WO1992017204A1 - Circumsporozoite protein of plasmodium reichenowi and vaccine for human malaria - Google Patents

Circumsporozoite protein of plasmodium reichenowi and vaccine for human malaria Download PDF

Info

Publication number
WO1992017204A1
WO1992017204A1 PCT/US1992/002647 US9202647W WO9217204A1 WO 1992017204 A1 WO1992017204 A1 WO 1992017204A1 US 9202647 W US9202647 W US 9202647W WO 9217204 A1 WO9217204 A1 WO 9217204A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
region
amino acid
acid sequence
peptide
Prior art date
Application number
PCT/US1992/002647
Other languages
French (fr)
Inventor
Altaf A. Lal
Ira F. Goldman
Original Assignee
The United States Of America, Represented By The Secretary, United States Department Of Commerce
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The United States Of America, Represented By The Secretary, United States Department Of Commerce filed Critical The United States Of America, Represented By The Secretary, United States Department Of Commerce
Publication of WO1992017204A1 publication Critical patent/WO1992017204A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/44—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
    • C07K14/445—Plasmodium
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/20—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans from protozoa
    • C07K16/205—Plasmodium
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates, in general, to the molecular cloning and sequencing of a circumsporozoite protein, and, in particular, to the circumsporozoite protein of Plasmodium vraowi.
  • the invention further relates to antibodies to the protein, and vaccines to human malaria.
  • CS circumsporozoite
  • the gene encoding this parasite antigen has been cloned from three of the four human malaria parasites (McCutchan, et al., Science 230:1381-1383 (1985); Arnot, et al., Science 230:815-816 (1985); Symbol, et al. , Science 225:593-599 (1984); Enea, et al., 225:628-630 (1984); Lai, et al., Mol. Biochem.
  • T- or B-cell determinants in subunit vaccine is to use regions of the protein involved in host parasite interaction. Because of the stringent structural constraints for specific host-parasite interactions, it is expected that the domains of a parasite protein that interact with stable host cellular sequences or conformational determinants to be conserved.
  • the non-polymorphic regions of the CS protein would reside in the non polymorphic regions of the mole ⁇ cule.
  • the non-polymorphic regions of the CS protein would also contain determinants that confer structural characteristics, such as signal and anchor sequences. Even though an immune response against these biologic and structural determinants may interfere with protein functions, the former determinant could provide relatively accessible targets for immune intervention unlike the often buried structural domains of the protein.
  • the inventor's approach in identifying these biologic regions uses comparison of protein sequences in evolutionarily related malaria parasites.
  • the underlying principle is that the conserved regions of the CS protein in a parasite population within a species are essential for structural and biologic (host-parasite) functions, and any differences in these regions in evolutionarily related malaria parasites adapted to different hosts may indicate changes associated with adaptation to a particular host type.
  • regions in the CS protein that vary between closely related parasites but are conserved within P. falciparum populations may possess biologically functional determinants.
  • the gene encoding the circumsporozoite protein of Plasmodium vraowi. a P. falciparum-like malaria parasite of chimpanzees has been cloned and sequenced.
  • the deduced protein shares sequence similarity with the CS protein of P. falciparum. Compari ⁇ son of the two CS proteins, however, reveals differences that could be significant in host-parasite interaction in these evolutionarily related parasites which have adapted to different hosts.
  • the P. venezowi protein also has a new repeat sequence NVNP in addition to £. falciparum like NANP and NVDP. Amino acids in the TH2R and TH3R regions are similar in both CS proteins. Since the sporozoite stage of the parasite initiates infection, and the surface antigen must play a
  • SUBSTITUTE SHEET key role in host cell recognition and subsequent development, the differences in the proteins from these evolutionarily related parasites may be functionally (biologically) significant. Unlike the polymorphic immunodominant determinants, use of these regions in malaria vaccine development will be beneficial because of their stable nature, if they prove effective targets in blocking host-parasite interactions in P. falciparum malaria. In conclusion, in order for a parasite to establish itself in particular biological environment where attachment and invasion are prerequisites for subsequent development, the regions involved in highly specific host-parasite interactions are conserved within species but may differ even between evolutionarily related parasite pairs.
  • the inventors have undertaken characterization of vaccine-related, stage-specific proteins of P. venezowi in order to identify differences with homolo- gous proteins of £. falciparum.
  • sequence of the CS protein gene of £. vraowi and identification of three regions of the protein that are different from the CS protein of £. falciparum. These unique regions are useful as antigenic determinants for obtaining antibodies to the £. falciparum protein, which antibodies are useful in vaccine for humans against malaria.
  • the present invention relates to a recombinantly produced or synthetic circumsporozoite protein of Plasmodium vraowi.
  • the present invention relates to a DNA fragment that encodes circumsporozoite protein of Plasmodium vraowi.
  • the DNA fragment encodes the amino acid sequence set forth in Figures 1A- 1C, and has the sequence of bases designated in Figures 1A-1C.
  • the present invention relates to a recombinantly produced or synthetic circum- sporozoite peptide molecule of Plasmodium falciparum consisting essentially of the amino acid sequence in pre- Region I of the CS protein, as set forth in Figure 3A.
  • the invention also relates to a recombinantly produced or synthetic circumsporozoite peptide molecule of Plasmodium falciparum consisting essentially of the sequence amino to Region II of the CS protein as set forth in Figure 3B, as well as to a recombinantly produced or synthetic circum ⁇ sporozoite peptide molecule of Plasmodium falciparum
  • the present invention relates to DNA fragments that encode the £. falciparum peptide molecules of the circumsporozoite protein.
  • the present invention relates to a recombinant DNA construct comprising: (i) a vector, and
  • the present invention relates to a host cell transformed with one of the recom ⁇ binant DNA constructs described above, in a manner allow ⁇ ing expression of the peptide molecule or protein.
  • the host cell may be a procaryotic cell or a eucaryotic cell.
  • the invention further relates to antibodies specific for the peptide molecules.
  • the invention also relates to vaccines for humans against malaria infection (for example, an infection caused by P. falciparum) consisting of one or more of the peptide molecules described above, in an amount sufficient to induce immu ⁇ nity against infection, and a pharmaceutically acceptable carrier.
  • Figures 1A-1C The nucleotide sequence and the deduced amino acid sequence of the CB protein of P. venezowi. The deduced amino acid sequence is given beneath the nucleotide sequence. The two conserved regions. Regions I and II, are marked. The repeat units
  • DADGN, NVNP, and NVDP are boxed, and the repeat NANP is underlined.
  • Figure 2 Comparison of the amino acid sequence of the CS protein of P. falciparum and P. venezowi. Single-letter, amino acid-coded, deduced amino acid * sequence of the 7G8 strain of £. falciparum (4, upper row) and £. yerowi CS protein (lower row) is shown. Dots indicate similar amino acids. The repeat sequence DADNG (underlined), NVDP, and NVNP (double underlined) are shown. The dashes indicate absence, and asterisks above amino acid residues indicate polymorphic positions in the £. falciparum CS protein.
  • Figures 3A-3C Sequence variation between the CS protein of P. rittowi and P. falciparum (7GB strain) . Species-specific nucleotide and amino acid residues are boxed. A) sequence variation in the pre-Region I region. B) sequence variation amino to the region II area of the protein. C) sequence variation carboxyl to the Region II of the CS protein. Polymorphic amino acids in the CS protein of £. falciparum are shown at respective positions (Casper, et al., Mol. Biochem. Parasitol. 35:185-190 (1989)).
  • Figure 4 Comparison of the sequence of the repetitive regions of the CS protein gene of P. rittowi and P. falciparum (7G8 strain). Silent and non-silent nucleotide substitutions are shown by upper case and lower case letters. Amino acid sequence is shown above the nucleotide sequence.
  • the present invention relates to a recombinantly produced or synthetic circumsporozoite protein of £.
  • the protein contemplated has an amino acid sequence corresponding to that shown in Figures 1A-1C, or is the functional equivalent.
  • the present invention also relates to a DNA fragment that encodes the CS protein of £. vraowi.
  • the DNA fragment contemplated encodes the amino acid sequence set forth in Figures 1A-1C.
  • the protein can have the complete sequence given in Figures 1A-1C, and can have the amino acid sequence of a molecule having substantially the same properties of the protein corresponding to Figures 1A-1C (for example, allelic variations of the CS protein of £. vraowi).
  • the present invention relates to a recombinantly produced or synthetic CS peptide molecule of Plasmodium falciparum, the amino acid sequence of which corresponds to pre-Region I of the CS protein, as set forth in Figure 3A.
  • the invention also relates to a DNA fragment that encodes the peptide.
  • the present invention relates to a recombinantly produced or synthetic CS peptide molecule of Plasmodium falciparum, the amino acid sequence of which corresponds to the sequence amino to Region II of the CS protein, as set forth in Figure 3B.
  • the invention also relates to a DNA fragment that encodes the peptide.
  • the present invention relates to a recombinantly produced or synthetic CS peptide molecule of Plasmodium falciparum, the amino acid sequence of which corresponds to the sequence carboxyl to Region II of the CS protein, as set forth in Figure 3C.
  • the invention also relates to a DNA fragment that encodes the peptide.
  • the above-described protein and peptides of the present invention can be present in a substantially pure form, that is, in a form substantially free of proteins and nucleic acids with which they are normally associated.
  • the above-described proteins can be purified using proto ⁇ cols known in the art.
  • the present invention also relates to a recom ⁇ binant DNA construct that includes a vector and one of the DNA sequences as described above.
  • the DNA sequence encodes one of the amino acid sequences shown in Figures 1A, 1B, 1C, 3A, 3B or 3C.
  • a recombinant DNA construct comprising a vector and one of the above-described DNA fragments can be constructed without undue experimenta ⁇ tion.
  • the vector can take the form of a virus, mammalian, or a plasmid expression vector.
  • the recombinant construct can be suitable for transforming procaryotic or eukaryotic cells.
  • the present invention also relates to a host cell transformed with one of the above-described recombi- nant molecules.
  • the host can be procaryotic (for example, bacterial), lower eukaryotic (for example, fungal, includ ⁇ ing yeast) or higher eukaryotic (for example, all mammalian, including but not limited to human).
  • Transfor ⁇ mation can be effected using methods known in the art.
  • the transformed host cells can be used as a source for the DNA sequences described above (which sequence constitutes a part of the recombinant construct).
  • the transformed cells can be used as a source for the above- described CS protein and/or peptides.
  • the present invention relates to substantially pure forms of antibodies specific for the CS protein of £. venezowi described above.
  • the invention also relates to antibodies specific for peptide molecules of £. falciparum having the amino acid sequence of pre-Region I (shown in Figure 3A), the sequence amino to Region II (shown in Figure 3B), or the sequence carboxyl to Region II (shown in Figure 3C) .
  • the antibodies can be specific to the peptides produced from the above-described transformed host cells.
  • One skilled in the art can raise monoclonal antibodies and polyclonal antibodies specific to at least one of the peptides (or a unique portion of the peptide) . The comparison of P. vraowi and P.
  • falciparum CS proteins has identified regions amino to the Region 1 and TH2R, and the alternating major minor repeat pattern that differ between the two proteins. Since these regions are conserved in the £. falciparum parasite populations, the essential determinants of parasite proteins may reside in these regions. To the knowledge of the inventors, these regions of the CS protein have not been explored for anti-parasite activity. These regions can be useful in overcoming obstacles in vaccine develop ⁇ ment, and their use independently or in conjunction with immunodominant epitopes in multivalent vaccine is warranted.
  • the present invention includes a vaccine for use in humans against malarial infection by P. falciparum.
  • a non-infectious antigenic portion of the above-described CS peptide molecule having the sequence of pre-Region I can be delivered to a human in a pharmacologi ⁇ cally acceptable vehicle.
  • the peptide molecule having the sequence amino to Region II can be delivered to a human.
  • the peptide molecule having the sequence carboxyl to Region II (shown in Figure 3C) can be delivered to a human.
  • Vac ⁇ cines of the present invention can include effective amounts of immunological adjuvants known to enhance an immune response.
  • the non-infectious portion of the peptide molecules can be in the vaccine in an amount sufficient to induce an immune response against the antigenic portion and thus to protect against human malarial infection by P. falciparum.
  • Protective antibodies are usually best elicited by a series of 2-3 doses given about 2 to 3 weeks apart. The series can be repeated when the concentration of circulating antibodies concentration in the patient drops.
  • the present invention can also be useful in determining antigenic determinants within proteins spe ⁇ cific to stages other than the sporozoite stage, for instance, the blood stage.
  • blood stage antigens can be detected using erythrocyte binding antigen 175. This can be effected using techniques well known in the art.
  • the CS gene was amplified from the genomic DNA (Saiki, et al.. Science 239:487-491 (1988)) using the amplification primer sequences ATGATGAGAAAATTAGCTATT and CTAATTAAGGAACAAGAAGG, which correspond to the two ends of the £. falciparum CS gene (Dame, et al., Science 225:593-599 (1984)).
  • the reason for using £. falciparum primers for £. vraowi CS gene amplification was based on hybridization experiments where primer oligonucleotides and those complementary to the repeats and conserved region hybridized to DNA of both parasites.
  • the DNA fragments were purified on an agarose gel, kinased, and cloned into
  • UBSTITUTESHEET the dephosphorylated Sma- site of pUC19.
  • the amplification primers were constructed to carry EcoR-I and BamH-I restriction sites. Fragments derived from such amplifications were cloned in plasmid DNA cleaved to expose the respective restriction sites. The recombinant molecules were used to transform the Escherichia coli strain DHmax. Colonies were trans ⁇ ferred to nitrocellulose disks and probed with the genus- conserved Region II oligonucleotide probe CCATGTAGTGTAA- CTTGTGGA.
  • plasmid DNA was prepared, and the sequence was determined using the dideoxy procedures and sequence-specific oligonucleotides as primers (Sanger, et al., PNAS USA 74:5463-5467 (1977)). Amplification of the genomic DNA of P. venezowi yielded a fragment of about 1.2 kb that hybridized to the oligonucleotides representative of the conserved region, Region II. In order to ensure that the sequence data were free of polymerase-induced artifacts, the genomic DNA of £. vraowi was amplified thrice, and in one case the CS fragments obtained were re-amplified.
  • the CS gene of £. vraowi is 1167 base pairs long (Fig. 1).
  • the CS gene fragment of £. vraowi yields a deduced protein of 389 amino acids, with features common to the CS genes of other malaria parasites: 5' and 3' hydrophobic signal and anchor regions, central repetitive region, and genus conserved Region I and Region II flanking the repetitive part of the gene.
  • falciparum reveals an overall 83% identity at the amino acid level and identifies regions that are different between the CS proteins of these two species.
  • Out of the first 77 amino acids in the amino terminus there are only two silent third base changes, and in 33 amino acids at the carboxyl terminus, including Region II, there are three silent nucleotide changes.
  • These regions of the protein contain putative signal and anchor sequences of the protein, and their similarity reflects a striking degree of homology of the two species of parasites. Comparison of the two CS proteins in the remainder of the molecule is given below.
  • THE CS IMMUNODOMINANT REPEAT REGION In contrast to the £. falciparum CS protein which has 36 to 43 copies of the tetramer repeat Asn-Ala-Asn-Pro (NANP) and 3-4 copies of Asn-Val-Asp-Pro (NVDP), depending upon the isolate sequenced (Lockyer, et al., Mol. Biochem. Parasitol. 37:275-280 (1989)), the CS protein of £. vraowi contains 26 copies of NANP, 6 copies of NVDP, and 4 copies of a sequence Asn-Val-Asn-Pro (NVNP) (Figs. 1A-1C,2). In the first half of the repeat region, the £.
  • kohli CS protein is organized such that the major repeat sequence, NANP, alternates with the minor repeat sequences, NVDP and NVNP (Figs. 1A-1C,2).
  • NANP major repeat sequence
  • NVDP minor repeat sequences
  • Figs. 1A-1C 2
  • Previous comparison of the repeat sequences of the CS protein genes of £. falciparum had suggested a non-random component to mechanism(s) of evolution operating at the DNA level potentially leading to emergence and expansion of new variant repeats (de la Cruz, et al., J. Biol. Chem. 262:11935-11939 (1987)), a feature also seen in CS proteins of simian malaria para- sites (Sharma, et al., Science 229:779-782 (1985); Galinsky, et al., Cell 48:311-319 (1987)).
  • this region of the CS protein of £. falciparum exhibits size polymorphism.
  • the NF54 train CS protein has a 57 bp deletion (Casper, et al., Mol. Biochem. Parasitol. 35 185-190 (1989)), and Wei and Bll CS proteins have a 30 bp insertion (de la Cruz, et al., J. Biol. Chem. 262:11935-11939 (1987)). Therefore, the inventors compared the CS amino acid sequences of £. yerowi with £. falciparum carboxyl to the deletion/insertion site of £. falciparum (Fig 3A).
  • REGION AMINO AND CARBOXYL TO REGION II The polymorphic regions H2R and' TH3R, located amino and carboxyl to Region-II, carry the helper, proliferative, and cytotoxic T-cell activity of the P. falciparum CS protein (Good, et al., Science 235:1059-1062 (1987); Kumar, et al.. Nature 334:258-260 (1988)). Comparison of £. vraowi and P. falciparum CS proteins in these regions yields both a similarity and difference. First, common amino acid residues are found within the TH2R and TH3R regions in the CS proteins from these two species.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The subject invention relates to cDNA of the circumsporozoite (CS) protein of Plasmodium reichenowi, and to the CS protein expressed by the cDNA. Comparison of the CS proteins of Plasmodium reichenowi and Plasmodium falciparum has revealed differences that could be significant in host-parasite interaction, and provide stable antigenic determinants for vaccine development against human malarial infection. Accordingly, the present invention relates to the specific peptides that make up the regions of differences between the two Plasmodium species, and to the DNA fragments encoding them. The invention also relates to DNA constructs containing at least one of the DNA fragments, and to host cells stably transformed therewith. The invention further relates to antibodies specific to the peptide molecules of Plasmodium falciparum, and to vaccines for humans against infection by this species.

Description

CIRCUMSPOROZOITE PROTEIN OF PLASMODIUM REICHENOWI AND VACCINE FOR HUMAN MALARIA
BACKGROUND OF THE INVENTION Technical Field
The present invention relates, in general, to the molecular cloning and sequencing of a circumsporozoite protein, and, in particular, to the circumsporozoite protein of Plasmodium reichenowi. The invention further relates to antibodies to the protein, and vaccines to human malaria.
Background Information The circumsporozoite (CS) protein, a species- and stage-specific sporozoite surface protein, is the focus of intense effort in the development of malaria vaccines (Miller, et al., Science 234:1346-1356 (1986)). The gene encoding this parasite antigen has been cloned from three of the four human malaria parasites (McCutchan, et al., Science 230:1381-1383 (1985); Arnot, et al., Science 230:815-816 (1985); Dame, et al. , Science 225:593-599 (1984); Enea, et al., 225:628-630 (1984); Lai, et al., Mol. Biochem. Parasitol. 30:291-294 (1988)). Current approaches in sporozoite vaccine pro¬ duction involve assembling the B- and T-cell determinants for inducing protective antibody and cell-mediated arms of the host immune system. However, human and rodent vaccine trials using synthetic or recombinant repeat sequences have failed to consistently produce protective antibody responses (Lai, et al., PNAS USA 84:8647-8651 (1987); Eagan, et al., Science 236:453-456 (1987); Zavala, et al., J. EXP. Med. 166:591-1595 (1987); Herrington, et al., Nature 328:257-259 (1987); Ballou, et al., Lancet June 6, 1277-1281 (1987)). In a recent rodent model study, the CS recombinant live vaccines failed to confer protection against sporozoite challenge despite eliciting CS specific cytotoxic immune response (Weiss, et al., j. Ex . Med. 171:763-767 (1990)). Genetic non-responsiveness and polymorphism in the T- and B-cell determinants is also anticipated to affect vaccine efficacy even if an effective means of inducing protective immunity is devel¬ oped using these determinants (Good, et al., J. Exp. Med. 164:655-660 (1986); Good, et al.., PNAS USA, 85:1199-1203 (1988); Rosenberg, et al., Science 245:973-976 (1990)). An alternate approach to using T- or B-cell determinants in subunit vaccine is to use regions of the protein involved in host parasite interaction. Because of the stringent structural constraints for specific host-parasite interactions, it is expected that the domains of a parasite protein that interact with stable host cellular sequences or conformational determinants to be conserved.
This would imply that the regions of the CS protein that interact with hepatocyte surface protein(s) would reside in the non polymorphic regions of the mole¬ cule. The non-polymorphic regions of the CS protein, however, would also contain determinants that confer structural characteristics, such as signal and anchor sequences. Even though an immune response against these biologic and structural determinants may interfere with protein functions, the former determinant could provide relatively accessible targets for immune intervention unlike the often buried structural domains of the protein. The inventor's approach in identifying these biologic regions uses comparison of protein sequences in evolutionarily related malaria parasites. The underlying principle is that the conserved regions of the CS protein in a parasite population within a species are essential for structural and biologic (host-parasite) functions, and any differences in these regions in evolutionarily related malaria parasites adapted to different hosts may indicate changes associated with adaptation to a particular host type. Thus, regions in the CS protein that vary between closely related parasites but are conserved within P. falciparum populations may possess biologically functional determinants.
The similarities in morphology and development between P. reichenowi, a malaria parasite of chimpanzees, and P. falciparum are unique among malaria parasites (Bray, et al., J. Parasitol.. 42:588-592 (1956); Collins, et al., J. Parasit. 72:292-298 (1986)). Only P. reichenowi, as seen in the peripheral blood of chimpan- zees, resembles £. falciparum in the peripheral blood of man. Moreover, P. falciparum and P. reichenowi are the only two species of malaria parasites with slender game- tocyte (Garnham, et al., Ann. Soc. Belσe Med. Trop. 36:811-821 (1956)). Based on these observations and DNA hybridization results, their close evolutionary relation¬ ship has been acknowledged (Lai, et al., J. Biol. Chem. 263:5495-5498 (1988); Coatney, G.R., Collins, W.E., Warren, M. , and Contacos, P.G. (1971) The Primate Malarias. Department of Health and Human Service, Wash. D.C.), even though they have adapted to different hosts. Although P. falciparum naturally infects human, its sporozoite will only cause infection in chimpanzees if the animal is splenectomized (Walliker, et al. Science 236:1661-1666 (1987)). Sporozoite-induced P. reichenowi infection of humans has not been attempted, but the blood stage forms of this parasite do not infect humans (Adler, et al., Ann. Trop. Med. Parasit. 17:13-19 (1923)).
In the present invention, the gene encoding the circumsporozoite protein of Plasmodium reichenowi. a P. falciparum-like malaria parasite of chimpanzees, has been cloned and sequenced. The deduced protein shares sequence similarity with the CS protein of P. falciparum. Compari¬ son of the two CS proteins, however, reveals differences that could be significant in host-parasite interaction in these evolutionarily related parasites which have adapted to different hosts.
These differences are around the conserved regions, Region I and Region II of the protein. The P. reichenowi protein also has a new repeat sequence NVNP in addition to £. falciparum like NANP and NVDP. Amino acids in the TH2R and TH3R regions are similar in both CS proteins. Since the sporozoite stage of the parasite initiates infection, and the surface antigen must play a
SUBSTITUTE SHEET key role in host cell recognition and subsequent development, the differences in the proteins from these evolutionarily related parasites may be functionally (biologically) significant. Unlike the polymorphic immunodominant determinants, use of these regions in malaria vaccine development will be beneficial because of their stable nature, if they prove effective targets in blocking host-parasite interactions in P. falciparum malaria. In conclusion, in order for a parasite to establish itself in particular biological environment where attachment and invasion are prerequisites for subsequent development, the regions involved in highly specific host-parasite interactions are conserved within species but may differ even between evolutionarily related parasite pairs. If these differing domains prove useful as targets to intervene in host-parasite interactions, then similar sequence comparisons between the asexual and sexual stage antigens of these two parasites should also be conducted. Such comparison will provide vaccine developers with additional information on the biologic regions of these molecules to target host parasite inter¬ actions at several stages. Similar approaches might also be considered in vaccine production against other infec- tious diseases, such as viruses, where evolutionarily related forms exist.
The inventors have undertaken characterization of vaccine-related, stage-specific proteins of P. reichenowi in order to identify differences with homolo- gous proteins of £. falciparum. Here is presented the sequence of the CS protein gene of £. reichenowi and identification of three regions of the protein that are different from the CS protein of £. falciparum. These unique regions are useful as antigenic determinants for obtaining antibodies to the £. falciparum protein, which antibodies are useful in vaccine for humans against malaria.
TUTESHEET SUMMARY OF THE INVENTION It is an object of the present invention to provide a circumsporozoite protein of P. reichenowi.
It is another object of the present invention to provide a DNA encoding for the CS protein of £. reichenowi, as well as DNA segments that encode peptide molecules of Plasmodium falciparum consisting essentially of the amino acid sequence in pre-Region I of the CS protein as set forth in Figure 3A, or the sequence amino to Region II of the CS protein as set forth in Figure 3B, or the sequence carboxyl to Region II of the CS protein as set forth in Figure 3C.
It is a further object of the present invention to provide vaccines against human malarial infection, such as that caused by £. falciparum.
Further objects and advantages of the present invention will become clear from the description that follows.
In one embodiment, the present invention relates to a recombinantly produced or synthetic circumsporozoite protein of Plasmodium reichenowi.
In another embodiment, the present invention relates to a DNA fragment that encodes circumsporozoite protein of Plasmodium reichenowi. The DNA fragment encodes the amino acid sequence set forth in Figures 1A- 1C, and has the sequence of bases designated in Figures 1A-1C.
In a further embodiment, the present invention relates to a recombinantly produced or synthetic circum- sporozoite peptide molecule of Plasmodium falciparum consisting essentially of the amino acid sequence in pre- Region I of the CS protein, as set forth in Figure 3A. The invention also relates to a recombinantly produced or synthetic circumsporozoite peptide molecule of Plasmodium falciparum consisting essentially of the sequence amino to Region II of the CS protein as set forth in Figure 3B, as well as to a recombinantly produced or synthetic circum¬ sporozoite peptide molecule of Plasmodium falciparum
ET consisting essentially of the sequence carboxyl to Region II of the CS protein as set forth in Figure 3C. In another embodiment, the present invention relates to DNA fragments that encode the £. falciparum peptide molecules of the circumsporozoite protein.
In another embodiment, the present invention relates to a recombinant DNA construct comprising: (i) a vector, and
(ii) one of the above-described DNA fragments. In yet another embodiment, the present invention relates to a host cell transformed with one of the recom¬ binant DNA constructs described above, in a manner allow¬ ing expression of the peptide molecule or protein. The host cell may be a procaryotic cell or a eucaryotic cell. The invention further relates to antibodies specific for the peptide molecules. The invention also relates to vaccines for humans against malaria infection (for example, an infection caused by P. falciparum) consisting of one or more of the peptide molecules described above, in an amount sufficient to induce immu¬ nity against infection, and a pharmaceutically acceptable carrier.
BRIEF DESCRIPTION OF THE FIGURES
Figures 1A-1C: The nucleotide sequence and the deduced amino acid sequence of the CB protein of P. reichenowi. The deduced amino acid sequence is given beneath the nucleotide sequence. The two conserved regions. Regions I and II, are marked. The repeat units
DADGN, NVNP, and NVDP are boxed, and the repeat NANP is underlined.
Figure 2: Comparison of the amino acid sequence of the CS protein of P. falciparum and P. reichenowi. Single-letter, amino acid-coded, deduced amino acid * sequence of the 7G8 strain of £. falciparum (4, upper row) and £. reichenowi CS protein (lower row) is shown. Dots indicate similar amino acids. The repeat sequence DADNG (underlined), NVDP, and NVNP (double underlined) are shown. The dashes indicate absence, and asterisks above amino acid residues indicate polymorphic positions in the £. falciparum CS protein.
Figures 3A-3C: Sequence variation between the CS protein of P. reichenowi and P. falciparum (7GB strain) . Species-specific nucleotide and amino acid residues are boxed. A) sequence variation in the pre-Region I region. B) sequence variation amino to the region II area of the protein. C) sequence variation carboxyl to the Region II of the CS protein. Polymorphic amino acids in the CS protein of £. falciparum are shown at respective positions (Casper, et al., Mol. Biochem. Parasitol. 35:185-190 (1989)).
Figure 4: Comparison of the sequence of the repetitive regions of the CS protein gene of P. reichenowi and P. falciparum (7G8 strain). Silent and non-silent nucleotide substitutions are shown by upper case and lower case letters. Amino acid sequence is shown above the nucleotide sequence.
DETAILED DESCRIPTION OF THE INVENTION The B and T epitopes on malarial circum¬ sporozoite proteins have been identified, and even though both antibody and CMI against the CS protein are indepen¬ dently capable of providing protection against sporozoite challenge, clear examples exist where each has failed to protect (Lai, et al., PNAS USA 84:8647-8651 (1987); Eagan, et al.. Science 236:453-456 (1987); Zavala, et al.. J. EXP. Med. 166:591-1595 (1987); Herrington, et al.. Nature 328:257-259 (1987); Ballou, et al., Lancet June 6, 1277-1281 (1987); Weiss, et al., J. EXP. Med. 171:763-767 (1990)). In addition, design of a sporozoite vaccine is fraught with problems, ranging from genetic nonresponsive- ness to determinant polymorphism (Good, et al., J. EXP. Med. 164:655-660 (1986); Good, et al., PNAS USA. 85:1199-1203 (1988); Rosenberg, et al.. Science 245:973- 976 (1990)). Accordingly, the present invention answers a well known problem in the field.
The present invention relates to a recombinantly produced or synthetic circumsporozoite protein of £.
SUBSTITUTE SHEET reichenowi. The protein contemplated has an amino acid sequence corresponding to that shown in Figures 1A-1C, or is the functional equivalent.
The present invention also relates to a DNA fragment that encodes the CS protein of £. reichenowi. The DNA fragment contemplated encodes the amino acid sequence set forth in Figures 1A-1C. The protein can have the complete sequence given in Figures 1A-1C, and can have the amino acid sequence of a molecule having substantially the same properties of the protein corresponding to Figures 1A-1C (for example, allelic variations of the CS protein of £. reichenowi).
In another embodiment, the present invention relates to a recombinantly produced or synthetic CS peptide molecule of Plasmodium falciparum, the amino acid sequence of which corresponds to pre-Region I of the CS protein, as set forth in Figure 3A. The invention also relates to a DNA fragment that encodes the peptide.
In a further embodiment, the present invention relates to a recombinantly produced or synthetic CS peptide molecule of Plasmodium falciparum, the amino acid sequence of which corresponds to the sequence amino to Region II of the CS protein, as set forth in Figure 3B. The invention also relates to a DNA fragment that encodes the peptide.
In another embodiment, the present invention relates to a recombinantly produced or synthetic CS peptide molecule of Plasmodium falciparum, the amino acid sequence of which corresponds to the sequence carboxyl to Region II of the CS protein, as set forth in Figure 3C. The invention also relates to a DNA fragment that encodes the peptide.
The above-described protein and peptides of the present invention can be present in a substantially pure form, that is, in a form substantially free of proteins and nucleic acids with which they are normally associated. The above-described proteins can be purified using proto¬ cols known in the art. The present invention also relates to a recom¬ binant DNA construct that includes a vector and one of the DNA sequences as described above. Advantageously, the DNA sequence encodes one of the amino acid sequences shown in Figures 1A, 1B, 1C, 3A, 3B or 3C. Using standard method¬ ology well known in the art, a recombinant DNA construct comprising a vector and one of the above-described DNA fragments can be constructed without undue experimenta¬ tion. The vector can take the form of a virus, mammalian, or a plasmid expression vector. The recombinant construct can be suitable for transforming procaryotic or eukaryotic cells.
The present invention also relates to a host cell transformed with one of the above-described recombi- nant molecules. The host can be procaryotic (for example, bacterial), lower eukaryotic (for example, fungal, includ¬ ing yeast) or higher eukaryotic (for example, all mammalian, including but not limited to human). Transfor¬ mation can be effected using methods known in the art. The transformed host cells can be used as a source for the DNA sequences described above (which sequence constitutes a part of the recombinant construct). When the recombi¬ nant construct takes the form of an expression system, the transformed cells can be used as a source for the above- described CS protein and/or peptides.
The present invention relates to substantially pure forms of antibodies specific for the CS protein of £. reichenowi described above. In a preferred embodiment, the invention also relates to antibodies specific for peptide molecules of £. falciparum having the amino acid sequence of pre-Region I (shown in Figure 3A), the sequence amino to Region II (shown in Figure 3B), or the sequence carboxyl to Region II (shown in Figure 3C) . The antibodies can be specific to the peptides produced from the above-described transformed host cells. One skilled in the art can raise monoclonal antibodies and polyclonal antibodies specific to at least one of the peptides (or a unique portion of the peptide) . The comparison of P. reichenowi and P. falciparum CS proteins has identified regions amino to the Region 1 and TH2R, and the alternating major minor repeat pattern that differ between the two proteins. Since these regions are conserved in the £. falciparum parasite populations, the essential determinants of parasite proteins may reside in these regions. To the knowledge of the inventors, these regions of the CS protein have not been explored for anti-parasite activity. These regions can be useful in overcoming obstacles in vaccine develop¬ ment, and their use independently or in conjunction with immunodominant epitopes in multivalent vaccine is warranted.
Accordingly, the present invention includes a vaccine for use in humans against malarial infection by P. falciparum. In one embodiment of this aspect of the invention, as is customary for vaccines, a non-infectious antigenic portion of the above-described CS peptide molecule having the sequence of pre-Region I (shown in Figure 3A) can be delivered to a human in a pharmacologi¬ cally acceptable vehicle. In a further embodiment of this aspect of the invention, the peptide molecule having the sequence amino to Region II (shown in Figure 3B) can be delivered to a human. In yet another embodiment, the peptide molecule having the sequence carboxyl to Region II (shown in Figure 3C) can be delivered to a human. Vac¬ cines of the present invention can include effective amounts of immunological adjuvants known to enhance an immune response. The non-infectious portion of the peptide molecules can be in the vaccine in an amount sufficient to induce an immune response against the antigenic portion and thus to protect against human malarial infection by P. falciparum. Protective antibodies are usually best elicited by a series of 2-3 doses given about 2 to 3 weeks apart. The series can be repeated when the concentration of circulating antibodies concentration in the patient drops.
T Besides identifying differences in protein sequences for vaccine development purposes, studies of this type also increase knowledge of animal reservoir. If a parasite that infects humans can adapt reversibly to alternate hosts, its subsequent re-entry into human populations would be detrimental to a vaccination program. Genetic studies of parasite forms that are evolutionarily related to human parasites are useful in addressing these problems. The present invention can also be useful in determining antigenic determinants within proteins spe¬ cific to stages other than the sporozoite stage, for instance, the blood stage. For example, blood stage antigens can be detected using erythrocyte binding antigen 175. This can be effected using techniques well known in the art.
The invention is described in further detail in the following non-limiting Examples.
Examples The P. reichenowi parasites, originally obtained from a naturally infected chimpanzee, were passaged to a splenectomized chimpanzee (Fuji) (Collins, et al., J. Parasit. 72:292-298 (1986)). The genomic DNA was prepared from a saponin lysed blood preparation (Dame, et al., Mol. Biochem. Parasitol. 8:263-280 (1983))
Gene Amplification, Cloning, and Nucleotide Sequence Determination: The CS gene was amplified from the genomic DNA (Saiki, et al.. Science 239:487-491 (1988)) using the amplification primer sequences ATGATGAGAAAATTAGCTATT and CTAATTAAGGAACAAGAAGG, which correspond to the two ends of the £. falciparum CS gene (Dame, et al., Science 225:593-599 (1984)). The reason for using £. falciparum primers for £. reichenowi CS gene amplification was based on hybridization experiments where primer oligonucleotides and those complementary to the repeats and conserved region hybridized to DNA of both parasites. At the end of amplification, the DNA fragments were purified on an agarose gel, kinased, and cloned into
UBSTITUTESHEET the dephosphorylated Sma- site of pUC19. In some ampli¬ fication experiments, the amplification primers were constructed to carry EcoR-I and BamH-I restriction sites. Fragments derived from such amplifications were cloned in plasmid DNA cleaved to expose the respective restriction sites. The recombinant molecules were used to transform the Escherichia coli strain DHmax. Colonies were trans¬ ferred to nitrocellulose disks and probed with the genus- conserved Region II oligonucleotide probe CCATGTAGTGTAA- CTTGTGGA. Positive colonies were identified, plasmid DNA was prepared, and the sequence was determined using the dideoxy procedures and sequence-specific oligonucleotides as primers (Sanger, et al., PNAS USA 74:5463-5467 (1977)). Amplification of the genomic DNA of P. reichenowi yielded a fragment of about 1.2 kb that hybridized to the oligonucleotides representative of the conserved region, Region II. In order to ensure that the sequence data were free of polymerase-induced artifacts, the genomic DNA of £. reichenowi was amplified thrice, and in one case the CS fragments obtained were re-amplified. Both the amplified and re-amplified fragments were cloned, and the sequence of one clone from each of these amplifi¬ cation runs was determined. The CS gene of the 7G8 clone of £. falciparum was amplified, cloned, and sequenced under identical conditions as a control.
The CS gene of £. reichenowi is 1167 base pairs long (Fig. 1). The sequences of three clones, including the clone obtained from re-amplified fragments, were the same, and the sequence of the 7G8 CS gene was in agreement with the published sequence (Dame, et al., Science 225:593-599 (1984)). The CS gene fragment of £. reichenowi yields a deduced protein of 389 amino acids, with features common to the CS genes of other malaria parasites: 5' and 3' hydrophobic signal and anchor regions, central repetitive region, and genus conserved Region I and Region II flanking the repetitive part of the gene. Comparison of the CS protein of P. reichenowi with the CS protein of P. falciparum reveals an overall 83% identity at the amino acid level and identifies regions that are different between the CS proteins of these two species. Out of the first 77 amino acids in the amino terminus, there are only two silent third base changes, and in 33 amino acids at the carboxyl terminus, including Region II, there are three silent nucleotide changes. These regions of the protein contain putative signal and anchor sequences of the protein, and their similarity reflects a striking degree of homology of the two species of parasites. Comparison of the two CS proteins in the remainder of the molecule is given below.
THE CS IMMUNODOMINANT REPEAT REGION: In contrast to the £. falciparum CS protein which has 36 to 43 copies of the tetramer repeat Asn-Ala-Asn-Pro (NANP) and 3-4 copies of Asn-Val-Asp-Pro (NVDP), depending upon the isolate sequenced (Lockyer, et al., Mol. Biochem. Parasitol. 37:275-280 (1989)), the CS protein of £. reichenowi contains 26 copies of NANP, 6 copies of NVDP, and 4 copies of a sequence Asn-Val-Asn-Pro (NVNP) (Figs. 1A-1C,2). In the first half of the repeat region, the £. reichenowi CS protein is organized such that the major repeat sequence, NANP, alternates with the minor repeat sequences, NVDP and NVNP (Figs. 1A-1C,2). Previous comparison of the repeat sequences of the CS protein genes of £. falciparum had suggested a non-random component to mechanism(s) of evolution operating at the DNA level potentially leading to emergence and expansion of new variant repeats (de la Cruz, et al., J. Biol. Chem. 262:11935-11939 (1987)), a feature also seen in CS proteins of simian malaria para- sites (Sharma, et al., Science 229:779-782 (1985); Galinsky, et al., Cell 48:311-319 (1987)). Our observa¬ tion of a new repeat sequence, NVNP, and expansion of NVDP may indicate the result of such events in £. reichenowi. The two parasite CS genes, however, seem to have evolved at different rates. This is indicated by differences in accumulation and pattern of third base silent nucleotide substitution in £. reichenowi repeat sequences compared with the pattern of nucleotide substitution common to the
ET P. falciparum repeat sequences (de la Cruz, et al. J. Biol. Chem. 262:11935-11939 (1987)) (Fig 4). The codon usage, like the £. falciparum CS gene, is biased against T residues more in Ala than in Pro; unlike the £. falciparum gene, however, both the first and third Asn residues in the NANP sequence are biased towards AAT codon. REGIONS 3' TO THE REPEAT REGION: The unique characteris¬ tic of this region in £. reichenowi is the presence of 2 copies of a 5 amino acid repeat, Asp-Ala-Asp-Gly-Asn (DADGN). Pre-Region I repeats have been seen in the rodent malaria £. voelii (Lai, et al., J. Biol. Chem. 262:2937-2940 (1987)) and in some isolates of P. falciparum in degenerative form (de la Cruz, et al., J. Biol. Chem. 262:11935-11939 (1987)). In £. falciparum, this region contains a polymorphic T-cell proliferation site (Good, et al., Science 235:1059-1062 (1987)) and a putative hepatocyte recognition site termed the N-1 region (Aley, et al., J. EXP. Med. 164:1915-1922 (1986)). In addition, this region of the CS protein of £. falciparum exhibits size polymorphism. For instance, the NF54 train CS protein has a 57 bp deletion (Casper, et al., Mol. Biochem. Parasitol. 35 185-190 (1989)), and Wei and Bll CS proteins have a 30 bp insertion (de la Cruz, et al., J. Biol. Chem. 262:11935-11939 (1987)). Therefore, the inventors compared the CS amino acid sequences of £. reichenowi with £. falciparum carboxyl to the deletion/insertion site of £. falciparum (Fig 3A). In this region, which includes Region I, 9 out of 27 amino acids are species specific. Within this region, polymor- phism in the £. falciparum CS proteins is restricted to three amino acid positions, and £. reichenowi CS protein residues in these positions are the same as those in some of the P. falciparum sequences.
REGION AMINO AND CARBOXYL TO REGION II: The polymorphic regions H2R and' TH3R, located amino and carboxyl to Region-II, carry the helper, proliferative, and cytotoxic T-cell activity of the P. falciparum CS protein (Good, et al., Science 235:1059-1062 (1987); Kumar, et al.. Nature 334:258-260 (1988)). Comparison of £. reichenowi and P. falciparum CS proteins in these regions yields both a similarity and difference. First, common amino acid residues are found within the TH2R and TH3R regions in the CS proteins from these two species. Second, there are amino acids unique to each of the CS proteins in this region. Comparison of the TH2R region (amino acid 326-343 in £. falciparum) and the comparable region in £. reichenowi (amino acid 302-319) shows that only two residues are specific to each of the two parasites, Tyr vs Phe at positions 34/310 and Thr/Lys vs Gin at positions 337/313. In the remainder of the TH2R region, the two parasite proteins share amino acid sequence (Fig 3B) . The region amino to the TH2R region shows 8 amino acid differ- ences in a total of 38 amino acids (Fig 3B) . In the TH3R region (amino acid 361 to 384 in £. falciparum and the comparable region in P. reichenowi) , only two amino acid residues show species specificity (Fig 3C) . In other positions within this polymorphic region, the £. reichenowi CS protein sequence is similar to some £. falciparum sequences.
Comparison of the remainder of the gene and protein has revealed sequence similarity in the immuno- dominant determinants of £. falciparum and P. reichenowi and maintenance of the repeat sequence NANP and NVDP in parasites infecting hosts that have diverged more than 5 million years ago. Only four silent and one non-silent nucleotide substitutions out of a combined 148 amino acids outside the repeats and varying region are found between the two proteins, an intriguing fact that may be due to structural constraints in the parasite or the relatedness of the hosts.
* * * * * * * *
The entire contents of all references mentioned herein above incorporated by reference.
While the foregoing invention has been described in some detail for purposes of clarity and understanding, it will be clear to one skilled in the art from a reading
SUBSTITUTE SHEET of this disclosure that various changes in form and detail can be made without departing from the true scope of the invention.
ET

Claims

WHAT IS CLAIMED IS:
1. A recombinantly produced or synthetic circumsporozoite protein of Plasmodium reichenowi.
2. The protein according to claim 1 , wherein said protein has an amino acid sequence corresponding to that shown in Figures 1A-1C.
3. The protein according to claim 1 , wherein said protein has an amino acid sequence that is the functional equivalent of the sequence corresponding to that shown in Figures 1A-1C.
4. An antibody specific for the protein according to claim 1.
5. A DNA fragment that encodes circum¬ sporozoite protein of Plasmodium reichenowi.
6. The DNA fragment according to claim 5, wherein said DNA fragment encodes the amino acid sequence set forth in Figures 1A-1C.
7. A recombinantly produced or synthetic peptide of Plasmodium falciparum consisting essentially of the amino acid sequence in pre-Region I of the circum¬ sporozoite protein as set forth in Figure 3A.
8. The DNA fragment that encodes a peptide of Plasmodium falciparum consisting essentially of the amino acid sequence in pre-Region I of the circumsporozoite protein as set forth in Figure 3A.
9. A recombinant DNA construct comprising: (i) a vector, and
(ii) said DNA fragment according to claim 8.
10. A host cell transformed with the recombi¬ nant DNA construct according to claim 9 in a manner allowing expression of the peptide.
11. An antibody specific for a peptide of Plasmodium falciparum consisting essentially of the amino acid sequence in pre-Region I of the circumsporozoite protein as set forth in Figure 3A.
12. A vaccine for humans against infection by Plasmodium falciparum comprising a peptide of Plasmodium
SUBSTITUTE SHEET falciparum consisting essentially of the amino acid sequence in pre-Region I of the circumsporozoite protein as set forth in Figure 3A, in an amount sufficient to induce immunity against said infection and a pharmaceuti- cally acceptable carrier.
13. A recombinantly produced or synthetic peptide of Plasmodium falciparum consisting essentially of the amino acid sequence amino to Region II of the circum¬ sporozoite protein, as set forth in Figure 3B.
14. The DNA fragment that encodes a peptide of
Plasmodium falciparum consisting essentially of the amino acid sequence amino to Region II of the circumsporozoite protein, as set forth in Figure 3B.
15. A recombinant DNA construct comprising: (i) a vector, and
(ii) said DNA fragment according to claim 14.
16. A host cell transformed with the recombi¬ nant DNA construct according to claim 15 in a manner allowing expression of the peptide.
17. An antibody specific for a peptide of Plasmodium falciparum consisting essentially of the amino acid sequence amino, to Region II of the circumsporozoite protein, as set forth in Figure 3B.
18. A vaccine for humans against infection by
Plasmodium falciparum comprising a peptide of Plasmodium falciparum consisting essentially of the amino acid sequence amino to Region II of the circumsporozoite protein, as set forth in Figure 3A, in an amount suffi- cient to induce immunity against said infection and a pharmaceutically acceptable carrier.
19. A recombinantly produced or synthetic peptide of Plasmodium falciparum consisting essentially of the amino acid sequence carboxyl to Region II of the circumsporozoite protein, as set forth in Figure 3C.
20. The DNA fragment that encodes a peptide of Plasmodium falciparum consisting essentially of the amino
TITUTESHEET acid sequence carboxyl to Region II of the circum¬ sporozoite protein, as set forth in Figure 3C.
21. A recombinant DNA construct comprising: (i) a vector, and (ii) said DNA fragment according to claim
20.
22. A host cell transformed with the recombi¬ nant DNA construct according to claim 21 in a manner allowing expression of the peptide.
23. An antibody specific for a peptide of
Plasmodium falciparum consisting essentially of the amino acid sequence carboxyl to Region II of the circum¬ sporozoite protein, as set forth in Figure 3C.
24. A vaccine for humans against infection by Plasmodium falciparum comprising a peptide of Plasmodium falciparum consisting essentially of the amino acid sequence carboxyl to Region II of the circumsporozoite protein, as set forth in Figure 3C, in an amount suffi¬ cient to induce immunity against said infection and a pharmaceutically acceptable carrier.
SUBSTITUTESHEET
PCT/US1992/002647 1991-04-01 1992-04-01 Circumsporozoite protein of plasmodium reichenowi and vaccine for human malaria WO1992017204A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US67753991A 1991-04-01 1991-04-01
US677,539 1991-04-01

Publications (1)

Publication Number Publication Date
WO1992017204A1 true WO1992017204A1 (en) 1992-10-15

Family

ID=24719123

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1992/002647 WO1992017204A1 (en) 1991-04-01 1992-04-01 Circumsporozoite protein of plasmodium reichenowi and vaccine for human malaria

Country Status (2)

Country Link
AU (1) AU1762092A (en)
WO (1) WO1992017204A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000049146A1 (en) * 1999-02-18 2000-08-24 Rmf Dictagene S.A. Malaria vaccine
WO2015085140A1 (en) * 2013-12-05 2015-06-11 Leidos, Inc. Anti-malarial compositions
US9115205B2 (en) 2010-10-18 2015-08-25 The United States Of America, As Represented By The Secretary Of The Army Plasmodium falciparum circumsporozoite vaccine gene optimization for soluble protein expression
US9169304B2 (en) 2012-05-01 2015-10-27 Pfenex Inc. Process for purifying recombinant Plasmodium falciparum circumsporozoite protein

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
JOURNAL OF CLINICAL MICROBIOLOGY, Volume 25, No. 5, issued May 1987, MCLAUGHLIN et al., "Comparison of Genomic, Plasmid, Synthetic, and Combined DNA Probes for Detecting Plasmodium falciparum DNA", pages 791-795. *
THE JOURNAL OF BIOLOGICAL CHEMISTRY, Volume 262, No. 25, issued 05 September 1987, DE LA CRUZ et al., "Sequence Variation in Putative Functional Domains of the Circumsporozoite Protein of Plasmodium falciparum", pages 11935-11939. *
THE JOURNAL OF BIOLOGICAL CHEMISTRY, Volume 263, No. 12, issued 25 April 1988, LAL et al., "Circumsporozoite Protein Gene from Plasmodium brasilianum", pages 5495-5498. *
THE JOURNAL OF BIOLOGICAL CHEMISTRY, Volume 266, No. 11, issued 15 April 1991, LAL et al., "Circumsporozoite Protein Gene from Plasmodium reichenowi, a Chimpanzee Malaria Parasite Evolutionarily Related to the Human Malaria Parasite Plasmodium falciparum", pages 6686-6689. *

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000049146A1 (en) * 1999-02-18 2000-08-24 Rmf Dictagene S.A. Malaria vaccine
US6579524B1 (en) 1999-02-18 2003-06-17 Rmf Dictagene S.A. Malaria vaccine
US9115205B2 (en) 2010-10-18 2015-08-25 The United States Of America, As Represented By The Secretary Of The Army Plasmodium falciparum circumsporozoite vaccine gene optimization for soluble protein expression
US9919040B2 (en) 2010-10-18 2018-03-20 The United States Of America As Represented By The Secretary Of The Army Soluble recombinant plasmodium falciparum circumsporozoite protein, use in vaccines, methods of making and uses thereof
US9169304B2 (en) 2012-05-01 2015-10-27 Pfenex Inc. Process for purifying recombinant Plasmodium falciparum circumsporozoite protein
US9849177B2 (en) 2012-05-01 2017-12-26 Pfenex Inc. Process for purifying recombinant plasmodium falciparum circumsporozoite protein
WO2015085140A1 (en) * 2013-12-05 2015-06-11 Leidos, Inc. Anti-malarial compositions
US9321834B2 (en) 2013-12-05 2016-04-26 Leidos, Inc. Anti-malarial compositions
US10160802B2 (en) 2013-12-05 2018-12-25 Leidos, Inc. Anti-malarial compositions
US10501534B2 (en) 2013-12-05 2019-12-10 Leidos, Inc. Anti-malarial compositions

Also Published As

Publication number Publication date
AU1762092A (en) 1992-11-02

Similar Documents

Publication Publication Date Title
Handman et al. Protective vaccination with promastigote surface antigen 2 from Leishmania major is mediated by a TH1 type of immune response
Crewther et al. Protective immune responses to apical membrane antigen 1 of Plasmodium chabaudi involve recognition of strain-specific epitopes
EP0880588B1 (en) Recombinant protein containing a c-terminal fragment of plasmodium msp-1
JP2893626B2 (en) Antigen peptide for protozoan vaccine and vaccine containing this peptide
Heal et al. Expression and immunogenicity of a liver stage malaria epitope presented as a foreign peptide on the surface of RNA-free MS2 bacteriophage capsids
JP2009000104A (en) Polypeptide molecule for malaria in pre-erythrocytic stage
JP4573773B2 (en) Malaria vaccine
Hedstrom et al. A malaria sporozoite surface antigen distinct from the circumsporozoite protein.
US20020169305A1 (en) Binding domains from Plasmodium vivax and Plasmodium falciparum erythrocyte
Pye et al. Failure of recombinant vaccinia viruses expressing Plasmodium falciparum antigens to protect Saimiri monkeys against malaria
JP2000506381A (en) Recombinant protein containing the C-terminal fragment of malaria parasite MSP-1
WO1992017204A1 (en) Circumsporozoite protein of plasmodium reichenowi and vaccine for human malaria
CN101190946A (en) Recombination plasmodium falciparum circumsporozoite surface protein and its preparation method and use
DK2763694T3 (en) Preparation of a cysteine-rich protein
TWI231300B (en) Coccidiosis vaccines
Matsumoto et al. Stable expression and secretion of the B-cell epitope of rodent malaria from Mycobacterium bovis BCG and induction of long-lasting humoral response in mouse
JIANG et al. Effects of the configuration of a multi-epitope chimeric malaria DNA vaccine on its antigenicity to mice
US20110262469A1 (en) Malaria vaccine based on fragments and combination of fragments of the cs protein of plasmodium vivax
AU618030B2 (en) Recombinant histidine-rich protein (37 kd antigen) of plasmodium falciparum, its preparation and use
US7427604B2 (en) DNA encoding an antigenic protein of Eimeria apical membrane antigen 1 and use thereof
Yang et al. Addition of the MSA1 signal and anchor sequences to the malaria merozoite surface antigen 1 C-terminal region enhances immunogenicity when expressed by recombinant vaccinia virus
AU4133000A (en) Vaccine
PL212249B1 (en) Ribosomal P protein complex of Plasmodium falciparum as an antigen of malarial pathogen and process for the preparation of this antigen and expression cassette, especially for this process
US7078043B2 (en) Malaria vaccine
Liu et al. Sequence diversity of serine repeat antigen gene exon II of Plasmodium falciparum in worldwide collected wild isolates

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IT LU MC NL SE

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA