpl8, a commercially available bacteriophage vector (Pharmacia, Piscataway, New Jersey) .
  • replicative form DNA from M13mpl8 was first isolated. Briefly, into 2 ml of LB (Luria-Bertani medium) , 50 ⁇ l of a culture of a bacterial strain carrying an F' episome (JM107, JM109 or TGI) were admixed with a one tenth suspension of bacteriophage particles derived from a single plaque. The admixture was incubated for 4 to 5 hours at 37°C with constant agitation. The admixture was then centrifuged at 12,000 x g for 5 minutes to pellet the infected bacteria.
  • LB Lia-Bertani medium
  • Solution I was prepared by admixing 50 mM glucose, 10 mM EDTA (disodium ethylenediaminetetraacetic acid) and 25 mM Tris-HCl at pH 8.0, and autoclaving for 15 minutes. To the bacterial suspension, 200 ⁇ l of freshly prepared Solution II was admixed and the tube was rapidly inverted five times. Solution II was prepared by admixing 0.2 N NaOH and 1% SDS.
  • Solution III was prepared by admixing 60 ml of 5 M potassium acetate, 11.5 ml of glacial acetic acid and 28.5 ml of water. The resultant bacterial lysate was then stored on ice for 5 minutes followed by centrifugation at
  • M13mpl8 replicative form DNA was then used as a template for isolating the gene encoding the membrane anchor domain at cpIII, the sequence of which is listed in the Sequence Listing as SEQ ID NO 33.
  • the amino acid residue sequence of membrane anchor domain cpIII is listed in SEQ ID NO 34.
  • M13mpl8 replicative form DNA was prepared as described above and used as a template for two PCR amplifications for construction of a DNA fragment consisting of the mature gene for cpIII membrane anchor domain located 5' to a sequence encoding the LacZ promoter, operator and cap-binding site for controlling light chain expression.
  • PCR reaction 2 ⁇ l containing 1 ng of M13mpl8 replicative form DNA were admixed with 10 ⁇ l of 10X PCR buffer purchased commercially (Promega Biotech, Madison, Wisconsin) in a 0.5 ml microfuge tube.
  • 10X PCR buffer purchased commercially (Promega Biotech, Madison, Wisconsin)
  • 8 ⁇ l of a 2.5 mM solution of dNTPs dATP, dCTP, dGTP, dTTP
  • ⁇ M micromolar
  • the resultant PCR modified cpIII membrane anchor domain DNA fragment from M13mpl8 containing samples were then purified with Gene Clean (BIO101, La Jolla, California) , extracted twice with phenol/chloroform, once with chloroform followed by ethanol precipitation and were stored at -70°C in 10 mM Tris-HCl at pH 7.5, and 1 mM EDTA.
  • the resultant PCR modified cpIII DNA fragment having Spe I and Nhe I sites in the 5' and 3' ends, respectively, of the fragment was verified by electrophoresis in a 1% agarose gel. The area in the agarose containing the modified cpIII DNA fragment was isolated from the agarose.
  • the sequence of the PCR modified cpIII membrane anchor domain DNA fragment is listed in the Sequence Listing as SEQ ID NO 40.
  • the resultant amplified PCR fragment also contained nucleotide sequences for encoding a five amino acid tether composed of four glycine residues and one serine juxtaposed between the heavy chain and cpIII encoding domains.
  • the primers used for this amplification were designed to incorporate a Nhe I site on the 5• end of the amplified fragment to overlap with a portion of the 3' end of the cpIII gene fragment and of the Nhe I site 3' to the amplified cpIII fragment.
  • the reaction and purification of the PCR product was performed as described above.
  • the sequence of the resultant PCR modified cpIII DNA fragment having a 5' Nhe I and 3' EcoR I restriction site is listed in the Sequence Listing as SEQ ID NO 41.
  • Lac-B' An alternative Lac-B primer for use in constructing the cpIII membrane anchor and LacZ promotor region was Lac-B' as shown in Table 3.
  • the amplification reactions were performed as described above with the exception that in the second PCR amplification, Lac-B' was used with Lac-F instead of Lac-B.
  • the product from the amplification reaction is listed in the sequence listing as SEQ ID NO 41 from nucleotide position 1 to nucleotide position 172.
  • the use of Lac-B' resulted in a LacZ region lacking 29 nucleotides on the 3' end but was functionally equivalent to the longer fragment produced with the Lac-F and Lac-B primers.
  • the products of the first and second PCR amplifications using the primer pairs G-3(F) and G-3(B) and Lac-F and Lac-B were then recombined at the nucleotides corresponding to cpIII membrane anchor overlap and Nhe I restriction site and subjected to a second round of PCR using the G-3(F) (SEQ ID NO 35) and Lac-B (SEQ ID NO 38) primer pair to form a recombined PCR DNA fragment product consisting of the following: a 5' Spe I restriction site; a cpIII DNA membrane anchor domain beginning at the nucleotide residue sequence which corresponds to the amino acid residue 198 of the entire mature cpIII protein; an endogenous stop site provided by the membrane anchor at amino acid residue number 112; a Nhe I restriction site, a LacZ promoter, operator and Cap-binding site sequence; and a 3' EcoR I restriction site.
  • a phagemid vector for the coordinate expression of a heavy chain-cpIII fusion protein as prepared in Example 2 with kappa light chain the recombined PCR modified cpIII membrane anchor domain DNA fragment was then restriction digested with Spe I and EcoR I to produce a DNA fragment for directional ligation into a similarly digested pComb2 phagemid expression vector having only one Spe I site prepared in Example la4) to form a pComb2-III (also referred to as pComb2-III) phagemid expression vector.
  • the resultant ampicillin resistance conferring pComb2-3 vector having only one Spe I restriction site, contained separate LacZ promoter/operator sequences for directing the separate expression of the heavy chain (Fd)-cpIII fusion product and the light chain protein.
  • the expressed proteins were directed to the periplasmic space by pelB leader sequences for functional assembly on the membrane.
  • Inclusion of the phage Fl intergenic region in the vector allowed for packaging of single stranded phagemid with the aid of helper phage.
  • helper phage superinfection lead to expression of two forms of cpIII.
  • phage morphogenesis was perturbed by competition between the Fab-cpIII fusion and the native cpIII of the helper phage for incorporation into the virion for Fab-cpVIII fusions.
  • vectors conferring chloramphenicol resistance and the like are also contemplated for use in this invention.
  • a more preferred phagemid expression vector for use in this invention having additional restriction enzyme cloning sites designated pComb-III* or pComb2-3', was prepared as described above for pComb2-3 with the addition of a 51 base pair fragment from pBluescript as described by Short et al., Nuc. Acids Res. , 16:7583-7600 (1988) and commercially available from Stratagene.
  • pComb2-3' pComb2-3 was first digested with Xho I and Spe I restriction enzymes to form a linearized pComb2-3.
  • the vector pBluescript was digested with the same enzymes releasing a 51 base pair fragment containing the restriction enzyme sites Sal I, Ace I, Hinc II, Cla I, Hind III, EcoR V, Pst I, Sma I and BaraH I.
  • the 51 base pair fragment was ligated into the linearized pComb2-3 vector via the cohesive Xho I and Spe I termini to form pComb2-3'.
  • Nhe I restriction site sequence is single underlined; the overlapping sequence with 3' end of cpIII is double underlined.
  • the heavy (Fd consisting of V H and C H 1) and light (kappa) chains (V L , C L ) of antibodies are first targeted to the periplasm of E. coli for the assembly of heterodimeric Fab molecules.
  • the nucleotide residue sequences encoding either the Fd or light chains must be operatively linked to the nucleotide residue sequence encoding a filamentous bacteriophage coat protein membrane anchor.
  • a coat protein for use in this invention in providing a membrane anchor is
  • a first and second cistron consisting of translatable DNA sequences are operatively linked to form a dicistronic DNA molecule.
  • Each cistron in the dicistronic DNA molecule is linked to DNA expression control sequences for the coordinate expression of a fusion protein, Fd-cpIII, and a kappa light chain.
  • the first cistron encodes a periplasmic secretion signal (pelB leader) operatively linked to the fusion protein, Fd-cpIII.
  • the second cistron encodes a second pelB leader operatively linked to a kappa light chain. The presence of the pelB leader facilitates the coordinated but separate secretion of both the fusion protein and light chain from the bacterial cytoplasm into the periplasmic space.
  • the phagemid expression vector carries an ampicillin selectable resistance marker gene (beta lactamase or bla) in addition to the Fd-cpIII fusion and the kappa chain.
  • the fl phage origin of replication facilitates the generation of single stranded phagemid.
  • IPTG isopropyl thiogalactopyranoside
  • a dicistronic message encoding the Fd-cpIII fusion (V H , C H1 , cpIII) and the light chain (V L , C L ) leads to the formation of heavy and light chains.
  • Each chain is delivered to the periplasmic space by the pelB leader sequence, which is subsequently cleaved.
  • the heavy chain is anchored in the membrane by the cpIII membrane anchor domain while the light chain is secreted into the periplasm.
  • the heavy chain in the presence of light chain assembles to form Fab molecules. This same result can be achieved if, in the alternative, the light chain is anchored in the membrane via a light chain fusion protein having a membrane anchor and heavy chain is secreted via a pelB leader into the periplasm.
  • the coat protein III is incorporated on the tail of the bacteriophage.
  • RNA isolation kit (Stratagene) according to the manufacturer's instructions.
  • the homogenate were mixed vigorously for ten seconds and maintained on ice for 15 minutes. The homogenate was then transferred to a thick-walled 50 ml polypropylene centrifuged tube (Fisher Scientific Company, Pittsburgh, PA) . The solution was centrifuged at 10,000 x g for 20 minutes at 4°C. The upper RNA-containing aqueous layer was transferred to a fresh 50 ml polypropylene centrifuge tube and mixed with an equal volume of isopropyl alcohol. This solution was maintained at -20°C for at least one hour to precipitate the RNA. The solution containing the precipitated RNA was centrifuged at 10,000 x g for twenty minutes at 4°C.
  • the pelleted total cellular RNA was collected and dissolved in 3 ml of the denaturing solution described above. Three ml of isopropyl alcohol were added to the re-suspended total cellular RNA and vigorously mixed. This solution was maintained at -20°C for at least 1 hour to precipitate the RNA. The solution containing the precipitated RNA was centrifuged at 10,000 x g for ten minutes at 4°C. The pelleted RNA was washed once with a solution containing 75% ethanol. The pelleted RNA was dried under vacuum for 15 minutes and then re-suspended in dimethyl pyrocarbonate-treated (DEPC-H 2 0) H 2 0.
  • DEPC-H 2 0 dimethyl pyrocarbonate-treated
  • RNA messenger RNA (mRNA) enriched for sequences containing long poly A tracts was prepared from the total cellular RNA using methods described in Molecular Cloning: A Laboratory Manual. Maniatis et al., eds., Cold Spring Harbor, NY, (1982). Briefly, one half of the total RNA isolated from a single donor prepared as described above was resuspended in one ml of DEPC-H 2 0 and maintained at 65°C for five minutes. One ml of 2X high salt loading buffer consisting of 100 mM Tris-HCl, 1 M NaCl, 2.0 mM EDTA at pH 7.5, and 0.2% SDS was admixed to the resuspended RNA and the mixture allowed to cool to room temperature.
  • 2X high salt loading buffer consisting of 100 mM Tris-HCl, 1 M NaCl, 2.0 mM EDTA at pH 7.5, and 0.2% SDS was admixed to the resuspended RNA and the
  • the total purified mRNA was then used in PCR amplification reactions as described in Example 2b. Alternatively, the mRNA was further purified to poly
  • RNA by the following procedure.
  • the total MRNA was applied to an oligo-dT (Collaborative Research Type 2 or Type 3) column that was previously prepared by washing the oligo-dT with a solution containing 0.1 M sodium hydroxide and 5 mM EDTA and then equilibrating the column with DEPC-H 2 0.
  • the eluate was collected in a sterile polypropylene tube and reapplied to the same column after heating the eluate for 5 minutes at 65°C.
  • the oligo-dT column was then washed with 2 ml of high salt loading buffer consisting of 50 mM Tris-HCl at pH 7.5, 500 mM sodium chloride, 1 mM EDTA at pH 7.5 and 0.1% SDS.
  • the oligo dT column was then washed with 2 ml of IX medium salt buffer consisting of 50 mM Tris-HCl at pH 7.5, 100 mM, 1 mM EDTA and 0.1% S
  • the messenger RNA was eluted from the oligo-dT column with 1 ml of buffer consisting of 10 mM Tris-HCl at pH 7.5, 1 mM EDTA at pH 7.5, and 0.05% SDS.
  • the messenger RNA was purified by extracting this solution with phenol/chloroform followed by a single extraction with 100% chloroform.
  • the messenger RNA was concentrated by ethanol precipitation and resuspended in DEPC H 2 0.
  • the resultant purified mRNA contained a plurality of anti-human cytomegalovirus (HCMV) antibodies encoding V H and V L sequences for preparation of an anti-HCMV Fab DNA library.
  • HCMV anti-human cytomegalovirus
  • nucleotide sequences encoding the immunoglobulin protein CDR's are highly variable. However, there are several regions of conserved sequences that flank the V region domains of either the light or heavy chain, for instance, and that contain substantially conserved nucleotide sequences, i.e., sequences that will hybridize to the same primer sequence. Therefore, polynucleotide synthesis (amplification) primers that hybridize to the conserved sequences and incorporate restriction sites into the DNA homolog produced that are suitable for operatively linking the synthesized DNA fragments to a vector were constructed. More specifically, the primers were designed so that the resulting DNA homologs produced can be inserted into an expression vector used in practicing this invention in reading frame with the upstream translatable DNA sequence at the region of the vector containing the directional ligation means.
  • V H1a 5' CAGGTGCAGCTCGAGCAGTCTGGG 3' SEQ ID NO 42
  • V H1f 5' CAGGTGCAGCTGCTCGAGTCTGGG 3' SEQ ID NO 43
  • V practice 2f 5 'CAGGTGCAGCTACTCGAGTCGGG 3' SEQ ID NO 44
  • V H3a 5' GAGGTGCAGCTCGAGGAGTCTGGG 3' SEQ ID NO 45
  • V practice 3f 5' GAGGTGCAGCTGCTCGAGTCTGGG 3' SEQ ID NO 46
  • V H4f 5' CAGGTGCAGCTGCTCGAGTCGGG 3' SEQ ID NO 47
  • V H6a 5' CAGGTACAGCTCGAGCAGTCAG
  • each of the 5' primers listed above were separately paired in PCR amplifications with the 3• primer, C G1z , having the nucleotide sequence 5' GCATGTACTAGTTTTGTCACAAGATTTGGG 3' (SEQ ID NO 49).
  • C, G1z is the primer for the heavy chain corresponding to part of the hinge region.
  • the Spe I site for cloning into the pComb2-3 vector is underlined.
  • the nucleotide sequences encoding the V L domain are highly variable. However, there are several regions of conserved sequences that flank the V L domains including the J L , V L framework regions and V L leader/promotor. Therefore, amplification primers were constructed that hybridized to the conserved sequences and incorporate restriction sites that allow cloning the amplified fragments into the pComb2-3 expression vector cut with Sac I and Xba I.
  • V ⁇ la 5 » GACATCGAGCTCACCCAGTCTCCA 3' SEQ ID NO 50
  • V ⁇ 1s (5* GACATCGAGCTCACCCAGTCTCC 3' SEQ ID NO 51)
  • V ⁇ 2a 5' GATATTGAGCTCACTCAGTCTCCA 3' SEQ ID NO 52
  • V ⁇ 5' GAAATTGAGCTCACGCAGTCTCCA 3' SEQ ID NO 53
  • V ⁇ b 5' GAAATTGAGCTCACRCAGTCTCCA 3', where R was either A or G, SEQ ID NO 54
  • These primers also introduced a Sac I restriction endonuclease site indicated by the underlined nucleotides to allow the kappa V L DNA homologs to be cloned into the p
  • the 3' kappa V L amplification primer, C ⁇ 1d had a nucleotide sequence 5'
  • the C ⁇ ld primer was used in separate PCR amplifications with each of the 5• primers listed above to amplify kappa light chains while incorporating the underlined Xba I restriction endonuclease site required to insert the kappa V L DNA homologs into the pComb2-3 expression vector.
  • V L1 5 1 AATTTTGAGCTCACTCAGCCCCAC 3' SEQ ID NO 56
  • V L2 5 1 AATTTTGAGCTCACTCAGCCCCAC 3' SEQ ID NO 56
  • V L7 (5' CAGGTTGAGCTCACTCAACCGCCC 3' SEQ ID NO 62) .
  • These primers also introduced a Sac I restriction endonuclease site indicated by the underlined nucleotides to allow the lambda V L DNA homologs to be cloned into the pComb2-3 expression vector.
  • the 3' V L lambda amplification primer, C L2 had a nucleotide sequence 5' CGCCGTCTAGAACTATGAACATTCTGTAGG 3' (SEQ ID NO 63) corresponding to the 3' end of the light chain constant domain.
  • the C L2 primer was used in separate PCR amplifications with each of the 5' primers listed above to amplify lambda light chain while incorporating the underlined Xba I restriction endonuclease site required to insert the lambda V L DNA homologs into the pComb2-3 expression vector.
  • mRNA prepared in Example 2a was used as a template for cDNA synthesis by a primer extension reaction.
  • 20-50 ⁇ g of total mRNA in water was first hybridized (annealed) at 70°C for 10 minutes with 600 ng (60.0 pmol) of either the heavy or light chain 3' primers in pairs listed above.
  • the hybridized admixture was used in a typical 50 ⁇ l reverse transcription reaction containing 200 ⁇ M each of dATP, dCTP, dGTP and dTTP, 40 mM Tris-HCl at pH 8.0, 8 mM MgCl 2 , 50 mM NaCl, 2 mM spermidine and 600 units of reverse transcriptase (Superscript; BRL) .
  • the reaction admixture was then maintained for 1 hour at 37°C to form an RNA-cDNA admixture.
  • RNA-cDNA admixture was then used in PCR amplification in a reaction volume of 100 ⁇ l containing a mixture of all four dNTP's at a concentration of 60 ⁇ M, 50 mM KC1, 10 mM Tris-HCl at pH 8.3, 15 mM MgCl 2 , 0.1% gelatin and 5 units of Pyrococcus furiosis DNA polymerase (Stratagene) , and 60 pmol of the appropriate 5' and 3• pairs of heavy chain primers listed in Example 2bl) or either kappa or lambda 5' and 3' primers listed in Example 2bl) .
  • the separate reaction admixtures were then subjected to 35 cycles of amplification on a Perkin Elmer 9600 Thermal Cycler (Perkin-Elmer, Norwalk, CT) .
  • Each amplification cycle included denaturation at 91°C for 1 minute, annealing at 52°C for 2 minutes and polynucleotide synthesis by primer extension (elongation) at 72°C for 1.5 minutes, followed by a final maintenance period of 10 minutes at 72°C.
  • An aliquot of each of the reaction admixtures was then separately electrophoresed on a 2% agarose gel.
  • V H -coding also referred to as Fd
  • the kappa V L -coding homologs were combined with the lambda V L -coding homolog to form one light chain DNA homolog-containing sample.
  • the resultant separate heavy and light chain PCR samples were then extracted twice with phenol/chloroform, once with chloroform, ethanol precipitated and were stored at -70°C in 10 mM Tris-HCl at pH 7.5, and 1 mM EDTA.
  • extension primers were designed. These oligonucleotide primers contained a poly(GA) tail 5' to the sequence of the original primers, the result of which increases the numbers of bases between the cutting site and the end of the molecule. All primer extension amplifications were performed as described above with 10 ng of the pooled heavy or light chain homologs prepared above with the primers indicated below. Twenty-five amplifications were performed on a Perkin Elmer 9600 Thermal Cycler (Perkin-Elmer) with denaturation at 94°C for 30 seconds, hybridization at 60°C for 20 seconds and extension at 72°C for 1 minute.
  • Perkin Elmer 9600 Thermal Cycler Perkin-Elmer
  • V H or Fd The heavy chain (V H or Fd) amplification was performed by using the 5' primers V Hae ⁇ t
  • the light chain, both kappa and lambda, amplification was performed with either of two sets of primers, with the latter set being the preferred primer pair.
  • the 5' primer V Ke ⁇ t (5' AGAGAGAGAGAGAGAGAGAGAGGAHATYGAGCTCACBCAGTCTCC 3', where H was either A, C or T, Y was either C or T, and B was either G,T or C, SEQ ID NO 67) was paired with the 3' primer C K1zext (5' AGAGAGAGAGAGAGAGAGAGCGCCGTCTAGAACTAACACTCTC 3' SEQ ID NO 68) .
  • the improved 3' kappa chain primer C ⁇ 1d (5' GCGCCGTCTAGAATTAACACTCTCCCCTGTTGAAGCTCTTTGTGACGGGC GAACTCAG 3' SEQ ID NO 55) was paired with the extension primer C ⁇ 1de ⁇ t (5' AGAGAGAGAGAGAGAGAGCGCCGTCTAGAATTAACACTCTC 3' SEQ ID NO 69) .
  • the resultant extension primed heavy and light chain products were then separately ligated into pComb2-3 expression vector as described below. 4) Insertion of V,. and V L -Coding DNA Homologs into pComb2-3 Expression Vector
  • V H -coding DNA homologs (heavy chain) prepared above were then digested with an excess of Xho I and Spe I for subsequent ligation into a similarly digested and linearized pComb2-3 in a total volume of 150 ⁇ l with 10 units of ligase at 16°C overnight.
  • the construction of the library was performed as described by Burton et al., Proc. Natl. Acad. Sci.. USA. 88:10134-10137 (1991). Briefly, following ligation, the pComb2-3 vector containing heavy chain DNA was then transformed by electroporation into 300 ⁇ l of XLl-Blue cells. After transformation and culturing, library size was determined by plating aliquots of the culture. Typically the library had about 10 7 members. An overnight culture was then prepared from which phagemid DNA containing the heavy chain library was prepared.
  • phage were prepared to allow for isolation of HCMV specific Fabs by panning on target antigens.
  • SOC medium SOC was prepared by admixture of 20 g bacto-tryptone, 5 g yeast extract and 0.5 g NaCl in 1 liter of water, adjusting the pH to 7.5 and admixing 20 ml of glucose just before use to induce the expression of the Fd-cpIII and light chain heterodimer
  • SOC SOC medium
  • SB was prepared by admixing 30 g tryptone, 20 g yeast extract, and 10 g Mops buffer per liter with pH adjusted to 7 containing 20 ⁇ g/ml carbenicillin and 10 ⁇ g/ml tetracycline were added.
  • This resultant admixture was admixed to 100 ml SB containing 50 ⁇ g/ml carbenicillin and 10 ⁇ g/ml tetracycline and shaken for 1 hour, after which time helper phage VCSM13 (10 12 pfu) were admixed and the admixture was shaken for an additional 2 hours. After this time, 70 ⁇ g/ml kanamycin was admixed and maintained at 30°C overnight. The lower temperature resulted in better heterodimer incorporation on the surface of the phage. The supernatant was cleared by centrifugation (4000 rpm for 15 minutes in a JA10 rotor at 4°C) .
  • Phage were precipitated by admixture of 4% (w/v) polyethylene glycol 8000 and 3% (w/v) NaCl and maintained on ice for 30 minutes, followed by centrifugation (9000 rpm for 20 minutes in a JA10 rotor at 4°C) . Phage pellets were resuspended in 2 ml of PBS and microcentrifuged for 3 minutes to pellet debris, transferred to fresh tubes and stored at -20°C for subsequent screening as described below.
  • phage packetaged phagemid
  • the phage library produced in Example 2b5) was panned against viral lysate containing HCMV antigen extract as described herein on coated microtiter plate to select for anti-HCMV heterodimers.
  • the panning procedure used was a modification of that originally described by Parmley and Smith (Parmley et al.. Gene. 73:305-318 (1988)). Four rounds of panning were performed to enrich for specific antigen-binding clones. For this procedure, four wells of a microtiter plate (Costar 3690) were coated overnight at 4°C with 25 ⁇ l of 40 ⁇ g/ml of the viral lysate in 0.1 M bicarbonate, pH 8.6. The HCMV-containing viral lysate was prepared by infecting human embryonic lung fibroblasts (HEL, ATCC Accession No. CCL 137) with human CMV strain AD-169 (ATCC Accession No.
  • VR-5348 at a input of 0.01 pfu per cell.
  • the infected cells were maintained for four to five days in Eagle's minimal essential medium supplemented with 1% fetal bovine serum, 100 units of penicillin/ml and 100 ⁇ g of streptomycin/ml. Eight to 11 days after infection, cultures were harvested by dislodging the cells.
  • the viral lysate was obtained by lysing the collected cells in 1 ml lysis buffer containing 140 mM NaCl, 20 mM Tris-HCl at pH 8.3, 1% Nonidet P-40, 0.5% deoxycholate, 1 mg/ml chick ovalbumin, 0.2 mM phenylmethylsulfonyl fluoride and 100 units/ml aprotinin.
  • the HCMV viral lysate-coated wells were washed twice with water and blocked by completely filling the well with 3% (w/v) BSA in PBS and maintaining the plate at 37°C for 1 hour. After the blocking solution was shaken out, 50 ⁇ l of the phage library prepared above (typically 10 11 cfu) were admixed to each well, and the plate was maintained for 2 hours at 37°C.
  • the plate was washed once more with distilled water and adherent phage were eluted by the addition of 50 ⁇ l of elution buffer (0.1 M HC1, adjusted to pH 2.2 with solid glycine, containing 1 mg/ml BSA) to each well followed by maintenance at room temperature for 10 minutes.
  • the elution buffer was pipetted up and down several times, removed, and neutralized with 3 ⁇ l of 2 M Tris base per 50 ⁇ l of elution buffer used.
  • Helper phage VCSM13 (10 12 pfu) were then added and the culture was shaken for an additional 2 hours. After this time, 70 ⁇ g/ml kanamycin was added and the culture was incubated at 37°C overnight. Phage preparation and further panning were repeated as described above.
  • the initial phage input ratio was determined by titering on selective plates to be approximately 10 11 cfu for each round of panning.
  • the final phage output ratio was determined by infecting 2 ml of logarithmic phase XLl-Blue cells as described above and plating aliquots on selective plates.
  • 4.6 X 10 11 phage were applied to wells and 2.0 X 10 5 phage were eluted.
  • 3.0 X IO 7 phage were eluted.
  • the panning selection resulted in an amplification of HCMV-specific clones of greater than 130-fold.
  • the panned phage surface libraries were then converted into ones expressing soluble Fab fragments for further screening by ELISA as described below. 7) Preparation of Soluble Heterodimers and Characterization of Binding Specificity to HCMV Antigens
  • soluble Fab heterodimers from acid eluted phage were prepared and analyzed in ELISA assays on HCMV-derived antigen-coated plates prepared as described above in Example 2b6) .
  • phagemid DNA from the positive clones prepared above was isolated and digested with Spe I and Nhe I. Digestion with these enzymes produced compatible cohesive ends.
  • the 4.7-kb DNA fragment lacking the gene III portion was gel-purified (0.6% agarose) and self-ligated. Transformation of E. coli XLl-Blue afforded the isolation of recombinants lacking the cpIII fragment. Clones were examined for removal of the cpIII fragment by Xho I - Xba I digestion, which should yield an 1.6 kb fragment.
  • Clones were grown in 100 ml SB containing 50 ⁇ g/ml carbenicillin and 20 mM MgCl 2 at 37°C until an OD 600 of 0.2 was achieved. IPTG (1 mM) was added and the culture grown overnight at 30°C (growth at 37°C provides only a light reduction in heterodimer yield) . Cells were pelleted by centrifugation at 4000 rpm for 15 minutes in a JA10 rotor at 4°C. Cells were resuspended in 4 ml PBS containing 34 ⁇ g/ml phenylmethylsulfonyl fluoride (PMSF) and lysed by sonication on ice (2-4 minutes at 50% duty) .
  • PMSF phenylmethylsulfonyl fluoride
  • Debris was pelleted by centrifugation at 14,000 rpm in a JA20 rotor at 4°C for 15 minutes. The supernatant was used directly for ELISA analysis as described below and was stored at -20°C. For the study of a large number of clones, 10 ml cultures provided sufficient heterodimer for analysis. In this case, sonications were performed in 2 ml of buffer.
  • HCMV antigen lysate was admixed to individual wells of a microtiter plate as described above for the panning procedure with the exception that 1 ⁇ l was used and maintained at 4°C overnight to allow the protein solution to adhere to the walls of the well. After the maintenance period, the wells were washed five times with water and thereafter maintained for 1 hour at 37°C with 100 ⁇ l solution of 1% BSA diluted in PBS to block nonspecific sites on the wells. Afterwards, the plates were inverted and shaken to remove the BSA solution.
  • soluble heterodimers prepared above were then admixed to each well and maintained at 37°C for 1 hour to form immunoreaction products. Following the maintenance period, the wells were washed ten times with water to remove unbound soluble antibody and then maintained with a 25 ⁇ l of a 1:1000 dilution of secondary goat anti-human IgG F(ab') 2 conjugated to alkaline phosphatase diluted in PBS containing 1% BSA. The wells were maintained at 37°C for 1 hour after which the wells were washed ten times with water followed by development with 50 ⁇ l of p-nitrophenyl phosphate (PNPP) . Color development was monitored at 405 nm. Positive clones gave A405 values of >0.5 (mostly >1.0) after 10 minutes, whereas negative clones gave values of 0.1 to 0.2.
  • PNPP p-nitrophenyl phosphate
  • the assay by ELISA of the soluble HCMV antibodies identified a large proportion of phage clones (16/20) that had eluted from the fourth round of HCMV panning which were antigen specific.
  • Immunoreactive heterodimers as determined in the above ELISA are then analyzed by competition ELISA to determine the affinity of the selected heterodimers.
  • the ELISA is performed as described above on microtiter wells separately coated with HCMV antigen lysate prepared as described above and diluted in 0.1 M bicarbonate buffer at pH 8.6. Increasing concentrations of soluble HCMV antigen over a dilution range in 0.5% BSA/0.025% Tween 20/PBS are admixed with soluble heterodimers, the dilutions of which are determined in titration experiments that result in substantial reduction of 0D values after a 2-fold dilution.
  • HCMV recombinant Fabs of this invention is performed in the presence of excess Fabs of this invention as well as those HCMV antibodies, polyclonal or monoclonal, present in patient sera, either asymptomatic or symptomatic, or obtained by other means such as EBV transformation and the like.
  • the ability of an exogenously admixed antibody to compete for the binding of a characterized Fab of this invention allows for the determination of equivalent antibodies in addition to unique epitopes and binding specificities.
  • the antibodies from patients in the convalescent phase of primary and recurrent HCMV infections competed with neutralizing HCMV-specific Fabs of this invention for the binding to HCMV glycoprotein B (gB) .
  • the HCMV-positive Fabs were screened on a virally infected monkey kidney epithelial cell line, designated Vero.
  • the cells were first infected at a low multiplicity of infection with HCMV and the cells were fixed 96 hours postinfection in 4% paraformaldehyde in PBS. After washing in PBS, the cell layer was blocked for 30 minutes in PBS containing 0.3% Triton X-100 and 1 mg/ml of BSA. The cells were then maintained for 1 hour at room temperature with bacterial supernate containing the HCMV-specific Fab heterodimers diluted 1:2 in blocking buffer.
  • the cells were washed with PBS and then maintained for 1 hour with a 1:1000 dilution of secondary fluorescein-labelled goat anti-human Fab antibodies (Boehringer Mannheim Biochemicals, Indianapolis, IN) .
  • the cells were then washed and mounted in n-propyl gallate solution (80 ml of glycerol in 20 ml of PBS containing 4% n-propyl gallate) . The preparations were then observed under a Zeiss Axiophot microscope.
  • the preparation of the PMNL was as described by Gerna et al., J. Clin. Microbiol.. 30:1232-1237 (1992) . Briefly, dextran-enriched PMNL preparations were obtained by centrifugation of 2 x 10 5 cells only glass slides at 900 X g for 3 minutes at room temperature using a cytocentrifuge (Cytospin 3, Shandon Southern Products, Runcorn, UK) . Slides were air-dried and fixed with 5% paraformaldehyde with 2% sucrose in PBS for 10 minutes at room temperature.
  • the cells were permeabilized with 0.5% NP40, 10% sucrose, and 1% fetal calf serum for 5 minutes at room temperature and then washed 3 times. After air-drying, the slides were incubated with the commercially available pool of mouse monoclonal antibodies ClO/Cll (Clonab, Biotest, Germany) or with the HCMV-immunoreactive Fabs 8, 15, 18, or a pool of Fabs 8, 15, and 18 at a concentration of approximately 30 ⁇ g/ml.
  • HCMV-immunoreactive Fab samples were used in immunofluorescence assays with PMNLs from patients with clinically relevant CMV disease, all three of the Fabs tested demonstrated comparable numbers of infected PMNLs as the pp65-specific monoclonal antibody ClO/Cll (Table 5). Thus, the HCMV- immunoreactive Fabs specifically recognized HCMV proteins in infected cells and failed to react with uninfected cells.
  • Non CMV-infected 19 0 0 0 0 0 0 0 0
  • the nucleotide sequence of the HCMV- immunoreactive Fabs 8, 15, and 18 were determined as described in Example 5.
  • the nucleotide sequence of HCMV-specific Fabs 8 and 15 reveal that the heavy and light chain variable region nucleotide sequences are identical.
  • the amino acid residue sequences of HCMV-specific Fabs 8 and 15 are identical.
  • the nucleotide sequence of the HCMV-specific Fabs 8 and 15 are also identical to HCMV-immunoreactive Fab 11.
  • the Fabs 8 and 15 give comparable results in this assay. While the amino acid residue sequence of HCMV-specific Fab 18 and Fab 4 light chain variable regions are unique, the amino acid residue sequences of the heavy chain variable regions are identical.
  • the methods of this invention have identified unique HCMV- immunoreactive Fabs that specifically immunoreact with PMNLs from patients with clinically relevant CMV disease in a manner which is comparable to the reactivity of the mouse monoclonal ClO/Cll which specifically immunoreacts with protein pp65.
  • viruses are neutralized by more than one mechanism and the one employed will depend on factors such as the nature of the virus, the epitope recognized, the isotype of the antibody, the cell receptor used for viral entry and the virus:antibody ratio.
  • the principle mechanisms of neutralization can be considered as aggregation of virions, inhibition of attachment of virus to cell receptor and inhibition of events following attachment such as fusion of viral and cellular membranes and secondary uncoating of the virion.
  • One of the important features of the third mechanism is that it may require far less than the approximately stoichiometric amounts of antibody expected for the first two mechanisms since occupation of a small number of critical sites on the virion may be sufficient for neutralization.
  • Example 2b7 Cells are then separately preincubated with dilutions of the soluble Fabs of this invention prepared in Example 2b7) or control antibodies diluted in PBS for 1 hour at 37°C.
  • the antibody-incubated cells are then inoculated with HCMV strain AD 169 as described in Example 2b6) for assaying plaque formation or inhibition thereof.
  • Inhibition of infectivity, also called neutralization, by antibodies is expressed as the percent of plaque formation in cultures preincubated with either the HCMV-specific antibodies or control antibodies compared to those cells exposed to PBS alone.
  • plaque assays showed that selected Fabs produced by the present methods can exhibit moderate to strong neutralizing activity, and typically the neutralizing Fabs exhibit an immunofluorescence reaction pattern with a glycoprotein-like distribution in HCMV-infected cells.
  • the heavy chain sequence was determined using the sequencing primer pair, SEQGb, (5' GTCGTTGACCAGGCAGCCCAG 3' SEQ ID NO 70) that hybridized to the plus strand and the T3 primer (5' ATTAACCCTCACTAAAG 3' SEQ ID NO 71) that hybridized to the minus strand.
  • SEQKb primer (5 1 ATAGAAGTTGTTCAGCAGGCA 3' SEQ ID NO 72) and KEF primer (5' GAATTCTAAACTAGCTAGTTCG 3' SEQ ID NO 73) were used, binding to the plus and minus strands, respectively.
  • the amino acid residue sequences of the variable heavy and light chains derived from the nucleic acid sequences of the HCMV-specific clones are listed in the Sequence Listing with assigned SEQ ID NOs for each of the designated heavy or light chains as indicated in Table 4.
  • the heavy chain clone designated GLCMV 11 had a unique nucleotide sequence and thus a unique and different amino acid residue sequence
  • the two remaining clones that were selected from the library had identical sequences.
  • the heavy chain clone designated GLCMV 4 was also found in the clone designated GLCMV 18. The same redundancy was present in some of the light chain variable domain clones where clones GLCMV 11 and 18 had the same light chain amino acid residue sequence.
  • Light chain variable domain clone 4 had a unique nucleotide sequence and thus a unique amino acid residue sequence.
  • HCMV-specific Fabs containing both heavy and light chain variable domains were found to have unique as well as overlapping pairing to form Fabs.
  • HCMV Fab 11 had a unique heavy chain sequence.
  • the heavy chain sequence of HCMV Fab 4 that was the same as the heavy chain in HCMV Fab 18, was shown to combine with a unique light chain to form unique Fabs.
  • HCMV Fab Heterodimers were then tested by immunoprecipitation with radiolabeled HCMV-infected cells.
  • 400 ⁇ l samples of lysates of the HCMV- immunoreactive Fabs 4, 5, 11, 14, and 34 were reacted with extracts of HCMV-infected cells radiolabeled with S 35 -methionine between 96 to 120 hours.
  • Monoclonal antibodies which immunoreact with gB, gH, IE 1 and 2, ICP 8, and ICP 36 were also reacted with extracts of radiolabeled HCMV-infected cells.
  • the monoclonal antibodies gB and gH are immunoreactive with phosphoroproteins gB and gH.
  • the monoclonal antibody ICP 36 is immunoreactive with a family of DNA-binding proteins.
  • Fabs, GL5, GL14, and GL34 and the monoclonal antibody ICP 36 which is immunoreactive with a family of DNA binding proteins demonstrate a similar electrophoretic banding pattern after immunoprecipitation. These Fabs and the monoclonal antibody ICP 36 are therefore likely to be reactive with a related antigen or antigens. These Fabs are not further characterized herein.
  • the Fab GL11 and the monoclonal antibody gH which is immunoreactive with the phosphoroprotein gH demonstrate similar electrophoretic banding pattern after immunoprecipitation. This Fab and the monoclonal antibody gH are therefore likely to be immunoreactive with a related antigen or antigens.
  • the GL11 Fab is further characterized herein.
  • the recombinant Fab heterodimers of this invention recognize various HCMV-infected-cell proteins, including glycoproteins.
  • a heavy chain is first subcloned into a tetanus toxoid binding clone expressed in pComb2-3.
  • the light chain library is then cloned into this construction to form a library.
  • the subcloning step is used to avoid contamination with and over-representation of the original light chain.
  • a similar procedure is adopted for shuffling of heavy chains against the light chain from light chain clones to form a separate library. Cloning and panning procedures are carried out as described above for the original library.
  • Combinatorial libraries randomly recombine heavy and light chains. Because of this randomization, the extent that antibodies derived from such libraries represent those produced in a response in vivo can then be determined. In principle, a heavy-light chain combination binding antigen could arise fortuitously, i.e., neither chain is involved in binding antigen in vivo but the combination does bind antigen in vitro.
  • Shuffling of a known heavy chain with a light chain binder and vice versa is preferred for use in this invention as new Fabs can be obtained beyond those generated in vivo.
  • Heavy chain promiscuity i.e., the ability of a heavy chain to pair with different light chains with retention of antigen affinity, presents serious problems for identifying in vivo light chain partners. This applies not only to the strict definition of partners as having arisen from the same B-cell but also to one which would encompass somatic variants of either partner.
  • the existence of predominant heavy-light chain combinations, particularly involving intraclonal light chain variants suggests that the light chains concerned are well represented in the library and probably are associated with antigen binding in vivo.
  • promiscuity means that, although some combinations probably do occur in vivo, one cannot be certain that one is not shuffling immune partner chains in the recombination.
  • the light chains arising from the combinatorial library may not be those employed in vivo.
  • a binary system of replicon-compatible plasmids is used in this invention to test the potential for promiscuous recombination of heavy and light chains within sets of human Fab fragments isolated from combinatorial antibody libraries. The efficiency of the system is demonstrated for the combinatorial library of this invention derived from the bone marrow library prepared in Example 2.
  • the binary plasmids pTACOlH and pTCOl for use in this invention contain the pelB leader region and multiple cloning sites from Lambda Hc2 and Lambda Lc3, respectively, and the set of replicon-compatible expression vectors pFL281 and pFL261.
  • pFL281 and pFL261 have been described by Larimer et al., Prot. Eng.. 3:227-231 (1990), the disclosure of which is hereby incorporated by reference.
  • the nucleotide sequences of pFL261 and pFL281 are in the EMBL,
  • the plasmid pFL281 is based on the plasmid pFL260 also described by Larimer et al., supra . and having the accession number M29362.
  • the only distinction between the plasmids pFL260 and pF1281 is that pFL281 lacks a 60 bp sequence of pFL260 between the Eag I site and the Xma III site resulting in the loss of one of the two BamH I sites. This deletion is necessary to allow for cloning of the BamH I Hc2 fragment into the expression vector as described herein.
  • the replicon-compatible expression vectors share three common elements: (i) the fl single-stranded DNA phage intergenic IG regions; (ii) the tightly regulated tac promoter and lac operator; and (iii) an rbs-ATG region with specific cloning sites.
  • the plasmid vectors differ in their antibiotic resistance markers and plasmid replicons: pFL261 carries a gene encoding chloramphenicol acetyltransferase (cat) , conferring chloramphenicol resistance, and the pl5A replicon; pFL281 carries a gene encoding beta-lactamase (bla) , conferring ampicillin resistance, and the ColEl replicon (ori) from pMBl.
  • the pl5A and ColEl replicons permit the coincident maintenance of both plasmids in the same E. coli host.
  • Hc2 and Lc2 vectors prepared in Examples la2) and la3) are converted into the plasmid form using standard methods familiar to one of ordinary skill in the art and as described by Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd ed. , Cold Spring Harbor Laboratory Press, New York (1989) and subsequently digested with Xho I-Spe I (pHc2) and Sac I-Xba I for (pLc2) .
  • the synthetic linkers for insertion into the digested pHc2 and Lc2 plasmids are prepared by American Synthesis. The linkers are inserted to increase the distance between cloning sites so as to increase the effectiveness of the digestions.
  • the 5' and 3' linkers for preparing the double-stranded linker insert into pHc2 are 5* TCGAGGGTCGGTCGGTCTCTAGACGGTCGGTCGGTCA 3' (SEQ ID NO 80) and 5' CTAGTGACCGACCGACCGTCTAGAGACCGACCGACCC 3' (SEQ ID NO 81), respectively.
  • the 5* and 3' linkers for preparing the double-stranded linker insert into pLc2 are 5' CGGTCGGTCGGTCCTCGAGGGTCGGTCGGTCT 3' (SEQ ID NO 82) and 5'
  • CTAGAGACCGACCGACCCTCGAGGACCGACCGACCGAGCT 3' (SEQ ID NO 83), respectively.
  • the pairs of linker oligonucleotides are separately ligated to their respective digested, calf intestinal phosphatase-treated vectors.
  • the multiple cloning sites of pHc2 and pLc2 are transferred into the expression vectors, pFL281 and pFL261, respectively.
  • the multiple cloning regions of both Lc2 and Hc2 are separately amplified by PCR as described by Gram et al., Proc. Natl. Acad. Sci.. USA. 89:3576-3580 (1992) and as described in Example 2b using Vent Polymerase (New England Biolabs) according to the manufacturer's recommendations.
  • the forward primer 5' CAAGGAGACAGGATCCATGAAATAC 3 » (SEQ ID NO 84) is designed to provide a flush fusion of the pelB leader sequence to the ribosome binding sites of the cloning vectors pFL261 and pFL281 via its internal BamH I site indicated by the underlined nucleotides.
  • the reverse primer 5' AGGGCGAATTGGATCCCGGGCCCCC 3' (SEQ ID NO 85) is designed to anneal downstream of the region of interest in the parent vector of pHc2/pLc2 and create a second BamH I site.
  • the resultant Hc2 and Lc2 PCR amplification products are then digested with BamH I to provide for BamH I overhangs for subsequent ligation into BamH I linearized pFL281 and pFL261 vectors, respectively.
  • the resulting light chain vector containing the Lc2 insert, designated pTCOl, is used in this form, whereas the heavy chain vector is further modified with a histidine tail to allow purification of Fab fragments by immobilized metal affinity chromatography as described by Skerra et al., - Ill -
  • pTCOl prepared above is first digested with Sac I and Xba I; individual light chain inserts are then obtained by separately digesting the pComb2-3 plasmids prepared and screened as described in Example 2 that bind to HCMV antigens followed by isolation of the appropriate fragment using low melting point agarose gel electrophoresis followed by agarose digestion.
  • the resultant isolated light chains are separately ligated into PTCOl overnight at 16°C under standard conditions using a 5:1 molar insert-to-vector ratio to form light chain pTCOl expression vectors.
  • pTACOlH prepared above is first digested with Xho I and Spe I; heavy chain inserts are then obtained by separately PCR amplification reactions of the pComb2-3 plasmids from which light chain inserts are obtained. PCR is used to isolate the heavy chain inserts instead of restriction digestion in order to obtain heavy chain without the cpIII gene anchor sequence in the vector.
  • the respective 5' and 3' primers for the PCR reaction, the respective 5' and 3' primers,
  • CaCl 2 -competent XLl-Blue cells (Stratagene; recAl, endAl, gyrA96, thi, hsdR17, supE44, relAl, lac, ⁇ F' proAB, lacl q , ZDM15, TnlO(tet R ) ⁇ ) are prepared and transformed with approximately 0.5 ⁇ g purified DNA of each plasmid in directed crosses of each of the 20 light chain vectors with each of the 20 heavy chain vectors.
  • the presence of both plasmids and the episome is selected for by plating transformants on triple-antibiotic agar plates (100 ⁇ g/ml carbenicillin, 30 ⁇ g/ml chloramphenicol, 10 ⁇ g/ml tetracycline, 32 g/1 LB agar) containing 1% glucose.
  • a binary plasmid system consisting of two replicon-compatible plasmids is constructed as shown in Figure 6.
  • the pTACOlH heavy chain vector schematic is shown in Figure 6A and the pTCOl light chain vector schematic is shown in Figure 6B.
  • Both expression vectors feature similar cloning sites including pel B leader sequences fused to the ribosome binding sites and the tac promoters via BamH I sites as shown in Figure 7.
  • the nucleotide sequences of the multiple cloning sites along with the tac promoter, ribosome binding sites (rbs) and the underlined relevant restriction sites for the light chain vector, pTCOl, and heavy chain vector, pTACOlH, are respectively shown in Figure 7A and Figure 7B.
  • the sequences are also listed in the Sequence Listing as described in the Brief Description of the Drawings.
  • the heavy chain vector pTACOlH also contains a (His) 5 -tail to allow purification of the recombinant Fab fragments by immobilized metal affinity chromatography.
  • the presence of both plasmids in the same bacterial cell is selected for by the presence of both antibiotics in the media. Expression is partially suppressed during growth by addition of glucose and induced by the addition of IPTG at room temperature. Under these conditions, both plasmids are stable within the cell and support expression of the Fab fragment as assayed by ELISA using goat anti-human kappa and goat anti-human IgGi antibodies.
  • the inoculated plates are then maintained with moderate shaking (200 rpm) on a horizontal shaker for 7-9 hours at 37°C, until the A ⁇ is approximately 1-1.5.
  • the cells are collected by centrifugation of the microtiter plate (1,500 X g for 30 minutes at 4°C), the supernatants are discarded, and the cells are resuspended and induced overnight at room temperature in fresh media containing 1 mM IPTG, but no glucose.
  • Cells are harvested by centrifugation, resuspended in 175 ⁇ l PBS (10 mM sodium phosphate, 160 mM NaCl at pH 7.4 at 25°C) containing 34 ⁇ g/ml phenylmethylsulfonyl fluoride (PMSF) and 1.5% (w/v) streptomycin sulfate, and lysed by 3 freeze-thaw cycles between -80°C and 37°C.
  • PMSF phenylmethylsulfonyl fluoride
  • streptomycin sulfate lysed by 3 freeze-thaw cycles between -80°C and 37°C.
  • the resultant crude extracts are partially cleared by centrifugation as above before analysis by antigen-binding ELISA.
  • Relative affinities are determined as described in Example 2b6) after coating wells with viral lysate containing HCMV antigens. For each antigen, a negative control extract of XLl-Blue cells co-transformed with pTCOl and pTACOlH is tested to determine whether other components in E. coli had any affinity for the antigens in the assay. Each extract is assayed for BSA-binding activity and BSA-positive clones are considered negative.
  • Human monoclonal anti-viral reagents, the anti-HCMV Fab heterodimers of this invention, that are capable of immunoreacting with HCMV, and in some cases mediating neutralization, provide valuable clinical agents for virus diagnosis, therapy and prophylaxis, overcoming the well known problems associated with clinical use of nonhuman antibodies.
  • the quantity of antibody administered clinically is reduced over current human pooled sera IgG preparations because of the marked increase in concentration of virus-specific antibody. Positive and negative synergy of particular monoclonal antibody combinations are contemplated for use in this invention.
  • the identification of genes encoding virus proteins shown by human antibodies to be important targets of diagnosis, therapy or prophylaxis are an important contribution of subunit vaccine design. Diagnostic applications, with the possibility of linking the antibodies of this invention to a marker group in a single construct, are also contemplated.
  • pCMV GL 11 is a plasmid containing the expression vector pComb2-3 for the expression of the Fab designated Fab 11 (GLCMV 11), prepared in Example 2.
  • the sequences of the heavy and light chain variable domains are listed in SEQ ID NOs 75 and 78, respectively. This deposit was made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • SEQUENCE DESCRIPTION SEQ ID NO:l: GGCCGCAAAT TCTATTTCAA GGAGACAGTC ATAATGAAAT ACCTATTGCC TACGGCAGCC 60 GCTGGATTGT TATTACTCGC TGCCCAACCA GCCATGGCCC AGGTGAAACT GCTCGAGATT 120 TCTAGACTAG TTACCCGTAC GACGTTCCGG ACTACGGTTC TTAATAGAAT TCG 173
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI - SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • SEQUENCE DESCRIPTION SEQ ID NO:12:
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • SEQUENCE DESCRIPTION SEQ ID NO:17: GTTATTACTC GCTGCCCAAC CAGCCATGGC CC 32 (2) INFORMATION FOR SEQ ID NO:18:
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • SEQUENCE DESCRIPTION SEQ ID NO:22: CGGAACGTCG TACGGGTAAC TAGTCTAGAA ATCTCGAG 38
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI - SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • SEQUENCE DESCRIPTION SEQ ID NO:37: TATGCTAGCT AGTAACACGA CAGGTTTCCC GACTGG 36
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • SEQUENCE DESCRIPTION SEQ ID NO:46: GAGGTGCAGC TGCTCGAGTC TGGG 24
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

L'invention concerne des anticorps monoclonaux humains réagissant immunologiquement avec le cytomégalovirus humain (HCMV). L'invention porte également sur des méthodes immunothérapeutiques et diagnostiques d'utilisation desdits anticorps monoclonaux ainsi que sur des acides nucléiques et des lignées cellulaires utilisés pour la production d'anticorps monoclonaux.
PCT/US1994/004705 1993-04-30 1994-04-29 Anticorps monoclonaux humains diriges contre des cytomegalovirus humains et procedes s'y rapportant WO1994025490A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU67775/94A AU6777594A (en) 1993-04-30 1994-04-29 Human monoclonal antibodies to human cytomegalovirus, and methods therefor

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US5598593A 1993-04-30 1993-04-30
US08/055,985 1993-04-30

Publications (1)

Publication Number Publication Date
WO1994025490A1 true WO1994025490A1 (fr) 1994-11-10

Family

ID=22001393

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1994/004705 WO1994025490A1 (fr) 1993-04-30 1994-04-29 Anticorps monoclonaux humains diriges contre des cytomegalovirus humains et procedes s'y rapportant

Country Status (2)

Country Link
AU (1) AU6777594A (fr)
WO (1) WO1994025490A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7947274B2 (en) 2007-01-04 2011-05-24 Humabs, LLC. Human cytomegalovirus neutralising antibodies and use thereof
US7955599B2 (en) 2007-01-04 2011-06-07 Humabs, LLC Human cytomegalovirus neutralizing antibodies and use thereof
US8124093B2 (en) 2008-07-16 2012-02-28 Institute For Research In Biomedicine Human cytomegalovirus neutralizing antibodies and use thereof
US9346874B2 (en) 2009-12-23 2016-05-24 4-Antibody Ag Binding members for human cytomegalovirus

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
INFECT. IMMUN., issued June 1982, Vol. 36, No. 3, L. PEREIRA et al., "Monoclonal Antibodies to Human Cytomegalovirus: Three Surface Membrane Proteins with Unique Immunological and Electrophoretic Properties Specify Cross-Reactive Determinants", pages 924-932. *
J. INFECT. DIS., Vol. 158, No. 3, issued March 1989, S.K.H. FOUNG et al., "Human Monoclonal Antibodies to Human Cytomegalovirus", pages 436-443. *
METHODS: A COMPANION TO METHODS IN ENZYMOLOGY, Vol. 2, No. 2, issued April 1991, C.F. BARBAS III et al., "Combinatorial Immunoglobulin Libraries on the Surface of Phage: Rapid Selection of Antigen-Specific Fabs", pages 119-124. *
PROC. NAT. ACAD. SCI., Vol. 88, issued November 1991, D.R. BURTON et al., "A Large Array of Human Monoclonal Antibodies to Type 1 Human Immunodeficiency Virus from Combinatorial Libraries of Asymptomatic Seropositive Individuals", pages 10134-10137. *
PROC. NAT. ACAD. SCI., Vol. 89, issued April 1992, S.L. ZEBEDEE et al., "Human Combinatorial Libraries to the Hepatitis B Surface Antigen", pages 3175-3179. *
PROC. NAT. ACAD. SCI., Vol. 90, issued May 1993, R.A. WILLIAMSON et al., "Human Monoclonal Antibodies Against a Plethora of Viral Pathogens from a Single Combinatorial Library", pages 4141-4145. *

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8545848B2 (en) 2007-01-04 2013-10-01 Institute For Research In Biomedicine Human cytomegalovirus neutralising antibodies and use thereof
US7955599B2 (en) 2007-01-04 2011-06-07 Humabs, LLC Human cytomegalovirus neutralizing antibodies and use thereof
US9611316B2 (en) 2007-01-04 2017-04-04 Institute For Research In Biomedicine Human cytomegalovirus neutralising antibodies and use thereof
US9217028B2 (en) 2007-01-04 2015-12-22 Institute For Research In Biomedicine Human cytomegalovirus neutralising antibodies and use thereof
US8298538B2 (en) 2007-01-04 2012-10-30 Institute For Research In Biomedicine Human cytomegalovirus neutralising antibodies and use thereof
US9149524B2 (en) 2007-01-04 2015-10-06 Institute For Research In Biomedicine Human cytomegalovirus neutralising antibodies and use thereof
US8309089B2 (en) 2007-01-04 2012-11-13 Institute For Research In Biomedicine Human cytomegalovirus neutralising antibodies and use thereof
US7947274B2 (en) 2007-01-04 2011-05-24 Humabs, LLC. Human cytomegalovirus neutralising antibodies and use thereof
US8435524B2 (en) 2008-07-16 2013-05-07 Institute For Research In Biomedicine Human cytomegalovirus neutralizing antibodies and use thereof
US9491906B2 (en) 2008-07-16 2016-11-15 Institute For Research In Biomedicine Human cytomegalovirus neutralizing antibodies and use thereof
US8765132B2 (en) 2008-07-16 2014-07-01 Institute For Research In Biomedicine Human cytomegalovirus neutralizing antibodies and use thereof
US9127049B2 (en) 2008-07-16 2015-09-08 Institute For Research In Biomedicine Human cytomegalovirus neutralizing antibodies and use thereof
US8298539B2 (en) 2008-07-16 2012-10-30 Institute For Research In Biomedicine Human cytomegalovirus neutralizing antibodies and use thereof
US8287870B2 (en) 2008-07-16 2012-10-16 Institute For Research In Biomedicine Human cytomegalovirus neutralizing antibodies and use thereof
US9221897B2 (en) 2008-07-16 2015-12-29 Institute For Research In Biomedicine Human cytomegalovirus neutralizing antibodies and use thereof
US9249213B2 (en) 2008-07-16 2016-02-02 Institute For Research In Biomedicine Human cytomegalovirus neutralizing antibodies and use thereof
US10889632B2 (en) 2008-07-16 2021-01-12 Institute For Research In Biomedicine Human cytomegalovirus neutralizing antibodies and use thereof
US9365636B1 (en) 2008-07-16 2016-06-14 Institute For Research In Biomedicine Human cytomegalovirus neutralizing antibodies and use thereof
US9371372B2 (en) 2008-07-16 2016-06-21 Institute For Research In Biomedicine Human cytomegalovirus neutralizing antibodies and use thereof
US8603480B2 (en) 2008-07-16 2013-12-10 Institute For Research In Biomedicine Human cytomegalovirus neutralizing antibodies and use thereof
US9527902B2 (en) 2008-07-16 2016-12-27 Institute For Research In Biomedicine Human cytomegalovirus neutralizing antibodies and use thereof
US8124093B2 (en) 2008-07-16 2012-02-28 Institute For Research In Biomedicine Human cytomegalovirus neutralizing antibodies and use thereof
US9725502B2 (en) 2008-07-16 2017-08-08 Institute For Research In Biomedicine Human cytomegalovirus neutralizing antibodies and use thereof
US9796772B2 (en) 2008-07-16 2017-10-24 Institute For Research In Biomedicine Human cytomegalovirus neutralizing antibodies and use thereof
US9796771B2 (en) 2008-07-16 2017-10-24 Institute For Research In Biomedicine Human cytomegalovirus neutralizing antibodies and use thereof
US9803000B1 (en) 2008-07-16 2017-10-31 Institute of Research in Biomedicine Human cytomegalovirus neutralizing antibodies and use thereof
US10040845B2 (en) 2008-07-16 2018-08-07 Institute For Research In Biomedicine Human cytomegalovirus neutralizing antibodies and use thereof
US10414817B2 (en) 2008-07-16 2019-09-17 Institute For Research In Biomedicine Human cytomegalovirus neutralizing antibodies and use thereof
US9346874B2 (en) 2009-12-23 2016-05-24 4-Antibody Ag Binding members for human cytomegalovirus

Also Published As

Publication number Publication date
AU6777594A (en) 1994-11-21

Similar Documents

Publication Publication Date Title
AU681360B2 (en) Human neutralizing monoclonal antibodies to human immunodeficiency virus
US6156313A (en) Human monoclonal antibodies to herpes simplex virus and methods therefor
US5804440A (en) Human neutralizing monoclonal antibodies to human immunodeficiency virus
WO1994007922A9 (fr) Anticorps monoclonaux neutralisateurs humains contre le virus de l'immunodeficience humaine
EP0671927B1 (fr) Anticorps monoclonaux et humains neutralisants contre le virus respiratoire syncytial
US6395275B1 (en) Synthetic human neutralizing monoclonal antibodies to human immunodeficiency virus
US6376170B1 (en) Ligand capture-directed selection of antibody
WO1996002273A9 (fr) Anticorps monoclonaux humains neutralisant le virus de l'immunideficience humaine
EP0851924A1 (fr) Anticorps monoclonaux neutralisants diriges contre le virus respiratorie syncytial
US7364737B2 (en) Human neutralizing monoclonal antibodies to respiratory syncytial virus
US20110097270A1 (en) Monoclonal Antibodies That Bind or Neutralize Hepatitis B Virus
WO1994025490A1 (fr) Anticorps monoclonaux humains diriges contre des cytomegalovirus humains et procedes s'y rapportant
US20030187247A1 (en) Human neutralizing monoclonal antibodies to human immunodeficiency virus
AU737135B2 (en) Human neutralizing monoclonal antibodies to human immunodeficiency virus
AU4162096A (en) Method for identifying protective antigens for eliciting neutralizing antibodies
AU745489B2 (en) Human neutralizing monoclonal antibodies to human immunodeficiency virus

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref country code: US

Ref document number: 1995 535238

Date of ref document: 19951213

Kind code of ref document: A

Format of ref document f/p: F

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA