WO1994013316A1

WO1994013316A1 - Potent and specific chemically-conjugated immunotoxins

Info

Publication number: WO1994013316A1
Application number: PCT/US1993/012078
Authority: WO
Inventors: Rockford K. Draper; Ghulam Jilani Chaudry
Original assignee: Board Of Regents, The University Of Texas System
Priority date: 1992-12-16
Filing date: 1993-12-13
Publication date: 1994-06-23
Also published as: AU5748994A

Abstract

The present invention involves a mutant Pseudomonas exotoxin having alterations in domain I. A first alteration includes an amino acid, dipeptide, tripeptide or tetrapeptide insertion in domain I of Pseudomonas exotoxin. This insertion attenuates eukaryotic cell binding while allowing substantial prokaryotic secretion, ADP ribosylation activity and eukaryotic membrane translocation. A second alteration involves a cysteine substitution in a surface residue of exotoxin domain I. This substitution is preferably on a side opposite to domains II and III of the exotoxin. The latter substitution allows attachment of a carrier molecule by a disulfide or thioether linkage. Attachment of carriers such as monoclonal antibodies results in immunotoxins having the binding specificity of the antibody rather than the native exotoxin.

Description

DESCRIPTION

POTENT AND SPECIFIC

CHEMICALLY-CONJUGATED IMMUNOTOXINS

BACKGROUND OF THE INVENTION

Abbreviations used herein include: dgRA, deglycosylated ricin A chain; DMEM, Dulbecco's modified Eagle's medium; ETA, exotoxin A; ETA-60EF61, exotoxin A with the dipeptide Glu-Phe inserted between the residues 60 and 61; ETA-Cysl61, exotoxin A with a cysteine substituted for methionine 161;

ETA-60EF61Cysl61, exotoxin A with Glu-Phe insertion between residues 60 and 61 and a cysteine substituted for methionine 161; FBS, fetal bovine serum; HEPES, N-2-hydroxyethylpiperazine-N' -2-ethane sulfonic acid; IC₅₀, the concentration of a toxin that reduces protein synthesis by 50%; PBS, phosphate buffered saline; SDS, sodium dodecyl sulfate; S CC, Succinimidyl 4- [N- maleimidomethyl] cyclohexane-1-carboxylate; SPDP, N-succinimidyl-3- (2-pyridyldithio)propionate; TfR, transferrin receptor; TSBD, trypticase soy broth dialysate.

Certain protein toxins are thought to kill mammalian cells by a process involving three basic steps. First, the toxins bind to specific receptors on the surface of target cells. Second, at least a part of the toxin carrying an enzymatic activity that inhibits protein synthesis is transported across a membrane into the cytoplasm. Third, the enzymatic activity catalytically inactivates protein synthesis, killing the cell. The plant toxin ricin as well as the bacterial toxins Pseudomonas aeruginosa exotoxin A and diphtheria toxin are examples of this type of toxin.

Two features of the toxins have attracted much attention. One is selectivity -- only cells that contain a receptor for the toxin are attacked. The second feature is the extreme potency of the toxins -- it is estimated that a single toxin molecule within the cell cytoplasm is sufficient to kill the cell because killing is the consequence of an enzymatic activity. Structurally, the receptor binding centers and catalytic centers of the toxins are on different protein domains or subunits of the toxins. The properties of the toxins have suggested that specific cell types in a mixed population of cells could be eliminated if the receptor specificity of the toxin could be controlled, while maintaining potency, so that only the desired subset of cells is attacked. Thus, a toxin could be designed that attacked only tumor cells bearing on their surface a unique determinant recognized by the toxin. There is now a large volume of literature on the design and construction of such toxins.

To control the receptor specificity of a toxin, the toxin is usually attached to another protein that itself binds to a cell surface receptor. For example, a tumor cell may bear a unique surface antigen to which a monoclonal antibody can be generated. If the monoclonal antibody is attached to a toxin, the resulting "hybrid" or "immuno" toxin should attack the tumor cell. However, if the antibody is attached to an intact toxin there is a problem: The hybrid protein can attack cells via two receptors, the normal receptor that the native toxin originally used, and the new receptor specified by the monoclonal antibody. Thus, the hybrid toxin would not be specific for the tumor cells. In an attempt to solve this problem, researchers have attached only part of the toxin, that part containing the toxic activity, to a monoclonal antibody so that only the desired receptor is used by the hybrid toxin. However, the toxin usually looses potency in constructs of this type, apparently because the missing binding part contributes significantly to the efficiency with which the toxic (enzymatic) domain of the toxin enters the cytoplasm. Another problem is that the attachment of the toxin to the antibody usually requires a chemical modification of the toxin itself that frequently impairs the potency of the hybrid toxin.

The present invention involves the combination of four concepts to help solve the problems described in the previous paragraph. These four concepts include: 1) Attenuating the receptor binding ability of a toxin by a mutation in the receptor binding domain that leaves the binding domain intact, although not functional in binding. 2) Placing a cysteine residue by site directed mutagenesis in the receptor binding domain of a toxin, which may further attenuate the endogenous receptor binding ability of the toxin and also provide a convenient reactive site for chemically coupling the toxin to alternative receptor binding proteins. 3) Changing or selecting the mutation in items 1) and 2) above so that the variant toxin is still secreted by microorganisms containing the toxin gene. 4) Using the free sulfhydryl of the cysteine residue as the site at which an alternative receptor binding moiety is chemically coupled to the toxin.

As a specific embodiment of the invention, a model hybrid toxin incorporating the above concepts using Pseudomonas aeruginosa exotoxin A (ETA) was developed. The steps in constructing a model toxin involved the following:

1) Insertion of the dipeptide glutamic acid- phenylalanine (EF) between amino acid residues 60 and 61 of the ETA binding domain. The resulting product is called ETA(60EF61) . The inventors previously showed that ETA(60EF61) is still secreted by bacteria and is impaired in binding to surface receptors on cells.

2) Substitution of cysteine for methionine by site-directed mutagenesis at position 161 in ETA(60EF61) .

This results in a double mutant of ETA, termed ETA(60EF61) Cysl61 that appears to be even more impaired in binding to cell surface receptors than the mutant containing only the dipeptide insertion. The double mutant is still secreted.

3) Chemical attachment of a monoclonal antibody such as 14C3, for example, to the free sulfhydryl provided by the cysteine residue in ETA(60EF61) Cysl61.

Model hybrid toxins have proven to work extremely well in specific cell killing, as described elsewhere herein.

The combination of three important features confirms novelty and inventiveness in the present invention. These features include:

a) modification of the endogenous receptor binding region of a protein toxin by a mutation that leaves the cell binding domain of the toxin prmarily intact while substantially attenuating receptor binding ability.

b) Placement, by site directed mutagenesis, of a cysteine residue in the receptor binding domain of the toxin, which may further attenuate the endogenous receptor binding ability of the toxin while adding a potential coupling site.

c) Use of the free sulfhydryl of the cysteine residue as the site at which an alternative receptor binding moiety is chemically coupled to the toxin.

SUMMARY OF THE INVENTION

The present invention involves a Pseudomonas exotoxin having mutations in domain I. A first mutation includes any mutation that attenuates binding to receptors for wild-type exotoxin, leaves domain I intact and does not prohibit toxin secretion by bacterial hosts, or prohibit ADP ribosyl transferase activity or membrane penetration activity. Said mutant exotoxin has the capability to be endocytosed when bound to a eukaryotic cell via an alternative binding moiety and has eukaryotic cytotoxicity. A preferred embodiment is this mutant exotoxin being exoplasmically or periplasmically secreted by prokaryotes. Mutations could be amino acid insertions, substitutions, or deletions that fit these criteria. Preferred embodiments include amino acid, dipeptide, tripeptide or tetrapeptide insertions in domain I of Pseudomonas exotoxin which fit these criteria. A second mutation involves a cysteine substitution or insertion in a surface residue of exotoxin domain I to provide a coupling site. This substitution or insertion is preferably on a side opposite to domains II and III of the exotoxin. The latter substitution or insertion allows ready attachment of a carrier molecule by a disulfide or thioether linkage. Attachment of carriers such as monoclonal antibodies results in immunotoxins having the binding specificity of the antibody rather than the native exotoxin.

A preferred first alteration is the insertion of a dipeptide comprising glutamate. Another preferred first alteration in domain I is the insertion of a dipeptide comprising leucine or phenylalanine. In a most preferred embodiment the first alteration is insertion of glutamyl phenylalanyl between positions 60 and 61 in domain I of Pseudomonas exotoxin.

A preferred second alteration is cysteine substitution for a preexisting amino acid in domain I. Most preferably cysteine is substituted for methionine at position 161. Other positions, particularly on the surface of domain I opposite to domain II and III should also be suitable for maintenance of desired biological activities upon coupling to carrier molecules such as antibodies.

In a broad sense, the alterations of Pseudomonas exotoxin of the present invention result in the following properties:

1) substantially undiminished prokaryotic secretion, which greatly facilitates obtaining adequate amounts of purified toxin;

2) effective endocytosis of the modified toxin occurs when the modified toxin is bound to a eukaryotic cell via an alternative binding moiety, which allows intracellular transport when presented to a eukaryotic cell surface;

3) eukaryotic cytotoxicity, that is, undiminished ADP ribosylation activity, which allows catalytic toxic events to occur upon intracellular eukaryotic presentation; 4) having a substitution on the surface of domain I which allows ready coupling of a carrier such as a monoclonal antibody, such coupling not interfering with ultimate intracellular transport of essential toxic portions to a target cell .

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1. Construction of pRC362-Cysl61 and pRC362ΔE-60EF61Cysl61. A, wildtype and the mutant oligonucleotide sequences. In this site-directed mutagenesis system the "plus" phage strand is packaged during the preparation of single-stranded DNA, which corresponds to the coding strand (mRNA-like) of the cloned toxin fragment. Therefore, the mutant oligonucleotide synthesized for site-directed mutagenesis was complementary to the coding strand. The codon for glutamic acid 160 was changed to GAA and the codon selected for cysteine was TGC. This was done to incorporate the restriction site for BsmI (5'GAATGC), thus facilitating mutant screening by BsmI mapping. B, derivation of pRC362-Cysl61 and pRC362ΔE-60EF61Cysl61. The black bars represent the ETA structural gene (toxA) . Site-directed mutagenesis was carried out according to the directions of the manufacturer (Amersham) to derive the plasmid pIBI25-toxA580Cysl61, and the mutation was confirmed by BsmI mapping. The 307 bp KpnI-AccI fragment of pIB125-toxA580Cysl61 containing the cysteine 161 mutation was then substituted for the corresponding fragment in pRC362 to derive pRC362-Cysl61. pRC362ΔE- 60EF61Cysl61 was then derived by substituting the 1209bp KpnI-XhoI (both sites are unique in toxA) fragment from pRC362-Cysl61 for the corresponding fragment in pRC362ΔE- 60EF61. The mutation was confirmed by BsmI mapping at various stages. Symbols: A, AccI; Bg, Bgrlll; Bm, BamHI; Bs, the newly generated BsmI site; E, EcoRI; K, Kpnl; P, Pstl ; X, Xhol ; Δ (E) , deleted BcoRI stie; Δ(Bg, Bm) , deleted Bgl and BamHI sites; EF, insertion site for the hexanucleotide encoding the dipeptide Glu-Phe in the variant ETA-60EF61; Cysl61, site-directed mutagenesis site resulting in the substitution of cysteine for methionine 161.

Figure 2. Analysis of wild type and variant ETA proteins by SDS-polyacrylamide gel electrophoresis under reducing and nonreducing conditions. 9-10 μg of each toxin was applied to each lane and the protein bands were visualized by Coomassie Blue staining. Lanes 1 and 6, ETA-Cysl61; Lanes 2 and 7, ETA-60EF61Cysl61; Lanes 3 and 8, ETA-60EF61; Lanes 4 and 9, wildtype ETA; Lane 5, molecular weight standards. Lanes 1-4 are under nonreducing conditions and 5-9 under reducing. The molecular weight markers are, from top to bottom, β- galactosidase (116 kDa) , phosphorylase b (97 kDa) , bovine serum albumin (66 kDa) , ovalbumin (45 kDa) , and carbonic anhydrase (29 kDa) . The gel contained 10% acrylamide.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

In its most general application, the present invention concerns a mutant Pseudomonas exotoxin where eukaryotic cell binding capacity is attenuated, substantial Pseudomonas secretion of the exotoxin occurs, eukaryotic membrane translocation capacity is substantially retained when said exotoxin is bound to a eukaryotic cell via an alternative binding moiety, and intracellular toxicity is substantial.

The preparation of a mutant ETA defective in receptor binding by placing the dipeptide GluPhe between residues 60 and 61 has been described in detail in a publication by the authors (Chaudry et al . , 1989) . Substituting cysteine for methionine 151 and combining this mutation with the GluPhe mutation to produce the double mutant ETA-60EF61Cysl61 is described in Figure 1 of this application and elsewhere herein. Secretion of the double mutant by Pseudomonas aeruginosa has been verified by the Elek test as described previously (Chaudry et al. , 1989). Retention of membrane penetration when the toxin is bound to a eukaryotic cell via an alternative binding moiety, and demonstration of cytotoxicity, is shown by disclosures elsewhere in this application.

The preferred mutant Pseudomonas exotoxin comprises a modification in domain I. The more preferred exotoxin of the present invention also comprises a cysteine insertion in domain I allowing attachment of a carrier molecule having binding specificity for a eukaryotic cell target.

A preferred mutant Pseudomonas exotoxin comprises an amino acid or peptide insertion in domain I. The insertion is preferably a dipeptide insertion, preferably between positions 60 and 61 in domain I.

A most preferred mutant Pseudomonas exotoxin comprises a cysteine substitution for methionine of position 161 in domain I. This is preferably accompanied by an amino acid, dipeptide, tripeptide or tetrapeptide insertion in domain I. A preferred insertion is a dipeptide comprising glutamate. The cysteine substitution may, however be generally in a domain I surface residue on a side opposite to exotoxin domains II and III, said substitution allowing attachment of a carrier molecule by a disulfide or thioether linkage and in a manner facilitating ultimate biological effectiveness. It is preferred that the cysteine substitution be for a preexisting amino acid in domain I; however, it could also be a cysteine insertion.

A preferred domain I alteration is one which comprises a dipeptide or tetrapeptide insertion comprising glutamate and leucine or phenylalanine, for example between positions 60 and 61. This is most preferably a glutamate-phenylalanine dipeptide insertion preferably in combination with a cysteine substitution for methionine of position 161.

Both plasmid pRC362-Cysl61, containing the directions to synthesize the preferred cysteine substituted for methionine 161 of the exotoxin and plasmid PRC362 E60EF61Cysl61, containing the directions to synthesize the 60-61 glutamyl phenylalanyl and cysteine 161 mutant exotoxins are important portions of the present invention.

An important aspect of the present invention is a nontoxic Pseudomonas transformant producing an exotoxin having a dipeptide insertion and a cysteine substitution in domain I. A method for preparing a nontoxigenic Pseudomonas producing a modified Pseudomonas exotoxin is of course also part of the present invention. This method comprises transforming a nontoxigenic Pseudomonas with a plasmid coding for a Pseudomonas exotoxin variant having an amino acid, dipeptide, tripeptide or tetrapeptide insertion and cysteine substitution in domain I, said insertion attenuating cell binding capacity and said substitution enhancing capacity for linking carrier molecules.

Another important component of the present invention is an immunotoxin comprising a Pseudomonas exotoxin variant having attenuated eukaryotic cell binding capacity, being secreted by Pseudomonas producing said variant having eukaryotic membrane translocation capacity when bound to a eukaryotic cell via an alternative binding moiety and substantial intracellular toxicity retained. To complete the immunotoxin a monoclonal antibody coupled to an inserted cysteine of said exotoxin variant, said antibody having binding affinity for surface structures of specific eukaryotic cells. A preferred antibody is a monoclonal antibody. Monoclonal antibodies having desired binding specificities for therapeutic usage may be prepared by the well known procedure of Kohler and Milstein as refined by those of skill in the art.

The immunotoxin of the present invention may also be described as an immunotoxin comprising: a mutant

Pseudomonas exotoxin having a modification in domain I which attenuates eukaryotic cell binding while allowing substantially undiminished prokaryotic secretion and eukaryotic intracellular toxicity; a cysteine insertion in domain I; and an antibody bound to the inserted cysteine, said antibody having binding specificity for a eukaryotic cell target.

As mentioned earlier for the preferred mutant exotoxins, for preferred immunotoxins the exotoxin modification in domain I is a dipeptide insertion, preferably a dipeptide insertion between positions 60 and 61. The preferred immunotoxin contains an exotoxin with a cysteine substitution for methionine of position 161.

A broader preferred immunotoxin of the present invention has a exotoxin modified to have an amino acid, dipeptide, tripeptide or tetrapeptide insertion in domain I. A preferred cysteine insertion is a cysteine substitution in a domain I surface residue on a side opposite to domains II and III. Such a substitution allows attachment of a carrier molecule, particularly an antibody, by a disulfide or thioether linkage.

In one view, the preferred immunotoxin of the present invention involves an exotoxin with a modification that is a dipeptide insertion comprising glutamate in domain I . A preferred cysteine insertion is a cysteine substitution for a preexisting amino acid in domain I.

The immunotoxin of the present invention has an exotoxin which has a modification that is a dipeptide or tetrapeptide insertion comprising glutamate and leucine or phenylalanine between positions 60 and 61. Such a modification results in an exotoxin with an uninhibited intracellular ADP ribosylation activity.

The most preferred immunotoxin of the present invention is one with an exotoxin where the modification is a glutamate-phenylalanine dipeptide insertion and the cysteine insertion is a cysteine substitution for methionine of position 161 of domain I. The preferred glutamate-phenylalanine insertion is between position 60 and 61.

In the following example, to introduce a free sulfhydryl into Pseudomonas aeruginosa exotoxin A (ETA) , methionine 161 in domain I of the toxin was changed to cysteine by site-directed mutagenesis. The free sulfhydryl provides a convenient site for covalent attachment of ETA to other proteins in the production of chimeric toxins. The mutation was then introduced into a variant of ETA that is impaired in receptor binding, (ETA-60EF61) , that has the dipeptide Glu-Phe inserted between the residues 60 and 61. The resulting double mutant, ETA-60EF61Cysl61, was conjugated to three different monoclonal antibodies via a thioether linkage and the immunotoxins were tested for cytotoxicity with cells in culture. Various insertion mutants previously produced by the inventors by Barany hexanucleotide insertions (Chaudry et al . 1989) may be utilized herein. Each immunotoxin was extremely potent against cells that expressed surface determinants for the monoclonal antibodies, but had little effect on cells that did not bind the antibodies. For comparison, ricin A chain was also conjugated to each of the three monoclonal antibodies. It was found that the resulting ricin immunotoxins were at least two orders of magnitude less potent than the corresponding toxins made with ETA- 60EF61Cysl61. This demonstrates that ETA-60EF61Cysl61 makes potent and specific immunotoxins for selectively eliminating subpopulations of cells in vi tro or in vivo.

In view of the above description and following specific Examples, one of skill in the art is directed to prepare and identify the toxins of the present invention.

EXAMPLE 1

Pseudomonas aeruginosa exotoxin A (ETA,M_r = 66,583) kills mammalian cells by a process involving at least three steps. First, the toxin binds to a cell surface receptor and is endocytosed. There is recent evidence that the physiological receptor is the α₂-macroglobulin receptor/low density lipoprotein receptor-related protein (Kounnas et al . , 1992) . Second, a carboxy-terminal fragment of the toxin escapes from an intracellular compartment to enter the cytosol. Third, the toxin then catalyzes the covalent attachment of the adenosine diphosphate ribose (ADP-ribose) moiety of NAD⁺ to elongation factor 2 in the cytoplasm, thereby arresting protein synthesis (Iglewski et al . , 1975) .

Crystallographic studies of Allured et al . (1986) identified three domains in the ETA protein that correlate with toxin functions (For reviews, see Wick et al . , 1990; Pastan et al . , 1991; Pastan et al. , 1992) . Domain la (residues 1-252) is the receptor binding domain. There is also domain lb (residues 365-399) whose role is unknown. Domain II (residues 253-364) functions in membrane penetration. Domain II also contains a loop that is proteolytically cleaved between residues 279 and 280, liberating a 37 kDa carboxyl-terminal fragment that is believed to eventually reach the cytosol (Ogata et al . , 1990; Theuer et al. , 1992). Domain III (residues 400-613) contains the catalytic center for ADP-ribosyl transferase activity. In addition, domain III contains the tetrapeptide sequence REDL (residues 609-612) that is adjacent the carboxy-terminal lysine and which is essential for activity (Chaudhary et al. , 1990). KDEL can substitute for the REDL sequence and it has been speculated that after endocytosis the toxin binds to the KDEL receptor and is transported to the endoplasmic reticulum before penetrating to the cytosol (Pastan et al., 1992; Pelham et al . , 1992).

There has been much work on combining protein toxins such as ETA with monoclonal antibodies to produce immunotoxins that selectively attack target cells bearing determinants for the antibody. It is important that an immunotoxin be highly specific so that it only attacks the desired target cells while simultaneously retaining high potency. To be specific, the inherent receptor binding ability of the toxin molecule itself needs to be eliminated so that an immunotoxin not interact with two receptors, the original toxin receptor and the determinant for the monoclonal antibody. The present embodiment concerns a variant of ETA containing a dipeptide insert between residues 60 and 61 (termed ETA- 60EF61) that strongly impaired the ability of ETA to bind receptors (Chaudry et al. , 1989). However, when ETA- 60EF61 was chemically derivatized to introduce reactive thiols at primary amines and subsequently coupled to transferrin, the resulting toxin was found to be not very potent. One possible explanation for the loss in potency was that the toxin molecule had been damaged by chemical derivatization. To avoid chemically derivatizing the toxin, a free cysteine was introduced ih domain I of ETA- 60EF61 by site directed mutagenesis. The new cysteine residue provides a convenient moiety for conjugating the toxin to other proteins at a defined site in domain la. An important aspect of the present invention concerns several immunotoxins made with this new derivative of ETA-60EF61 that are highly specific and extremely potent.

Materials and Methods

Media and Biologicals -- LB and LB agar were prepared as described in Maniatis et al. (1982) . Tryptic soy broth dialysate (TSBD) was prepared as described by Iglewski et al . (1979) with the following modifications: the medium was dialyzed for 20 hours, glycerol was then added (1.5%, w/v) and the medium was deferrated with Chelex-100 (Bio-Rad) for 20 hours. The medium was filter-sterilized (0.22 μm pore size) and supplemented with 50-75 mM monosodium glutamate and 1 mM MgS0₄. Tetracycline concentration was 10-20 μg/ml for Escherichia coli and 200 μg/ml for Pseudomonas aeruginosa . TSBD that was used to produce the toxins contained 300 μg/ml carbenicillin. DNA ligase and restriction enzymes were from Promega, BRL, or New England Biolabs. SMCC and SPDP, were from Sigma. Anti- ETA rabbit polyclonal antibody was described by Mozola et al . (1984) .

Plasmids and Bacterial Strains - - Table 1 describes plasmids used. E. coli DH5α (F^" hsdR17 {r^~m⁺ (kl2) supE44 t i-1 λ^" recAl gyrA96 relA Δ(argF^" lacIOPZYA) D169 φ 80d IacZΔM15) was used as the host for site-directed mutagenesis, as well as other recombinant work. The nontoxigenic P. aeruginosa host PA103ΔtoxAl, carrying a deletion in the ETA gene (Chaudry, 1991) , was used to produce the plasmid-encoded toxin variants.

Table l. PLASMIDS

Construction of pRC362 -Cys 161 and pRC362L\E- 60EF61Cysl61 - - The strategy for site-directed mutagenesis and construction of pRC362-Cysl61 and pRC362ΔE-60EF61Cysl61 is summarized in Fig. 1. To substitute cysteine for methionine 161 (codon beginning at nucleotide 1301 of the 2.76 kbp Pstl-EcoRI fragment containing toxA) in domain I of ETA, the 580 bp Sall- Bgrlll fragment (nucleotides 908-1488) of the toxin gene was first subcloned into the unique Sail and BamHI sites of pIBI25 (IBI) . This subcloning destroyed the BamHI site of the vector and the Bglll site of the toxA fragment, resulting in the plasmid pIBI25- oxA580. A 22- mer oligonucleotide, 3'CTCGTTGCTTACGGTCGGCTGC (Fig. 1A) , was synthesized and site-directed mutagenesis carried out using materials from an Amersham Kit. The mutant sequence was designed such that it also contained a new restriction site for BsmI (5'GAATGC) , unique in pIBI25- toxA580Cysl61 (Fig. IB) . E. coli DH5α was transformed with the mutagenized plasmid, selecting for ampicillin resistance, and the plasmid DNA of several Amp^r clones isolated. The desired mutants were identified by restriction enzyme mapping with BsmI and Kpnl .

pRC362-Cysl61 and pRC362ΔE-60EF61Cysl61 were derived by substituting restriction enzyme fragments as shown in Fig. IB. All the relevant fragments were separated using ultrapure, low melting point agarose (BRL) , and the ligations were also in the same agarose. pRC362-Cysl61 was derived by substituting the 307 bp Kpnl-Accl fragment (nucleotides 1126-1433) of pIBI25-toxA580Cysl61, which contains the cysteine 161 mutation, for the corresponding fragment in pRC362. pRC362ΔE-60EF61Cysl61 was then derived by substituting the 1209 bp i-pnl-XhoI fragment from pRC362-Cysl61 for the corresponding fragment in pRC362ΔE-60EF61, a plasmid that encodes the toxin variant ETA-60EF61 (Chaudry et al . , 1989) . The Kpnl and Xhol sites are unique in these plasmids. The constructs were confirmed by BsmI mapping. The plasmids were then introduced into the nontoxigenic P. aeruginosa host PA103ΔtoxAl to produce the plasmid-encoded toxin variants ETA-Cysl61 and ETA-60EF61Cysl61.

Purification of ETA Variants - - ETA-Cysl6l and ETA- 60EF61Cysl61 were purified from culture supernatants as described by Chaudry et al. (1989), except that the nontoxigenic P. aeruginosa host was PA103ΔtoxAl, a derivative of PA103 in which the toxA was deleted

(Chaudry, 1991) . The variants were further purified by chromatography using a Pharmacia FPLC instrument. ETA- Cysl61 and ETA-60EF61Cysl61 preparations (in 20 mM Tris,

1 mM EDTA, 1 mM 2-mercaptoethanol, pH 8.2) were diluted with an equal volume of 50 mM sodium phosphate buffer, pH

7.8, and applied to a Q-Sepharose column (Pharmacia) at a flow rate 1.5 ml/min. The toxins were eluted with a linear phosphate gradient ranging from 50 mM to 200 mM, and the toxin-containing .fractions were pooled. These preparations were then diluted three-fold and applied to a Mono-Q 10/10 column (Pharmacia) . The column was washed with phosphate buffer until the absorbance at 280 nm was zero. The toxins were then eluted with a linear gradient of 50 to 300 mM sodium phosphate, pH7.6, in a total gradient volume of 50 ml, and the fractions were monitored by checking absorbance at 280 nm. Each toxin preparation resolved into three peaks at sodium phosphate concentrations of 100 mM (peak 1) , 150 mM (peak 2) , and 200 mM (peak 3) . The fractions were also analyzed by electrophoresis in polyacrylamide gels with SDS, which showed that peak 1 was a 25 kDa protein contaminant, peak

2 was ETA, and peak 3 contained a nonprotein material, presumably pigment. The fractions containing ETA were pooled and concentrated by ultrafiltration (Amicon, 15,000 M_r cutoff membrane) . The preparations were then extensively dialyzed against 20 mM Tris, 1 mM EDTA, 2 mM 2-mercaptoethanol, pH 8.2, and the toxins were quantitated by absorbance at 280 nm or by a radioimmune assay (Tsaur and Clowes, 1989) . The final preparations were analyzed by SDS-polyacrylamide gel (10%) electrophoresis under reducing and nonreducing conditions (Laemmli, 1970) and used for all assays.

Preparation of Ricin and dgRA -- Ricin was purified as described by Nicolson et al. (1974) and ricin A chain was prepared as described by Fulton et al . (1986) . Ricin A chain was deglycosylated prior to conjugation with antibodies (Thorpe et al. , 1985).

Monoclonal Antibodies - - Monoclonal antibody 5E9, which reacts with the human transferrin receptor, was produced from American Type Culture Collection hybridoma HB21. Hybridoma cells producing monoclonal antibody 14C3, which reacts with Thy-1 antigen, were kindly provided by Dr. Paul Gottlieb, University of Texas at Austin. Hybridoma cells secreting monoclonal antibody 33-24,12, which reacts with surface IgM, were originally descried by Leptin et al.

Monoclonal antibodies were produced in tissue culture by growing the hybridoma cell lines at 37°C under 5% C0₂ in a 50:50 mixture of DMEM and Ham's F12 media containing 1% Nutridoma (Boehringer Mannheim) and 0.1% fetal bovine serum. The monoclonal antibodies were purified from media by precipitation with 45% saturated ammonium sulfate, followed by ion exchange chromatography essentially as described by Parham et al . (1982), except that Mono Q (Pharmacia) was used instead of DEAE- cellulose.

Construction and Purification of Immunotoxins - - Monoclonal antibodies were derivatized with SMCC for making conjugates with ETA and with SPDP for making the conjugates with dgRA. The unreacted linkers were removed by gel filtration using a Sephadex G-25 or a Bio-Rad P-2 column. The derivatized antibodies were then mixed with underivatized ETA-60EF61Cysl61 or dgRA, and the mixture incubated overnight at 4°C. These methods couple ETA to antibodies via a thioether bond and dgRA to antibodies via a reducible disulfide bond. The reaction mixtures were 1-3 ml and contained about 1 mg each of the antibody and the toxin moieties in 50 mM phosphate buffer, pH 7.8. Immunotoxins containing ETA-60EF61Cysl61 were purified by anion exchange chromatography using Mono-Q 10/10

(Pharmacia) . The mixtures were loaded on the column at a flow rate of 1.5 ml per minute, collecting 1.5 to 3 ml fractions. The toxins were eluted with linear phosphate gradient (50-200 mM) at the same flow rate. Fractions containing the immunotoxins were pooled, concentrated, and subjected to gel filtration using a Superdex-200 column (1.6 cm x 60 cm, Pharmacia) . Two ml fractions were collected at flow rate 2 ml per minute. The immunotoxin-containing fractions were pooled, concentrated, and filter-sterilized. Immunotoxins containing dgRA were purified by gel filtration and Sepharose-Blue chromatography as described by Fulton et al . (1988) .

ETA variants were quantified by either absorbance at 280nm or by radioimmune assay using the IgG enriched fraction of rabbit polyclonal anti-ETA. The extinction coefficients for 1 mg/ l solutions were 1.2 for ETA, 1.4 for monoclonal antibodies, 1.3 for the immunotoxins with ETA, 1.0 for the immunotoxins with ricin A-chain, and 1.2 for holoricin and 0.77 for ricin A-chain.

Cytotoxici ty Assays - - A431 cells and mouse thymidine kinase deficient L (LMTK^") cells were grown at 37°C in Dulbecco's modified Eagle's medium (DMEM) , pH 7.4, in an atmosphere of 10% C0₂ and 90% air in a humidified incubator. DMEM was supplemented with 5% fetal bovine serum (Hyclone) , 4.5 mg/ml glucose, 292 μg/ml glutamine, and 2.5 μg/ml amphotericin B. Protein synthesis assays were done in assay medium, which was DMEM with methionine at 1/100 the normal concentration and without serum and which contained 10 mM HEPES, 100 units/ml penicillin, and 100 μg/ml streptomycin. A day before the assay, 5-6 x 10⁴ cells per well were seeded in 24-well assay plates (Corning or Falcon) . The cells were washed once with assay medium and then incubated in 0.5 ml assay medium for 30-60 min. The toxins, diluted in toxin dilution buffer (PBS containing 1 mg/ml BSA and 0.005% gentamycin) , were then added. Incubation at 37°C with toxins was for 24 h, the last hour with 2-4 μCi/ml ³⁵S-methionine. At the end of the 24th hour, cells were washed once with PBS (1.5 ml/well) and lysed in 90 μl lysis solution (0.1% SDS, 1 mM CaCl₂, 1 mM MgCl₂, and 0.2 mg/ml DNase I) . Lysed cells were then transferred to Whatman 3MM filter paper squares. The squares were then soaked in 5% trichloroacetic acid containing 0.5 mg/ml methionine for 30 min., dried, and counted in liquid scintillant (Marnell et al . , 1984).

EL4/9 cells were grown in DMEM supplemented with 10% fetal bovine serum. WEHI-279 cells were grown in an atmosphere of 95% air and 5% C0₂ in DMEM/F12 supplemented with 10% fetal bovine serum and 0.05 mM 2- mercaptoethanol. Protein synthesis assays with these cells were as with A431 cells, except that the assay medium contained fetal bovine serum. 2-3 x 10⁵ cells per well were seeded and toxins were directly added to cells the same day. After 23 hours, the assay plates were centrifuged for 6 minutes to pellet the cells, the medium removed, and assay medium containing ³⁵S-methionine added. After one additional hour, the plates were centrifuged again, assay medium removed, and the cells lysed. The PBS wash was excluded. The IC₅₀ is the concentration of a toxin that reduces protein synthesis by 50% compared to controls without toxin. When three or more determinations of an IC₅₀ value were available to average, the standard deviation from the mean is given.

Competi tion Assays - - The cells were seeded as described above. Each monoclonal antibody was added 15- 20 minutes before adding the relevant immunotoxin for receptor binding competition. Concentrations of immunotoxins and antibodies are given in Table 2.

Table 2. Cytotoxicity of immunotoxins in the presence of matching or unmatching antibodies.

Protein Synthesis (% of control)

33-24.12-ETA- 60EF61Cysl61 (2.8 pM with WEHI-279 cells)

14

12

10 7

87

These data indicate that free antibody abolishes the toxicity of corresponding immunotoxins.

15

Characterization of ETA-Cysl61 and ETA-60EF61Cysl61 - - Wildtype ETA has eight cysteines which consecutively form the four disulfide bonds in the toxin (Allured et al . , 1986) . The new cysteine at residue 161 would have the potential to participate in either intrachain or interchain disulfide bond formation and thus become unavailable for hybrid toxin construction. If cysteine 161 participated in intrachain disulfide bond formation, it could disrupt the normal sequence of disulfide bonds, grossly perturb the toxin structure and possibly alter biological activity or impede the intracellular processing resulting in prokaryotic toxin secretion. However, both ETA-Cysl61 and ETA-60EF61Cysl61 were found to be secreted as efficiently as wildtype ETA and there was also no apparent difference in the immunological reactivity among the three proteins. This suggested that the protein structure of the variant toxins was not disrupted to any major extent by cysteine 161 and that the normal intrachain disulfide bonds of the toxin had formed properly. To see whether the extra cysteine residues formed interchain disulfide bonds to generate homodimers, purified ETA-Cysl61 and ETA-60EF61Cysl61 were analyzed by electrophoresis in polyacrylamide gels with SDS under nonreducing and reducing conditions. No homodimers were observed under nonreducing conditions and all proteins had the expected electrophoretic migration (Fig. 2) ETA-Cysl61 and ETA-60EF61Cysl61 in crude culture supernatants also were not present as dimers (data not shown) . Altogether, these results suggest that cysteine 161 does not participate in disulfide bond formation and should therefore be available for conjugating to monoclonal antibodies.

The effect of the cysteine at position 161 on the biological activity of the toxin was assessed by comparing the ability of wildtype and variant toxins to inhibit protein synthesis in mouse LMTK^" cells, which are extremely sensitive to ETA (Table 3) .

Table 3. Cytotoxicity of wildtype ETA and ETA variants on mouse LMTK^" cells.

TOXIN IC₅₀(pM)

ETA (wildtype) 0.9

ETA-Cysl61 6.9 ETA-60EF61 450

ETA-60EF61Cysl61 1200

Purified ETA-Cysl61 was about 7-fold less cytotoxic than the wildtype toxin and ETA-60EF61 was approximately 450- fold less cytotoxic. The presence of both mutations in ETA-60EF61Cysl61 reduced cytotoxicity about 1300-fold. It is not entirely clear why cysteine at residue 161 reduces cytotoxicity, but it may affect binding to the toxin receptor, considering that the mutation is in domain la.

Preparation and characterization of immunotoxins - - The enzymatically active moiety of exotoxin A that enters the cell cytosol is apparently part of a 37 kDa fragment generated by proteolytic cleavage between arginine 279 and glycine 280 in domain II (Ogata et al . , 1990; Theuer et ai., 1992) . Considering that cysteine 161 is in domain I, ETA-60EF61Cysl61 was conjugated to monoclonal antibodies via a thioether bond, rather than a reducible disulfide bond, because domain I should be separated from the 37 kDa fragment after proteolysis. Conjugates made with thioether bonds should be more stable than those made with reducible disulfide bonds (Gregory, 1955; Marsh et al . , 1988) . To make the immunotoxins, SMCC- derivatized monoclonal antibodies were reacted with underivatized ETA-60EF61Cysl61 and purified as described above in Materials and Methods. Electrophoresis of conjugates in polyacrylamide gels with SDS indicated that the immunotoxins were highly purified and the stoichiometry of ETA-60EF61Cysl61 to antibody was one to one.

Immunotoxins made with the anti-human TfR monoclonal antibody 5E9 were tested with A431 cells, which express high levels of the human TfR. Monoclonal antibody 14C3 recognizes the murine T-cell marker Thyl. Mouse T-cell leukemia EL4/9 cells, which express Thyl, were the target for immunotoxins made with antibody 14C3. Monoclonal antibody 33.24.12 recognizes murine surface IgM. Immunotoxins made with this monoclonal were tested on WEHI-279, a mouse B-cell lymphoma line that expresses the surface IgM.

Immunotoxins made with ETA-60EF61Cysl61 and each of the three monoclonal antibodies were extremely potent against appropriate target cells, with IC₅₀ values of about 1 pM or less (Table 4) .

Table 4. Cytotoxic activities of toxins and immunotoxins.

ANTIBODY 5E9 (anti-TfR)

5E9 (anti-TfR)

14C3 (anti-Thy 1)

33-24.12 (anti-IgM)

a Human TfR is expressed on the surface of A431 cells (human epi

-°Thy-l antigen is expressed on the surface of EL4/9 cells. ^cIgM is expressed on the surface of WEHI-279 cells (murine - B-

As shown in Table 4 ETA-60EF61Cysl61 alone had little cytotoxic activity against any of the cells. When dgRA was coupled with each of the three monoclonal antibodies, the conjugates were about 100 to 400-fold less cytotoxic toward the appropriate target cells than immunotoxins containing ETA-60EF61Cysl61. When alone, dgRA was not cytotoxic. There was little cytotoxic activity of immunotoxins against non-target cell types indicating that the immunotoxins were highly specific. As mentioned earlier, cytotoxicity assays were done in the presence of free competing monoclonal antibodies (Table 2) . Cytotoxicity was abolished when antibodies 14C3, 33-24.12 or 5E9 were present with their matching immunotoxins, but not when cross-tested with unmatching immunotoxins.

Several lines of evidence suggest that preparing immunotoxins by chemically derivatizing ETA with SPDP or 2-iminothiolane, which modify lysine residues, would adversely affect the activity of the resulting immunotoxins. 1) The carboxyl-terminal residue of ETA, a lysine at position 613, is adjacent the REDL sequence that is necessary for cytotoxicity (Chaudhary et al . 1990) and derivatization of this lysine is likely to impair function of the REDL sequence. 2) In addition to lysine-613, domain III of ETA contains two other lysines at positions 590 and 606. Derivatization of these could impair passage through a membrane or the enzymatic activity of domain III, or both. 3) Batra et al . (1989) compared the activity of conjugates made with PE40, a derivative of ETA lacking domain I, with the activity of conjugates made with LysPE40, which contains an extra lysine at the N-terminus. Conjugates made with LysPE40 were more toxic than those made with PE40, and the authors suggested that the enhanced potency resulted because the N-terminal lysine provided an extra site for conjugation, reducing conjugation at the other lysines in domain III. 4) Recombinant chimeric toxins containing PE40 and variable regions of the monoclonal antibodies or growth factors are markedly more potent than the corresponding chemical conjugates with PE40 (Pastan et al . , 1992) .

To avoid adding a free sulfhydryl by chemically derivatizing ETA, a free sulfhydryl was added by substituting methionine 161 with cysteine. In addition to the site of conjugation being defined, there should be only one antibody conjugated per ETA molecule. The mutation was made at methionine 161 in domain I for the following reasons: In the crystal structure of wild type ETA (Allured et al . , 1986), methionine 161 is a surface residue, its side chain projecting away from the surface of the toxin molecule. It is reasonable that the side chain of cysteine would also project away from the surface, available to react with monoclonal antibodies, because cysteine is more hydrophilic than methionine. Position 161 is far removed from the nearest disulfide bonds, one between cysteines 11 and 15 and the other between cysteines 197 and 214, and likely would not disrupt the sequence of existing disulfide bonds. Position 161 is also on the opposite side of the protein from domains II and III, and thus the ligands conjugated through cysteine 161 should not sterically hinder the functions of domains II and III. Finally, monoclonal antibodies attached to the new cysteine in domain I should not interfere with translocation of the 37 kDa carboxyl fragment to the cytosol because domain I is believed to be proteolytically removed prior to translocation. Thus, it should be possible to conjugate antibodies to cysteine 161 by a stable, non-reducible thioether bond. The fact that the immunotoxins made with ETA-60EF61Cysl61 via thioether linkages were so potent is consistent with the idea that the C-terminal portion of ETA is liberated prior to translocation (Ogata et al. , 1990; Theuer et al . , 1992) .

Other cysteine substitutions satisfying these criteria should be at least equally functional. It was a surprise that the cysteine substitution would reduce the cytotoxicity of ETA 7-fold, and the reason for the reduction is incompletely understood. However, it seems likely that the new cysteine impairs binding to normal toxin receptors because it is in domain la. The presence of cysteine 161 further reduced the cytotoxicity of ETA- 60EF61 an additional three-fold, an advantage because this should decrease the nonspecific cytotoxicity of immunotoxins.

Three different monoclonal antibodies recognizing different receptors were used and all three immunotoxins containing ETA-60EF61Cysl61 were extremely potent towards appropriate target cells. As a yardstick to measure the effectiveness of the constructs containing ETA- 60EF61Cysl61, each monoclonal antibody was also conjugated to dgRA. The corresponding immunotoxins with dgRA were at least two orders of magnitude less potent than those made with ETA-60EF61Cysl61. Several lines of evidence indicated that the immunotoxins containing ETA- 60EF61Cysl61 were highly specific. 1) The immunotoxins were more than four orders of magnitude more potent than ETA-60EF61Cysl61 alone. 2) There was little cytotoxicity for cells that failed to express determinants for the antibodies. 3) Each immunotoxin was inhibited by the relevant monoclonal antibody.

In summary, the results presented here demonstrate that the prototype ETA-60EF61Cysl61 forms immunotoxins that are highly potent and specific. SEQUENCE LISTING

(1) GENERAL INFORMATION: (i) APPLICANT: NAME: BOARD OF REGENTS, THE UNIVERSITY OF

TEXAS SYSTEM STREET: 201 West 7th Street CITY: Austin STATE: Texas COUNTRY: United States of America

POSTAL CODE: 78701 TELEPHONE NO: (512)499-4462 TELEFAX: (512)499-4523

(ii) INVENTORS : DRAPER, ROCKFORD K.

CHAUDRY, G. JILANI

(iii) TITLE OF INVENTION: POTENT AND SPECIFIC

CHEMICALLY-CONJUGATED IMMUNOTOXINS

(iv) NUMBER OF SEQUENCES: 5

(v) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: ARNOLD, WHITE & DURKEE

(B) STREET: P.O. BOX 4433

(C) CITY: HOUSTON

(D) STATE: TEXAS (E) COUNTRY : USA

(F) ZIP: 77210

(vi) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: FLOPPY DISK/ASKII

(B) COMPUTER: IBM PC COMPATIBLE

(C) OPERATING SYSTEM: PC-DOS/MS-DOS (D) SOFTWARE: WORDPERFECT 5.1

(vii) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: UNKNOWN

(B) FILING DATE: UNKNOWN

(C) CLASSIFICATION: UNKNOWN

(viii) PRIOR APPLICATION.DATA:

(A) APPLICATION NUMBER: 07/992,900

(B) FILING DATE: 16.12.92

(C) CLASSIFICATION: UNKNOWN

(ix) ATTORNEY/AGENT INFORMATION:

(A) NAME: HODGINS, DANIEL S.

(B) REGISTRATION NUMBER: 31,026

(C) REFERENCE/DOCKET NUMBER: UTFF046PCT

(x) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 512-320-7200

(B) TELEFAX: 713-789-2676 (C) TELEX: 79-0924

(3) INFORMATION FOR SEQ ID NO:l:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 22 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS : single (D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1 GAGCAACGAG ATGCAGCCGA CG 22

(3) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2

GAGCAACGAA TGCCAGCCGA CG 22

(3) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3

CGTCGGCTGG CATTCGTTGC TC 22

(3) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 4 amino acid residues

(B) TYPE: amino acid

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4

Arg Glu Asp Leu 1

(3) INFORMATION FOR SEQ ID NO:5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 4 amino acid residues

(B) TYPE: amino acid

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

Lys Asp Glu Leu 1

The following citations are incorporated in pertinent part by reference herein for the reasons cited in the above text.

REFERENCES

Allured et al. 1986. Structure of exotoxin A of Pseudomonas aeruginosa at 3.0-angstrom resolution. Proc. Natl. Acad. Sci. U.S.A. 83:1320-1324.

Barany 1985 Gene (Amst.) 87:111-123.

Batra et al._f 1989. Antitumor activity in mice of an immunotoxin made with anti-transferrin receptor and a recombinant form of Pseudomonas exotoxin. Proc. Natl. Acad. Sci. U.S.A. 86:8545-8549.

Chaudhary et al., 1990. Pseudomonas exotoxin contains a specific sequence at the carboxyl terminus that is required for cytotoxicity. Proc. Natl. Acad. Sci. U.S.A. 87:308-312.

Chaudry, G.J. 1991. Genetically engineered variants of exotoxin A impaired in receptor binding and construction of hybrid toxins. Ph.D. Dissertation, University of Texas at Dallas. 128 p.

Chaudry et al., 1989. A dipeptide insertion in domain I of exotoxin A that impairs receptor binding. J^". Biol. Che . 264:15151-15156.

Fulton et al., 1986. Purification of ricin Al, A2 and B chains and characterization of their toxicity. J. Biol. Chem. 261:5314-5319. Fulton et al . , 1988. Pharmacokinetics of tumor-reactive immunotoxins in tumor-bearing mice: Effect of antibody valency and deglycosylation of the ricin A chain on clearance and tumor localization. Cancer Res . 48:2618- 2625.

Gregory, J.D. , 1955. The stability of N-ethylmaleimide and its reaction with sulfhydryl groups. J^". A er. Chem. Soc. 77:392-393.

Iglewski et al . , 1975. NAD-dependent inhibition of protein synthesis by Pseudomonas aeruginosa toxin. Proc. Natl . Acad. Sci . U. S .A. 72:2284-2288.

Iglewski et al . , 1979. Toxin inhibitors of protein synthesis: production, purification, and assay of Pseudomonas aeruginosa toxin A. Methods Enzymol . 68:780- 793.

Kohler and Milstein (1975) Nature 256:495-497.

Kounnas et al. , 1992. The α₂-macroglobulin receptor/low density lipoprotein receptor-related protein binds and internalizes Pseudomonas exotoxin A. J^". Biol . Chem. 267:12420-12423.

Laemmli, U.K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.

Leptin et al . (1984) Eur. J. Immunol . , 14, 534-542

Maniatis eta 1 . , 1982. Molecular cloning: a laboratory manual . Cold Spring Harbor Laboratory, Cold Spring Harbor, ΝY. pp 113-114 and 135-139. Marnell et al . , 1984. Evidence for penetration of diphtheria toxin to the cytosol through a prelysosomal membrane. Infect. Immun . 44:145-150.

Marsh et al. , 1988. Antibody-toxin conjugation in Immunotoxins, ed. A. E. Frankel, Kluwer Academic Publishers, Boston, pp. 213-237.

Mozola et al . , 1984. Cloning and expression of a gene segment encoding the enzymatic moiety of Pseudomonas aeruginosa exotoxin A. J. Bacteriol. 159:683-687.

Nicolson et al . , 1974. Characterization of two plant lectins from Ricinus communis and their quantitative interaction with a murine lymphoma. Biochemistry 13:196- 204.

Ogata et al . , 1990. Processing of Pseudomonas exotoxin by a cellular protease results in the generation of a 37,000-Da toxin fragment that is translocated to the cytosol. J. Biol . Chem. 265:20678-20685.

Olsen et al. , 1982. J. Bacteriol . , 150:60-69.

Parham et al . , 1982. Monoclonal antibodies: purification, fragmentation, and application to structural and functional studies of class I MHC antigens. J. Immunol . Methods 53:133-173.

Pastan et al . , 1992. Recombinant toxins as novel therapeutic agents. Annu . Rev. Biochem. 61:331-354.

Pastan et al . , 1991. Recombinant toxins for cancer treatment. Science 254:1173-1177.

Pelham et al. , 1992. Toxin entry: how reversible is the secretory pathway? Trends in Cell Biology 2:183-185. Theuer et al . , 1992. A recombinant form of Pseudomonas exotoxin directed at the epidermal growth factor receptor that is cytotoxic without requiring proteolytic processing. J. Biol . Chem. 267:16872-16877.

Thorpe et al . , 1985. Modification of the carbohydrate in ricin with metaperiodate-cyanoborohydride mixtures. Effects on toxicity and in vivo distribution. Eur. J. Biochem . 147:197-206.

Tsaur et al . , 1989. Localization of the control region for expression of exotoxin A in Pseudomonas aeruginosa . J. Bacteriol . 171:2599-2604.

Wick et al . , 1990. Analysis of the structure-function relationship of Pseudomonas aeruginosa exotoxin A. Molecular Microbiology 4:527-535.

Claims

1. A mutant Pseudomonas exotoxin, comprising:

a first mutation in domain I causing attenuated binding to receptors for wild-type exotoxin; and

a second mutation in domain I causing a cysteine insertion or substitution to provide a coupling site;

said mutant exotoxin having capability to be endocytosed when bound to a eukaryotic cell via an alternative binding moiety and having eukaryotic cytotoxicity.

2. The mutant Pseudomonas exotoxin of claim 1 defined further as exoplasmically or periplasmically secreted by prokaryotes.

3. The mutant Pseudomonas exotoxin of claim 2, where exoplasmic prokaryotic secretion occurs from a non¬ toxigenic Pseudomonad.

4. The mutant Pseudomonas exotoxin of claim 2, where substantial periplasmic secretion occurs in an E. coli

5. The mutant Pseudomonas exotoxin of claim 1 wherein the coupling site facilities attachment of a carrier molecule having binding specificity for a eukaryotic cell target.

6. The mutant Pseudomonas exotoxin of claim 1 wherein the first mutation comprises an insertion, substitution or deletion of an amino acid, dipeptide, tripeptide or tetrapeptide.

7. The mutant Pseudomonas exotoxin of claim 1 wherein the first mutation comprises a dipeptide, tripeptide or tetrapeptide insertion in domain I.

8. The mutant Pseudomonas exotoxin of claim 1 wherein the first mutation comprises a dipeptide insertion in domain I .

9. The mutant Pseudomonas exotoxin of claim 1 wherein the first mutation comprises a dipeptide insertion between positions 60 and 61 in domain I.

10. The mutant Pseudomonas exotoxin of claim 1 wherein the first mutation comprises a dipeptide insertion including glutamate in domain I.

11. The mutant Pseudomonas exotoxin of claim 1 wherein the first mutation comprises a dipeptide or tetrapeptide insertion including glutamate and leucine or phenylalanine between positions 60 and 61 in domain I.

12. The mutant Pseudomonas exotoxin of claim 1 wherein the first mutation comprises a glutamate-phenylalanine dipeptide insertion in domain I.

13. The mutant Pseudomonas exotoxin of claim 1 wherein the second mutation comprises a cysteine substitution for a preexisting amino acid.

1 . The mutant Pseudomonas exotoxin of claim 1 wherein the second mutation comprises a cysteine insertion or substitution in a surface residue on a side opposite to domains II and III, said substitution allowing attachment of a carrier molecule by a disulfide or thioether linkage.

15. The mutant Pseudomonas exotoxin of claim 14 defined further wherein the cysteine insertion is a cysteine substitution for methionine of position 161.

16. Plasmid pRC362-Cysl61

17. Plasmid pRC362ΔE-60EF61Cysl61.

18. A prokaryotic transformant producing an exotoxin having a dipeptide insertion and a cysteine substitution in domain I.

19. The prokaryotic transformant of claim 18 defined further as being a nontoxigenic Pseudomonad or an E. coli .

20. A method for preparing a nontoxigenic Pseudomonad which produces a mutant Pseudomonas exotoxin, the method comprising transforming a nontoxigenic Pseudomonas with a plasmid coding for a Pseudomonas exotoxin mutant having an amino acid, dipeptide, tripeptide or tetrapeptide insertion and cysteine substitution in domain I, said insertion attenuating cell binding capacity and said substitution enhancing capacity for linking carrier molecules.

21. An immunotoxin comprising:

a Pseudomonas exotoxin mutant having attenuated binding to receptors for wild-type exotoxin, a cysteine insertion or substitution to provide a coupling site, capability to be endocytosed when bound to a eukaryotic cell via an alternative binding moiety and eukaryotic cytotoxicity; and

a monoclonal antibody coupled to the inserted or substituted cysteine the antibody having binding affinity for surface structures of specific eukaryotic cells.

22. A hybrid toxin comprising:

a mutant Pseudomonas exotoxin having attenuated binding to receptors for wild-type exotoxin, a cysteine insertion or substitution to provide a coupling site, capability to be endocytosed when bound to a a eukaryotic cell via an alternative binding moiety and eukaryotic cytotoxicity; and

a peptide or protein coupled to the inserted or substituted cysteine, the peptide or protein having binding specificity for a eukaryotic cell target.

23. The hybrid toxin of claim 22 where the attenuated binding to receptors for wild-type exotoxin is due to a dipeptide insertion in domain I.

24. The hybrid toxin of claim 22 where the attenuated binding to receptors for wild-type exotoxin is due to a dipeptide insertion between positions 60 and 61 of domain I.

25. The hybrid toxin of claim 22 where the attenuated binding to receptors for wild-type exotoxin is due to an insertion into domain I of a dipeptide comprising glutamate.

26. The hybrid toxin of claim 22 where the attenuated binding to receptors for wild-type exotoxin is due to a dipeptide or tetrapeptide insertion comprising glutamate and leucine or phenylalanine between positions 60 and 61 of domain I.

27. The hybrid toxin of claim 22 where the attenuated binding to receptors for wild-type exotoxin is due to a glutamyl-phenylalanyl insertion into domain I.

28. The hybrid toxin of claim 22 where the attenuated binding to receptors for wild-type exotoxin is due to a glutamyl-phenylalanyl insertion between position 60 and 61 of domain I.

29. The immunotoxin of claim 21 where the cysteine insertion is a cysteine substitution for methionine 161,

30. The hybrid toxin of claim 22 where the cysteine insertion is a cysteine substitution for a preexisting amino acid.

31. The hybrid toxin of claim 22 where the cysteine insertion is a cysteine substitution for methionine 161

32. The hybrid toxin of claim 22 where the attenuated binding to receptors for wild-type exotoxin is due to an amino acid, dipeptide, tripeptide or tetrapeptide insertion; and the cysteine insertion is a cysteine substitution in a surface residue on a side opposite to domains II and III, said substitution mediating attachment of a peptide or protein by a disulfide or thioether linkage.

33. The hybrid toxin of claim 22 where the attenuated binding to receptors for wild-type exotoxin is due to a glutamate-phenylalanine dipeptide insertion and the cysteine insertion is a cysteine substitution for methionine 161, said substitution mediating attachment of a peptide or protein by a thioether linkage.

34. The hybrid toxin of claim 22 where the peptide or protein is an antibody or fragment thereof.

35. The hybrid toxin of claim 22 where the peptide or protein is a monoclonal antibody.

36. The hybrid toxin of claim 22 where the peptide or protein is transferrin, epidermal growth factor, or transforming growth factor.