WO1994015620A1 - Novel oligonucleotides modified with non-nucleotide bridging groups - Google Patents

Abstract

An oligonucleotide having a structural formula selected from the group consisting of (a) and (b). S1, S2, S3, S4, and S5 are oligonucleotide strands, and each of X1 and X2 is a bridging moiety which may be a nucleotide strand or a non-nucleotide bridging moiety. Each of X1 and X2 may be the same or different, with the proviso that when one of X1 and X2 is a nucleotide strand, the other of X1 and X2 is a non-nucleotide bridging moiety. Each of X1 and X2 independently is a bridging moiety having first and second termini that each binds independently with a nucleotide phosphate moiety or a nucleotide hydroxyl moiety. Such oligonucleotides are designed to have increased resistance to exonucleases and endonucleases, greater thermal stabilities, improved cellular uptake, and improved binding to target proteins and nucleic acids.

Description

NOVEL OLIGONUCLEOTIDES MODIFIED WITH NON-NUCLEOTIDE

BRIDGING GROUPS

This invention relates to oligonucleotide duplexes. More particularly, this invention relates to single or double-stranded oligonucleotides in which the 5' and 3' ends of opposing oligonucleotide strands are linked by novel bridging groups.

The synthesis of single or double-stranded

oligonucleotides with natural nucleotide bridging groups has been described in the literature. Erie, et al.,

Biochemistry, Vol. 28, 268-273 (1989) describe the synthesis of a 26-residue double-stranded circular oligonucleotide using five thymidylate residues for each bridging group. Formation of the closed circular form was carried out using T4 DNA ligase. Ashley, et al., Biochemistry, Vol. 30, pgs. 2927-2933 (1991), disclose the construction of cyclic oligonucleotides, or dumbbells, which employ four thymidyiic acid residues as the bridging groups. Cyclization of the linear oligonucleotide precursor was achieved using a carbodiimide as the coupling agent. Amaratunga, et al., Biopolymers, Vol. 32, pgs. 865-879 (1992), disclose the preparation of sets of double-stranded oligonucleotides having 16 base pairs in which the number of thymidylate bridging groups was varied between 2 and 14. These

oligonucleotides were also circularized using an enzymatic method. Single-stranded circular oligonucleotides have also been described in Kool, J. Am. Chem. Soc, Vol. 113, pgs. 6265-6266 (1991), by Prakash, et al., J. Chem. Soc. Chem. Commun., pgs. 1161-1163 (1991), and by Prakash, et al., J. Am. Chem. Soc, Vol. 114, pgs. 3523-3527 (1992).

Chu, et al., Nucl. Acids Res., Vol. 19, pg. 6958, disclose the binding of hairpin and dumbbell DNA sequences to transcription factors. These DNA sequences employed natural nucleotides for the bridging groups.

Durand, et al., Nucl. Acids Res., Vol. 18, pgs.

6353-6359 (1991) disclose self-complementary

oligonucleotides containing a hairpin loop, or bridging group . The loop consi sts of a hexaethylene glycol chain, and the oligonucleotide could form a hairpin structure as effectively as the analogous oligonucleotide possessing thymidylate residues for the bridging groups.

Click, et al., J. Am Chem. Soc., Vol. 114, pgs,

5447-5448 (1992), disclose the formation of a

double-stranded oligonucleotide which is crosslinked through linker arms attached to the bases rather than the sugar phosphate backbone.

In accordance with an aspect of the present invention, there is provided an oligonucleotide having a structural formula selected from the group consisting of:

S₁ , S₂, S₃, S₄, and S₅ are oligonucleotide strands, Each of X₁ and X₂ is a nucleotide strand, such as a

nucleotide bridging loop, or a non-nucleotide bridging moiety. Each of X₁ and X₂ may be the same or different, and when one of X₁ and X₂ is a nucleotide strand, the other of X₁ and X₂ is a non-nucleotide bridging moiety. Thus, each of X₁ and X₂ independently is a bridging moiety having first and second termini that each binds independently with a nucleotide phosphate moiety or a nucleotide hydroxyl moiety.

Examples of terminal moieties that bind with phosphate moieties; e.g., terminal phosphates of nucleic acid

sequences, include, but are not limited to, -OH groups, -NH₂ groups, and -SH groups.

Examples of terminal moieties that bind with a hydroxyl moiety, particularly the terminal hydroxyl moiety of a nucleic acid sequence (e.g., the ribose of a 3' terminal nucleotide), including, but are not limited to, -PO₃ ^2- groups, -SO₃- groups, and -COO- groups.

When X₁ and/or X₂ is a non-nucleotide bridging moiety, the non-nucleotide bridging moiety may have the following structural formula:

T₁ - R - T₂, whereas each of T₁ and T₂ independently binds with a nucleotide phosphate moiety or a hydroxyl moiety. R is selected from the group consisting of (a) saturated and unsaturated hydrocarbons; (b) polyalkylene glycols; (c) polypeptides; (d) thiohydrocarbons; (e)

polyalkylamines; (f) polyalkylene thioglycols; (g)

polyamides; (h) disubstituted monocyclic or polycyclic aromatic hydrocarbons; (i) intercalating agents; (j) monosaccharides; and (k) oligosaccharides; or mixtures thereof.

In one embodiment, one of T₁ and T₂ binds with a nucleotide phosphate moiety, and the other of T₁ and T₂ binds with a nucleotide hydroxyl moiety. In one embodiment, the oligonucleotide has the structural formula:

In one embodiment, at least a portion of S₁ is complementary to S₂. In another embodiment, all of S₁ and S₂ are complementary to each other such that S₁ and S₂ bind to form a double-stranded region.

In yet another embodiment, S₁ is not complementary to S₂, and the oligonucleotide molecule exists as an unpaired oligonucleotide.

In another embodiment, the oligonucleotide has the structural formula:

In one embodiment, at least a portion of S₃ is

complementary to portions of S ₄ and/or S₅. In another embodiment, all of S₄ and S₅ are complementary to S₃ such that S₄ and S₅ bind to S₃ to form double-stranded regions.

In yet another embodiment, S₃ is not complementary to S₄ and S₅, and formation of double-stranded regions is not possible, so that the oligonucleotide molecule exists as an unpaired oligonucleotide.

The term "oligonucleotide" as used herein means that the oligonucleotide may be a ribonucleotide,

deoxyribonucleotide, or a mixed ribonucleotide/deoxyribonucleotide; i.e., the

oligonucleotide may include ribose or deoxyribose sugars or both. Alternatively, the oligonucleotide may include other 5-carbon or 6-carbon sugars, such as, for example arabinose, xylose, glucose, galactose, or deoxy derivatives thereof or any mixture of sugars.

In one embodiment, each of S₁, and S₂, or S₃, and S₄ and S₅ combined may include from about 5 to about 100 nucleotide units, and preferably from about 10 to about 100 nucleotide units.

The phosphorus containing moieties of the

oligonucleotide may be, for example, a phosphate,

phosphonate, alkylphosphonate, aminoalkyl phosphonate, thiophosphonate, phosphoramidate, phosphordiamidate

phosphorothioate, phosphorothionate, phosphorothiolate, phosphoramidothiolate, and phosphorimidate. It is to be understood, however, the scope of the present invention is not to be limited to any specific phosphorus moiety or moieties. The phosphorus moiety be modified with cationic, anionic, or zwitterionic moieties. The oligonucleotides may also contain backbone linkages which do not contain

phosphorus, such as carbonates, carboxymethyl esters, acetamidates, carbamates, acetals, and the like.

The oligonucleotides may include any natural or

unnatural, substituted or unsubstituted, purine or

pyrimidine base. Such purine and pyrimidine bases include, but are not limited to, natural purines and pyrimidines, such as adenine, cytosine, thymine, guanine, uracil, or other purines and pyrimidines, such as isocytosine,

6-methyluracil, 4, 6-di-hydroxypyrimidine, hypoxanthine, xanthine, 2, 6-diaminopurine, 5-azacytosine, 5-methyl cytosine and the like.

In one embodiment, each of X₁ and X₂ is a

non-nucleotide bridging moiety having the formula T₁-R-T₂, as hereinabove described. In one embodiment, R is a

saturated or unsaturated hydrocarbon, and preferably R is a polyalkylene moiety wherein the polyalkylene group has from 5 to 100 carbon atoms, preferably from 5 to 20 carbon atoms. Most preferably, the polyalkylene is a polymethylene moiety. The bridging moiety including the polyalkylene group may be attached to the sugar phosphate backbone of the

oligonucleotide.

In another embodiment, R is a polyalkylene glycol. In particular, the polyalkylene glycol has the structural formula (R-O)_n, wherein R is an alkylene group having from 2 to 6 carbon atoms, preferably from 2 to 3 carbon atoms, and n is from 1 to 50, preferably from 3 to 6. In one

embodiment, the polyalkylene glycol is polyethylene glycol, and preferably the polyethylene glycol is hexaethylene glycol.

Bridging moieties including polyalkylene glycols may be attached to the oligonucleotide by converting the

polyalkylene glycol into a material which may be employed in a DNA synthesizer. For example, the polyalkylene glycol may be converted to its mono-dimethoxytrityl ether, which is then reacted with chloro-N, N-diisopropylamino- cyanoethoxy-phosphine to produce a bridging group

phosphoramidite. For oligonucleotide synthesis, a

phosphorylating agent is attached to a solid support of a DNA synthesizer, and a series of DNA bases is delivered in order, depending upon the sequence required for binding to the target DNA, RNA, protein or peptide. The bridging group phosphoramidite is then added, followed by the addition of a further sequence of DNA bases. Optionally, another bridging group is then attached, and a further sequence of DNA bases is added to complete the oligonucleotide sequence.

At the conclusion of the synthesis, the oligonucleotide is cleaved from the solid support with ammonia to give a crude trityl-containing oligonucleotide possessing a

3'-phosphate group. Purification is carried out using reversed phase HPLC and the later eluting, trityl-containing oligonucleotide is collected. The oligonucleotide is detritylated using acetic acid, extracted with ethyl acetate to remove trityl alcohol, and lyophilized to give an

oligonucleotide which can hybridize to itself to form an open chain 3'-phosphorylated oligonucleotide. Reaction of this open chain oligonucleotide with a carbodiimide coupling agent in an aqueous buffer produces a closed circular oligonucleotide. In one procedure, small portions of the carbodiimide coupling agent are added at infrequent

intervals as described in Example 2. In another procedure, a large excess of coupling agent is added at the beginning of the procedure as described in Example 4.

Unpaired open chain oligonucleotides can be

circularized using a coupling agent such as cyanogen bromide in the presence of a complementary oligonucleotide splint as described by Prakash, et al., J . Chem. Soc. Chem. Commun., pgs. 1161-1163 (1991) or using a water soluble carbodiimide in the presence of a complementary oligonucleotide splint as described by Dolinnaya, et al, Nucl. Acids Res., Vol. 16, pgs 3721-3738 (1988).

In another embodiment, R is a polypeptide.

Polypeptides which can be included in the bridging groups include, but are not limited to, hydrophobic polypeptides such as (Ala) , basic polypeptides such as (Lys_n), and acidic polypeptides such as (Glu)_n, wherein n is from 3 to 50, preferably from 4 to 10. In an alternative embodiment, the polypeptides may contain mixtures of amino acids.

Such bridging groups including polypeptides may be attached to the oligonucleotide by procedures such as that given in Example 7 hereinbelow. In yet another embodiment, R is a polyalkylamine.

Polyalkylamines which may be included in the bridging groups include, but are not limited to those having the following structural formula:

R₃NH[(CH₂)_m NHR₁]_p - [(CH₂)_n NHR₂]_q,

wherein each of R₁, R₂, and R₃ is hydrogen or an alkyl group having from 2 to 10 carbon atoms, and wherein m and n are from 2 to 10, preferably from 2 to 4, and p and q each are from 2 to 20, preferably from 3 to 6. R₁, R₂ and R₃ may be the same or different, m and n can be the same or different, and p and q can be the same or different. Examples of such polyamines include polyethylene imine, which has the formula H₂N(CH₂ CH₂ NH)_R H, wherein m and n each are 2, p+q=r, and R₁, R₂, and R₃ are H; and spermidine, which has the formula H₂N(CH₂)₄-NH-(CH₂)₃-NH₂, wherein m is 4, n is 3, p is 1, and q is 1, and each of R₁, R₂, and R₃ is hydrogen.

Examples of polyalkylene thioglycols which may be included in the bridging groups include, but are not limited to,

3,6 dithio-1,8-octanediol,HOCH₂CH₂SCH₂CH₂SCH₂CH₂OH,

2-mercaptoethyl sulfide, (HSCH₂CH₂)₂S,

3,3'-thiodipropanol, S(CH₂CH₂CH₂OH)₂,

2-mercaptoethyl ether, (HSCH₂CH₂)₂O, and

2,2'-dithiodiethanol S(CH₂CH₂OH)₂.

Examples of thiohydrocarbons such as polyalkylene disulfides which may be employed in the bridging groups include, but are not limited to, 2-hydroxyethyl disulfide (HOCH₂CH₂)₂S₂ An example of incorporation of one of these moieties as a bridging group is described in Example 9 hereinbelow.

In another embodiment, R is a polyamide.

Polyamides which may be included in the bridging groups include those having the following structural formula: H[NH(CH₂)_m-CO]_nOH,

wherein m is from 1 to 6, and n is from 3 to 50.

Bridging groups containing such polyamides may be attached to the oligonucleotide by procedures such as those given in Example 7 hereinbelow.

In yet another embodiment, R is a disubstituted

monocyclic aromatic. Disubstituted monocyclic aromatics which may be included in the bridging groups include those having the following structural formula :

(CH₂)_m (-X

Y) -(CH₂)_m, wherein each of X and Y is -CONH, or X is -NHCO and Y is CONH, m is from 1 to 10 and n is from 1 to 5. In another embodiment, the disubstituted monocyclic aromatic may have the following structural formula:

( X)_n,

wherein X is oxygen, sulfur, or -OCH₂, and n is from 1 to 10.

In another embodiment, R is a disubstituted polycyclic aromatic hydrocarbon. Disubstituted polycyclic aromatic hydrocarbons which may be employed include, but are not limited to, disubstituted naphthalenes, anthracenes,

phenanthrenes, fluorenes, and pyrenes. Bridging moieties containing disubstituted aromatics may be attached to the oligonucleotide by procedures such as given in Example 10 hereinbelow.

In yet another embodiment, R is an intercalating agent.

Intercalating agents which can be included in the bridging moieties include, but are not limited to,

acridines, phenanthridines, anthracyclinones, phenazines, phenothiazines, and quinolines. Bridging moieties including such agents may be attached to the oligonucleotide by procedures such as those given in Example 11 hereinbelow.

In another embodiment, R is a monosaccharide, or in yet another embodiment, R is a oligoeaccharide. Monosaccharides and oligosaccharides which may be included in the bridging groups include, but are not limited to, glucose, mannose, and galactose; disaccharides such as cellobiose and

gentobiose; trisaccharides such as cellotriose; and larger oligosaccharides such as cellotetraose, cellopentaose, and pentamannose.

Bridging moieties containing such monosaccharides and oligosaccharides may be attached to the oligonucleotide by procedures such as those given in Example 12 hereinbelow.

The oligonucleotides of the present invention may be employed to bind to RNA sequences by Watson-Crick

hybridization, and thereby block RNA processing or

translation. For example, the oligonucleotides of the present invention may be employed as "antisense" complements to target sequences of mRNA in order to effect translation arrest and selectively regulate protein production.

The oligonucleotides of the present invention may be employed to bind RΝA or DΝA to form triplexes, or triple helices. Single stranded oligonucleotides have been

described to bind double-stranded DΝA and thereby interfere with transcription in Maher, et al., Biochemistry, Vol. 29, pgs. 8820-8826 (1990) and in Orson et al., Nucleic Acids Res., Vol. 19, pgs. 3435-3441 (1991).

Similarly, such triplex formation could be expected to interfere with replication. Single-stranded

oligonucleotides could also be envisaged to bind to

double-stranded (e.g., viral) RNA to form triplexes which block transcription or reverse transcription. Circular paired oligonucleotides may be employed to form "reverse triplexes" in which the paired oligonucleotides form

triplexes with a single-stranded RNA or DNA target, thereby blocking transcription, replication or reverse transcription of said RNA or DNA target.

Triple helix formation by oligonucleotides in a

sequence-specific, manner is normally restricted to polypurine tracts of duplex DNA. In order to increase the number of targets for triple helix formation, Froehler et al., in Biochemistry, Vol. 31, pgs. 1603-1609 (1992) and Home, et al., in J. Am. Chem. Soc., Vol. 112, pgs.

2435-2437 (1990) utilized oligonucleotides containing a 3 ',3' internucleotide junction or linker group to allow for binding to opposite strands of DNA. Unpaired circular oligonucleotides of the present invention can be employed to form "switchover" complexes with double-stranded DNA or RNA as shown in the following structure:

In such complexes, pyrimidines on one portion of the bridged cyclic oligonucleotide interact via Hoogsteen interactions with purines on one strand of the nucleic acid target, while pyrimidines on another portion of the

oligonucleotide interact with purines on the other strand of the target. Structures of this type do not need an

intervening linker group and have the added advantage that stacking interactions are maintained. The bridging residues and the cyclic nature of the oligonucleotide serves to minimize degradation by nucleases. Unpaired cyclic

oligonucleotides forming switchover complexes as described herein can be envisaged to occur with target double-stranded DNA or RNA, thereby blocking transcription, replication, or reverse transcription.

The paired or unpaired circular oligonucleotides of the present invention may be employed to bind specifically to target proteins, or to selected regions of target proteins so as to block function or to restore functions that had been lost by a protein as a result of mutation. For

example, the oligonucleotides of the present invention may be used to block the interaction between a receptor and its ligand(s) or to interfere with the binding of an enzyme to its substrate or cofactor or to interfere otherwise with the catalytic action of an enzyme. Conversely, the

oligonucleotides of the present invention may be employed to restore lost function to a mutated protein, for example, by eliciting conformational alteration of such a protein through formation of a complex with that protein.

In another embodiment, the oligonucleotides may bind to transcriptional activators or suppressors. Such factors might, for example, enhance transcription of cellular DNA, in order to regulate cellular gene expression. As a further example, the oligonucleotides may inhibit the action of the protein encoded by the myb oncogene, which acts as a

transcriptional activator (Gabrielsen, et al., Science, Vol. 253, pgs. 1140-1143 (1991)). When this protein is

inappropriately expressed, it can activate genes leading to the formation of a cancer. Binding of the myb protein to the oligonucleotides of the present invention would block the gene activation and block the growth of the cancerous cells.

Alternatively, the oligonucleotides may bind to viral transcription factors. For example, the oligonucleotides may inhibit human immunodeficiency (HIV) transcriptional activators or enhancers or bovine or human papilloma virus transcriptional activators or enhancers. Alternatively, the oligonucleotides may activate gene expression by binding to and preventing activity of, transcriptional repressors.

Bielinska, et al., Science, Vol. 250, pgs. 997-1000 (November 16, 1990), disclose double-stranded

phosphorothioate oligonucleotides which bind to

transcription factors or enhancers of viruses such as HIV. Such oligonucleotides may also be added to Jurkat leukemia T- cells in order to inhibit interleukin-2 secretion.

Androphy, et al., Nature, Vol. 325, pgs. 70-73 (January 1, 1987), disclose a 23 base pair oligonucleotide which

prevents binding of the E2 protein of bovine papilloma virus (BPV) to the upstream regulatory region of the BPV genome, which immediately precedes the early genes of the BPV genome. European Patent Application No. 302,758 discloses double-stranded oligonucleotides which bind to transcription enhancers of bovine papilloma virus or human papilloma virus, thereby repressing the transcription of the DNA of the virus and inhibiting the growth of the virus. The above oligonucleotides disclosed in the above-mentioned

publications may be modified to include the bridging

moieties of the present invention and still be employed for binding to transcription factors or enhancers.

The RNA, DNA, protein or peptide target of interest, to which the oligonucleotide binds, may be present in or on a prokaryotic or βukaryotic cell, a virus, a normal cell, or a neoplaβtic cell, in a bodily fluid or in stool. The target nucleic acids or proteins may be of plasmid, viral,

chromosomal, mitochondrial or plastid origin. The target sequences may include DNA or RNA open reading frames encoding proteins, mRNA, ribosomal RNA, snRNA, hnRNA, introns, or untranslated 5'- and 3'-sequences flanking DNA or RNA open reading frames. The modified oligonucleotide may therefore be involved in inhibiting production or function of a particular gene by inhibiting the expression of a repressor, enhancing or promoting the function of a particular mutated or modified protein by eliciting a conformational change in that protein, or the modified oligonucleotide may be involved in reducing the

proliferation of viruses, microorganisms, or neoplastic cells. The oligonucleotides may also target a DNA origin of replication or a reverse transcription initiation site.

The oligonucleotides may be used in vitro or in vivo for modifying the phenotype of cells, or for limiting the proliferation of pathogens such as viruses, bacteria, protists, Mycoplasma species, Chlamydia or the like, or for killing or interfering with the growth of neoplastic cells or specific classes of normal cells. Thus, the

oligonucleotides may be administered to a host subject in a diseased or susceptible state to inhibit the transcription and/or expression of the native genes of a target cell, or to inhibit function of a protein in that cell. Therefore, the oligonucleotides may be used for protection from, or treatment of, a variety of pathogens in a host, such as, for example, enterotoxigenic bacteria, Pneumococci, Neisseria organisms, Giardia organisms, or Entamoebas, etc. Such oligonucleotides may also inhibit function, maturation, or proliferation of neoplastic cells, such as carcinoma cells, sarcoma cells, and lymphoma cells; specific B-cells;

specific T-cells, such as helper cells, suppressor cells, cytotoxic T-lymphocytes (CTL), natural killer (NK) cells, etc.

The oligonucleotides may be selected so as to be capable of interfering with RNA processing (transcription product maturation) or production of proteins by any of the mechanisms involved with the binding of the subject

composition to its target sequence. These mechanisms may include interference with processing, inhibition of transport across the nuclear membrane, cleavage by

endonucleases, or the like.

The unpaired, circular oligonucleotides may contain sequences complementary to those present in growth factors, lymphokines, immunoglobulins, T-cell receptor sites, MHC antigens, DNA or RNA polymerases, antibiotic resistance, multiple drug resistance (mdr), genes involved with

metabolic processes, in the formation of amino acids, nucleic acids, or the like, DHFR, etc. as well as introns or flanking sequences associated with the open reading frames.

The following table is illustrative of some additional applications of the subject compositions.

Area of Application Specific Application Targets

Infectious Diseases:

Antivirals, Human HIV, HSV, CMV, HPV, VZV

infections

Antivirals, Animal Chicken Infectious Bronchitis

Pig Transmissible

Gastroenteritis Virus

infections

Antibacterial, Human Drug Resistance Plasmids

Antiparasitic Agents Malaria

Sleeping Sickness

(Trypanosomes)

Cancer

Direct Anti-Tumor Oncogenes and their products

Agents Tumor Suppressor genes and their produces

Adjunctive Therapy Drug Resistance genes

and their products Auto Immune Diseases

T-cell receptors or Rheumatoid Arthritis

autoantibodies Type I Diabetes

Systemic Lupus

Multiple sclerosis

Organ Transplants OKT3 cells causing

GVHD

The oligonucleotides of the present invention may be employed for binding to target molecules, such as, for example, proteins including, but not limited to, ligands, receptors, and or enzymes, whereby such oligonucleotides inhibit the activity of the target molecules, or restore activity lost through mutation or modification of the target molecules.

The oligonucleotides of the present invention are administered in an effective binding amount to an RNA, a DNA, a protein, or a peptide. Preferably, the

oligonucleotides are administered to a host, such as a human or non-human animal host, so as to obtain a concentration of oligonucleotide in the blood of from about 0.1 to about 100 umole/1. It is also contemplated that the oligonucleotides may be administered in vitro or ex vivo as well as in vivo.

The oligonucleotides may be administered in conjunction with an acceptable pharmaceutical carrier as a

pharmaceutical composition. Such pharmaceutical

compositions may contain suitable excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Such oligonucleotides may be administered by intramuscular, intraperitoneal, intraveneous, or subdermal injection in a suitable solution. Preferably, the preparations,

particularly those which can be administered orally and which can be used for the preferred type of administration, such as tablets, dragees and capsules, and preparations which can be administered rectally, such as suppositories, as well as suitable solutions for administration

parenterally or orally, and compositions which can be administered buccally or sublingually, including inclusion compounds, contain from about 0.1 to 99 percent by weight of active ingredients, together with the excipient. It is also contemplated that the oligonucleotides may be administered topically in a suitable carrier, emulsion, or cream, or by aerosol.

The pharmaceutical preparations of the present

invention are manufactured in a manner which is itself well known in the art. For example, the pharmaceutical

preparations may be made by means of conventional mixing, granulating, dragee-making, dissolving or lyophilizing processes. The process to be used will depend ultimately on the physical properties of the active ingredient used.

Suitable excipients are, in particular, fillers such as sugar, for example, lactose or sucrose, mannitol or

sorbitol, cellulose preparations and/or calcium phosphates, for example, tricalcium phosphate or calcium hydrogen phosphate, as well as binders such as starch or paste, using, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethylcellulose, sodium carboxypropylmethyl- cellulose, sodium carboxymethylcellulose, and/or polyvinyl pyrrolidone. If desired, disintegrating agents may be added, such as the above-mentioned starches as well as carboxymethyl-starch, cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof, such as sodium alginate. Auxiliaries are flow-regulating agents and lubricants, such as, for example, silica, talc, stearic acid or salts thereof, such as magnesium stearate or calcium stearate, and/or polyethylene glycol. Dragee cores may be provided with suitable coatings which, if desired, may be resistant to gaβtric juices. For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinylpyrrolidone, polyethylene glycol and/or titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. In order to produce coatings resistant to gastric juices, solutions of suitable cellulose preparations such as acetylcellulose phthalate or hydroxypropylmethylcellulose phthalate, are used. Dyestuffs and pigments may be added to the tablets of dragee coatings, for example, for identification or in order to characterize different combinations of active compound doses.

Other pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer such as glycerol or βorbitol. The push-fit capsules can contain the oligonucleotides in the form of granules which may be mixed with fillers such as lactose, binders such as

starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds are preferably dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added.

Possible pharmaceutical preparations which can be used rectally include, for example, suppositories, which consist of a combination of the active compounds with a suppository base. Suitable suppository bases are, for example, natural or synthetic triglycerides, paraffin hydrocarbons,

polyethylene glycols, or higher alkanols. In addition, it is also possible to use gelatin rectal capsules which consist of a combination of the active compounds with a base. Possible base materials include, for example, liquid triglycerides, polyethylene glycols, or paraffin

hydrocarbons.

Suitable formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble or water-dispersible form. In addition, suspensions of the active compounds as appropriate oil injection suspensions may be administered. Suitable lipophilic solvents or vehicles include fatty oils, for example, sesame oil, or synthetic fatty acid esters, for example, ethyl oleate or triglycerides. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethyl cellulose, sorbitol and/or dextran.

Optionally, the suspension may also contain stabilizers.

Additionally, the compounds of the present invention may also be administered encapsulated in liposomes, wherein the active ingredient is contained either dispersed or variously present in corpuscles consisting of aqueous concentric layers adherent to lipidic layers. The active ingredient, depending upon its solubility, may be present both in the aqueous layer, in the lipidic layer, or in what is generally termed a liposomic suspension. The hydrophobic layer, generally but not exclusively, comprises

phospholipids such as lecithin and sphingomycelin, steroids such as cholesterol, surfactants such as dicetylphosphate, stearylamine, or phosphatidic acid, and/or other materials of a hydrophobic nature. The diameters of the liposomes generally range from about 15 nm to about 5 microns.

A variety of functional groups, such as -OH,-NH₂, -COOH, or -SH, can be attached to the bridging moieties through linker arms and used to attach conjugate molecules which might confer favorable properties to the adduct.

Examples of favorable properties include increased uptake into the cell, increased lipophilicity or improved binding to cell surface receptors. Examples of such conjugate groups include, but are not limited to, biotin, folic acid, cholesterol, epidermal growth factor, and acridine.

The oligonucleotides may be used as a diagnostic probe. Haptens, such as, but not limited to, 2, 4-dinitrophenyl groups; vitamins such as biotin and iminobiotin;

streptavidin; fluorescent moieties such as fluorescein and FITC; or enzymes such as alkaline phosphatase, acid

phosphatase, or horseradish peroxidase, may be attached to the oligonucleotides. Other labels include, but are not limited to, detectable markers such as radioactive nuclides; and chemical markers including, but not limited to,

biotinated moieties, antigens, sugars, fluors, and

phosphors, apoenzymes and co-factors, ligands, allosteric effectors, ferritin, dyes, and microspheres. These labels can be attached to any portion of the oligonucleotide which is not essential for binding to its target. Preferably, the marker is attached to the bridging groups. In general, the bridging group has no biological function, and therefore, attachment of the label to the bridging group does not interfere with the therapeutic or diagnostic applications of the oligonucleotides.

The invention will now be described with respect to the following examples, the scope of which does not limit the invention. In particular, the sequences of the paired oligonucleotides in the examples hereinafter described comprise a DNA binding sequence of the tumor suppressor protein, p53. This protein, which is mutated in a number of human cancers, was identified as a sequence-specific

DNA-binding-protein by Kern, et al., Science, Vol. 252, pgs. 1708-1711 (1991). The subject of p53 mutations in human cancers has also bee reviewed in Hollstein, et al., Science, Vol. 253, pgs. 49-53 (1990). Example 1

Synthesis of an open chain oligonucleotide with two hexaethylene glycol bridging groups.

An oligonucleotide with the following structure:

5'-DMTr-AGCATGCCXGGCATGCTCAGACATGCCXGGCATGTCTGY, wherein A is adenine, C is cytosine, G is guanine, T is thymine, X is hexaethylene glycol phosphodiester, Y is phosphate, and DMTr is dimethoxytrityl, was synthesized using a DNA

synthesizer.

Synthesis was carried out on a 1 umole scale using conventional cyanoethyl phosphoramidities and other reagents as as follows: The 3'-phosphate was introduced using

(2-cyanoethoxy)-2-(2'-0-4,4'-dimethoxytrityloxyethyl- sulfonyl) ethoxy-N, N-diisopropylamino-phosphine (Horn and Urdea, Tetrahedron Letters, Vol. 27 pgs. 4705-4708 (1986)) as the phosphoramidite, the reagent being coupled directly to controlled-pore glass solid support to which a

deoxycytidine residue was attached ( i . e . , a C-column). The hexaethylene glycol bridging groups were introduced using 4,4'-dimethoxytrityloxy-hexaethyleneoxy-2-cyanoethoxy-N,N'- diisopropylaminophosphine (Durand et al, Nucleic Acids

Research, Vol. 18, pgs. 6353-6359 (1990)). After cleavage from the solid support, the aqueous ammonia solution was heated at 55°C to remove protecting groups and ammonia was removed by passing a stream of nitrogen over the solution. The solution was then lyophilized and dissolved in 0.02 M triethylaπunonium bicarbonate, pH 7.6. The crude trityl-on oligonucleotide was purified by reversed phase HPLC (C4 Radial Pak cartridge, 25 X 100 mm, 15u, 300A) using a linear gradient of 0.1 M triethylammonium acetate

(TEAA)/acetonitrile, with the concentration of acetonitrile being varied from 2 to 20% over 55 minutes. The peak eluting between 43 and 50 minutes, corresonding to the tritylated oligonucleotide, was collected and lyophilized to remove buffer and detritylated by treatment with 0.1M acetic acid solution for 10 minutes at room temperature. The product was directly extracted with ethyl acetate (3x) followed by ether (6x) and lyophilized to dryness. The residue was converted into the sodixim salt by dissolution in water (1 mL) and passage through a column of ion exchange resin (Dowex AG50W-X8, 7 x 150 mm). The eluate was

evaporated to dryness to give an open chain oligonucleotide having the following structural formula:

G-G-C-A-T-G-C-T-C-A-G-A-C-A-T-G-C-C

C-C-G-T-A-C-G-A G-T-C-T-G-T-A-C-G-G

5' HO PO₃ ^2-3'

wherein X is O(CH₂ CH₂O)₆ -PO-₃.

The above sequence corresponds to a portion of the DNA sequence which is known to bind to the p53 protein encoded by the p53 tumor suppressor gene.

Example 2

Formation of a closed circular oligonucleotide with two hexaethylene glycol bridging groups.

The oligonucleotide isolated from Example 1 (10 OD₂₆₀ units) was dissolved in sodium 4-morpholine-ethanesulfonate buffer (MES , 0.05 M, pH 6.0 , 22 uL ) containing 20 mM

magnesium chloride and treated with

1-(3-dimethylaminopropyl)-3-ethylcarbodiimide) (EDC, 6.4 mg). The mixture was briefly vortexed, stored at 4°C and analyzed by HPLC using a Dionex PA-100 column, 4 x 250 mm. (Buffer A:25 mM tris-chloride, pH 8, containing 0.5%

acetonitrile; buffer B: 25mM tris-chloride, 1M ammonium chloride, pH 8, containing 0.5% acetonitrile. Flow rate 1.5 mL/min, gradient: 15% B to 70% B over 5 min., then 70-80% B 5-20 min.) Since, analysis after 15 hours indicated that a substantial amount of starting material remained, the oligonucleotide was precipitated by addition of absolute ethanol (85 uL), redissolved in MES buffer (22 uL) and treated with additional EDC (8.7 mg). After storage for 2 days at 4°C, the ethanol precipitation procedure was repeated and the oligonucleotide was treated for a third time with EDC (5.3 mg) in MES (22uL) for 24 hours at 4°C. HPLC analysis at this point indicated that no starting material remained. The oligonucleotide was precipitated by addition of ethanol (85 uL), (washed with 300 uL absolute ethanol), and dried to give a closed, circular,

oligonucleotide having the following structural formula:

G-G-C-A-T-G-C-T-C-A-G-A-C-A-T-G-C-C

C-C-G-T-A-C-G-A-G-T-C-T-G-T-A-C-G-G

wherein X is O(CH₂CH₂O)₆ -PO₃-

Analysis by polyacrylamide gel electrophoresis (15% acrylamide, 7M urea, tris borate/EDTA buffer), followed by UV detection, revealed a single, faster running band as compared to the unligated material.

Example 3

Synthesis of an Open Chain Double-Stranded Oligonucleotide with Two Dodecanediol Bridging Groups

a) Synthesis of 4,4'-dimethoxytrityldodecanediol-2- cyanoethoxy-N,N-di-isopropylamino-phosphine.

Dodecanediol (1.012 g, 5 mmol) was dried by

coevaporation with disti lled pyridine ( 2 x 10 mL) , dissolved in distilled pyridine (20 mL) under nitrogen, and while being stirred was treated with dimethoxytrityl chloride (1.694 g, 5 mmol). The reaction was monitored by TLC using methanol/methylene chloride (1:9) as the solvent system and after 3.5 hours at room temperature the mixture was

partitioned between methylene chloride (100 mL) and 5% aqueous sodium bicarbonate (80 mL). The organic layer was washed with 5% sodium bicarbonate (2 x 80 mL) followed by saturated sodium chloride (80 mL) and concentrated to a gum. The sample was purified by column chromatography on silica gel (80 g, 230-400 mesh) using a linear gradient of methanol in methylene chloride/triethylamine (99.8:0.2). The

concentration of methanol was raised in a stepwise manner from 0.5-7%. The appropriate fractions were combined and evaporated to yield 1.16 g (2.30 mmol, 46%) of

mono-(4,4'-dimethoxytrityl)-dodecanediol as a yellowish gum.

A sample of mono-(4,4'-dimethoxytrityl)-dodecanediol (1.16 g, 2.30 mmol) was dissolved in dimethylethylamine (1.24 mL, 5x) and methylene chloride (15 mL) under nitrogen and, while being stirred was treated with 2-cyanoethyl N, N-diisopropylamino-chlorophosphine (1 g, 4.225 mmol, 1.8 x). After 2.5 hrs. at room temperature, the reaction was checked by TLC using ethyl acetate/triethylamine (95:5) as the solvent system, and since the reaction was incomplete, additional 2-cyanoethyl-N, N-diisopropylamino- chlorophosphine (1g, 4.225 mmol, 1.8 x) was added. After an additional 0.5 hr., TLC showed the reaction to be

substantially complete. The mixture was partitioned between ethyl acetate (80 mL) and 5% sodium bicarbonate (100 mL) and the organic layer was washed with 5% sodium bicarbonate (2 x 100 mL) followed by saturated sodium chloride (100 mL) and concentrated to gum. The sample was purified by column chromatography on silica gel (50 g, 230-400 mesh) using ethyl acetate/triethylamine (99.8:0.2). The appropriate fractions were combined and evaporated to yield 1.454 g (2.06 mmol, 89.6%) of dimethoxytrityldodecanediol- 2-cyanoethoxy-N,N-di-isopropylamino-phosphine as a yellowish gum. b) Oligonucleotide synthesis

An oligodeoxynucleotide with the following structure is synthesized using a DNA synthesizer:

5'-DMTr-AGCATGCCTXAGGCATGCTCAGACATGCCTXAGGCATGTCTGY, where A = adenine, C = cytosine, G = guanine, T = thymine, X = dodecanediol-phosphodiester bridging group, Y = phosphate and DMTr = dimethoxytrityl.

Synthesis is carried out on a 1 umole scale using conventional cyanoethyl phosphoramidites and other reagents as follows: The 3' phosphate is introduced as described in Example 1, the reagent being coupled directly to controlled- pore glass solid support to which a deoxycytidine residue was attached (i.e. a C-column). The dodecanediol- phosphodiester bridging groups are introduced using

4,4'-dimethoxytrityloxy-dodecanediol-2-cyanoethoxy-N,N'- diisopropylamino-phosphine. After cleavage from the solid support, the aqueous ammonia solution is heated at 55°C to remove protecting groups and ammonia is removed by passing a stream of nitrogen over the solution. The solution is then lyophilized and dissolved in 0.02 M triethylammonium

bicarbonate, pH 7.6. The crude, trityl-on oligonucleotide is purified by reversed phase HPLC (C4 Radial Pak cartridge, 25 x 100 mm, 15u, 300A) using a linear gradient of 0.1 M triethylammonium acetate (TEAA)/acetonitrile, with the concentration of acetonitrile being varied from 2 to 20 % over 55 minutes. The peak corresponding to the tritylated oligonucleotide is collected and lyophilized to remove buffer and detritylated by treatment with 0.1M acetic acid solution for 10 minutes at room temperature. The product is directly extracted with ethyl acetate (3x) followed by ether (6x) and lyophilized to dryness. The residue is converted into the sodium salt by dissolution in water (1 mL) and passage through a column of ion exchange resin (Dowex

AG5OW-X8, 7 x 150 mm). The eluate is evaporated to dryness to give the open chain double-stranded oligonucleotide with two dodecanediol bridging groups. The purity of the product is examined by reinjection into an analytical ion exchange Dionex PA-100 column, 4 x 250 mm. Buffer A: 25 mM

tris-chloride, pH 8 containing 0.5% acetonitrile, buffer B: 25 mM tris-chloride, IM sodium chloride, pH 8 containing 0.5 % acetonitrile. Flow rate 1.5 mL/min. Gradient: 15% B to 70% B over 5 min, then 70-80% B 5-20 min. This material of the following structure is suitable for chemical ligation as described hereinbelow in Example 4.

A-G-G-C-A-T-G-C-T-C-A-G-A-C-A-T-G-C-C-T

T-C-C-G-T-A-C-G-A G-T-C-T-G-T-A-C-G-G-A

5' HO OPO₃ ^2- ₃,

where X is O-(CH₂)₁₂-O-PO₃-

Example 4

Synthesis of a Closed, Circular Double-Stranded

Oligonucleotide with Two Dodecanediol Bridging Groups

The oligonucleotide isolated from Example 3 (10 OD₂₆₀ units) is dissolved in sodium 4-morpholine-ethanesulfonate buffer (MES, 0.05 M, pH 6.0, ImL) containing 20 mM magnesium chloride and treated with

1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (EDC, 100 mg). The mixture is briefly vortexed, stored at 4°C for 2 days, and the oligonucleotide is precipitated by addition of absolute ethanol (9 mL), washed with 1 mL absolute ethanol, and dried to give the closed circular oligonucleotide.

Analysis by polyacrylamide gel electrophoresis (15%

acrylamide, 7M urea, tris borate/EDTA buffer, UV detection), reveals a single, faster running band as compared to the unligated material. HPLC analysis employed a Dionex PA-100 column, 4 x 250 mm (Buffer A: 25 mM tris-chloride, pH 8 containing 0.5% acetonitrile: Buffer B: 25 mM

tris-chloride, 1M sodium chloride, pH 8 containing 0.5% acetonitrile. Flow rate: 1.5 mL/min. Gradient: 15% B to 70% B over 5 min. then 70-80% B 5-20 min). This procedure provides material having the following structure:

A-G-G-C-A-T-G-C-T-C-A-G-A-C-A-T-G-C-C-T

T-C-C-G-T-A-C-G-A-G-T-C-T-G-T-A-C-G-G-A

where X is O- (CH₂)₁₂-O-PO₃-

Example 5

Synthesis of an Open Chain, Double-Stranded Oligonucleotide with Biotin Attached to one of the Bridging Groups

An oligodeoxynucleotide with the following structure is prepared using a DNA synthesizer:

5'-DMTr-AGCATGCCTXZXAGGCATGCTCAGACATGCCTWAGGCATGTCTGY, 3 where A is adenine, C is cytosine, G is guanine, T is thymine, W is hexaethylene glycol phosphodiester, X is triethylene glycol, Y is phosphate, Z is

2(4-biotinamidopentyl)-1,3-propanediol-phosphodiester, and DMTr = 4,4'-dimethoxytrityl.

Synthesis is carried out on a 1 umole scale using conventional cyanoethyl phosphoramidites and other reagents as follows: The 3'- phosphate and the hexaethylene glyco l group are introduced as described in Example 1 and the triethylene glycol groups are introduced using

4,4'-dimethoxytrityloxy-triethyleneoxy-2-cyanoethoxy-N,N'- diisopropylaminophosphine, obtained from Glen Research

Corporation, Sterling, Virginia. The biotin is introduced using 1-(4,4'-dimethoxytrityl)-2(4-biotinamidopentyl)-1,3- propanediol-3- (2-cyanoethyl)-N, N-diisopropylamino- chlorophosphine, also obtained from Glen Research

Corporation. After cleavage from the solid support, the aqueous ammonia solution is heated at 55°C to remove protecting groups and ammonia is removed by passing a stream of nitrogen over the solution. The solution is then

lyophilized and purified by reversed-phase HPLC. The product is directly extracted with ethyl acetate (3x) followed by ether (6x) and lyophilized to dryness. The residue is converted into the sodium salt by dissolution in water (1 mL) and passage through a column of ion exchange resin (Dowex AG5OW-X8, 7 x 150 mm). The eluate is

evaporated to dryness to give the open chain double stranded oligonucleotide having the following structure, with biotin in one of the bridging groups. A-G-G-C-A-T-G-C-T-C-A-G-A-C-A-T-G-C-C-T T-C-C-G-T-A-C-G-A G-T-C-T-G-T-A-C-G-G-A

HO PO 2- where W is O(CH₂CH₂O)₆-PO₃- X is O(CH₂CH₂O)₃-PO₃-

Z is OCH₂CHCH₂O-PO₃-

CH₂CH₂CH₂CH₂NH-Biotin

This material is suitable for chemical ligation as described in Example 6.

Example 6

Synthesis of a Closed, Circular Double-Stranded

Oligonucleotide with Biotin Attached to one of the Bridging Groups

The oligonucleotide isolated from Example 5 (10 OD₂₆₀ units) is dissolved in sodium 4-morpholine-ethanesulfonate buffer (MES, 0.05 M, pH 6.1, 22 uL) containing 20 mM

magnesium chloride and treated with

1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (EDC, 6.4 mg). The mixture is briefly vortexed, stored at 4°C for 15 hrs. and the oligonucleotide is precipitated by addition of absolute ethanol (85 uL), redissolved in MES buffer (22 uL) and treated with additional EDC (8.7 mg). After storage for 2 days at 4°C, the ethanol precipitation procedure is repeated and the oligonucleotide is treated for a third time with EDC (5.3 mg) in MES (22uL) for 24 hours at 4°C. The oligonucleotide iε precipitated by addition of ethanol (85 uL), washed with 300 uL absolute ethanol, and dried to give the closed circular oligonucleotide having the following structure: A-G-G-C-A-T-G-C-T-C-A-G-A-C-A-T-G-C-C-T T-C-C-G-T-A-C-G-A-σ-T-C-T-G-T-A-C-G-G-A

where W is O(CH₂CH₂O)₆-PO₃- X is O(CH₂CH₂O)₃-PO₃-

Z is OCH₂CHCH₂O-PO₃

CH₂CH₂CH₂CH₂NH-Biotin

Example 7

Synthesis of an oligonucleotide with peptide bridging groups.

a) Synthesis of a peptide phosphoramidite.

The tripeptide Ala-Ala-Ala (4 mmol) is treated with the N-hydroxysuccinimide ester of 3-hydroxybutyric acid (4 mmol) in dimethylformamide (20 mL) at room temperature for 4 hours. After removal of solvent, the residue is dissolved in pyridine and treated with 4,4'-dimethoxytrityl chloride (2 mmol) at room temperature for 18 hours. The product is evaporated to dryness, partitioned between ethyl acetate and aqueous sodium bicarbonate and the organic layer is washed with sodium bicarbonate (1 x) followed by water (2 x) and dried over magnesium sulfate. The solution is filtered, evaporated to dryness, and purified by silica column

chromatography using methylene chloride/methanol/

triethylamine as the solvent to give the dimethoxytritylated tripeptide of the following structure:

DMTrO-CH(CH₃)CH₂-CO-NHCH(CH₃)CO-NHCH(CH₃)CO-NHCH(CH₃)COO-

This material (2 mmol) is dissolved in dimethylformamide and treated with 6-aminohexanol (2 mmol) at room temperature for 18 hours using dicyclohexylcarbodiimide (5 mmol) as the coupling agent. The urea iε removed by filtration and the product is evaporated to dryness, partitioned between ethyl acetate and aqueous sodium bicarbonate, and the organic layer is washed with sodium bicarbonate (1 x) followed by water (2 x) and dried over magnesium sulfate. The solution is filtered, evaporated to dryness, and purified by silica column chromatography using methylene

chloride/methanol/triethylamine as the solvent to give the dimethoxytritylated tripeptide aminohexanol derivative of the following structure:

DMTrO-CH(CH₃)CH₂-CO-NHCH(CH₃)CO-NHCH(CH₃)CO-NHCH(CH₃)CO- -NH(CH₂)₆-OH

The aminohexanol derivative (1 mmol) is dissolved in

methylene chloride containing diisopropylethylamine (2 mmol) and treated with 2-cyanoethyl-N,N-diisopropylamino- chlorophosphine (2 mmol) at room temperature for 20 min. The solution is poured into ethyl acetate, extracted with 5% aqueous sodium bicarbonate (2 x) followed by saturated aqueous sodium chloride (2 x) and dried over magnesium chloride overnight. The solid is removed by filtration and the solution is evaporated to dryness and purified by silica column chromatography using methylene

chloride/methanol/triethylamine as the solvent to give the phosphoramidite with the following structure :

DMTrO-CH(CH₃)CH₂CO-NHCH(CH₃)CO-NHCH(CH₃)CO-NHCH(CH₃)C - -NH(CH₂)₆-O-P(OCH₂CH₂CN)N(iPr)₂

This material is used to attach the bridging groups to the oligonucleotide in the DNA synthesizer.

b) Oligonucleotide synthesis

The procedures outlined in Examples 1 and 2 are

followed to synthesize oligonucleotides with peptide

bridging groups, except that the peptide phosphoramidite of the present example is substituted for the bridging group phosphoramidite described in Example 1.

This procedure can also be used to attach polyamides as bridging groups for oligonucleotides.

Example 8

Synthesis of an oligonucleotide with polyamine bridging groups

The polyamine spermidine (4 mmol) is treated with l-butyrolactone to give the disubstituted derivative of the following structure:

HO(CH₂)₃CO-NH(CH₂)₃NH(CH₂)₄NH-CO(CH₂)₃-OH

This material is disεolved in pyridine (10 mL) and treated with trifluoroacetic anhydride (2 mL) overnight at room temperature. The solution is treated with water at 0°C for 4 hours and evaporated to dryness to give the

N-trifluoroacetyl derivative which is treated with

4,4-dimethoxytrityl chloride (4 mmol) for 18 hours at room temperature and evaporated to dryness. The residue is partitioned between ethyl acetate and aqueous sodium

bicarbonate and the organic layer is washed with water (2 x) and dried over magnesium sulfate overnight. The solid is removed by filtration and the solution is evaporated to dryness and purified by silica column chromatography.

Fractions containing the monotrityl derivative are combined, evaporated to dryness and 1 mmol of this material is

dissolved in methylene chloride containing

diisopropylethylamine (2 mmol) and treated with

2-cyanoethyl-N,N-diisopropylamino-chlorophosphine (2 mmol) at room temperature for 20 min. The solution is poured into ethyl acetate, extracted with 5% aqueous sodium bicarbonate (2 x) followed by saturated aqueous sodium chloride (2 x) and dried over magnesium chloride overnight. The solid is removed by filtration and the solution is evaporated to dryness and purified by silica column chromatography using methylene chloride/methanol as the solvent to give the phosphoramidite with the following structure:

DMTr-O(CH₂)₃CO-NH(CH₂)₃NH(CH₂)₄NH-CO(CH₂)₃-O-P-OCH₂CH₂CN

COCF₃ N (iPr)₂

This material is used in the DNA synthesizer to introduce bridging groups into the oligonucleotide. The procedures outlines in Examples 1 and 2 are followed to synthesize oligonucleotides with polyamine bridging groups, except that the bridging group phosphoramidite of the present example is substituted for the bridging group phosphoramidite described in Example 1. Example 9

Incorporation of polyalkylene thioglycol bridging groups

3,6-Dithio-1,8-octanediol is treated with

4, 4-dimethoxytrityl chloride in pyridine and then converted into a phosphoramidite derivative of the following structure by reaction with 2-cyanoethyl-N,N-diisopropylamino- chlorophosphine using the procedure described in Example 3:

DMTr-OCH₂CH₂SCH₂CH₂SCH₂CH₂O-P-N(iPr)₂

OCH₂CH₂CN

This material is employed as the bridging group

phosphoramidite in the synthesis of an oligonucleotide as described in Example 1.

Example 10

Synthesis of Double-Stranded Oligonucleotides with Two

Disubstituted Aromatic Bridging Groups

An oligodeoxynucleotide with the following structure is synthesized-using a DNA synthesizer:

5'-DMTr-AGCATGCCTXAGGCATGCTCAGACATGCCTXAGGCATGTCTGY, 4 wherein A = adenine, C = cytosine, G = guanine, T = thymine X =O-(CH₂)₆-NHCO-C₆H₅-CONH-(CH₂)₆-OPO₃- bridging group, Y = phosphate and DMTr = dimethoxytrityl.

Synthesis is carried out on a 1 umol scale using

conventional cyanoethyl phosphoramidites and other reagents as follows: The 3' phosphate is introduced as described in Example 1, and the aromatic bridging groups are introduced using N-(6-(4,4'-dimethoxytrityloxy)hexyl)-N'

-(6(2-cyanoethoxy-N,N'- diisopropylamino- phosphinyloxy)hexyl)terephthalamide as described by Cashman et al. in the Journal of the American Chemical Society, Vol. 114, pgs. 8772-8777 (1992). After cleavage from the solid support, the oligonucleotide is processed as described in Example 1 to give an open chain oligonucleotide duplex with two aromatic bridging groups. Formation of the closed circular duplex is carried out using the procedure outlined in Example 2.

Example 11

Incorporation of an intercalating agent as a bridging group

The intercalating agent acriflavine is treated with 6-bromo-1-hexanol to form a disubstituted derivative which is then treated with one equivalent of 4, 4-dimethoxytrityl chloride to give the monotrityl compound having the

following structure:

After purification and isolation by silica column chromatography, the monotrityl compound is treated with trifluoroacetic anhydride in pyridine followed by aqueous workup to give the N-trifluoroacetyl derivative which is then converted into a phosphoramidite of the following structure by treatment with 2-cyanoethyl-N,N- diisopropylamino-chlorophosphine as described in Example 3

The phosphoramidite is incorporated into an oligonucleotide by the procedure outlined in Example 1.

Example 12

Incorporation of a carbohydrate bridging moiety

6-O-B-D glucopyranosyl-D-glucopyranose (B-gentobiose) is treated with t-butyl-dimethylsilyl chloride to produce the 6' -silyl compound which is converted into the acetobromo derivative by a conventional method using acetic anhydride followed by hydrogen bromide in acetic acid. The 1-bromo derivative is then treated with 1,6- hexanediol to give the glycoside which is reacted with 4,4- dimethoxytrityl chloride to give a compound having the following structure:

CH ) c

The silyl group is removed using fluoride ion and the 6-hydroxy compound is treated with 2-cyanoethoxy-N,N- diisopropylamino-chlorophosphine to give a phosphoramidite having the following structure:

This material is employed in the DNA synthesizer to introduce bridging groups as described in previous examples.

Example 13

Thermal Denaturation of Bridged, Double-Stranded

Oligonucleotides

The thermal denaturation temperatures (Tm's) of some of the oligonucleotides of the present invention were measured on a Gilford spectrometer at 260 nm in order to determine their relative stabilities. Approximately 1 OD₂₆₀ unit of each oligonucleotide was dissolved in 0.9 mL of 10 mM

disodium phosphate buffer, pH 7.0, and each sample was heated briefly at 100°C, and allowed to cool slowly to room temperature. Melting profiles were obtained by increasing the temperature of the samples from 25°C to 100°C at a rate of 0.8°C per minute, followed by measurement of optical absorption at each time interval. The oligonucleotides examined in this study are as follows:

Oligonucleotide 1. X = pentathymidylate (T₅)

Oligonucleotide 2. X = triethylene glycol phosphodiester A-G-G-C-A-T-G-C-T-C-A-G-A-C-A-T-G-C-C-T T-C-C-G-T-A-C-G-A-G-T-C-T-G-T-A-C-G-G-A

Oligonucleotide 3. X = T₅

Oligonucleotide 4. X = triethyiene glycol phosphodiester A-G-G-C-A-T-G-C-T-C-A-G-A-C-A-T-G-C-C-T

Oligonucleotide 5.

T-C-C-G-T-A-C-G-A-G-T-C-T-G-T-A-C-G-G-A

Oligonucleotide 6.

The thermal denaturation temperatures of

Oligonucleotides 1 through 6 are given in Table I below.

This experiment demonstrates that an open chain, double-stranded oligonucleotide with triethylene glycol bridging groups is more stable towards thermal denaturation than either the same sequence with pentathymidylate bridging groups, or an unmodified duplex without any bridging groups. The closed, circular double-stranded oligonucleotide with triethylene glycol bridging groups is also more stable than the same sequence with pentathyamidylate bridges. Example 14

Enzymatic Stability of a Double-Stranded Oligonucleotide with Hexaethylene Glycol Bridging Groups

Enzymes:

Exonuclease - Exonuclease III

Endonuclease - Mung Bean Nuclease

Buffers:

For Exonuclease III: 50 mM Tris-HCl, pH 7.5; 5mM MgCl₂;

5 mM DTT; 50 mg/mL BSA.

For Mung Bean Nuclease: 30 mM NaOAc, pH 5.0; 50 mM NaCl;

1 mM ZnCl₂; 5% glycerol.

The enzymatic degradation of the detritylated

oligonucleotide of Example 1, having hexaethylene glycol bridging groups, was compared to a duplex of the same sequence without any bridging groups. A 1 OD₂₆₀ sample of each oligonucleotide was digested in a mixture of 95 μL of the reaction buffer and 5 μL of the enzyme solution

containing 1 unit of the enzyme. The mixtures were

incubated at 37°C (for Exonuclease III) or room temperature (for Mung Bean Nuclease) and the extent of degradation was monitored by HPLC with a Dionex ion-exchange column, using a linear gradient of ammonium chloride (O-1M) in tris

hydrochloride. The time required for 50% degradation (t1/2) for each sample was determined and the following results were obtained: Oligonucleotide Mung Bean Nuclease Exonuclease III

(t1/2) (t1/2)

Detritylated 68 hours > 80 hours

Oligonucleotide of

Example 1

Unmodified 3 hours 2.5 hours duplex

This experiment demonstrates that the oligonucleotide of Example 1, possessing hexaethylene glycol bridging groups, is considerably more resistant to degradation than an unmodified duplex of the same sequence.

Example 15

Binding of an Open Chain Double-stranded Oligonucleotide with Two Hexaethylene Glycol Bridging Groups to p53 Tumor Suppressor Gene Protein

The following oligodeoxynucleotides were prepared for bind to p53 protein.

1. G-G-C-A-T-G-C-T-C-A-G-A-C-A-T-G-C-C

C-C-G-T-A-C-G-A G-T-C-T-G-T-A-C-G-G

5' HO OH 3'

where X= O(CH₂CH₂O)₆-PO₃- 2. G-G-C-A-T-G-C-T-C-A-G-A-C-A-T-G-C-C 3. C-C-G-T-A-C-G-A-G-T-C-T-G-T-A-C-G-G Oligonucleotide 1 was prepared by the procedure

outlined in Example 1, except that the 3'-phosphorylation reagent was omitted and the hexaethylene glycol bridging groups were introduced using

4,4'-dimethoxytrityloxy-hexaethyleneoxy-2-cyanoethoxy-N,N'- diisopropylaminophosphine as the bridging group reagent. A 92 base pair natural duplex containing a randomized internal

60 base pair region was used as the control oligonucleotide. The oligonucleotides were radiolabeled with 32P using a standard protocol as described in "Molecular Cloning, a

Laboratory Manual" by Sambrook, Fritsch and Maniatis, page

11.31, Cold Spring Harbor Press (1989). The radiolabeled oligonucleotides were then purified and used in an

immunoprecipitation assay to evaluate binding efficiency to p53 tumor suppressor gene protein. The immunoprecipitation assay was performed with 2.0 pmoles purified p53, 0.25 pmoles radiolabeled oligonucleotide, 100ng poly d1-dC, and

400ng each of anti-p53 antibodies pAb421 and pAb1801

(purchased from Oncogene Sciences, Inc.), incubated in 100 μl of binding buffer containing 100 mM NaCl, 20 mM Tris pH

7.2, 10% glycerol, 1% NP40, and 5 mM EDTA a 4°C for 1 hour.

The DNA-p53-anti-p53 antibody complexes were precipitated following the addition of 30 μl of a 50% slurry of protein A sepharose and mixing at 4°C for 30 minutes. After removal of the supernatant, the immunoprecipitate was washed three times with binding buffer. Bound oligonucleotide was then quantified by direct Cerenkov counting. Specific binding was evaluated by comparison to an immunoprecipitation performed in the absence of p53. The results are summarized below. p53 Binding of natural and modified oligonucleotide duplexes

Oligonucleotide Percent Bound

(vs unmodified duplex)

2 + 3 100 1 43.5 control 3.2

This experiment shows that the open chain,

double-stranded Oligonucleotide 1, with hexaethylene glycol bridging groups, is capable of binding to p53 protein although somewhat less efficiently than an unmodified duplex of the same sequence. This result, taken together with the results of Example 14 (which demonstrated that an open chain double-stranded oligonucleotide with hexaethylene glycol bridging groups was considerably more stable towards

nucleases than an unmodified duplex), indicates that an oligonucleotide with bridging groups of this type has considerably greater pharmacological potential.

Advantages of the present invention include increased resistance of the circular oligonucleotides to enzymes which degrade oligonucleotides by attack at the 5' and/or 3' termini, such as, for example, 3' exonucleases. In

addition, double-stranded oligonucleotides of the present invention are resistant to enzymes which degrade

single-stranded regions of DNA because the non-nucleotide bridging groups cannot be recognized by such enzymes. The bridging groups can be constructed from simple, readily available starting materials, and may be incorporated easily into an oligonucleotide using a DNA synthesizer. In

addition, both the open chain and the closed, circular, paired oligonucleotides with non-nucleotide bridging groups are capable of forming more stable hydrogen-bonded

structures than the corresponding sequences with nucleotide (pentathymidylate) bridging groups or with natural duplexes without bridging groups and thus provide binding to target proteins which are capable of binding double-stranded oligonucleotides. Because the paired oligonucleotides also remain hydrogen-bonded at higher temperatures this could be advantageous for diagnostic applications. Unpaired circular oligonucleotides might possess a significant advantage over single-stranded oligonucleotides in binding to

double-stranded target DNA or RNA by forming Hoogsteen interactions with both strands of the target DNA or RNA.

Also, the bridging moieties of the double-stranded oligonucleotides may be modified to introduce favorable properties into the molecules, such as increased

lipophilicity, or be modified to introduce materials which assist in the delivery of the oligonucleotide into the cell, such as cationic groups or molecules which are recognized by cell surface receptors.

It is to be understood, however, that the scope of the present invention is not to be limited to the specific embodiments described above. The invention may be practiced other than as particularly described and still be within the scope of the accompanying claims.

Claims

What is Claimed is:

1. An oligonucleotide having a structural formula selected from the group consisting of:

wherein S₁ , S₂, S₃, S₄, and S₅ are oligonucleotide strands, and each of X₁ and X₂ is a bridging moiety which may be a nucleotide strand or a non-nucleotide bridging moiety, and each of X₁ and X₂ may be the same or different, with the proviso that when one of X₁ and X₂ Is a nucleotide strand, the other of X₁ and X₂ is a non-nucleotide bridging moiety, and each of X₁ and X₂ independently is a bridging moiety having first and second termini that each binds

independently with a nucleotide phosphate moiety or a nucleotide hydroxyl moiety.

2. The oligonucleotide of Claim 1 wherein said

non-nucleotide bridging moiety has the following structural formula:

T₁-R-T₂, wherein each of T₁ and T₂ independently binds with a nucleotide phosphate moiety or a nucleotide hydroxyl moiety, and R is selected from the group consisting of: (a) saturated and unsaturated hydrocarbons; (b) polyalkylene glycols; (c) polypeptides; (d) thiohydrocarbons; (e) polyalkylamines; (f) polyalkylene thioglycols; (g)

polyamides; (h) disubstituted monocyclic or polycyclic aromatic hydrocarbons; (i) intercalating agents; (j) monosaccharides; and (k) oligosaccharides; or mixtures thereof.

3. The oligonucleotide of Claim 2 wherein R is a

polyalkylene having from about 5 to about 100 carbon atoms

4. The oligonucleotide of Claim 3 wherein R is

polymethylene.

5. The oligonucleotide of Claim 2 wherein R is a

polyalkylene glycol.

6. The oligonucleotide of Claim 5 wherein said

polyalkylene glycol is polyethylene glycol.

7. The oligonucleotide of Claim 2 wherein R is a

polypeptide.

8. The oligonucleotide of Claim 2 wherein R is a

thiohydrocarbon.

9. The oligonucleotide of Claim 2 wherein R is a

polyalkylamine.

10. The oligonucleotide of Claim 2 wherein R is a

polyalkylene thioglycol.

11. The oligonucleotide of Claim 2 wherein R is a

polyamide.

12. The oligonucleotide of Claim 2 wherein R is a

disubstituted monocyclic or polycyclic aromatic hydrocarbon.

13. The oligonucleotide of Claim 2 wherein R is an

intercalating agent.

14. The oligonucleotide of Claim 2 wherein R is a

monosaccharide.

15. The oligonucleotide of Claim 2 wherein R is an

oligosaccharide.

16. A composition for binding to a DNA, an RNA, a protein, or a peptide, comprising:

(a) an oligonucleotide having a structural formula selected from the group consisting of:

wherein S₁, S₂, S₃, S₄, and S₅ are oligonucleotide strands, and each of X₁ and X₂ is a bridging moiety which may be a nucleotide strand or a non-nucleotide bridging moiety, and each of X₁ and X₂ may be the same or different, with the proviso that when one of X₁ and X₂ is a nucleotide strand, the other of X₁ and X₂ is a non-nucleotide bridging moiety and each of X₁ and X₂ independently is a bridging moiety having first and second termini that each binds

independently with a nucleotide phosphate moiety or a nucleotide hydroxyl moiety; and

(b) an acceptable pharmaceutical carrier, wherein said oligonucleotide iε present in an effective amount for binding to a DNA, and RNA, a protein, or a peptide.

17. The composition of Claim 16 wherein said non-nucleotide bridging moiety has the following structural formula:

T₁-R-T₂, wherein each of T₁ and T₂ independently binds with a nucleotide phosphate moiety or a nucleotide hydroxyl moiety, and R is selected from the group consisting of: (a) saturated and unsaturated hydrocarbons; (b) polyalkylene glycols; (c) polypeptides; (d) thiohydrocarbons; (e) polyalkylamineε; (f) polyalkylene thioglycols; (g)

polyamides; (h) disubstituted monocyclic or polycyclic aromatic hydrocarbons; (i) intercalating agents; (j) monosaccharides; and (k) oligosaccharides; or mixtures thereof.

18. The composition of Claim 17 wherein R is a polyalkylene having from about 5 to about 100 carbon atoms.

19. The composition of Claim 18 wherein R is polymethylene

20. The composition of Claim 17 wherein R is a polyalkylene glycol.

21. The composition of Claim 20 wherein said polyalkylene glycol is polyethylene glycol.

22. The composition of Claim 17 wherein R is a polypeptide

23. The composition of Claim 1 wherein R is a

thiohydrocarbon.

24. The composition of Claim 17 wherein R is a

polyalkylamine.

25. The composition of Claim 17 wherein R is a polyalkylene thioglycol.

26. The composition of Claim 17 wherein R is a polyamide.

27. The composition of Claim 17 wherein R is a

disubstituted monocyclic or polycyclic aromatic hydrocarbon.

28. The composition of Claim 17 wherein R is an

intercalating agent.

29. The composition of Claim 17 wherein R is a

monosaccharide.

30. The composition of Claim 17 wherein R is an

oligosaccharide.

31. In a process wherein an oligonucleotide is administered for binding to a DNA, an RNA, a protein, or a peptide, the improvement comprising:

administering to a host an oligonucleotide having a structural formula selected from the group consisting of:

wherein S₁, S₂, S₃, S₄, and S₅ are oligonucleotide strands, and each of X₁ and X₂ is a bridging moiety which may be a nucleotide strand or a non-nucleotide bridging moiety, and each of X₁ and X₂ may be the same or different, with the proviso that when one of X₁ and X₂ is a nucleotide strand, the other of X₁ and X₂ is a non-nucleotide bridging moiety, and each of X₁ and X₂ independently is a bridging moiety having first and second termini that each binds

independently with a nucleotide phosphate moiety or a nucleotide hydroxyl moiety, said oligonucleotide being administered in an amount effective for binding to a DNA, an RNA, a protein, or a peptide.

32. The process of Claim 31 wherein said non-nucleotide bridging moiety has the following structural formula:

T₁-R-T₂, wherein each of T₁ and T₂ independently binds with a nucleotide phosphate moiety or a nucleotide hydroxyl moiety, and R is selected from the group consisting of: (a) saturated and unsaturated hydrocarbons: (b) polyalkylene glycols; (c) polypeptides; (d) thiohydrocarbons; (e)

polyalkylamines; (f) polyalkylene thioglycols; (g)

polyamides; (h) disubstituted monocyclic or polycyclic aromatic hydrocarbons; (i) intercalating agents; (j)

monosaccharides; and (k) oligosaccharides; or mixtures thereof.

33. The process of Claim 32 wherein R is a polyalkylene having from about 5 to about 100 carbon atoms.

34. The process of Claim 33 wherein R is polymethylene

35. The process of Claim 32 wherein R is a polyalkylene glycol.

36. The process of Claim 35 wherein said polyalkylene glycol is polyethylene glycol.

37. The process of Claim 32 wherein R is a polypeptide.

38. The process of Claim 32 wherein R is a thiohydrocarbon.

39. The process of Claim 32 wherein R is a polyalkylamine.

40. The process of Claim 32 wherein R is a polyalkylene thioglycol.

41. The process of Claim 32 wherein R is a polyamide.

42. The process of Claim 32 wherein R is a disubstituted monocyclic or polycyclic aromatic hydrocarbon.

43. The process of Claim 32 wherein R is an intercalating agent.

44. The process of Claim 32 wherein R is a monosaccharide.

45. The process of Claim 32 wherein R is an

oligosaccharide.

46. The oligonucleotide of Claim 2 wherein at least one of X₁ and X₂ includea a conjugate group selected from the group consisting of biotin, folic acid, cholesterol, epidermal growth factor, and acridine.

47. The oligonucleotide of Claim 2 wherein at least one of X₁ and X₂ includes a detectable marker.

48. The composition of Claim 17 wherein at least one of X₁ and X₂ includes a conjugate group selected from the group consisting of biotin, folic acid, cholesterol, epidermal growth factor, and acridine.

49. The composition of Claim 17 wherein at least one of X₁ and X₂ includes a detectable marker.

50. The process of Claim 32 wherein at least one of X₁ and X₂ includes a conjugate group selected from the group consisting of biotin, folic acid, cholesterol, epidermal growth factor, and acridine.

51. The process of Claim 32 wherein at least one of X₁ and X₂ includes a detectable marker.

52. The oligonucleotide of Claim 1 wherein said

oligonucleotide has the following structural formula:

53. The oligonucleotide of Claim 52 wherein S₁ and S₂ combined include from about 5 to about 100 nucleotide units

54. The oligonucleotide of Claim 53 wherein S₁ and S₂ combined include from about 10 to about 100 nucleotide units.

55. The oligonucleotide of Claim 1 wherein said

oligonucleotide has the following structural formula:

56. The oligonucleotide of Claim 55 wherein S₃, S₄, and S₅ combined include from about 5 to about 100 nucleotide units.

57. The oligonucleotide of Claim 56 wherein S₃, S₄, and S₅ combined include from about 10 to about 100 nucleotide units.

58. The composition of Claim 16 wherein said

oligonucleotide has the following structural formula:

59. The composition of Claim 58 wherein S₁ and S₂ combined include from about 5 to about 100 nucleotide units.

60. The composition of Claim 59 wherein S₁ and S₂ combined include from about 10 to about 100 nucleotide units.

61. The composition of Claim 16 wherein said

oligonucleotide has the following structural formula:

62. The composition of Claim 61 wherein S₃, S₄, and S₅ combined include from about 5 to about 100 nucleotide units.

63. The composition of Claim 62 wherein S₃, S₄, and S₅ combined include from about 10 to about 100 nucleotide units.

64. The process of Claim 31 wherein said oligonucleotide has the following structural formula:

65. The process of Claim 64 wherein S₁ and S₂ combined include from about 5 to about 100 nucleotide units.

66. The composition of Claim 65 wherein S₁ and S₂ combined include from about 10 to about 100 nucleotide units.

67. The process of Claim 31 wherein said oligonucleotide has the following structural formula:

68. The process of Claim 67 wherein S₃, S₄, and S₅ combined include from about 5 to about 100 nucleotide units.

69. The process of Claim 68 wherein S₃, S₄, and S₅ combined include from about 10 to about 100 nucleotide units.