WO1992019972A1

WO1992019972A1 - Islet cell autoantigen (gad) for the detection of preclinical diabetes

Info

Publication number: WO1992019972A1
Application number: PCT/DK1992/000141
Authority: WO
Inventors: Birgitte Michelsen
Original assignee: Novo Nordisk A/S
Priority date: 1991-05-03
Filing date: 1992-05-01
Publication date: 1992-11-12
Also published as: AU1749692A

Abstract

The presence of autoantibodies against an approximately 67 kD islet cell autoantigen (67 kD autoantibodies) in serum may be determined by a method comprising contacting a serum sample with a higher molecular weight glutamic acid decarboxylase (hMr GAD) or a fragment thereof capable of binding 67 kD autoantibodies, and detecting any binding of autoantibodies to the hMr GAD.

Description

ISLET CELL AUTOANTIGEN (GAD) FOR THE DETECTION OF PRECLINICAL DIABETES.

FIELD OF INVENTION

The present invention relates to a method of diagnosing preclinical stages of insulin-dependent diabetes mellitus by determining the presence of autoantibodies against a specific islet cell autoantigen in serum, as well as to an antibody and test kit for use in the method.

BACKGROUND OF THE INVENTION

Insulin-dependent diabetes mellitus (IDDM) is an autoimmune disease characterized by the gradual destruction of the insulin-producing pancreatic islet 3-cells. Clinical symptoms of diabetes set in at a fairly late stage of this process, at a point where about 90% of the 0-cells have been destroyed.

However, in recent years it has been found that a number of circulating autoantibodies against 5-cells associated with IDDM are present in serum before the clinical onset of the disease.

Such circulating autoantibodies include one against a 64 kD islet S-cell autoantigen (S. Baekkeskov et al.. Nature 298.

1982, pp. 167-169) . The 64 kD autoantibody has been found to be present in the serum of more than 80% of the patients with newly diagnosed IDDM and has furthermore been found in serum up to several years before the clinical onset of the disease (S.

Baekkeskov et al., J. Clin. Invest. 79. 1987, pp. 926-934; M. R.

Atkinson et al.. Lancet 335, 1990, pp. 1357-1360; E. Sigurdsson and S. Baekkeskov, Curr. Top. Microbiol. Immun. 164, 1990, pp.

143-167) . The early detection of the 64 kD autoantibody would be of great value for the study of the development of IDDM as well as for devising preventive therapies.

The 64 kD autoantigen has recently been identified (S. Baekkeskov et al., Nature 347 , 1990, pp. 151-156) as the enzyme glutamic acid decarboxylase (GAD) which is otherwise known to be involved in the biosynthesis of gamma-amino butyric acid in the central nervous system. Although this article mentions the existence of the autoantigen in different isofor s, a 65 kD, a 64 kD α and a 64 kD β form, there is no indication that the 65 kD form is reactive with autoantibodies from IDDM sera.

In the following, the nomenclature used in M.G. Erlander et al.. Neuron 2, 1991, pp. 91-100, to indicate the higher molecular weight (67 kD) and lower molecular weight (65 kD) forms of GAD is used.

SUMMARY OF THE INVENTION

The present invention is based on the finding that the higher molecular weight (67 kD) isofor of GAD is capable of reacting with autoantibodies from IDDM sera.

Accordingly, the present invention relates to a method of determining the presence of autoantibodies against an approximately 67 kD islet 5-cell autoantigen (67 kD autoantibodies) in serum, which method comprises contacting a serum sample with higher molecular weight glutamic acid decarboxylase (hMr GAD) or a fragment thereof capable of binding autoantibodies, and detecting any binding of these autoantibodies to the hMr GAD.

The method is useful for diagnosing and/or monitoring the development of preclinical stages of IDDM in a patient and thus presents a valuable opportunity to initiate preventive or ameliorative treatment of IDDM.

In another aspect, the invention relates to an antibody which is raised against a peptide fragment of hMr GAD.

In a further aspect, the invention relates to a test kit for determining the presence of 67 kD autoantibodies in serum, which comprises, in separate containers, (a) hMr GAD immobilised on a solid support, and

(b) a labelled reagent capable of binding to the 67 kD autoantibody, or a labelled antibody which is capable of competing with the autoantibody for binding to hMr GAD.

DETAILED DISCLOSURE OF THE INVENTION

GAD has been found to be present in brain, pancreas and testicles. It is assumed that GADs from these tissues are sufficiently homologous to be useful in the present method regardless of their origin. However, it may be preferred to use pancreatic GAD for the purpose of diagnosing IDDM or a preclinical stage thereof in patient serum since the antigen against which the 67 kD autoantibodies are formed is pancreatic GAD. Likewise, it is contemplated that GAD derived from different mammalian sources, such as cattle, pigs, rats, dogs or cats, may be used in the present method. For the purpose of diagnosing IDDM in a human patient it will, however, typically be preferred to use GAD derived from a human source.

The GAD employed in the method and test kit of the invention may be produced by extraction from tissues containing it, but it is preferred to produce it by recombinant DNA technigues in a manner known per se. Briefly, a DNA fragment encoding hMr GAD may be obtained by preparing a cDNA or genomic DNA library and screening for DNA sequences coding for all or a part of the hMr GAD by hybridization to oligonucleotide probes (cf. Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd. Ed. Cold Spring Harbor, 1989) . The resulting DNA fragment may be inserted into a suitable expression vector in accordance with conventional techniques, e.g. as described in Sambrook et al. , op. cit. The expression vector may then be introduced into a suitable host cell, for instance a mammalian cell, the COS (ATCC CRL 1650) , BHK (ATCC CCL 10) or CHO (ATCC CCL 61) cell lines being suitable for that purpose. The resulting cell may be cultured in an appropriate nutrient medium under conditions which are conducive to the expression of hMr GAD, after which hMr GAD may be recovered from the culture.

In the method according to the invention of determining the presence of 67 kD autoantibodies in serum, the hMr GAD is preferably employed in the absence of lower molecular weight GAD (i.e. the 65 kD α and β isoforms) .

In a favoured embodiment of the method of the invention, the serum sample is contacted with hMr GAD immobilised on a solid support, after which the solid support is contacted with a labelled reagent capable of binding to any autoantibody bound to the hMr GAD, detection of any label bound to the solid support indicating the presence of 67 kD autoantibodies in the sample.

The hMr GAD may be immobilized directly on the solid support by physical adsorption or be bound covalently or through bridging molecules such as protein A, polylysine or an antibody (preferably reactive with an epitope of hMr GAD which does not participate in binding the 67 kD autoantibodies) to the solid support. The solid support employed in the method and test kit of the invention preferably comprises a polymer. The polymer may be selected from the group consisting of a plastic (e.g. latex, a polystyrene, polyvinylchloride, polyurethane, polyacrylamide, polyvinylalcohol, nylon, polyvinylacetate, and any suitable copolymer thereof) , cellulose (e.g. various types of paper, such as nitrocellulose paper and the like) , a silicon polymer (e.g. siloxane) , a polysaccharide (e.g. agarose or dextran) , or an ion exchange resin (e.g. conventional anion or cation exchange resins) .

The physical shape of the solid support is not critical, although some shapes may be more convenient than others for the present purpose. Thus, the solid support may be in the shape of a plate, e.g. a microtiter plate, or a paper strip, dipstick, membrane (e.g. a nylon membrane or a cellulose filter) or solid particles (e.g. latex beads) .

The labelled reagent used in the method and test kit of the invention may be an antibody reactive with the 67 kD autoantibody (e.g. an anti-human antibody) including an anti- idiotype antibody (i.e. an antibody directed against the epitope-binding site of the 67 kD autoantibody) . The labelled reagent may also be a T-cell receptor for the 67 kD autoantibody or a fragment thereof capable of binding to the 67 kD autoantibody.

The label substance for the reagents used for binding to the 67 kD autoantibody is preferably selected from the group consisting of enzymes, coloured or fluorescent substances and radioactive isotopes.

Examples of enzymes useful as label substances are peroxidases (such as horseradish peroxidase) , phosphatases (such as acid or alkaline phosphatase) , β-galactosidase, urease, glucose oxidase, carbonic anhydrase, acetylcholinesterase, glucoamylase, lysozyme, malate dehydrogenase, glucose-6- phosphate dehydrogenase, β-glucosidase, proteases, pyruvate decarboxylase, esterases, luciferase, etc.

Enzymes are not in themselves detectable but must be combined with a substrate to catalyse a reaction the end product of which is detectable. Thus, a substrate may be added after contacting the support with the labelled reagent, resulting in the formation of a coloured or fluorescent substance. Examples of substrates which may be employed according to the invention include hydrogen peroxide/tetramethylbenzidine or chloronaphthole or o-phenylenediamine or 3-(p-hydroxyphenyl) propionic acid or lu inol, indoxyl phosphate, p-nitrophenyl- phosphate, nitrophenyl galactose, 4-methyl umbelliferyl-D- galactopyranoside, or luciferin. Alternatively, the label substance may comprise coloured or fluorescent substances, including gold particles, coloured or fluorescent latex particles, dye particles, fluorescein, phycoerythrin or phycocyanin.

Radioactive isotopes which may be used for the present purpose may be selected from 1-125, 1-131, H-3, P-35 and C-14.

In an alternative embodiment, the serum sample may be contacted with hMr GAD immobilised on a solid support simultaneously with contacting the immobilised hMr GAD with a predetermined amount of a labelled antibody competing with the autoantibody for binding to hMr GAD, detection of any decrease in the amount of labelled antibody bound to the solid support relative to the amount of labelled antibody added indicating the presence of 67 kD autoantibodies in the sample.

In this case, the labelled antibody is suitably one which is reactive with the epitope of GAD which binds the 65 kD autoantibody. Thus, the antibody may be one which is raised against a peptide fragment comprising this epitope.

In this embodiment, the solid support and label substance may be as described above.

The antibody raised against a peptide fragment of hMr GAD may conveniently be used in the method and test kit of the invention as the labelled reagent, labelled antibody or antibody immobilised on the solid support to which the hMr GAD is subsequently bound, as indicated above. In the present context, the term "antibody" is used to indicate any substance formed in the human or animal body or by a human or animal cell as a response to exposure to the antigen. The antibody may be a polyclocal or monoclonal antibody or may be one prepared by recombinant DNA techniques. The term also includes antibody fragments, such as Fab*, F(ab')₂ or Fv fragments as well as single-domain antibodies. Monoclonal antibodies may be obtained by well-established methods, e.g. as described in A. Johnstone and R. Thorpe, Immunochemistry in Practice, 2nd. Ed. , Blackwell Scientific Publications, 1987, pp. 35-43. When prepared by recombinant DNA techniques, the antibody may be produced by cloning a DNA sequence coding for the antibody or a fragment thereof into a suitable cell, e.g. a microbial, plant, animal or human cell, and culturing the cell under conditions conducive to the production of the antibody or fragment in question and recovering the antibody or fragment thereof from the culture. Possible strategies for the preparation of cloned antibodies are discussed in, for instance, L. Riechmann et al., Nature 332, 24 March 1988, p. 323 ff. , describing the preparation of chimeric antibodies of rat variable regions and human constant regions; M. Better et al., Science 240, 20 May 1988, p. 1041 ff., describing the preparation of chimeric mouse-human Fab fragments; A. Sharra and A. Plϋckthun, Science 240, 20 May 1988, pp. 1038-1040, describing the cloning of an immunoglobulin Fv fragment containing antigen-binding variable domains; and E.S. Ward et al., Nature 341. 12 October 1989, pp. 544-546, describing the cloning of isolated antigen-binding variable domains ("single-domain antibodies") .

The peptide fragment against which the antibody is raised may be prepared by synthesis using a device available from Applied Biosystems as described in (12) .

In particular for use as the labelled reagent or as the antibody immobilised on the solid support, the antibody is advantageously one which is raised against an epitope of hMr GAD which does not participate in binding autoantibodies so as not to interfere with the binding of any 67 kD autoantibodies present in the sample or so as to ensure optimal binding of the labelled reagent to any 67 kD autoantibodies bound to hMr GAD in the assay. If, on the other hand, the antibody is intended for use as the labelled antibody competing with any antibodies in the sample for binding to the immobilised hMr GAD, the antibody is preferably one which is raised against an epitope of hMr GAD which binds the 67 kD autoantibody.

DESCRIPTION OF SPECIFIC EMBODIMENTS

In one embodiment, the test kit of the invention comprises, in separate containers,

(a) higher molecular weight glutamic acid decarboxylase (hMr GAD) immobilised on a solid support, and

(b) a labelled reagent capable of binding to the 67 kD autoantibody.

In this case, the hMr GAD may be bound to an antibody immoblised to the solid support, as indicated above. The labelled reagent is preferably an antibody.

In another embodiment, the test kit of the invention comprises, in separate containers,

(a) an antibody reactive with an epitope of higher molecular weight glutamic acid decarboxylase (hMr GAD) which does not participate in binding the autoantibodies, the antibody being immobilised on a solid support,

(b) hMr GAD, and

(c) a labelled reagent capable of binding to the autoantibody.

In a further embodiment, the test kit of the invention comprises, in separate containers, (a) higher molecular weight glutamic acid decarboxylase (hMr GAD) immobilised on a solid support, and

(b) a labelled antibody which is capable of competing with the 67 kD autoantibody for binding to hMr GAD.

The labelled antibody may be one which is raised against a peptide fragment of hMr GAD.

The hMr GAD may be bound to an antibody immobilised on the solid support, as indicated above.

In a still further embodiment, the test kit of the invention comprises, in separate containers,

(a) an antibody reactive with an epitope of higher molecular weight glutamic acid decarboxylase (hMr GAD) which epitope does not participate in binding the 67 kD autoantibodies, the antibody being immobilised on a solid support,

(b) hMr GAD, and

(c) a labelled antibody which is capable of competing with the autoantibody for binding to hMr GAD.

It is at present contemplated that the hMrGAD may have a therapeutic use. Thus, it is believed to be of potential use in a method of preventing the development of IDDM, in which method hMr GAD or a fragment thereof is administered to an individual who does not show clinical symptoms of IDDM in a quantity sufficient to induce immunological tolerance to the 65 kD islet cell autoantigen. Said individual may for instance be a neonate because the immune system is not yet fully developed in neonates.

It is further contemplated that antibodies raised against a peptide fragment of hMr GAD may be useful for the prevention of IDDM if administered to an individual who does not show clinical symptoms of IDDM in a quantity sufficient for blocking an autoantigenic epitope of the 67 kD islet cell autoantigen so that this epitope will not be recognized by the immune system of the patient. For this purpose, the antibody may conveniently be one which is raised a fragment of GAD comprising this autoantigenic epitope.

BRIEF DESCRIPTION OF THE DRAWING

Pig. 1. Immunoprecipitation experiment using sheep anti GAD serum (S3), IDDM sera (IDDM-1 and IDDM-2) and control serum

(CONTROL) to immunoprecipitate the various GAD components

(indicated by arrows) from islets (A) , from COS cells transfected with GAD1 (B) and from COS cells transfected with

GAD2 (C) . The present invention is further illustrated by the following example which is not in any way intended to limit the scope of the invention as claimed.

EXAMPLE

Materials and Methods

cDNA library: 50.000 rat islets were used to prepare total RNA by CsCl gradient centrifugation (1) . mRNA was purified on a poly(U) Sephadex column (2) . First strand cDNA was primed with oligo(dT) (Pharmacia, Denmark) and synthesized with AMV reverse transcriptase (Life Sciences, Johannesburg) (3) and second strand synthesis with RNase H and DNA polymerase I (BRL, NY) as described (4) . BstXI adaptors (Invitrogen Corporation, San Diego, CA) were added to the cDNA (5) , which was then fractionated according to size on a potassium acetate gradient (6) . The fractionated cDNA products were precipitated with ammonium acetate and ethanol (7) and ligated into the BstXI site of pCDM8 (Invitrogen Corporation, San Diego, CA) . Ligated material was transformed into E. coli MC1061/p3 by electroporation (8) .

Isolation of GAD cDNA clones: GAD containing cDNA clones 5 were recognized by in situ colony hybridization (9) using a synthetic GAD specific oligonucleotide probe with the sequence 5¹ [GGCAAAAATTCTTGATGCCAAACAAAAGGG]3^» (10). The identity of the putative GAD clones was confirmed by DNA sequencing.

Expression of cDNA clones in COS-cells: GAD clones with cDNA

10 inserts in the sense (pGADl) or antisense (pGAD2) orientation with respect to the CMV promoter in pCDM8 were transfected into

COS fibroblasts by the calcium phosphate precipitation technique, where 107 cells were seeded per 400cm2 tissue culture dish with 50 ml E-medium (DMEM (Gibco) + 50 μg/ml

15 Gentamycin + 110 μg/ml Na-pyrovate + 10% heat inactivated fetal calf serum) and left at 37°C overnight. 800 μg pGADl or pGAD2 in 5250 μl 250mM CaCl₂ was gently mixed with an equal volume of

2x HBS (0.82% w/v NaCl + 0.59% w/v HEPES + 0.02% w/v Na₂HP0₄ pH=7.12) and added to each dish in addition to 1050 μl lO M

20 Chloroquin diphosphate. The cells were left with the DNA precipitate overnight, whereafter the medium was exchanged with

50 ml fresh E-medium.

Labelling of islets with 35S-_αethionine: Islets of Langerhans were prepared from Wistar rats and cultured and labelled with 2535S-Met as previously described (11) .

65kD assay: IDDM sera were tested for the presence of autoantibodies against the hydrophobic, low molecular weight (65kD) GAD by standard immunoprecipitation methods (11) .

Harvesting of transfected cells: Transfected COS cells were 30 harvested by scraping in the presence of RPMI 1640. The cell suspension was transferred to 50ml centrifuge tubes. Cells were pelleted at lOOOrpm for 1 sec. and resuspended in RPMI 1640. Finally, cells were washed twice with PBS (GIBCO) and stored at -20°C until extraction.

Extraction of hydrophilic proteins: Rat islets or COS cells transfected with pGADl or pGAD2 were swollen in lOmM HEPES pH 57.4 + lmM MgCl₂ + ImM EGTA on ice for 10 min, followed by ho ogenization by 20 strokes in a glass ho ogenizer. The homogenates were centrifuged at 1000 x g, and the postnuclear supernatant centrifuged at 100,000 x g for lhr at 4"C to obtain cytosol and particulate fractions. The cytosol fraction was separated in a hydrophobic and a hydrophilic fraction by Triton X-114 phase separation as described in (12) , with the following modifications: the cytosol fraction was made 1% in Triton X-114, warmed at 37"C for 2 min to introduce Triton X-114 phase transition, and centrifuged at 15,000 x g for 2 min to separate the aqueous phase from the detergent phase. The aqueous phase from the Triton X-114 phase separation was diluted in 20mM Tris buffer pH 7.4 + 150mM NaCl and immunoprecipitated as described (11) using aqueous phase from 400 islets or from 2.5 x 105 transfected COS cells per assay. Immunoprecipitates were analyzed by SDS-PAGE (10%) , electroblotted onto nitrocellulose and immunostained as previously described (12) using a peptide antiserum, which was raised against the sequence [Thr-Gln-Ser-Asp-Ile-Asp-Phe-Leu-Ile-Glu-Glu-Ile-Glu-Arg-Leu- Gly-Gln-Asp-Leu] by methods described (12) , and which recognizes three forms of GAD in rat islets.

Sera: The S3 antiserum to rat GAD was provided through the Laboratory of Clinical Science, NIMH where it was developed under the supervision of Dr. Irwin J. Kopin with Drs. Wolfgang Oertel, Donald E. Schmechel and Marcel Tappaz. The IDDM sera were from recent onset IDDM patients. Twenty sera were tested for the presence of antibodies against the hydrophobic, low molecular weight (65kD) form of GAD. Ten of the positive sera were selected for analysis of transfected COS cells. Labelling of transfected cells with 35S-methionine: 2-3 days after transfection, cells are labelled with 375MBq 35S-Methionine (S2020 from Amersham) in 50ml labelling medium per dish (methionine-free RPMI 1640 medium + 20mM HEPES + 0.35 g/1 NaHC0₃ (GIBCO BRL) + 2% Nu-serum (Nunc) + 1% normal human serum + 10.000 units/1 pen-strep (GIBCO BRL) + 2mM L-glutamine (GIBCO BRL) + lg/1 D-glucose (Analar) . The medium is aspired after 4hrs and the cells washed with RPMI 1640 with 75mg/l methionine (GIBCO BRL) before harvesting.

Results

Cloning of GAD from islets: A rat islet cDNA library was screened with a synthetic oligonucleotide sequence based on a published GAD cDNA sequence from rat brain. One clone containing a full-length GAD cDNA in the sense-orientatin relative to the expression vector was characterized by DNA sequencing, and was thereby shown to be identical to the previously published form from which the probe sequence was derived.

Expression and antigenicity of islet GAD in COS cells: C O S cells were transfected with cDNA clones containing GAD in sense- and anti-sense orientation within the expression vector (pGADl and pGAD2, respectively) . The cells were harvested three days after transfection. The hydrophilic fractions of cytosolic components from (A) rat islets were subjected to immuno- precipitation with 1) a polyclonal sheep antiserum (S3) directed against rat GAD (13) , 2) serum from a healthy person, and 3) sera from 10 IDDM patients known to react with the hydrophobic, low molecular weight (65kD) GAD (Fig. 1) . The S3 serum and all IDDM sera immunoprecipitated the high molecular weight (67kD) as well as 2 low molecular weight (65kD a and β) GAD components from islets as expected (13) . Furthermore, these sera all recognized a 67kD component, comigrating with the higher form in islets, in COS cells transfected with pGADl. This protein was not present in COS cells transfected with pGAD2.

From these experiments it may be concluded that the hydrophilic, high molecular weight (67kD) form of GAD in rat 5 islets is identical to the previously described rat brain GAD (10) . Furthermore, it has been shown that this protein is immunogenic in IDDM since it is recognized by IDDM sera when expressed in heterologous cells lacking the lower forms of GAD (65kD α and β) .

10 A further study, reported by S. Christgau et al., "Autoantibodies in IDDM Recognize both the 65 kD and 64 kD Forms of Glutamic Acid Decarboxylase from Pancreatic /5-Cells", in "Pancreatic /5-Cell 1991: Gene To Disease", (Abstracts from a conference held on 29 June - 1 July 1991 in the Gotman

15 Conference Center, Harvard University, Cambridge, Mass. and arranged by G. and S. Bonner-Weir, Section on Islet Cell Physiology, Joslin Diabetes Center, Boston, Mass.) concludes that the 67 kD GAD and 65 kD GAD both contain autoantigenic epitopes recognized by antibodies associated with /5-cell

20 destruction, and that the 67 kD GAD form may contain autoantigenic epitopes not present on the 65 kD GAD form. Interestingly, the study shows that some patients had autoantibodies against 67 kD GAD, but not against 65 kD GAD.

REFERENCES

251) J.M. Chirgwin, A.E. Przybyla, R.J. MacDonald, W.J. Rutter Biochemistry (1979) 18:5294-5299

2) S.L. Berger, A.R. Kimmel (eds.) Methods in Enzymology, Academic Press, Inc. San Diego, CA (1987) 152:256-258

3) S.L. Berger, A.R. Kimmel (eds.) Methods in Enzymology, 0 Academic Press, Inc. San Diego, CA (1987) 152:320-321 4) S.L. Berger, A.R. Kimmel (eds.) Methods in Enzymology, Academic Press, Inc. San Diego, CA (1987) 152:330-333

5) S.L. Berger, A.R. Kimmel (eds.) Methods in Enzymology, Academic Press, Inc. San Diego, CA (1987) 152:346

56) A. Aruffo, B. Seed, Proc. Natl. Acad. Sci. USA (1987) 84:8573-8577

7) S.L. Berger, A.R. Kimmel (eds.) Methods in Enzymology, Academic Press, Inc. San Diego, CA (1987) 355

8) Dower W.J., Miller J.F. and Ragsdale C.W. , Nucl. Acids 10 Res. (1988) 16:6127-6145

9) S.L. Berger, A.R. Kimmel (eds.) Methods in Enzymology, Academic Press, Inc. San Diego, CA (1987) 399-413

10) Wyborski R.J., Bond R.W. , gottlieb D.I., 1990, Mol.Brain Res. 8, pp. 193-198.

1511) Christie M, Landin-Olsson M, Sundkvist G, Dahlquist G, Lernmark A and Baekkeskov S, Diabetologia (1988) 31:597-602

12) Atar D, Dyrberg T, Michelsen B, Karlsen A, Kofod H, Mølvig J, and Lernmark A, J. Immunol. (1989) 143:533-538

13) Baekkeskov S et al., Nature (1990) 347:151-156

Claims

1. A method of determining the presence of autoantibodies against an approximately 67 kD islet cell autoantigen (67 kD autoantibodies) in serum, which method comprises contacting a

5 serum sample with higher molecular weight glutamic acid decarboxylase (hMr GAD) or a fragment thereof capable of binding 67 kD autoantibodies, and detecting any binding of autoantibodies to the hMr GAD.

2. A method according to claim 1, wherein the hMr GAD is 10 employed in the absence of lower molecular weight GAD.

3. A method according to claim 1, wherein the serum sample is contacted with hMr GAD immobilised on a solid support, after which the solid support is contacted with a labelled reagent capable of binding to any autoantibody bound to the hMr GAD,

15 detection of any label bound to the solid support indicating the presence of 65 kD autoantibodies in the sample.

4. A method according to claim 3, wherein the labelled reagent is an antibody.

5. A method according to claim 4, wherein the antibody is an 20 anti-idiotype antibody.

6. A method according to claim 3, wherein the hMr GAD is bound to an antibody immobilised on the solid support, said antibody being reactive with an epitope of hMr GAD which does not participate in binding the 67 kD autoantibodies.

257. A method according to claim 6, wherein the antibody is one which is raised against a peptide fragment of hMr GAD.

8. A method according to claim 1, wherein the serum sample is contacted with hMr GAD immobilised on a solid support simultaneously with contacting the immobilised hMr GAD with a predetermined amount of a labelled antibody competing with the 67 kD autoantibody for binding to hMr GAD, detection of any decrease in the amount of labelled antibody bound to the solid support relative to the amount of labelled antibody added indicating the presence of 67 kD autoantibodies in the sample.

9. A method according to claim 8, wherein the labelled antibody is one which is raised against a peptide fragment of hMr GAD.

10. A method according to claim 8, wherein the hMr GAD is bound to an antibody immobilised on the solid support, said antibody being reactive with an epitope of hMr GAD which does not participate in binding the 67 kD autoantibodies.

11. A method according to claim 10, wherein the immobilised antibody is one which is raised against a peptide fragment of hMr GAD.

12. An antibody which is raised against a peptide fragment of higher molecular weight glutamic acid decarboxylase (hMr GAD) .

13. An antibody according to claim 12 which is raised against an epitope of hMr GAD which does not participate in binding 67 kD autoantibodies.

14. An antibody according to claim 12 or 13 immobilised on a solid support.

15. An antibody according to claim 12 which is raised against an epitope of hMr GAD which is reactive with the 67 kD autoantibody.

16. An antibody according to claim 12 or 15 provided with a label.

17. An antibody according to any of claims 12-16, wherein the peptide fragment is a fragment of brain or pancreas hMr GAD.

18. A test kit for determining the presence of autoantibodies against an approximately 67 kD islet cell autoantigen (67 kD

5 autoantibodies) in serum, which comprises, in separate containers,

(b) a labelled reagent capable of binding to the 67 kD 10 autoantibody.

19. A test kit according to claim 18, wherein the hMr GAD is bound to an antibody immobilised on the solid support, said antibody being reactive with an epitope of hMr GAD which does not participate in binding the 67 kD autoantibodies.

1520. A test kit according to claim 18 or 19, wherein the labelled reagent is an antibody.

21. A test kit for determining the presence of autoantibodies against an approximately 67 kD islet cell autoantigen (67 kD autoantibodies) in serum, which comprises, in separate 0 containers,

(a) an antibody reactive with an epitope of higher molecular weight glutamic acid decarboxylase (hMr GAD) which does not participate in binding the 67 kD autoantibodies, the antibody being immobilised on a solid support,

5 (b) hMr GAD, and

(c) a labelled reagent capable of binding to the 67 kD autoantibody.

22. A test kit according to claim 21, wherein the labelled reagent is an antibody.

23. A test kit for determining the presence of autoantibodies against an approximately 67 kD islet cell autoantigen (67 kD

5 autoantibodies) in serum, which comprises, in separate containers,

(b) a labelled antibody which is capable of competing with the 1067 kD autoantibody for binding to hMr GAD.

24. A method according to claim 23, wherein the labelled antibody is one which is raised against a peptide fragment of hMr GAD.

25. A test kit according to claim 23, wherein the hMr GAD is 15 bound to an antibody immobilised on the solid support, said antibody being reactive with an epitope of hMr GAD which does not participate in binding the 67 kD autoantibodies.

26. A test kit for determining the presence of autoantibodies against an approximately 67 kD islet cell autoantigen (67 kD 0 autoantibodies) in serum, which comprises, in separate containers,

(a) an antibody reactive with an epitope of higher molecular weight glutamic acid decarboxylase (hMr GAD) which epitope does not participate in binding the 67 kD autoantibodies, the 5 antibody being immobilised on a solid support,

(b) hMr GAD, and

(c) a labelled antibody which is capable of competing with the 67 kD autoantibody for binding to hMr GAD.