WO1994006936A1 - Method for the diagnosis of genetic disorders associated with chromosomal abnormalities and uniparental disomy - Google Patents

Abstract

A method for the diagnosis of a genetic disorder associated with a chromosome structural abnormality or with uniparental disomy of a critical chromosomal region and for determining the parental origin of such a genetic disorder, and for determining the genotype of a patient with such a genetic disorder. The method utilizes in situ hybridization on metaphase chromosomes or interphase nuclei and analysis of tandemly repeated sequence polymorphisms in the chromosomal region associated with the disorder.

Description

METHOD FOR THE DIAGNOSIS OF GENETIC DISORDERS ASSOCIATED WITH CHROMOSOMAL ABNORMALITIES AND UNIPARENTAL DISOMY

BACKGROUND OF THE INVENTION

1. Field of the Invention

This invention relates to a method for the diagnosis of a genetic disorder which is associated with either a chromosome structural abnormality, or with uniparental disomy of a critical chromosomal region. The invention also relates to a method of determining the parental origin of the chromosomal aberration which causes the genetic disorder, and to identifying the genotype of a patient being analyzed for the disorder.

2. Description of the Related Art

A number of genetic disorders have been identified which are associated with either a chromosome structural abnormality of a critical chromosomal region, or with uniparental disomy of that critical chromosomal region. Thus, the phenotype associated with the disorder can be caused by two mechanisms. Uniparental disomy occurs as a result of nondisjunction during meiosis, and can result from transfer of the same chromosome in duplicate

(isodisomy) from one parent, or from two different copies of the same homolog (heterodisomy) from one parent.

In cases where the disorder is associated with

uniparental disomy, a phenomenon known as imprinting may be involved. Imprinting results in an effect on phenotype depending on the parental origin of the chromosomal region. This phenomenon has been extensively studied in the mouse.

Prader-Willi Syndrome (PWS) is an example of such a disorder, and has been associated with either a deletion of proximal chromosome 15q (q11-q13), or with maternal uniparental disomy. Thus, a copy of this region of the paternal chromosome 15 appears to be required for normal development. This syndrome is characterized by infantile hypotonia with feeding problems, short stature, small hands and feet, almond-shaped eyes, hypogonadism, psychomotor retardation, hypopigmentation, and early onset of childhood hyperphagia with consequent obesity.

Similarly, Angelman Syndrome has been associated with a deletion in this same chromosomal region, but with paternal uniparental disomy. Angelman Syndrome is

characterized by severe mental retardation, seizures, inappropriate laughter, ataxic gait, puppet-like upper-limb movements, lack of speech, a large mandible,

hypopigmentation, an open mouth with protruding tongue, and microcephaly. The different parental origins of deletions and uniparental disomy in Prader-Willi and Angelman

Syndromes strongly implicate genomic imprinting in this chromosome region.

A syndrome associated with both a duplication in a critical chromosomal region, or with uniparental disomy is Beckwith-Wiedemann Syndrome (BWS). This syndrome has been associated with a duplication at the llpl5.5 region of human chromosome 11 and with paternal disomy. (Waziri et al, 1983, J. of Pediatrics , Vol. 102, pp. 873-876; Henry et al, 1991, Nature, Vol. 351, pp. 665-7). The BWS phenotype includes macroglossia (enlarged tongue), exomphalos

(umbilical abnormalities), gigantism, hypoglycemia, visceromegaly, adrenocortical cytomegaly and dysplasia of the renal medulla. Patients are also at increased risk of developing tumors such as adrenal carcinoma,

nephroblastoma, hepatoblastoma, and rhabdomyosarcoma.

Other disorders associated with uniparental disomy include maternal isodisomy 7, which has been shown to be associated with cystic fibrosis, shortness of stature, and possibly developmental delay, and maternal and paternal heterodisomy 14, which appear to have caused complex, unclassified malformation syndromes (Spence et al, 1988, Am . J. Hum . Genet . , Vol 42, pp. 217-226).

In the past, the physical mapping and ordering of probes in the chromosomal regions associated with these syndromes has been performed using restriction fragment linked polymorphism (RFLP) analysis and quantitative

Southern blot analysis. A RFLP is a polymorphic difference in DNA sequence between individuals that can be recognized by restriction endonucleases. Although DNA markers within these chromosomal regions have been available for several years, detailed molecular characterization of the regions has been difficult due to the relatively low polymorphic content for most markers. The majority of probes to these markers detect conventional RFLPs with polymorphism information content of less than 40% (PIC # 0.40). Because of this, a great deal of the deletion mapping on these regions has been based on quantitative Southern blot analysis. However, even with careful controls and repeated experiments, dosage analysis is subject to some degree of error.

Conventional cytogenetic analysis has also been used to study banding patterns in metaphase chromosomes.

However, there are submicroscopic abnormalities associated with these genetic disorders which render cytogenetics insufficient for obtaining an accurate diagnosis.

The ability to isolate YAC clones in these regions provides better probes for ordering markers by in situ hybridization interphase analysis, and especially by fluorescence in situ hybridization (FISH). It also provides material to isolate more highly polymorphic markers such as variable number tandem repeats (VNTRs), short tandem repeats (STRs) such as di-, tri-, and

tetranucleotide repeats, and polymorphisms associated with the 3' end of the Alu and LINE (long interspersed sequence) repeat families (Dryja et al, 1989, Nature, Vol. 339, pp. 556-558; Orita et al, 1990, Genomics, Vol. 5, pp. 874-879; Sinnett et al, 1990, Genomics, Vol. 7, pp. 331-334).

FISH analysis has previously been shown to be more sensitive than high-resolution cytogenetic analysis for the detection of microdeletions and cryptic translocation events (Altherr et al, 1991, Am. J. Hum . Genet . , Vol. 49, pp. 1235-1242; Kuwano et al, 1991, Am. J. Hum . Genet . , Vol. 49, pp. 707-714; Ledbetter et al, 1992, Am . J. Hum . Genet . , Vol. 50, pp. 182-189). For the Miller-Dieker syndrome and isolated lissencephaly sequence, FISH analysis may be used as the standard diagnostic test, and may completely

eliminate the use of high-resolution cytogenetics. FISH is less time-consuming and requires less cytogenetics

expertise than does high-resolution G-banding.

Polymorphic sequences such as VNTRs, STRs and Alu/LINE repeats are associated with these critical chromosomal regions, and have been found to be highly polymorphic among individuals. VNTRs are highly polymorphic but tend to be clustered in telomeres, and therefore are not as highly interspersed as the other STRs. Human trimeric and

tetrameric STRs are present every 300-500 kb in human genomic DNA, while dinucleotide repeats such as CA repeats are found throughout the genome approximately every 100 kb. CA repeats have a heterozygosity of approximately 80%. The function of these tandemly repeated blocks is unknown, but it has been proposed that they may serve as hot spots for recombination. (Weber and May, 1989, Am. J. Hum . Genet . , Vol. 44, pp. 388-396).

Because these repeats vary in length among

individuals, they represent genetic markers for determining heredity. YACs, cosmids, phage clones or any other cloned DNA that has been identified as being within the critical chromosomal region can be screened for such repeats. The critical chromosomal region for the

Prader-Willi/Angelman Syndrome has been studied in the past.

It is now clear that approximately 70% of PWS patients have cytogenetic or molecular deletions of chromosome 15, while the majority of the non-deletion cases show maternal uniparental disomy (Hamabe et al, 1991, Am . J. Med. Genet . , Vol. 41, pp. 54-63; Robinson et al, 1991, Am. J. Hum .

Genet . , Vol. 49, pp. 1219-1234; Nicholls et al, 1989, Nature, Vol. 16, pp. 281-285; Mascara et al, 1992, New Engl . J. Med. , Vol. 326, pp. 1599-1607). For Angelman Syndrome, a similar percentage show deletion, a small number of patients show paternal disomy, and a significant minority of patients show neither deletion or uniparental disomy Knoll et al, 1989, Am. J. Med. Genet . , Vol. 32, pp. 285-290; Hamabe et al, 1991, Am . J. Med. Genet . , Vol. 41, pp. 64-68; Malcolm et al, 1991, Lancet , Vol. 337, pp.

694-697; Nicholls et al, 1992, Annals Neur. , In Press). Standard diagnostic detection of deletions has involved high-resolution G-banding analysis, with a small number of research centers using molecular techniques for

confirmation or clarification of cytogenetic results, for determination of parental origin, or to identify

submicroscopic deletions. Since G-banded chromosome analysis is not always optimal in quality, interpretation is frequently ambiguous and occasionally incorrect.

Of the original 5 markers described in the PWS critical region, IR10-1 was placed distal to TD189-1, IR4-3R,

TD3-21, and ML34 based on an unbalanced Y;15 translocation patient deleted for the latter 4 markers but not for IR10-1 (Nicholls et al, 1989, Am. J. Med. Genet . , Vol. 33, pp. 66-77; Tantravahi et al, 1989, Am . J. Med. Genet . , Vol. 33, pp. 78-87). Subsequently, Knoll et al . (1990, Am. J. Hum . Genet . , Vol. 47, pp. 149-155) placed IR39 proximal to these five markers based on two classes of molecular deletions in patients with Angelman Syndrome, in which IR39 was included or excluded from the deletion. Together, these data

provided a tentative map of the deletion region as follows: cen- - IR39 - - (TD3 -21 , ML34 , TD189-1 , IR4-3R) - - IR10-1 , in which the four markers deleted in all patients could not be ordered. Independent studies have mapped PW71 (Buiting et al, 1990, Genomics , Vol. 6, pp. 521-527) and GABRB3

(Wagstaff et al, 1991, Am. J. Hum . Genet . , Vol. 49, pp. 330-337) to the common deletion interval.

A PWS patient with an unbalanced 9; 15 translocation was found to be deleted for ML34, TD189-1, and IR4-3R, but not for GABRB3 and IR10-1 (Wagstaff et al, 1991, Am . J.

Hum. Genet . , Vol. 49, pp. 330-337). This result confirms that the PWS critical region is proximal to the Angelman Syndrome critical region, confirms the distal location of IR10-1, and also places GABRB3 distal to the other three probes. The familial case of Angelman Syndrome with submicroscopic deletion of TD3-21 and GABRB3 only (Hamabe et al, 1991, Am. J. Med. Genet . , Vol. 41, pp. 64-68; Saitoh et al, 1992, Lancet , Vol. 339, pp. 366-367) indicates these two markers are adjacent. A single PWS patient reported by Robinson et al (1991, Am. J. Hum . Genet . , Vol. 49, pp.

1219-1234) was found to be deleted for TD3-21, IR10-1, and CMW-1, but not for TD189-1, ML34, or IR4-3R. This suggests a location between TD189-1 and TD3-21 for PWS loci. If this were confirmed, it would significantly narrow the critical region for PWS. Summarizing these data provides the order cen-IR39 - - (ML34, IR4-3R, TD189-1) - - (GABRB3 , TD3-2D--IR10-1--CMW-1.

Other investigators have commented on the variation observed in deletions among PWS and Angelman Syndrome patients as to which DNA markers are included.

Particularly, the proximal marker IR39 is deleted in a small number of patients (Knoll et al, 1990, Am. J. Hum.

Genet . , Vol. 47, pp. 149-155) and the distal marker IR10-1 is deleted in most, but not all patients (Hamabe et al, 1991, Am. J. Med. Genet . , Vol. 41, pp. 54-63; Hamabe et al, 1991, Am . J. Med. Genet . , Vol. 41, pp. 64-68; Tantravahi et al, 1989, Am . J. Med. Genet . , Vol. 33, pp. 78-87; Wagstaff et al, 1991, Am . J. Hum. Genet . , Vol. 49, pp. 330-337). The majority of PWS and Angelman Syndrome patients are deleted for a common set of markers including ML34, IR4-3R, TD189-1, and TD3-21. Hence, the majority of patients show a relatively homogeneous deletion.

The consistency of breakpoints among PWS and Angelman Syndrome patients makes refinement of the critical regions for the two disorders difficult. Only a very small number of patients have been identified who show deletions for a subset of markers, and it is these rare patients who contribute to refinement of the critical region. Perhaps the most important of these is the familial case of

Angelman Syndrome first reported by Hamabe et al (1991, Am . J. Med. Genet . , Vol. 41, pp. 64-68). A submicroscopic deletion is inherited in this family such that transmission through females produces Angelman Syndrome, but

transmission through males produces no abnormal phenotype. This submicroscopic deletion therefore defines the Angelman Syndrome critical region, and absence of the PWS phenotype when inherited from males excludes PWS loci from this interval.

It is evident that due to the relatively low

polymorphic content for most DNA markers in these regions, and due to the submicroscopic abnormalities in the critical chromosomal regions which are associated with genetic disorders, prior art methods of detecting chromosome structural abnormalities or uniparental disomy of the critical chromosomal region have not produced results which reliably diagnose the associated genetic disorders. SUMMARY OF THE INVENTION

In view of the difficulties encountered with prior art methods of analyzing and molecularly characterizing critical chromosomal regions, it should be apparent that there exists a need in the art for a method which can reliably identify a genetic disorder which is associated with either a chromosome structural abnormality, such as a translocation, inversion, deletion or duplication or with uniparental disomy of a critical chromosomal region, and which is able to identify the particular mechanism which causes the disorder.

The present invention has advantages over prior art methods of diagnosing syndromes associated with a

chromosome structural abnormality or uniparental disomy including providing clear-cut positive/negative results, and detection of the genetic abnormality and parental descent with a far greater accuracy.

Accordingly, a major object of the present invention is to provide an alternative method to RFLP analysis and Southern blotting for detecting a chromosome structural abnormality or uniparental disomy, which utilizes in situ hybridization on metaphase chromosomes or interphase nuclei.

Another object of the invention is to provide a method for diagnosis of a genetic disorder associated with a chromosome structural abnormality or with uniparental disomy of a critical chromosomal region, which further includes comparing a DNA sequence within a critical chromosomal region to the corresponding DNA sequence of both parents.

Another object of the invention is to provide a method for determining the parental origin of a genetic disorder associated with a chromosome structural abnormality or with uniparental disomy of the critical chromosomal region, and a method for determining the genotype of a patient, which involves comparing a DNA sequence within a critical chromosomal region to the corresponding DNA sequence of both parents.

A still further object of the invention is to provide probes for the diagnosis of Prader-Willi/Angelman Syndrome.

Other objects of the invention are to provide a kit for the in situ diagnosis and a kit for determining the parental origin of a genetic disorder associated with a chromosome structural abnormality or uniparental disomy of a critical chromosomal region.

In a first aspect, the present invention relates to a method for the diagnosis of a genetic disorder associated with a chromosome structural abnormality or with

uniparental disomy of a critical chromosomal region, which includes (a) performing in situ hybridization in cells of a sample obtained from a patient, using probes which are separately detectable and which represent DNA markers in the critical chromosomal region; (b) comparing a pattern of separately detectable markers obtained in step (a) to a predetermined pattern of separately detectable markers obtained from performing in situ hybridization on cells not exhibiting the genetic disorder; and (c) detecting a chromosome structural abnormality in the critical

chromosomal region of cells in the sample.

In a second aspect, the present invention relates to a method for the diagnosis of a genetic disorder which further includes the steps of (d) comparing a DNA sequence in cells of a sample obtained from a patient, of a

chromosomal region containing a tandemly repeated sequence polymorphism to the chromosomal region containing a

tandemly repeated sequence polymorphism in both parents; and (e) determining whether the sequence of the patient matches a maternal or paternal sequence.

In a third aspect, the present invention relates to a method for determining the parental origin of a genetic disorder associated with a chromosome structural

abnormality or with uniparental disomy of a critical chromosomal region, and a method for determining the genotype of a patient, which involves (a) comparing a DNA sequence of a chromosomal region in cells of the sample obtained from the patient, containing a tandemly repeated sequence polymorphism, to the chromosomal region containing a tandemly repeated sequence polymorphism in both parents; and (b) determining whether the sequence of the patient matches a maternal or paternal sequence.

In a fourth aspect, the present invention relates to probes for the diagnosis of Prader-Willi/Angelman Syndrome, represented by multiple probes spanning the critical chromosomal region, sufficient to determine whether a chromosomal abnormality is present.

In a fifth aspect, the present invention relates to probes for the diagnosis of Prader-Willi/Angelman

syndromes, which are located in the IR4-3R and GABRB3 regions of chromosome 15.

In a sixth aspect, the present invention relates to a kit for the in situ diagnosis of a genetic disorder

including multiple probes spanning the critical chromosomal region, sufficient to determine whether a chromosomal abnormality is present.

In a seventh aspect, the present invention relates to a kit for determining the parental origin of a genetic disorder associated with a chromosome structural

abnormality or uniparental disomy of a critical chromosomal region, including at least one probe in the critical chromosomal region which is sufficient to detect a tandemly repeated polymorphic sequences.

The present invention provides a remarkable

consistency of observation of deletion size and breakpoint location with a small number of patients. It will now be possible to further refine the location of the breakpoints within clones obtained from the critical chromosomal region, and to molecularly clone and characterize the breakpoints of unrelated patients to determine whether the DNA sequence around the breakpoints provides clues to the mechanism of deletion. Since deletions such as the chromosome 15 deletion in PWS and Angelman Syndrome are some of the most frequent human deletions, it would not be surprising to find that these breakpoints represent hotspots for chromosome breakage.

With the foregoing and other objects, advantages and features of the invention that will become hereinafter apparent, the nature of the invention may be more clearly understood by reference to the following detailed

description of the preferred embodiments of the invention and to the appended claims.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is an Alu-PCR dot-blot hybridization against a reference panel of YACs located in the PWS/Angelman

Syndrome critical region.

Figure 2 is an interphase ordering of DNA markers with three color FISH.

Figure 3 is a patient deletion analysis by FISH.

Figure 4 is a summary map of the PWS/Angelman Syndrome critical region incorporating YAC contig information, interphase ordering experiments, and patient deletion analysis.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

OF THE INVENTION One may begin the analysis of a critical chromosomal region associated with a genetic disorder by obtaining or generating a DNA library which includes clones containing sequences in that region. Critical chromosomal region as used herein relates to a chromosomal region which is responsible for the phenotype of the individual.

Libraries useful for screening regions associated with the genetic disorder include any genomic library obtained from a normal individual, which library contains fragments from the critical region. Especially useful libraries are those which utilize a vector in which large DNA fragments from the critical chromosomal region can be inserted.

Examples of appropriate vectors are YACs and cosmids. The library may be generated by any method known in the art. Such libraries may be commercially available or available from particular research institutions.

Probes suitable for use in identifying clones in the critical chromosomal region may be in the range of 18 to 1 × 10⁶ nucleotides long, more preferably 30 to 2 × 10⁵ nucleotides long, and even more preferably 1000 to 4 × 10⁴ nucleotides long. Probes to screen libraries containing DNA sequences from the critical chromosomal region can be obtained using any method known in the art, and may be DNA or RNA. One method utilizes chromosomal microdissection of the critical chromosomal region, followed by digestion with an appropriate restriction enzyme, and ligation of the resulting fragments into a vector which has been appropriately digested. Probes may also be generated by direct oligonucleotide synthesis, for example using an Applied Biosystems (Foster City, CA) DNA Synthesizer (model 380b), by PCR amplification of microdissection clones, and from commercially available sources such as the American Type Culture Collection (ATCC). Microdissection as used herein refers to the microscopic dissection of a region of a chromosome. Probes may be isolated by comparison of Alu-PCR patterns in somatic cell hybrids containing as their only human chromosome the chromosome containing the critical region, to Alu-PCR products of a second hybrid cell containing the same human chromosome which has been deleted in the critical region. Alu region as used herein, means a set of dispersed, related sequences, each

approximately 300 bp long, found in the human genome, and having Alu cleavage sites at each end.

Probes may be directly labelled with any detectable label known in the art, including radioactive nuclides such as ³²p, ³H and ³⁵S, fluorescent markers such as fluorescein, Texas Red, AMCA blue, lucifer yellow, rhodamine, and the like, or with any cyanin dye which is detectable with visible light. The probe may be labelled using methods such as PCR, random priming, end labelling, nick

translation or the like. Probes may also be directly labelled by incorporating nucleotides with an activated linker arm attached, to which a fluorescent marker may be added. Alternatively, probes may also be indirectly labelled, by incorporating a nucleotide covalently linked to a hapten or other molecule such as biotin or

digoxygenin, and performing a sandwich hybridization with a labelled antibody directed to that hapten or other

molecule, or in the case of biotin, with avidin conjugated to a detectable label. Antibodies may be conjugated with a fluorescent marker, or with an enzymatic marker such as alkaline phosphatase or horseradish peroxidase to render them detectable.

Sequence tagged sites (STSs) for PCR screening of the libraries can be developed using DNA from appropriate probes which have been isolated and sequenced by standard methods. A preferred method of sequencing is by dideoxy sequencing, preferably using the Sequenase® version 2.0 kit (United States Biochemical Corporation, Cleveland, OH). STS as used herein, is a Human Genome Project-related concept which relates to the systematic development of PCR primers to various human genomic regions, designed to facilitate information exchange and dissemination. STS is not to be confused with STR (short tandem repeats).

Libraries may be screened using any method known in the art. One preferable method of screening YAC libraries is by PCR, using a procedure such as that of Green and Olson ( Proc. Natl . Acad. Sci . , Vol. 87, pp. 1213-1217) followed by a final positive colony identification using a PCR based matrix pooling strategy such as that employed by Kwiatkowski et al (1991, Nucl . Acids . Res . , Vol. 18, pp. 7191-7192). Another preferable method is screening by hybridization on conventional Southern blots. Transformed cells can be stamped onto a nitrocellulose or nylon membrane, transferred to an agar plate and then pooled. DNA can then be isolated from these pooled cells, then digested using a restriction enzyme, and run on an

acrylamide or preferably an agarose gel and blotted.

Alternatively, cells on the membrane may be grown, lysed and treated by methods known in the art so that

hybridization with the probe can be conducted. DNA from positive cells containing the vector with large chromosomal inserts can then be analyzed using pulsed-field gel electrophoresis.

To test YAC clones for chimerism, one may use any method known in the art. Chimerism as used herein refers to a clone containing a non-contiguous sequence of DNA. Preferably, positive clones can be tested for chimerism by performing in situ hybridization on human metaphase chromosomes, or by hybridization of PCR products produced from the clone to a PCR dot blot panel of single chromosome hybrids. PCR products can be generated using any probes known to flank a particular region of the critical

chromosomal region. Primers may be designed to bind to Alu regions in and around the critical chromosomal region, and the products of such PCR reactions are termed Alu-PCR products. These PCR products can be labelled by any method, and used as probes against all other clones obtained to determine overlap. In situ analysis is preferably done using fluorescence. Overlaps among the clones may also be analyzed using a dot blot hybridization strategy.

in situ hybridization analysis can then be conducted using the clones which are determined to be positive for DNA from the critical chromosomal region. Cell samples to be used for diagnosis by the present invention can be obtained from individuals with the clinical diagnosis of a disorder involving a chromosome structural abnormality or uniparental disomy. These patients may have normal karyotypes by high resolution chromosome analysis, or may have visible structural abnormalities in the critical chromosomal region. If it is determined that the patient has a chromosome structural abnormality, the patient's parents will be studied to rule out an inherited

chromosomal abnormality.

Fetal cells may also be used for the prenatal diagnosis of the genetic disorder, in which case no clinical diagnosis would have been made. These cells can be obtained through amniocentesis, chorionic villus sampling, or from the maternal circulation.

Any somatic cell type may be used. In particular, cells derived from blood samples are particularly useful for the present invention. For in situ hybridization analysis, the cells are placed on a solid support suitable for examination under microscopy, such as a slide or coverslip, and treated by methods well known in the art to permeablize the cells so that detectable probe can enter the cells and bind to the chromosomal region. Any method known in the art of rendering a probe detectable may be used.

The probe may be labelled with a detectable marker by any method known in the art. Preferred methods for labelling probes are by random priming, end labelling, PCR and nick translation, but nick translation is preferable. For nick translation, probes may be treated with a

restriction enzyme to reduce the size of the DNA, treated with DNase I, and labelled. Labelling is conducted in the presence of DNA polymerase, three unlabelled nucleotides, and a fourth nucleotide which is either directly labelled, contains a linker arm for attaching a label, or is attached to a hapten or other molecule to which a labelled binding molecule may bind. Suitable direct labels include

radioactive nuclides such as ³²p, ³H and ³⁵S, fluorescent markers such as fluorescein, Texas Red, AMCA blue, lucifer yellow, rhodamine, and the like, or cyanin dyes which are detectable with visible light. Fluorescent markers may alternatively be attached to nucleotides with activated linker arms which have been incorporated into the probe. Probes may also be indirectly labelled, by incorporating a nucleotide covalently linked to a hapten or other molecule such as biotin or digoxygenin, and performing a sandwich hybridization with a labelled antibody directed to that hapten or other molecule, or in the case of biotin, with avidin conjugated to a detectable label. Antibodies and avidin may be conjugated with a fluorescent marker, or with an enzymatic marker such as alkaline phosphatase or horseradish peroxidase to render them detectable.

Conjugated avidin and antibodies are commercially available from companies such as Vector Laboratories (Burlingame, CA) and Boehringer Mannheim (Indianapolis, IN).

The enzyme can be detected through a colorimetric reaction by providing a substrate and/or a catalyst for the enzyme. In the presence of various catalysts, different colors are produced by the reaction, and these colors can be visualized to separately detect multiple probes. Any substrate and catalyst known in the art may be used.

Preferred catalysts for alkaline phosphatase include

5-bromo-4-chloro-3-indolylphosphate (BCIP), nitro blue tetrazolium (NBT) and diaminobenzoate (DAB). Preferred catalysts for horseradish peroxidase include

orthophenylenediamine (OPD) and

2,2'-azinobis(3-ethylbenz-thiazolinesulfonic acid) (ABTS).

Probes suitable for use in in situ hybridization may be in the range of 18 to 1 × 10⁶ nucleotides long, more preferably 30 to 2 × 10⁵ nucleotides long, and even more preferably 1000 to 8 × 10⁴ nucleotides long. Probes may be DNA or RNA. Probes may also be generated by direct

oligonucleotide synthesis, for example using an Applied Biosystems (Foster City, CA) DNA Synthesizer (model 380b), by PCR amplification of microdissection clones, and from commercially available sources such as the American Type Culture Collection (ATCC). Probes may be isolated by comparison of Alu-PCR patterns in somatic cell hybrids containing as their only human chromosome the chromosome containing the critical region, to Alu-PCR products of a second hybrid cell containing the same human chromosome which has been deleted in the critical region.

Multiple probes spanning the critical chromosomal region may be used. These multiple probes may be

overlapping, or may be positioned with the 3' end of a first probe directly adjacent to the 5' end of a second probe. Alternatively, these probes may not span the entire critical chromosomal region, but may span a sufficient sequence to detect whether a chromosomal abnormality is present.

Hybridization of the detectable probes to the cells is conducted with a probe concentration of 0.1-500 ng/μl, preferably 5-250 ng/μl, and most preferably 10-120 ng/μl. The probe concentration is greater for a larger clone.

The hybridization mixture will preferably contain a

denaturing agent such as formamide, and non-specific human DNA, preferably derived from the placenta, which is used to block repeat sequences. The non-specific DNA is added at a concentration of 100 ng/μl - 2 μg/μl, more preferably 0.2-1 μg/μl, and most preferably 0.25-0.5 μg/μl to compete out any repetitive portions of the probe. Hybridization may be done in the presence of probes which are specific for particular regions of specific chromosomes, preferably for that chromosome which contains the critical chromosomal region for the genetic disorder to be detected. Such probes include those directed to genes known to be found on a specific chromosome, or probes directed to satellite DNA which is specific for a given chromosome. Hybridization is carried out at 25-45°C, more preferably at 32-40°C, and most preferably at 37-38°C. The time required for hybridization is about 0.25-96 hours, more preferably 1-72 hours, and most preferably for 4-24 hours. Hybridization time will be varied based on probe concentration and hybridization solution content which may contain accelerators such as hnRNP binding protein, trialkyl ammonium salts, lactams and the like. Slides are then washed with solutions containing a denaturing agent, such as formamide, and decreasing concentrations of sodium chloride or in any solution that removes unbound and mismatched probe.

The temperature and concentration of salt will vary depending on the stringency of hybridization which is desired. For example, high stringency washes may be carried out at 42-68°C, while intermediate stringency may be in the range of 37-55°C, and low stringency may be in the range of 30-37°C. Salt concentration for a high stringency wash may be 0.5-1X SSC (3M NaCl, 0.3M Na citrate), while medium stringency may be 1X-4X, and low stringency may be 2X-6X SSC.

The detection incubation steps, if required, should preferably be carried out in a moist chamber at 23-42°C, more preferably at 25-38°C and most preferably at 37-38°C. Labelled reagents should preferably be diluted in a solution containing a blocking reagent such as bovine serum albumin, non-fat dry milk or the like. Dilutions may range from 1:10-1:10,000, more preferably 1:50-1:5000, and most preferably at 1:100-1:1000. The slides or other solid support should be washed between each incubation step to remove excess reagent.

Slides may then be mounted and analyzed by microscopy in the case of a visible detectable marker, or by exposure to autoradiographic film in the case of a radioactive marker. In the case of a fluorescent marker, slides are preferably mounted in a solution which contains an antifade reagent, and analyzed using a fluorescence microscope.

Multiple nuclei may be examined for increased accuracy of diagnosis.

Screening for tandemly repeated sequence polymorphisms can be done by any method known in the art, but it is preferably conducted using PCR. Nucleotide repeat

sequences include variable number tandem repeats, short nucleotide repeats including tri- and tetrameric repeats (Edwards et al, 1991, Am . J. Human Genetics, Vol. 49, pp. 746-756) and dinucleotide repeats. Common dinucleotide repeats include CA repeats which are preferable for use in the practice of the present invention. Clones containing the critical chromosome region can be screened for CA repeats by any method known in the art, including cloning into an M13 vector and directly sequencing, or by using a combination of Alu and CA or GT primers by the method of Feener et al (1991, Am J. Hum. Genet . , Vol. 48, pp.

621-627). Primers are preferably 12-50 nucleotides long, more preferably 20-40 nucleotides long, and most preferably 20-30 nucleotides long. Multiplexing is a preferred method of carrying out multiple PCR reactions at the same time in a single tube.

PCR products generated using these primers can be cloned into an appropriate sequencing vector such as pBS (Bluescribe) or pBluescript (Stratagene, La Jolla, CA) and sequenced using dideoxy sequencing. Confirmation that the tandemly repeated sequence polymorphism is found on the chromosome of interest may be done using PCR on somatic cell hybrids. Screening for VNTRs may be done by

hybridizing a total human library using consensus sequences such as those disclosed by Nakamura et al (1987, Science, Vol. 235, pp. 1616-1622), and identifying clones positive for the consensus sequence which also map to the critical chromosomal region.

Sequences flanking a dinucleotide repeat region may be used as PCR primers to generate PCR products which are labelled with ³²P, and which contain the entire

dinucleotide repeat. The polymorphism in the dinucleotide repeat can be determined by running the products on a polyacrylamide gel to resolve alleles. By comparing the length of the dinucleotide repeat among individuals, most preferably between parents and offspring, one may determine whether the critical chromosomal region was derived from one or both parents. Alternatively, in the case of VNTRs, a restriction digest of genomic DNA may be run on a gel, Southern blotted and hybridized with a VNTR probe to determine its size. The following examples are presented in order to more fully illustrate the preferred embodiments of the invention. They should in no way be construed, however, as limiting the broad scope of the invention. EXAMPLE 1

Patients and cell lines

Peripheral blood samples were obtained from 8 patients with the clinical diagnosis of PWS and 3 patients with the diagnosis of Angelman Syndrome. Of the 8 PWS patients, four had visible deletions of 15q11-q13 and four had normal karyotypes by previous high resolution chromosome analysis performed in our clinical diagnostic laboratory. Of the 3 Angelman Syndrome patients, two had typical deletions and one had a normal karyotype. This patient sample was significantly biased by the inclusion of a high percentage of patients with apparently normal karyotypes. These patients were specifically recruited for molecular investigation under the assumption that they would most likely represent cases of uniparental disomy and that the FISH analysis would be normal.

Lymphoblast cell lines from two individuals of the Angelman Syndrome family reported by Hamabe et al. (1991, Am. J. Med. Genet . , Vol. 41, pp. 64-68) were studied, including the oldest affected brother and his

phenotypically normal grandfather. RFLP studies of this family previously revealed a deletion involving probes TD3-21 and the GABA_A B₃ subunit gene (GABRB3) but not other

DNA probes, including IR39, ML34, IR4-3R, and IR10-1

(Hamabe et al, 1991, Am. J. Med. Genet . , Vol. 41, pp.

64-68; Saitoh et al, 1991, Lancet, Vol, 339, pp. 366-367).

A lymphoblastoid cell line from a patient with

Angelman Syndrome associated with a

45,XY,-13,-15,+der(13)t(13;15)(p13;q13) karyotype (Wagstaff et al, 1991, Am . J. Hum. Genet . , Vol. 49, pp. 330-337;

Greenberg and Ledbetter, Am. J. Med. Genet . Vol. 28, pp. 813-820) was used for interphase mapping experiments. This patient was known to be deleted for most markers in this region, thus simplifying the interphase analysis as only one signal per nucleus would be present for each probe.

EXAMPLE 2

DNA probes and STSs

The following probes from the PWS/Angelman Syndrome region were used to screen YAC libraries: pIR39 (D15S18), pML34 (D15S9), pIR4-3R (D15S11), pTD189-1 (D15S13), pTD3-21 (D15S10), pIR10-1 (D1SS12) (Nicholls et al, 1989, Am. J. Med. Genet . , Vol. 33, pp. 66-77; Donlon et al, 1986, Proc . Natl . Acad . Sci . USA, Vol. 83, pp. 4408-4412; Knoll et al, 1990, Am. J. Hum . Genet . , Vol. 47, pp. 149-155), GABRB3 (Wagstaff et al, 1991, Am. J. Hum. Genet . , Vol. 49, pp. 330-337), pCMW-1 (Dl5S24) (Rich et al, 1988, Nucleic Acids Res . , Vol. 16, pp. 8740), and PW71 (Dl5S36) (Buiting et al, 1990, Genomics , Vol. 6, pp. 521-527). In addition, a new probe in this region, pLS6-l (D15S113) was isolated by comparison of Alu-PCR patterns in somatic cell hybrids as described by Ledbetter and Nelson (1991, In McPherson et al, eds., PCR : A Practical Approach, IRL Press, Oxford, pp. 107-119). Briefly, the Alu-517 PCR products of 15A

(GM11418), a hybrid containing chromosome 15 as its only human chromosome, were compared with the Alu-517 PCR products of a second hybrid, LS-6 (GM11250) containing a deleted chromosome 15 from a PWS patient with an unbalanced 15;17 translocation. A 1 kb PCR product was identified in 15A that was not present in LS-6. This fragment was subcloned into pBluescript (Stratagene, La Jolla, CA) and was confirmed to be in the PWS region by hybridization to a somatic cell hybrid panel.

DNA from probes pIR39, pIR4-3R, pTD189-1, pTD3-21 and PW71 was isolated by standard methods and sequenced to develop STSs for PCR screening of the libraries. The STS for pML34 was kindly provided by Dr. M. Lalande. Dideoxy sequencing was performed using the Sequenase® version 2.0 kit (United States Biochemical Corporation, Cleveland, OH). Oligonucleotide primers were synthesized on an Applied Biosystems (Foster City, CA) DNA synthesizer (model 380B). DNA from GABRB3 , pIR10-1, PCMW-1, and pLS6-1 was labeled with ³²p by the random primer method and used as probes for hybridization screening of the YAC libraries.

EXAMPLE 3

YAC library screening

Total human YAC libraries were obtained from Dr.

Maynard Olson (Burke et al, 1967, Science, Vol. 236, pp. 806-812) and from the Centre d' Etude du Polymorphism (CEPH) (Albertsen et al, 1990, Proc. Natl . Acad. Sci . USA , Vol. 87, pp. 4256-4260), hereafter referred to as the St.

Louis and CEPH libraries, respectively. The libraries were screened by one of two methods. PCR screening was

performed as described by Green and Olson (Green and Olson, 1990, Proc . Natl . Acad. Sci . USA, Vol. 87, pp. 1213-1217) with the final positive colony identification for most YACs performed by a PCR based matrix pooling strategy

(Kwiatkowski et al, 1990, Nucl . Acids . Res . , Vol. 18, pp.7191-7192).

Alternatively, screening by hybridization was

performed against pools of 384 yeast colonies on

conventional Southern blots. To prepare the filters used for hybridization screening, cells from four 96-well plates were stamped onto a nylon membrane, grown for 3 days at 30°C on a selective agar plate and then scraped into pools. DNA was isolated from each pool by a modification of the method of Green and Olson (1990, Proc. Natl . Acad. Sci . USA, Vol. 87, pp. 1213-1217) and about 5 μg of each pool was digested with EcoRI. The DNA was run on a 0.7% TBE gel to approximately 4 cm and transferred by standard methods. (Schwartz and Cantor, 1984, Cell , Vol. 37, pp. 67-75).

Each filter contained DNA digests from 30 YAC pools and a genomic DNA control. Each library was contained on 5 filters. To identify the final positive colony, the four 96 well plates that corresponded to the positive pool were stamped onto a nylon membrane (Oncor Sureblot,

Gaithersburg, MD) and grown for 3 days as before. The filters were then transferred to filter paper saturated with 150 U/ml lyticase (ICN 152270, Cleveland, OH) in 1 M sorbitol, 0.1 M sodium citrate, 0.05 M EDTA, 0.015 N dithiothreitol and incubated at 37°C overnight (Brownstein et al, 1989, Science, Vol. 224, pp. 1348-1351). After pretreatment with 5% SDS/2X SSC for 5 minutes, the filters were transferred to a microwave oven and subjected to maximum power on a rotating turntable for 5 min to lyse the cells and denature the DNA (Forster et al, 1990, Trends Genet . Vol. 6, p. 141). The filters were then transferred to dry blotting paper, baked for 1-2 hours at 80°C to fix the DNA to the membrane and then washed in 0.1X SSC/0.1% SDS at 65°C for 30 minutes to remove cell debris and excess SDS . Hybridization and washes were carried out as

previously described (Ledbetter et al, 1990, Genomics , Vol. 7, pp. 264-269). High molecular weight YAC DNA for size determination by pulsed-field gel electrophoresis (PFGE) was isolated in agarose plugs (Schwartz and Cantor, 1984, Cell , Vol. 37, pp. 67-75; van Ommen and Verkerk, 1986, In Davis, K.E., ed., Human Genetic Diseases - A Practical Approach, IRL Press, Oxford, pp. 113-117). PFGE was

performed using the LKB Pulsaphor as previously described (Ledbetter et al, 1990, Genomics , Vol. 7, pp. 264-269).

EXAMPLE 4

Isolation of cosmid clones

Cosmid clones 27F10, 171F12, and 162B3 were isolated for IR4-3R by screening an arrayed total human cosmid library with a ³²p labelled plasmid containing IR4-3R.

These cosmids were each approximately 25 kb.

Cosmid clones B25E9-2F, B25E9-5A and B25E9-5B for the

GABRB3 locus were generated by subcloning YAC B25E9 into sCosI (Stratagene, La Jolla, CA) and identifying

overlapping clones which gave a strong signal on in situ hybridization to normal chromosome 15s. These cosmids were each approximately 30 kb. EXAMPLE 5

YAC characterization

For detection of chimerism, one of two methods was used. Some YACs were tested for chimerism by FISH to human metaphase chromosomes (see Example 6). Others were tested by hybridization of the Alu-PCR products of the YAC to an Alu-PCR dot blot panel of single chromosome hybrids as described by Ledbetter et al, (1990, Genomics , Vol. 8, pp. 614-622) and Banfi et al (1992, Nucl . Acids Res . , Vol. 20, p. 1814).

Identification of overlaps among YACs was performed by a dot blot hybridization strategy as follows: DNA from each YAC was amplified with Alu primer PDJ34, (SEQ. ID NO. 1): [TGAGC(C/T) (G/A) (A/T) GAT (C/T) (G/A) (C/T) (G/A) CCA (C/T) TGCAC TCCAGCCTGGG] (Breukel et al, 1990, Nucl . Acids Res . , Vol. 18, p. 3097) and with Alu primer 2484, (SEQ. ID NO. 2): [AGGAGTGAGCCACCGCACCCAGCC] which is located at the far 5' end of the Alu sequence. PDJ34 and 2484 were used at final concentrations of 0.1 μM and 0.3 μM, respectively, in a 100 μl reaction containing about 1 μg YAC DNA, 250 μM each of dTTP, dGTP, dCTP and dATP, 10 mM Tris-HCl pH 8.4, 50 g KCl, 1.2 mM MgCl₂ and 2.5 units of Thermus aquaticus polymerase (Perkin Elmer Cetus, Norwalk, CT). Initial denaturation was at 95°C for 4 minutes followed by 35 cycles of

denaturation at 94°C for 1 minute, annealing at 55°C for 2 minutes, extension at 72°C for 2 minutes and a final extension at 72°C for 7 minutes.

The PDJ34 and 2484 primer products of each YAC were combined in one tube (50 μl each), precipitated and then resuspended in 20 μl 10 mM Tris-HCl, 1 mM EDTA. One microliter of this combined product for each YAC was spotted onto a nylon membrane (Oncor Sureblot,

Gaithersburg, MD). Denaturation, hybridization and wash conditions were as previously described (Ledbetter et al, 1990, Genomics, Vol. 8, pp. 614-622). In addition, 2 μl of the precipitated product of each YAC was labeled by the random primer method and used as a probe to test each YAC individually against the dot blot panel containing all YACs.

The end fragments of YACs A156E1 and B58C7 were obtained by Alu-vector PCR (Nelson et al, 1989, Proc . Natl . Acad . Sci . USA, Vol. 88, pp. 6157-6161), subcloned into pBluescript (Stratagene, La Jolla, CA) and sequenced. The end fragments of YACs 254B5 and 256H12 were obtained by inverse PCR after circularization of TagI digested yeast DNA (Silverman et al, 1989, Proc. Natl . Acad. Sci . USA, Vol. 86, pp. 7485-7489).

STSs were developed for 7 of the 10 probes, and the primer sequences and length of the PCR product are shown in Table 1.

Initial screening was performed on the St. Louis library by PCR or hybridization and yielded 1-4 positive YACs for each probe tested, except IR10-1 which showed no positives. The CEPH library became available at a later date, and most probes were also screened using this library. Each probe identified 2 to 10 clones in the CEPH library. Chimerism was tested by either FISH analysis or Alu-dot blot

hybridization to a panel of monochromosomal hybrids as described in methods. For nine of the 10 probes, at least one clone was identified which contained a single YAC that was not chimeric. The exception was PW71, in which a single chimeric YAC of 125 kb was identified. An end-clone from this YAC was used to screen the CEPH library (see below).

In order to determine whether any of these primary

YACs overlapped each other, the Alu-PCR product of each YAC was hybridized to a dot blot that contained the Alu-PCR product of all the YACs (examples in Figure 1). Figure 1 shows the Alu-PCR dot-blot hybridization against a

reference panel of YACs located in the PWS/Angelman

Syndrome critical region.

Each YAC showed positive hybridization to itself and to all primary YACs identified with the same probe. The IR43R YAC A156E1 was labeled and used as a probe which showed strong hybridization to itself and to the other IR4-3R YAC B95C11. In addition, it showed strong

hybridization to the PW71 YAC B58C7, indicating an overlap between these YACS. This is consistent with interphase analysis, which could not order these YACs (see below).

In order to expand the IR4-3R and PW71 contig, the ends of YACs A156E1 and B58C7 were isolated by Alu-vector PCR, and sequenced, and primers were developed to screen the CEPH library. The right end of YAC A156E1 (IR4-3R) identified YAC 495D1, which was 360 kb in size and not chimeric. The right end of the chimeric YAC B58C7 (PW71), which hybridized to chromosome 15, identified 9 new YACs. Of these, clone 326F6 was found to be 370 kb in size and not chimeric, and was used for further studies. These two new YACS, 495D1 and 326F6, were tested for overlaps with the YACs identified in the first screen of the libraries by Alu-dot blot hybridization as described above.

YAC 326F6 hybridized to itself, the PW71 clone B58C7, and the other 8 new YACs, including 225D1, 309G7, 417F3, 457B4, and 471H7, identified in the walk as expected. It also showed strong hybridization to the TD189-1 clones 307A12, 163D9 and B25E8 (Figure 1b). This probe shows faint cross-hybridization to several other YACs (TD3-21 YAC B230E3 and GABRB3 YAC B25E9).

YAC 495D1, identified with a walk clone from the right end of A156E1, hybridized to itself and to the IR4-3R clones A156E1 and B95E11 as expected. It also hybridized strongly to the ML34 YACs 264A1, 318A6 and 225B4 and weakly to the ML34 YAC 254B5 and the PW71 YAC B58C7 (Figure 1c). This indicates that PW71 and TD189-1 are adjacent markers. YACs for these two markers could not be ordered by

interphase FISH, consistent with this close proximity.

This result was also confirmed by the subsequent

identification of a CEPH YAC with IR4-3R, 172A10,

containing two YACs of 640 and 540 kb (Table 1). The larger of the two YACs was found to be positive for IR4-3R and also for the left ends of the ML34 YACs 254B5 and 256H12 (which are identical clones). These results expand the IR4-3R--PW71 contig to include ML34 and TD189-1, with an order ML34--IR4-3R--PW71--TD189-1. The size of this contig is estimated as 1-1.5 Mb, based on the sum of the sizes of the non-overlapping YACs (254B5, A156E1, and 307A12) within the contig. EXAMPLE 6

FISH methods for chimerism detection and patient

deletion analysis

Chromosome preparations were made from peripheral blood or lymphoblast cultures as described in Kuwano et al (1991, Am . J. Hum. Genet . , Vol. 49, pp. 707-714). Prior to nick translation the YAC DNA was digested with EcoRl

(4U/μg) and Hindlll (4U/μg) to reduce the size of the DNA so that commercially available nick translation kits

(Boehringer Mannheim, Indianapolis, IN) could be used without modification of the DNasel concentration. Each YAC was labeled with either biotin-11-dUTP, digoxigenin-11-dUTP

(Boehringer Mannheim, Indianapolis, IN) or a 1:1 mixture of biotin and digoxigenin-11-dUTP.

Hybridization was performed as described in Kuwano et al (1991, Am. J. Hum. Genet . , Vol. 49, pp. 707-714) using a final probe concentration of 20-120 ng/μl, depending on the size of the YAC. The hybridization solution contained 50% formamide, 10% dextran sulfate, 2x SSC, 0.5 μg/μl salmon sperm DNA and 0.5-1.0 μg/μl human placental DNA to compete out the repetitive portion of the probe. Co-hybridization with 0.5 ng/μl chromosome 15 classical satellite probe (D15Z1, Oncor, Gaithersburg, MD) was performed with most

YACs to allow unambiguous identification of chromosome 15. Hybridization was at 37°C for 24-48 hours, the longer hybridization yielding greater signal intensity for interphase ordering experiments. Following hybridization, slides were washed at 45°C in 50% formamide/2x SSC for 20 minutes, 1X SSC for 10 minutes, and 0.1X SSC for 10 minutes and then immersed in 1X PBD (Oncor, Gaithersburg, MD) for 5 minutes at room temperature.

Detection and amplification of single, biotinylated YACs was performed using the Oncor In Situ kit as described in Kuwano et al (1991, Am. J. Hum . Genet . , Vol. 49, pp. 707-714). Slides were viewed using a Zeiss Axiophot microscope and filter combination 487709 (excitation at 450-490 ran). Photographs were taken with Kodak Ektachrome 400 film.

For chimerism analysis , at least 30 cells were analyzed from normal controls co-hybridizing each YAC with the 15 classical satellite (D15Z1). For patient deletion analysis, a total of 20 metaphase cells were scored for each probe. Positive hybridization was defined as signal being present on both chromatids.

EXAMPLE 7

Multi-color FISH for interphase ordering

Reagents for three color detection were obtained from the following manufacturers: FITC-avidin and biotinylated anti-avidin D from Vector Laboratories (Burlingame, CA); mouse anti-digoxigenin from Sigma (St. Louis, MO);

anti-mouse Ig [F(ab')₂-digoxigenin, anti-digoxigenin

[Fab] -rhodamine and blocking reagent (catalog # 1096176) from Boehringer Mannheim (Indianapolis, IN).

The slides were transferred from the final 0.1X SSC wash to TNT (100 mM Tris-HCl pH 8.0, 150 mM NaCl, 0.05% Tween 20) for 2 minutes. The four detection incubation steps were at 37°C for 30 minutes in a moist chamber, with each reagent diluted in TNB (TNT with 0.5% blocking reagent), as follows: (1) 60 μl FITC-avidin diluted 1:1000; (2) 60 μl mouse anti-digoxigenin diluted 1:500 and

biotinylated anti-avidin D diluted 1:100; (3) 60 μl anti-mouse Ig-digoxigenin diluted 1:250 and FITC-avidin diluted 1:1000; and (4) 60 μl anti-digoxigenin-rhodamine diluted 1:100. After each incubation step, the slides were washed in 3 changes of TNT at room temperature for 5 minutes each. Slides were mounted in antifade solution (Oncor, Gaithersburg, MD) containing 0.5 μg/ml DAPI and 0.05 μg/ml propidium iodide. Analysis was performed with a Zeiss FITC-rhodamine-Texas red dual filter combination (#487923) which allowed the simultaneous visualization of signals from biotin-FITC (green), digoxigenin-rhodamine (red) and the combined biotin: digoxigenin (yellow-orange). Dilute propidium iodide in the antifade solution allowed

visualization of the nucleus without quenching the YAC signal.

Each set of 3 probes was coded and analysis was done in a blinded fashion. For each probe combination, 100 interphase nuclei in which three discrete signals could be identified were scored.

Preliminary experiments were carried out to determine a tentative order for each of the probes. D15Z1 was used as the centromeric anchor and CMW-1, previously mapped outside the PWS/Angelman Syndrome critical region (Robinson et al, 1991, Am . J. Hum . Genet . , Vol. 49, pp. 1219-1234) was used as the telomeric anchor. The probes were combined into groups of three with one probe labeled with

biotin-FITC (green), one with digoxigenin-rhodamine (red) and one with biotin-FITC and digoxigenin-rhodamine

(yellow-orange). 100 nuclei in which three discrete signals were scored.

Each probe combination gave an unambiguous order except for IR4-3R, PW-71 and TD189-1 which could not be reliably distinguished. Since these three probes were inseparable, we chose the IR4-3R YAC as representative of the contig in the subsequent blinded studies.

In the blinded analysis, probes were combined in groups of three based on the preliminary ordering

information. Each combination gave an unambiguous result in terms of which of the three probes was between the other two (Table 2).

Dilute propidium iodide staining delineates the nuclei and allows simultaneous visualization of nucleus and three probes (red, green, and yellow-orange) with a dual band pass filter. For example, in the combination

D15Z1--IR39--ML34, 75/100 nuclei showed IR39 between D15Z1 and ML34. For IR39--ML34--IR4-3R, ML34 was located between IR39 and IR4-3R in 70/100 nuclei (Figure 2a). In Figure 2a, ML34 (264A1) was labeled with biotin-FITC (green), IR4-3R (A156E1) with digoxigenin-rhodamine (red), and IR39 (A124A3) with both (yellow-orange). In 70% of interphase nuclei in which three discrete signals were observed, ML34 (green) was between IR39 and IR4-3R. Combining these two results provides an order of cen--IR39--ML34--IR4-3R.

Additional examples are shown in Figure 2 for

ML34--IR4-3R--LS6-1 (Figure 2b) and for

GABRB3--IR10-1--CMW-1 (Figure 2c). In Figure 2b, LS6-1 (A229A2) was labeled with biotin (green), IR4-3R (A156E1) with digoxigenin (red), and ML34 (264A1) with both

(yellow-orange). In 69% of interphase cells, IR4-3R (red) was located between ML34 and LS6-1. In Figure 2c, IR10-1 (149A2) was labeled with biotin (green), GABRB3 (B25E9) with digoxigenin (red), and CMW-1 (B94H7) with both

(yellow-orange). In 69% of interphase nuclei scored, IR10-1 (green) was located between GABRB3 and CMW-1. The results of all combinations yields an order of

cen--IR39--ML34--IR4-3R--LS6-1--D3-21--GABRB3--IR10-1--CMW- 1. Combining this data with the contig data presented above provides a unique, unambiguous order for all 10 probes of

cen- -IR39 - -ML34- -IR4 -3R- -PW71- -TD189 -1- -LS6-1- -TD3 -21 - -GABR B3--IR10-1--CMW-1.

EXAMPLE 8

FISH analysis was performed with these YAC clones on 8 PWS patients and 3 Angelman Syndrome patients (Table 3).

Although four of the PWS patients and one Angelman Syndrome patient were previously found to have normal karyotypes by high-resolution G-banding analysis, all eleven patients showed deletions by FISH involving multiple YAC clones. YACs for probes IR4-3R, LS6-1, TD3-21, and GABRB3 were deleted in all eleven patients (e.g., Figure 3a).

In Figure 3, the chromosome 15 classical-satellite (D15Z1) probe was co-hybridized with YACs for IR4-3R, LS6-1, and GABRB3 to unambiguously identify both 15 homologs (a, d, e, and f), and appears as a large positive signal in the centromeric region. Patient 36909 is examined in Figure 3a-c. In Figure 3a, GABRB3 YAC B25E9 is positive on one 15 (filled arrowhead) but negative on the other homolog (open arrowhead), indicating a deletion. In Figure 3b, ML34 YAC 264A1 is positive on only one homolog (filled arrowhead) and negative on the other homolog (which is not identified, as the 15 classical satellite cannot be used with ML34 due to overlapping signals). For probe ML34, YAC 264A1 was also deleted in all patients. In Figure 3c, a second ML34 YAC, 254B5, is positive on both 15 homologs in the same patient. However, the signal intensity is consistently reduced on one of the two homologs (open arrowhead), indicating this YAC is partially contained within the deletion and crosses the breakpoint of the deletion. ML34 YAC 254B5 showed hybridization on both 15 homologs in all patients. However, the signal intensity was consistently reduced in one of the two homologs in all cases. Patient 37261 is examined in Figure 3d-f. This patient represents the familial Angelman Syndrome case with submicroscopic deletion. In Figure 3d, IR4-3R YAC A156E1 is positive on both 15 homologs (filled arrowheads). In Figure 3e, LS6-1 YAC A229A2 is positive on one homolog (filled arrowhead), but negative on the other (open arrowhead). In Figure 3f, GABRB3 YAC B25E9 is positive on one homolog (filled arrowhead), but negative on the other homolog (open arrowhead). This indicates that 254B5 crosses the

breakpoint of the deletion in 10/10 patients, a striking consistency in the location of the proximal breakpoint among unrelated patients.

Similarly, one of the IR10-1 YACS, 149A2, was deleted in all patients tested. However, a second overlapping IR10-1 YAC, 93C9, was completely deleted in only 1/9 patients tested. In the remaining 8 patients,

hybridization was observed on both chromosome 15s, but with a significantly reduced intensity on one of the two homologs. This suggests that 93C9 crosses the breakpoint of most patients, and that the distal breakpoint for

PWS/Angelman Syndrome deletions is also relatively

consistent. None of the patients tested showed deletions for YACs corresponding to IR39 or CMW-1.

In addition to these 10 sporadic patients, two individuals from the familial Angelman Syndrome pedigree were studied, including an affected individual (37216) and his phenotypically normal grandfather (37262). Both were found to be normal for IR39, ML34, IR4-3R, TD189-1, and CMW-1 and deleted for TD3-21 and GABRB3 (Figure 3d-f), consistent with the RFLP analysis of Hanabe et al (1991, Am. J. Med. Genet . , Vol. 41, pp. 64-68) and Saitoh et al (1992, Lancet , Vol. 339, pp. 366-367). In Figure 3d,

IR4-3R YAC A156E1 is positive on both 15 homologs (filled arrowheads). In Figure 3e, LS6-1 YAC A229A2 is positive on one homolog (filled arrowhead), but negative on the other (open arrowhead). In Figure 3f, GABRB3 YAC B25E9 is positive on one homolog (filled arrowhead), but negative on the other homolog (open arrowhead). This indicates that 254B5 crosses the breakpoint of the deletion in 10/10 patients, a striking consistency in the location of the proximal breakpoint among unrelated patients. In addition, both individuals were deleted for LS6-1 which had not been previously tested. Since the LS6-1, TD3-21 and GABRB3 YACs do not overlap each other, this indicates the deletion in these patients is at least 650 kb in size. This represents the minimum estimate of the size of the Angelman Syndrome critical region. Since this deletion produces Angelman

Syndrome when inherited from a female, but does not produce PWS when inherited from a male, genes responsible for the PWS phenotype are excluded from this >650 kb interval.

Figure 4 summarizes the YAC contig information, interphase FISH ordering, and patient deletion analysis. From the centromere, IR39 is represented by a 260 kb YAC which is not deleted in most PWS/Angelman Syndrome patients. The order of 10 DNA probes in relation to the centromere (cen) is derived from the interphase ordering experiments combined with YAC contig data for ML34, IR4-3R, PW71, and TD189-1. At least one non-chimeric YAC (rectangle with YAC ID inside) is shown for each probe, except PW71 which is represented by a single chimeric YAC. The

asterisks for YACS A156E1 and B58C7 indicate YAC ends which were subcloned and sequenced for YAC walks. The heavy, jagged lines represent the most common deletion breakpoints for both PWS and Angelman Syndrome patients. YACs for probes IR4-3R->GABRB3 were consistently deleted in all 11 sporadic cases of PWS or Angelman Syndrome. For ML34, one YAC (264A1) was deleted in all patients, while YAC 254B5 appeared partially deleted (i.e., crossed the breakpoint) in 10/10 patients tested. For IR10-1, YAC 149A2 was deleted in 9/9 patients tested, while YAC P93C9 was deleted in one patient, but only partially deleted in 8/9 patients. Thus, the distal breakpoint among these patients lies within a single YAC. The brackets indicate the boundaries of the submicroscopic deletion in the familial Angelman Syndrome case, and define the minimum critical region for Angelman Syndrome as ≥650 kb. The PWS region is proximal to the Angelman Syndrome critical region, and is at least 1000 kb in size.

The proximal deletion breakpoint for most patients lies in the ML34 YAC 254B5, while ML34 itself is usually contained within the deletion region (Hamabe et al, 1991, Am . J. Med . Genet . , Vol. 41, pp. 54-63; Hamabe et al, 1991, Am . J. Med . Genet . , Vol. 41, pp. 64-68;

Robinson et al, 1991, Am . J. Hum . Genet . , Vol. 49, pp.

1219-1234; Knoll et al, 1990, Am. J. Hum. Genet . , Vol. 47, pp. 149-155). The typical distal breakpoint in most

PWS/Angelman Syndrome patients appears to be contained m the IR10-1 YAC, 93C9, while the IR10-1 probe itself is usually deleted (Hamabe et al, 1991, Am . J. Med. Genet . , Vol. 41, pp. 54-63; Hamabe et al, 1991, Am . J. Med. Genet . , Vol. 41, pp. 64-68; Tantravahi et al, 1989, Am. J. Med. Genet . , Vol. 33, pp. 78-87; Wagstaff et al, 1991, Am . J. Hum. Genet . , Vol. 49, pp. 330-337; Knoll et al, 1990, Am . J. Hum. Genet . , Vol. 47, pp. 149-155). CMW-1 is distal to the typical deletion interval.

In the present study, five patients were included who had been signed out as karyotypically normal following high resolution chromosome analysis in our diagnostic

laboratory. Molecular studies were undertaken under the assumption that these patients most likely had maternal uniparental disomy. However, FISH analysis indicated these patients had deletions which included the same set of probes as the patients signed out as visible deletions.

Since these deletions are at least 1.5-2 Mb in size, this suggests high-resolution cytogenetic analysis is not reliable for detection of deletions in this size range. A complicating factor m analysis of chromosome 15 deletions is the close proximity of the deletion to the centromeric heterochromatin, in which polymorphic variation in the amount of heterochromatin may confound the analysis.

In summary, all patients were deleted for YACs corresponding to IR4-3R, PW71, TD189-1, LS6-1, TD3-21, and GABRB3. The breakpoints for most patients were localized within a single ML34 YAC of 245 kb on the proximal side (10/10 patients) and a single IR10-1 YAC of 200 kb on the distal side (8/9 patients).

The data further shows that the familial

submicroscopic deletion associated with Angelman Syndrome is >650 kb in size, and includes two anonymous markers (LS6-1 and TD3-21) and one gene of known function, GABRB3. If the density of coding sequences in the genome is 1 per 30 kb (100,000 genes/3, 000 kb), the current Angelman

Syndrome critical region could contain 20 or more genes.

Although GABRB3 has been proposed as a candidate gene which may be involved in the Angelman Syndrome phenotype

(Wagstaff et al, 1991, Am. J. Hum . Genet . , Vol. 49, pp. 330-337; Saitoh et al, 1992, Lancet , Vol. 339, pp.

366-367), the large number of potential expressed sequences in an interval this size suggests caution in consideration of any single candidate gene. EXAMPLE 8

Identification of a dinucleotide repeat

polymorphism at the GABA_A ß3 GABRB3 ) locus in the

Angelman/Prader- Willi region of chromosome 15

The GABRB3 gene has previously been mapped to proximal 15q in the Angelman Syndrome/PWS region (Wagstaff et al, 1991, Am. J. Hum. Gen . , Vol. 49, pp. 330-337). Using primers generated from the sequence of the rat GABRB3 cDNA (Ymer et al, 1989, EMBO, Vol. 8, pp. 1665-1670), a DNA probe was generated by PCR of human genomic DNA and used to screen a total human YAC library (Green and Olson, 1990, Proc . Natl . Acad. Sci . USA, Vol. 87, pp. 1213-1217). Clone B25E9 (150 kb) was identified and confirmed to map to proximal 15q by FISH. Alu-PCR products from this YAC were screened for CA repeats by modification of a PCR method using a combination of Alu and CA or GT primers (Feener et al, 1991, Am. J. Hum. Genet . , Vol. 48, pp. 621-627).

Positive fragments were subcloned into pBS SK and

sequenced. Sequences flanking a ACAC(CA)17 repeat element (SEQ ID NO:21) were used to design PCR primers. The primer sequences were as follows:

CA strand (SEQ. ID NO-22):

5'-CTCTTGTTCCTGTTGCTTTCAATACAC-3'

GT strand (SEQ. ID NO:23):

5'-CACTGTGCTAGTAGATTCAGCTC-3'

The length of the amplified fragment was 181 to 201

basepairs. PCR was performed in a total volume of 20 μl

containing 25 ng genomic DNA, 0.5 μM of each primer, 50 mM KCL, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl₂, 0.01% (w/v) gelatin, 250 μM each dNTP, and 0.5 units Taq polymerase (Perkin-Elmer/Cetus, Norwalk, CT). Initial denaturation was at 95°C for 4 minutes, followed by 26 cycles of 94°C for 1 minute, 55°C for 2 minutes, 72°C for 2 minutes, and a final extension of 7 minutes at 72°C.

TABLE 4

Polymorphism: estimated from 80 chromosomes of 40 unrelated individuals.

Allele Basepairs Frequency Allele Basepairs Frequency

A1 201 0.050 A7 189 0.013

A2 199 0.050 A8 187 0.013 A3 197 0.138 A9 185 0.088

A4 195 0.113 A10 183 0.088

A5 193 0.088 A11 181 0.325

A6 191 0.038

% Heterozygosity = 82.5% PIC = 0.83

The chromosomal localization was assigned to the

Angelman Syndrome/PWS region at 15q11-13. The localization of the YAC was confirmed by FISH. The dinucleotide repeat was confirmed to be on chromosome 15 by PCR of somatic cell hybrids.

EXAMPLE 9

Identification of a dinucleotide repeat

polymorphism at the D15S11 locus in the

Angelman/Prader-Willi region of chromosome 15

An STS was generated from probe p4-3R (D15S11), which has previously been mapped to proximal 15q in the Angelman Syndrome/PWS region (Butler, 1990, Am. J. Med . Genet . , Vol. 35, pp. 319-332), and used to screen a total human YAC library (Williams et al, 1989, Am . J. Med. Genet . , Vol. 32, pp. 339-345). Clone A156E1 (250 kb) was identified and confirmed to map to proximal 15q by FISH. The Alu-PCR products from this YAC were screened for CA repeats by modification of a PCR method using a combination of Alu and CA or GT primers (Magenis et al, 1990, Am . J. Med. Genet . , Vol. 35, pp. 333-349). Positive fragments were subcloned into pBS SK and sequenced. Sequences flanking a (CA)13 repeat element (SEQ. ID NO: 24) were used to design the following PCR primers:

GT strand (SEQ. ID NO:25):

5'-GACATGAACAGAGGTAAATTGGTGG-3'

CA strand (SEQ. ID NO:26):

5'-GCTCTCTAAGATCACTGGATAGG-3'

PCR was performed in a total volume of 20 μl

containing 25 ng genomic DNA, 0.5 μM of each primer, 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl₂, 0.01% (w/v) gelatin, 250 μM each dNTP, and 0.5 unit Tag polymerase

(Perkin-Elmer/Cetus, Norwalk, CT). Initial denaturation was at 95°C for 4 minutes, followed by 25 cycles of 94°C for 1 minute, 55°C for 2 minutes, 72°C for 2 minutes, and a final extension of 7 minutes at 72°C. The length of the amplified fragment was 243 to 263 bp. TABLE 5

Polymorphism: Estimated from 76 chromosomes of 38 unrelated individuals.

Allele Basepairs Frequency Allele Basepairs Frequency

A1 263 0.026 A6 253 0.066

A2 261 0.039 A7 251 0.092

A3 259 0.053 A8 249 0.171

A4 257 0.026 A9 245 0.013

A5 255 0.013 A10 243 0.500

% Heterozygosity = 74% PIC = 0.70

The chromosomal localization was assigned to the Angelman Syndrome/PWS region at 15q11-13. The localization of the YAC was confirmed by FISH. The dinucleotide repeat was confirmed to be on chromosome 15 by PCR of somatic cell hybrids.

While the invention has been described and illustrated herein by references to various specific material,

procedures and examples, it is understood that the

invention is not restricted to the particular material combinations of material, and procedures selected for that purpose. Numerous variations of such details can be implied as will be appreciated by those skilled in the art.

SEQUENCE LISTING ) GENERAL INFORMATION :

(i) APPLICANT:

(A) NAME: BAYLOR COLLEGE OF MEDICINE

(B) STREET: ONE BAYLOR PLAZA

(C) CITY: HOUSTON

(D) STATE: TEXAS

(E) COUNTRY: U.S.A.

(F) ZIP: 77030

(G) TELEPHONE: 713-798-6392

(H) TELEFAX: 713-798-6368

(ii) TITLE OF INVENTION: METHOD FOR THE DIAGNOSIS OF GENETIC DISORDERS ASSOCIATED WITH CHROMOSOMAL ABNORMALITIES AND UNIPARENTAL DISOMY

(iii) NUMBER OF SEQUENCES: 26

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: ONCOR, INC.

(B) STREET: 209 PERRY PARKWAY, SUITE 7

(C) CITY: GAITHERSBURG

(D) STATE: MARYLAND

(E) COUNTRY: U.S.A.

(F) ZIP: 20877

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: PatentIn Release #1.0, Version #1.25

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: PCT/US93/08501

(B) FILING DATE: 10-SEP-1993

(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: US 07/943,639

(B) FILING DATE: ll-SEP-1992

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: GLENN E. KARTA

(B) REGISTRATION NUMBER: 30,649

(C) REFERENCE/DOCKET NUMBER:

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 301-963-3500

(B) TELEFAX: 301-926-6129 (2) INFORMATION FOR SEQ ID NO:1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 35 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:

TGAGCYRWGA TYRYRCCAYT GCACTCCAGC CTGGG 35

(2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

AGGAGTGAGC CACCGCACCC AGCC 24

(2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 23 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

GGAACCATGT GCCCCATACT GTG 23 (2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 23 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

GCATGATCAG TCCTTGGGAG TTG 23

(2) INFORMATION FOR SEQ ID NO:5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

TTTCATAACA TATCCTGTGC 20

(2) INFORMATION FOR SEQ ID NO:6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:

AGTATGCAGT CATGATACGT 20

(2) INFORMATION FOR SEQ ID NO: 7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 30 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

GACATAGACC ACAAAGAAAC CTTAGACCAG 30

(2) INFORMATION FOR SEQ ID NO:8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 30 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:

GTGGTTACTG AGGCAAGAAA TTGGTGACTG 30

(2) INFORMATION FOR SEQ ID NO:9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 29 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

CAGGGTTTAA TCACCTAAGG CAAGGTTGC 29

(2) INFORMATION FOR SEQ ID NO:10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:

CAAGTGTTAT ACCTAGCTGT CCCAC 25

(2) INFORMATION FOR SEQ ID NO:11:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:

ACAACTTTAA CTCTGAAGAA 20

(2) INFORMATION FOR SEQ ID NO:12:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:

ACAACAAATG TGGAGAGGTG 20

(2) INFORMATION FOR SEQ ID NO:13:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:

CAACAGCTGT GTTCCTAAGT GAGC 24

(2) INFORMATION FOR SEQ ID NO:14:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:

CATCGCAAGG AGAGCAGCAA TTTC 24

(2) INFORMATION FOR SEQ ID NO:15:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 29 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:

CAGGCTGAAG CATTTATTGG TGTATAATC 29

(2) INFORMATION FOR SEQ ID NO:16:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 30 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:

CACATGAGCC CATGCCTAAT AAATTGCCTC 30

(2) INFORMATION FOR SEQ ID NO:17:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 30 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:

GTTCCTTATC TCATTTAGTA TATTTGTTGG 30

(2) INFORMATION FOR SEQ ID NO:18:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 28 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:

GGGCTGTTTC AAAACTGAAA GTAACATG 28

(2) INFORMATION FOR SEQ ID NO:19:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 23 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:

GTTGGTGACA CCAGGAATTC AGC 23

(2) INFORMATION FOR SEQ ID NO:20:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 22 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:

GTACAGCCAG TAAACTAAGT TG 22

(2) INFORMATION FOR SEQ ID NO:21:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 38 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: double

(D ) TOPOLOGY : linear

(ii) MOLECULE TYPE: DNA (genomic)

(ix) FEATURE :

(A) NAME/KEY: repeat_region

(B) LOCATION: 5..38

(D) OTHER INFORMATION: /rpt_type= "tandem"

/rpt_unit= 5 .. 6 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:

ACACCACACA CACACACACA CACACACACA CACACACA 38

(2) INFORMATION FOR SEQ ID NO:22:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 27 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:

CTCTTGTTCC TGTTGCTTTC AATACAC 27

(2) INFORMATION FOR SEQ ID NO:23:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 23 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:

CACTGTGCTA GTAGATTCAG CTC 23

(2) INFORMATION FOR SEQ ID NO:24:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 26 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: double

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(ix) FEATURE:

(A) NAME/KEY: repeat_region

(B) LOCATION: 1..26

(D) OTHER INFORMATION: /rpt_type= "tandem"

/rpt unit= 1 .. 2 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:

CACACACACA CACACACACA CACACA 26

(2) INFORMATION FOR SEQ ID NO: 25:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:

GACATGAACA GAGGTAAATT GGTGG 25

(2) INFORMATION FOR SEQ ID NO: 26:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 23 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:

GCTCTCTAAG ATCACTGGAT AGG 23

Claims

WHAT IS CLAIMED IS:

1. A method for the diagnosis of a genetic disorder associated with a chromosome structural abnormality or with uniparental disomy of a critical chromosomal region, comprising the steps of:

a. performing in situ hybridization in cells of a sample obtained from a patient, using probes which are separately detectable and which represent DNA markers in said critical chromosomal region;

b. comparing a pattern of separately detectable markers obtained in step (a) to a predetermined pattern of separately detectable markers obtained from performing in situ hybridization on cells not exhibiting said genetic disorder; and

c. detecting a chromosome structural abnormality in said critical chromosomal region of cells in the sample.

2. The method of Claim 1, wherein the chromosome structural abnormality is a deletion.

3. The method of Claim 1, wherein the chromosome structural abnormality is a duplication.

4. The method of Claim 1, wherein the chromosome structural abnormality is a translocation.

5. The method of Claim 1, wherein the chromosome structural abnormality is an inversion.

6. The method of Claim 2, wherein the genetic disorder is Prader-Willi/Angelman syndrome.

7. The method of Claim 3, wherein the genetic disorder is Beckwith-Wiedemann syndrome.

8. The method of Claim 1, wherein the probes are unlabelled.

9. The method of Claim 1, wherein the probes are directly labelled.

10. The method of Claim 9, wherein the direct label is a radioactive nuclide.

11. The method of Claim 10, wherein the radioactive nuclide is ³²P, ³H or ³⁵S.

12. The method of Claim 9, wherein the direct label is a fluorescent dye.

13. The method of Claim 12, wherein the fluorescent dye is fluorescein, rhodamine, lucifer yellow, Texas red, or AMCA blue.

14. The method of Claim 9, wherein the direct label is a cyanin dye.

15. The method of Claim 9, wherein the probe is labelled by:

(a) synthesizing the probe by incorporating a nucleotide attached to an activated linker arm; and

(b) adding a detectable marker which binds to the activated linker arm.

16. The method of Claim 15, wherein the detectable marker is a fluorescent dye.

17. The method of Claim 16, wherein the fluorescent dye is fluorescein, rhodamine, lucifer yellow, Texas red, or AMCA blue.

18. The method of Claim 15, wherein the detectable label is a cyanin dye.

19. The method of Claim 1, wherein the probes are indirectly labelled.

20. The method of Claim 19, wherein the probe is labelled by:

(a) synthesizing the probe by incorporating a hapten attached to a nucleotide; and

(b) adding a detectable marker attached to a binding molecule which binds to the hapten.

21. The method of Claim 20, wherein the hapten is biotin.

22. The method of Claim 21, wherein the binding molecule is avidin.

23. The method of Claim 22, wherein the detectable marker is a fluorescent dye.

24. The method of Claim 23, wherein the fluorescent dye is fluorescein, rhodamine, lucifer yellow, Texas red, or AMCA blue.

25. The method of Claim 22, wherein the detectable marker is a cyanin dye.

26. The method of Claim 19, wherein the probe is labelled by:

(a) synthesizing the probe by incorporating a hapten attached to a nucleotide; and

(b) adding a binding molecule which binds to the hapten, and to which binding molecule an enzyme producing a detectable signal has been attached.

27. The method of Claim 21, wherein the hapten is biotin.

28. The method of Claim 22, wherein the binding molecule is avidin.

29. The method of Claim 28, wherein the enzyme is alkaline phosphatase or horseradish peroxidase.

30. The method of Claim 20, wherein the hapten is digoxygenin.

31. The method of Claim 30, wherein the binding molecule is an antibody directed to digoxygenin.

32. The method of Claim 31, wherein the detectable marker is a fluorescent dye.

33. The method of Claim 32, wherein the fluorescent dye is fluorescein, rhodamine, lucifer yellow, Texas red or AMCA blue.

34. The method of Claim 31, wherein the detectable label is a cyanin dye.

35. The method of Claim 21, wherein the hapten is digoxygenin.

36. The method of Claim 35, wherein the binding molecule is an antibody directed to digoxygenin.

37. The method of Claim 36, wherein the enzyme is alkaline phosphatase or horseradish peroxidase.

38. A method for the diagnosis of a genetic disorder according to Claim 1, further comprising:

(d) comparing a DNA sequence in cells of a sample obtained from a patient, of a chromosomal region containing a tandemly repeated sequence polymorphism to the

chromosomal region containing a tandemly repeated sequence polymorphism in both parents; and

(e) determining whether the sequence of the patient matches a maternal or paternal sequence.

39. The method of Claim 38, wherein the chromosome structural abnormality is a deletion.

40. The method of Claim 38, wherein the chromosome structural abnormality is a duplication.

41. The method of Claim 38, wherein the chromosome structural abnormality is a translocation.

42. The method of Claim 38, wherein the chromosome structural abnormality is an inversion.

43. The method of Claim 39, wherein the genetic disorder is Prader-Willi/Angelman syndrome.

44. The method of Claim 40, wherein the genetic disorder is Beckwith-Wiedemann syndrome.

45. The method of Claim 38, wherein the probes are directly labelled.

46. The method of Claim 45, wherein the direct label is a radioactive nuclide.

47. The method of Claim 46, wherein the radioactive nuclide is ³²P, ³H, or ³⁵S.

48. The method of Claim 45, wherein the direct label is a fluorescent dye.

49. The method of Claim 48, wherein the fluorescent dye is fluorescein, rhodamine, lucifer yellow, Texas red or AMCA blue.

50. The method of Claim 45, wherein the direct label is a cyanin dye.

51. The method of Claim 45, wherein an enzyme is directly attached to the probe.

52. The method of Claim 51, wherein the enzyme is alkaline phosphatase or horseradish peroxidase.

53. The method of Claim 45, wherein the probe is labelled by :

(a) synthesizing the probe by incorporating a nucleotide attached to an activated linker arm; and

(b) adding a detectable marker which binds to the activated linker arm.

54. The method of Claim 45, wherein the probe is labelled by:

(a) synthesizing the probe by incorporating a nucleotide attached to an activated linker arm; and

(b) adding an enzyme which produces a detectable signal and which binds to the activated linker arm.

55. The method of Claim 54, wherein the enzyme is alkaline phosphatase or horseradish peroxidase.

56. The method of Claim 53, wherein the detectable marker is a fluorescent dye.

57. The method of Claim 56, wherein the fluorescent dye is fluorescein, rhodamine, lucifer yellow, Texas red or AMCA blue.

58. The method of Claim 53, wherein the detectable label is a cyanin dye.

59. The method of Claim 38, wherein the probes are indirectly labelled.

60. The method of Claim 59, wherein the probe is labelled by:

(a) synthesizing the probe by incorporating a nucleotide attached to a hapten; and

(b) adding a detectable marker attached to a binding molecule which binds to the hapten.

61. The method of Claim 60, wherein the enzyme is alkaline phosphatase or horseradish peroxidase.

62. The method of Claim 60, wherein the hapten is biotin.

63. The method of Claim 62, wherein the binding molecule is avidin.

64. The method of Claim 63, wherein the detectable marker is a fluorescent dye.

65. The method of Claim 64, wherein the fluorescent dye is fluorescein, rhodamine, lucifer yellow, Texas red, or AMCA blue.

66. The method of Claim 60, wherein the detectable label is a cyanin dye.

67. The method of Claim 59, wherein the probe is labelled by :

(a) synthesizing the probe by incorporating a hapten attached to a nucleotide; and

(b) adding a binding molecule which binds to the hapten, and to which binding molecule an enzyme producing a detectable signal has been attached.

68. The method of Claim 67, wherein the hapten is biotin.

69. The method of Claim 68, wherein the binding molecule is avidin.

70. The method of Claim 69, wherein the enzyme is alkaline phosphatase or horseradish peroxidase.

71. The method of Claim 60, wherein the hapten is digoxygenin.

72. The method of Claim 71, wherein the binding molecule is an antibody directed to digoxygenin.

73. The method of Claim 72, wherein the detectable marker is a fluorescent dye.

74. The method of Claim 73, wherein the fluorescent dye is fluorescein, rhodamine, lucifer yellow, Texas red or AMCA blue.

75. The method of Claim 72, wherein the detectable label is a cyanin dye.

76. The method of Claim 67, wherein the hapten is digoxygenin.

77. The method of Claim 76, wherein the binding molecule is an antibody directed to digoxygenin.

78. The method of Claim 77, wherein the enzyme is alkaline phosphatase or horseradish peroxidase.

79. A method for determining the parental origin of a genetic disorder associated with a chromosome structural abnormality or with uniparental disomy of a critical chromosomal region, comprising:

(a) comparing a DNA sequence m cells of a sample obtained from a patient, of a chromosomal region containing a tandemly repeated sequence polymorphism to the

chromosomal region containing a tandemly repeated sequence polymorphism in both parents; and

(b) determining whether the sequence of the patient matches a maternal or paternal sequence.

80 . The method of Claim 79 , wherein the genetic disorder is Prader-Willi /Angelman syndrome .

81. The method of Claim 79, wherein the genetic disorder is Beckwith-Wiedemann syndrome.

82. The method of Claim 79, wherein the tandemly repeated sequence polymorphism is a variable number tandem repeat.

83. The method of Claim 82, wherein the variable number tandem repeat is analyzed using a restriction digest.

84. The method of Claim 79, wherein the tandemly repeated sequence polymorphism is a short tandem repeat.

85. The method of Claim 84, wherein the short tandem repeat is analyzed by PCR.

86. The method of Claim 84, wherein the short tandem repeat is tetrameric.

87. The method of Claim 84, wherein the short tandem repeat is trimeric.

88. The method of Claim 84, wherein the short tandem repeat is a dinucleotide.

89. The method of Claim 88, wherein the dinucleotide is a CA repeat.

90. A method for determining the genotype of a patient with a chromosome structural abnormality or with uniparental disomy of a critical chromosomal region, comprising:

(a) comparing a DNA sequence in cells of a sample obtained from a patient, of a chromosomal region containing a tandemly repeated sequence polymorphism to the

chromosomal region containing a tandemly repeated sequence polymorphism in both parents; and

(b) determining whether the sequence of the patient matches a maternal or paternal sequence.

91. The method of Claim 90, wherein the genetic disorder is Prader-Willi/Angelman syndrome.

92. The method of Claim 90, wherein the genetic disorder is Beckwith-Wiedemann syndrome.

93. The method of Claim 90, wherein the tandemly repeated sequence polymorphism is a variable number tandem repeat.

94. The method of Claim 93, wherein the variable number tandem repeat is analyzed using a restriction digest.

95. The method of Claim 90, wherein the tandemly repeated sequence polymorphism is a short tandem repeat.

96. The method of Claim 95, wherein the short tandem repeat is analyzed by PCR.

97. The method of Claim 95, wherein the short tandem repeat is tetrameric.

98. The method of Claim 95, wherein the short tandem repeat is trimeric.

99. The method of Claim 95, wherein the short tandem repeat is a dinucleotide.

100. The method of Claim 99, wherein the dinucleotide is a CA repeat.

101. A set of probes for the diagnosis of

Prader-Willi/Angelman Syndrome comprising multiple clones spanning the IR4-3R region, sufficient to determine whether a chromosomal abnormality is present.

102. A set of probes according to Claim 101, wherein the clones are 27F10, 171F12, and 162B3.

103 . A probe for the diagnosis of

Prader-Willi /Angelman Syndrome comprising clone 27F10.

104. A probe for the diagnosis of

Prader-Willi/Angelman Syndrome comprising clone 171F12.

105. A probe for the diagnosis of

Prader-Willi/Angelman Syndrome comprising clone 162B3.

106. A set of probes for the diagnosis of

Prader-Willi/Angelman Syndrome comprising multiple clones spanning the GABRB3 region, sufficient to determine whether a chromosomal normality is present.

107. A set of probes according to Claim 106, wherein the clones are B25E9-2F, B25E9-5A and B25E9-5B.

108. A probe for the diagnosis of

Prader-Willi/Angelman Syndrome comprising clone B25E9-2F.

109. A probe for the diagnosis of

Prader-Willi/Angelman Syndrome comprising clone B25E9-5A.

110. A probe for the diagnosis of

Prader-Willi/Angelman Syndrome comprising clone B25E9-5B.

111. A kit for the diagnosis of a genetic disorder associated with a chromosome structural abnormality or uniparental disomy of a critical chromosomal region, comprising multiple probes which are separately detectable and which span the critical chromosomal region, and are sufficient to determine whether a chromosomal abnormality is present.

112. The kit of Claim 111, wherein the genetic disorder is Prader-Willi/Angelman syndrome.

113. The kit of Claim 111, wherein the genetic disorder is Beckwith-Wiedemann syndrome.

114. A kit for the diagnosis of a genetic disorder according to Claim 111, further comprising at least one probe in the critical chromosomal region which is

sufficient to detect a tandemly repeated sequence

polymorphism.

115. The kit of Claim 114, wherein the genetic disorder is Prader-Willi/Angelman syndrome.

116. The kit of Claim 114, wherein the genetic disorder is Beckwith-Wiedemann syndrome.

117. A kit for determining the parental origin of a genetic disorder associated with a chromosome structural abnormality or uniparental disomy of a critical chromosomal region, comprising at least one probe in the critical chromosomal region which is sufficient to detect a tandemly repeated sequence polymorphism.

118. The kit of Claim 117, wherein the genetic disorder is Prader-Willi/Angelman syndrome.

119. The kit of Claim 118, wherein the genetic disorder is Beckwith-Wiedemann syndrome.

120. A kit for determining the genotype of a patient analyzed for a genetic disorder associated with a

chromosome structural abnormality or uniparental disomy of a critical chromosomal region, comprising at least one probe in the critical chromosomal region which is

sufficient to detect a tandemly repeated sequence

polymorphism.

121. The kit of Claim 120, wherein the genetic disorder is Prader-Willi/Angelman syndrome.

122. The kit of Claim 120, wherein the genetic disorder is Beckwith-Wiedemann syndrome.