WO1992013063A1 - Procedes permettant de moduler par transcription l'expression de genes de facteurs de croissance et de genes de recepteurs de facteurs de croissance - Google Patents

Procedes permettant de moduler par transcription l'expression de genes de facteurs de croissance et de genes de recepteurs de facteurs de croissance Download PDF

Info

Publication number
WO1992013063A1
WO1992013063A1 PCT/US1992/000419 US9200419W WO9213063A1 WO 1992013063 A1 WO1992013063 A1 WO 1992013063A1 US 9200419 W US9200419 W US 9200419W WO 9213063 A1 WO9213063 A1 WO 9213063A1
Authority
WO
WIPO (PCT)
Prior art keywords
growth factor
molecule
receptor
gene encoding
expression
Prior art date
Application number
PCT/US1992/000419
Other languages
English (en)
Inventor
J. Gordon Foulkes
Casey C. Case
Franz Leichtfried
Christian Pieler
John R. Stephenson
Richard Michitch
Original Assignee
Oncogene Science, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oncogene Science, Inc. filed Critical Oncogene Science, Inc.
Publication of WO1992013063A1 publication Critical patent/WO1992013063A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0069—Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/64—General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/108—Plasmid DNA episomal vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
    • C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/80—Vector systems having a special element relevant for transcription from vertebrates
    • C12N2830/85—Vector systems having a special element relevant for transcription from vertebrates mammalian
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/44—Vectors comprising a special translation-regulating system being a specific part of the splice mechanism, e.g. donor, acceptor

Definitions

  • Growth Factors and Growth Factor Receptors The proliferation and differentiation of normal cells is tightly controlled by exogenous growth factors. These polypeptides comprise a diverse group of regulatory agents that typically act in a hormone-like receptor-dependent manner (1) by initiating a cascade of responses involving a variety of key proteins, some, but not all of these factors mediate their pleiotropic action by binding to and activating cell surface receptors with an intrinsic protein kinase activity (2). Growth factor receptors with protein tyrosine kinase activity have a similar molecular topology.
  • EGF epidermal growth factor
  • Growth factor action can also be influenced by the presence of other growth factors, suggesting an interaction between peptides in regulating growth factor activity.
  • transforming growth factor- ⁇ stimulates the in vitro growth of fibroblasts in the presence of platelet-derived growth factor (PDGF), while inhibiting their growth in the presence of epidermal growth factor (EGF).
  • PDGF platelet-derived growth factor
  • EGF epidermal growth factor
  • TGF- ⁇ Transforming growth factor- ⁇
  • TGF- ⁇ Transforming growth factor- ⁇
  • Biological activities described for TGF- ⁇ include stimulating growth of cells in soft agar (12) as well as stimulating mesenchymal cell growth in monolayer (13).
  • TGF- ⁇ is also chemotactic for fibroblasts and macrophages (14,15) and was shown to have a pronounced effect an extracellular matrix production by causing an increase in collagen, fibronectin and proto-glycan expression (16,17).
  • CSFs Hemopoietic Colony Stimulatory Factors
  • M-CSF macrophage
  • GM-CSF granulocyte/macrophage
  • G-CSF granulocyte multi-CSF
  • IL-3 erythroid, megakaryocyte and eosinophil
  • stem cell factor or c-kit ligand
  • SCGFs Stem Cell Growth Factors
  • This group of growth factors consists of these separate members: SCGF-1, which stimulates the proliferation of the pluripotent cells that produce it; SCGF-2, which stimulates fibroblast growth and induces them to express properties of the transformed phenotype; SCGF-3, which stimulates the proliferation of friend erythroleukemia cells and inhibits their induced differentiation (22).
  • GH Growth Hormone
  • the interleukins are a family of protein hormones which regulate the growth, differentiation and activities of leukocytes. Representative members of this family include interleukin 2 (IL-2) which mediates the growth and activation of B and T cells, interleukin 3 (IL-3) which has hematopoietic growth factor activity, and IL-5 which is also known as eosinophile differentiation factor.
  • IL-2 interleukin 2
  • IL-3 interleukin 3
  • IL-5 which is also known as eosinophile differentiation factor.
  • Growth Factor Receptors Typically, growth factors bind to their cognate receptor and thereby induce conformational changes in the receptor which in turn lead to activation of kinase activity (in receptor tyrosine kinase family members) that trigger of an array of cellular responses, including Na+/H+ exchanges, Ca 2+ influx, activation of phospholipase C, and stimulation of glucose and amino acid transport (2).
  • kinase activity in receptor tyrosine kinase family members
  • a number tyrosine kinase receptors of potential biological importance have been identified. Representative examples include:
  • c-erbB2 this oncogene encoded product as a 185,000 kd transmembrane glycoprotein with tyrosine kinase activity which shares sequence similarity to the epidermal growth factor receptor (EGF-R) (24).
  • EGF-R epidermal growth factor receptor
  • the erbB-2 gene Originally identified in ethylnitrosourea-induced rat neuroblastomas (25), the erbB-2 gene has subsequently been shown to be amplified in several adenocarcinomas and is overexpressed in about 30% of human breast cancer patients (26). pl85erbB-2 was shown to be necessary for maintenance of the malignant phenotype of cells transformed by erbB-2
  • gp 30 a 30 kD glycoprotein which interacts with erbB-2 and may, in fact, be the ligand for p185erbB-2 (28).
  • PDGF Platelet Derived Growth Factor Receptors: PDGF trigger proliferation and chemotaxis by stimulating the tyrosine kinase activity of the PDGF receptors. Two receptor types exist, called ⁇ and ß. Each responds differently to the various combinations of PDGF dimers (AA, AB and BB) (68).
  • c-kit a member of the PDGF receptor subfamily and the gene product of the murine white spotting (W) locus, c-kit encodes a transmembrane tyrosine kinase receptor (29,30).
  • the c-kit/W gene functions in immature progenitor cell populations and in more mature cell types of the three cell lineages.
  • the ligand for the c-kit proto-oncogene receptors has been identified as the gene product of the steel (S1) locus of the mouse (31,32).
  • Some growth factor receptors e.g. the erythropoietin receptor
  • the expression of a specific gene can be regulated at any step in the process of producing an active protein. Modulation of total protein activity may occur via transcriptional, transcript-processing, translational or post-translational mechanisms. Transcription may be modulated by altering the rate of transcriptional initiation or the progression of RNA polymerase (33). Transcript-processing may be influenced by circumstances such as the pattern of RNA splicing, the rate of mRNA transport to the cytoplasm or mRNA stability.
  • This invention concerns the use of molecules which act by modulating the in vivo concentration of their target proteins via regulating gene transcription. The functional properties of these chemicals are distinct from previously described molecules which also affect gene transcription.
  • researchers have documented the regulation of transcription in bacteria by low molecular weight chemicals (34,35). Extracellular xenobiotics, amino acids and sugars have been reported to interact directly with an intracellular proteinaceous transcriptional activator or represser to affect the transcription of specific genes.
  • procaryotic cells lack a distinct membrane bound nuclear compartment.
  • procaryotic DNA elements responsible for initiation of transcription differ markedly from those of eucaryotic cells.
  • the eucaryotic transcriptional unit is much more complex than its procaryotic counterpart and consists of additional elements which are not commonly found in bacteria, including enhancers and other cis-acting DNA sequences (36,37).
  • Procaryotic transcription factors most commonly exhibit a "helix-turn-helix" motif in the DNA binding domain of the protein (38,39).
  • Eucaryotic transcriptional factors frequently contain a "zinc finger” (39,40), a “leucine zipper” (41), a “helix-loop-helix” or “helix-turn-helix” motif (42). Furthermore, several critical mechanisms at the post-transcriptional level such as RNA splicing and polyadenylation are typically not found in procaryotic systems (43,44). In higher eucaryotes, modulation of gene transcription in response to extracellular factors can be regulated in both a temporal and tissue specific manner (45). For example, extracellular factors can exert their effects by directly or indirectly activating or inhibiting tissue specific transcription factors (45,33).
  • Modulators of transcription factors involved in direct regulation of gene expression have been described, and include those extracellular chemicals entering the cell passively and binding with high affinity to their receptor-transcription factors.
  • This class of direct transcriptional modulators include steroid hormones and their analogs, thyroid hormones, retinoic acid, vitamin D 3 and its derivatives, and dioxins, a chemical family of polycyclic aromatic hydrocarbons (40,46,47).
  • Dioxins are molecules generally known to modulate transcription, however, dioxins bind to naturally-occurring receptors which respond normally to xenobiotic agents via transcriptionally activating the expression of cytochrome P450. Similarly, plants also have naturally occurring receptors to xenobiotics to induce defense pathways. For example, the fungal pathogen Phytophthora megasperma induces an anti-fungal compound in soybeans. Such molecules which bind to the defined ligand binding domains of such naturally occurring receptors are not included on the scope of this invention. The clinical use of steroid hormones, thyroid hormones, vitamin D 3 and their analogs demonstrates that agents which modulate gene transcription can be used for beneficial effects, although these agents can exhibit significant adverse side effects.
  • analogs of these agents could have similar clinical utility as their naturally occurring counterparts by binding to the same ligand binding domain of such receptors.
  • These types of molecules do not fall within the scope of this invention because they function by binding to the ligand-binding domain of a receptor normally associated with a defined physiological effect.
  • Indirect transcriptional regulation involves one or more general signal transduction mechanisms. This type of regulation typically involves interaction with a receptor, the receptor being part of a multistep intracellular signaling pathway, the pathway ultimately modulating the activity of nuclear transcription factors.
  • This class of indirect transcriptional modulators include polypeptide growth factors such as platelet-derived growth factor, epidermal growth factor, cyclic nucleotide analogs, and mitogenic tumor promoters such as PMA (48,49,50). It is well documented that a large number of chemicals, both organic and inorganic, e.g. metal ions, can non-specifically modulate transcription. Most heavy metals modulate gene expression through receptors in a mechanism similar to that employed by dioxin, steroid hormones, vitamin D3 and retinoic acid.
  • nucleotide analogs in methods to non-specifically modulate transcription.
  • the mechanism involves incorporating nucleotide analogs into nascent mRNA or non-specifically blocking mRNA synthesis.
  • alkylating agents e.g. cyclophosphamide
  • intercalating agents e.g. doxorubicin
  • chemical inhibitors of hydroxymethyl-glutaryl CoA reductase e.g. lovastatin
  • lovastatin are known to indirectly modulate transcription by increasing expression of hepatic low density lipoprotein receptors as a consequence of lowered cholesterol levels.
  • Signal effector type molecules such as cyclic AMP, diacylglycerol, and their analogs are known to non-specifically regulate transcription by acting as part of a multistep protein kinase cascade reaction. These signal effector type molecules bind to domains on proteins which are thus subject to normal physiological regulation by low molecular weight ligands (51,52).
  • PCT/US88/10095 The specific use of sterol regulatory elements from the LDL receptor gene to control expression of a reporter gene has recently been documented in PCT/US88/10095.
  • One aspect of PCT/US88/10095 deals with the use of specific sterol regulatory elements coupled to a reporter as a means to screen for drugs capable of stimulating cells to synthesize the LDL receptor.
  • PCT/US88/10095 describes neither the concept of simultaneously screening large numbers of chemicals against multiple target genes nor the existence of transcriptional modulators which (a) do not naturally occur in the cell, (b) specifically transcriptionally modulate expression of the growth factor or growth factor receptor genes, and (c) bind to DNA or RNA or bind to a protein through a domain of such protein which is not a defined ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with a defined physiological or pathological effect.
  • the main focus of PCT/US88/10095 is the use of the sterol regulatory elements from the LDL receptor as a means to inhibit expression of toxic recombinant biologicals.
  • reporter gene to analyze nucleotide sequences which regulate transcription of a gene-of-interest is well documented.
  • the demonstrated utility of a reporter gene is in its ability to define domains of transcriptional regulatory elements of a gene-of-interest.
  • Reporter genes which express proteins, e.g. luciferase are widely utilized in such studies. Luciferases expressed by the North American firefly, Photinus pyralis and the bacterium, Vibrio fischeri were first described as transcriptional reporters in 1985 (53,54).
  • Reporter genes have not been previously used to identify compounds which (a) do not naturally occur in the cell, (b) specifically transcriptionally modulate expression of the gene encoding growth factors or growth factor receptors, and (c) binds to DNA or RNA, or bind to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with a defined physiological or pathological effect.
  • a method to define domains of transcriptional regulating elements of a gene-of-interest typically has also involved use of phorbol esters, cyclic nucleotide analogs, concanavalin A, or steroids, molecules which are commonly known as transcriptional modulators.
  • transcriptional modulators molecules which are commonly known as transcriptional modulators.
  • available literature shows that researchers have not considered using a transcription screen to identify specific transcriptional modulators. Hence, success would be unlikely in doing so, however, we have demonstrated herein that this is not the case.
  • the molecules described herein may also serve to mimic normal physiological response mechanisms, typically involving the coordinated expression of one or more groups of functionally related genes. Therefore, determining whether a molecule can specifically transcriptionally modulate the expression of a growth factor or growth factor receptor gene and the ultimate clinical use of the molecule provides a therapeutic advantage over the use of single recombinant biologicals, or drugs which bind directly to the final target protein encoded by the gene-of-interest.
  • the invention provides a method for directly transcriptionally modulating the expression of a gene encoding a growth factor, the expression of which is associated with a defined physiological or pathological effect within a multicellular organism.
  • This method comprises contacting a cell, which is capable of expressing the gene, with a molecule at a concentration effective to transcriptionally modulate expression of the gene and thereby affect the level of the growth factor encoded by the gene which is expressed by the cell.
  • the molecule (a) does not naturally occur in the cell, (b) specifically transcriptionally modulates expression of the gene encoding the growth factor, and (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with a defined physiological or pathological effect.
  • the invention also provides a method for directly transcriptionally modulating the expression of a gene encoding a growth factor receptor, the expression of which is associated with a defined physiological or pathological effect within a multicellular organism.
  • This method comprises contacting a cell, which is capable of expressing the gene, with a molecule at a concentration effective to transcriptionally modulate expression of the gene and thereby affect the level of the growth factor receptor encoded by the gene which is expressed by the cell.
  • the molecule (a) does not naturally occur in the cell, (b) specifically transcriptionally modulates expression of the gene encoding the growth factor receptor, and (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with a defined physiological or pathological effect.
  • This invention further provides for a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a growth factor.
  • This method comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested. Each such cell comprises DNA which consists essentially of (i) a modulatable transcriptional regulatory sequence of the gene encoding the growth factor, (ii) a promoter of the growth factor, and (iii) a DNA sequence encoding a polypeptide other than the growth factor, which polypeptide is capable of producing a detectable signal.
  • the DNA sequence is coupled to, and under the control of, the promoter, and the contacting is effected under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene encoding the growth factor, causes a measurable detectable signal to be produced by the polypeptide so expressed.
  • This allows for a quantitative determination of the amount of the signal produced.
  • this method allows one to identify the molecule as one which causes a change in the detectable signal produced by the polypeptide so expressed, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the gene encoding the growth factor.
  • the invention still further provides a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a growth factor.
  • This method comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene encoding the growth factor, (ii) a promoter of the gene encoding the growth factor, and (iii) a reporter gene, which expresses a polypeptide, coupled to, and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene encoding the growth factor, causes a measurable change in the amount of the polypeptide produced, and quantitatively determining the amount of the polypeptide produced.
  • the molecule By comparing the amount so determined with the amount of polypeptide produced in the absence of any molecule being tested or upon contacting the sample with any other molecule, the molecule is identified as one which causes a change in the amount of polypeptide expressed, and thus identified as a molecule capable of transcriptionally modulating the expression of the gene encoding the growth factor.
  • the invention further encompasses a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a growth factor.
  • This method comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested.
  • Each of the cells so contacted comprises DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene encoding the growth factor, (ii) a promoter of gene encoding the growth factor, and (iii) a DNA sequence transcribable into mRNA coupled to and under the control of, the promoter.
  • the contacting is effected under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene encoding the growth factor, causes a measurable difference in the amount of mRNA transcribed from the DNA sequence.
  • the amount of the mRNA produced is quantitatively determined and the amount so determined compared with the amount of mRNA detected in the absence of any molecule being tested or upon contacting the sample with any other molecule so as to identify the molecule as one which causes a change in the detectable mRNA amount of, and thus identify the molecule as a molecule capable of transcriptionally modulating the expression of the gene encoding the growth factor.
  • This invention further provides for a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a growth factor receptor.
  • This method comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested.
  • Each such cell comprises DNA which consists essentially of (i) a modulatable transcriptional regulatory sequence of the gene encoding the growth factor receptor, (ii) a promoter of the growth factor receptor, and (iii) a DNA sequence encoding a polypeptide other than the growth factor receptor, which polypeptide is capable of producing , a detectable signal.
  • the DNA sequence is coupled to, and under the control of, the promoter, and the contacting is effected under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene encoding the growth factor receptor, causes a measurable detectable signal to be produced by the polypeptide so expressed.
  • This allows for a quantitative determination of the amount of the signal produced.
  • this method allows one to identify the molecule as one which causes a change in the detectable signal produced by the polypeptide so expressed, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the gene encoding the growth factor receptor.
  • the invention still further provides a method c. determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a growth factor receptor.
  • This method comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene encoding the growth factor receptor, (ii) a promoter of the gene encoding the growth factor receptor, and (iii) a reporter gene, which expresses a polypeptide, coupled to, and under the control of, the promoter, under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene encoding the growth factor receptor, causes a measurable change in the amount of the polypeptide produced, and quantitatively determining the amount of the polypeptide produced.
  • the molecule By comparing the amount so determined with the amount of polypeptide produced in the absence of any molecule being tested or upon contacting the sample with any other molecule, the molecule is identified as one which causes a change in the amount of polypeptide expressed, and thus identified as a molecule capable of transcriptionally modulating the expression of the gene encoding the growth factor receptor.
  • the invention further encompasses a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a growth factor receptor.
  • This method comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested.
  • Each of the cells so contacted comprises DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene encoding the growth factor receptor, (ii) a promoter of gene encoding the growth factor receptor, and (iii) a DNA sequence transcribable into mRNA coupled to and under the control of, the promoter.
  • the contacting is effected under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene encoding the growth factor receptor, causes a measurable difference in the amount of mRNA transcribed from the DNA sequence.
  • the amount of the mRNA produced is quantitatively determined and the amount so determined compared with the amount of mRNA detected in the absence of any molecule being tested or upon contacting the sample with any other molecule so as to identify the molecule as one which causes a change in the detectable mRNA amount of, and thus identify the molecule as a molecule capable of transcriptionally modulating the expression of the gene encoding the growth factor receptor.
  • a screening method comprises separately contacting each of a plurality of substantially identical samples, each sample containing a predefined number of cells under conditions such that contacting is affected with a predetermined amount of each different molecule to be tested.
  • Also disclosed is a method of essentially simultaneously screening molecules to determine whether the molecules are capable of transcriptionally modulating one or more genes encoding growth factors or receptors which comprises essentially simultaneously screening the molecules against the growth factors or receptors according to the methods mentioned above.
  • a method for directly transcriptionally modulating in a multicellular organism the expression of a gene encoding an growth factor, the expression of which is associated with a defined physiological or pathological effect in the organism comprises administering to the organism a molecule at a concentration effective to transcriptionally modulate expression of the gene and thus affect the defined physiological or pathological effect, which molecule (a) does not naturally occur in the organism, (b) specifically transcriptionally modulates expression of the gene encoding the growth factor, and (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with a defined physiological or pathological effect.
  • a method for directly transcriptionally modulating in a multicellular organism the expression of a gene encoding an growth factor receptor, the expression of which is associated with a defined physiological or pathological effect in the organism is also included.
  • This method comprises administering to the organism a molecule at a concentration effective to transcriptionally modulate expression of the gene and thus affect the defined physiological or pathological effect, which molecule (a) does not naturally occur in the organism, (b) specifically transcriptionally modulates expression or the gene encoding the growth factor receptor, and
  • (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with a defined physiological or pathological effect.
  • Figure 1 is a view of the mammalian expression shuttle vector pUV102 with its features.
  • the mammalian expression shuttle vector was designed to allow the construction of the promoter-reporter gene fusions and the insertion of a neomycin resistance gene coupled to the herpes simplex virus thymidine kinase promoter (TK-NEO).
  • TK-NEO herpes simplex virus thymidine kinase promoter
  • Figure 2 is a partial restriction enzyme cleavage map of the plasmid pD0432 which contains the luciferase gene from the firefly, Photinus pyralis.
  • Figure 3 is a partial restriction enzyme cleavage map of the plasmid pSVLuci which contains the luciferase gene from the firefly, Photinus pyralis.
  • Figure 4 is a partial restriction enzyme cleavage map of the plasmid pMLuci which contains the luciferase gene of the firefly, Photinus pyralis and the mouse mammary tumor virus long terminal repeat.
  • Figure 5 provides the nucleotide sequences of six oligonucletides, pUV-1 through pUV-6, which were annealed, ligated, and inserted into the SalI/EcoRl sites of the plasmid pTZ18R.
  • Figure 6 is a diagrammatic representation of the construction of the plasmid pUV001 from the plasmids pTZ18R and pBluescript KS(+).
  • Figure 7 is a diagrammatic representation of the construction of the plasmid pUV100 from the plasmid pUV001 and two DNA fragments, the XbaI/XmaI fragment from pMLuci and the XmaI/BamHI fragment from pMSG.
  • Figure 8 is a diagrammatic representation of the construction of the plasmid pUV100-3 from the plasmid pUV100 and a 476 b fragment containing a dimeric SV40 polyadenylation site.
  • Figure 9 is a diagrammatic representation of the construction of the plasmids pUV102 and pUV103 from the plasmid pUV100-3 and D-link oligonucleotides and the plasmid pUV100-3 and R-link oligonucleotides, respectively.
  • Figure 10 provides the nucleotide sequences of oligos 1-4 used for the construction of a synthetic HSV-Thymidine Kinase promoter and provides a diagrammatic representation of the HSV-TK promoter.
  • Figure 11 is a diagrammatic representation of the construction of the plasmid pTKL100 which contains the luciferase gene from the firefly, Photinus pyralis and the HSV-TK promoter sequence.
  • Figure 12 is a diagrammatic representation of the construction of the plasmid pTKNEO which contains the neo gene, from about 3.5 kb Nhel/Xmal fragment from pTKL100, and the about 0.9 kb BstBI/BglII fragment containing the neo coding region from pRSVNEO.
  • Figure 13 is a diagrammatic representation of the construction of the plasmid pTKNE02 from the plasmid pTKNEO and the oligonucleotides Neo 1 and 2.
  • Figure 14 is a diagrammatic representation of the construction of the plasmid pTKNE03 from the plasmid PTKNE02 and about 0.9 kb EcoRl/SalI fragment from pMClNEO.
  • Figure 15 is a partial restriction map of plasmid pUXLuci, a vector used in the construction of the human growth hormone reporter vector.
  • Figure 16 is a partial restriction enzyme cleavage map of the plasmid phGH:CAT which contains the CAT gene and human growth hormone promoter sequences.
  • Figure 17 is a partial restriction enzyme cleavage map of the plasmid phGH-Luci which contains the luciferase gene from the firefly, Photinus pyralis and human growth hormone promoter sequences.
  • Figure 18 is a partial restriction enzyme cleavage map of the plasmid pNEU106 which contains neu upstream sequences fused to the luciferase coding region.
  • Figure 19 is a partial restriction enzyme cleavage map of the plasmid pKRAS106 which contains K-ras upstream sequences fused to the luciferase gene from the firefly, Photinus pyralis.
  • Figure 20 is a graphical representation of the decay of reporter gene signal after treatment of cells with Actinomycin D. Plotted is relative intensity of the signal versus time after ActD addition.
  • Figure 21 is a quality assurance analysis of a high throughput screen measuring the ratios of negative values at various positions within a plate. The expected value is 1.0.
  • Figure 22 is a quality assurance analysis of a high throughput screen measuring a robustified coefficient of variance for the negative controls on a number of plates. Values less than 10 are acceptable.
  • Figure 23 is a quality assurance analysis of a high throughput screen measuring a robustified coefficient of variance for the positive controls on a number of plates. Values less than 10 are acceptable.
  • Figure 24 is a quality assurance analysis of a high throughput screen measuring a response of a reporter cell line to three different concentrations of a compound known to induce transcription.
  • Antisense nucleic acid means an RNA or DNA molecule or a chemically modified RNA or DNA molecule which is complementary to a sequence present within an RNA transcript of a gene.
  • Directly transcriptionally modulate the expression of a gene means to transcriptionally modulate the expression of the gene through the binding of a molecule to (1) the gene (2) an RNA transcript of the gene, or (3) a protein which binds to (i) such gene or RNA transcripts, or (ii) a protein which binds to such gene or RNA transcript.
  • a gene means a nucleic acid molecule, the sequence of which includes all the information required for the normal regulated production of a particular protein, including the structural coding sequence, promoters and enhancers.
  • Growth factor means a polypeptide factor, either soluble or displayed on the external surface of a plasma membrane, upon binding to a specific growth factor receptor on the surface of the appropriate cell type, stimulates the growth, division or differentiation of the cell. Growth factors may exhibit diverse effects (or no effects) on other cell types.
  • Growth factor receptor means a membrane spanning polypeptide which, when present on the surface of the appropriate cell type, and upon the binding of a specific growth factor, initiates a physiological response, such as growth, division or differentiation.
  • Indirectly transcriptionally modulate the expression of a gene means to transcriptionally modulate the expression of such gene through the action of a molecule which cause enzymatic modification of a protein which binds to (l) the gene or (2) an RNA transcript of the gene, or (3) protein which binds to (i) the gene or (ii) an RNA transcript of the gene.
  • a molecule which cause enzymatic modification of a protein which binds to (l) the gene or (2) an RNA transcript of the gene, or (3) protein which binds to (i) the gene or (ii) an RNA transcript of the gene constitutes indirect transcript modulation.
  • Ligand means a molecule with a molecular weight of less than 5,000, which binds to a transcription factor for a gene. The binding of the ligand to the transcription factor transcriptionally modulates the expression of the gene.
  • Ligand binding domain of a transcription factor means the site on the transcription factor at which the ligand binds.
  • Modulatable transcriptional regulatory sequence of a gene means a nucleic acid sequence within the gene to which a transcription factor binds so as to transcriptionally modulate the expression of the gene capable of regulating the transcription of a hematopoietic gene including, but not limited to, promoters, enhancers, attenuators, and silencers.
  • Receptor means a transcription factor containing a ligand binding domain.
  • transcriptionally modulate the expression of a gene means to transcriptionally modulate the expression of such gene alone, or together with a limited number of other genes.
  • Transcription means a cellular process involving the interaction of an RNA polymerase with a gene which directs the expression as RNA of the structural information present in the coding sequences of the gene. The process includes, but is not limited to the following steps: (1) the transcription initiation, (2) transcript elongation, (3) transcript splicing, (4) transcript capping, (5) transcript termination, (6) transcript polyadenylation, (7) nuclear export of the transcript, (8) transcript editing, and (9) stabilizing the transcript.
  • Transcription factor for a gene means a cytoplasmic or nuclear protein which binds to (1) such gene, (2) an RNA transcript of such gene, or (3) a protein which binds to (i) such gene or such RNA transcript or (ii) a protein which binds to such gene or such RNA transcript, so as to thereby transcriptionally modulate expression of the gene.
  • Transcriptionally modulate the expression of a gene means to change the rate of transcription of such gene.
  • Triple helix means a helical structure resulting from the binding of one or more oligonucleotide to double stranded DNA.
  • the invention also provides a method for directly transcriptionally modulating the expression of a gene encoding a growth factor, the expression of which is associated with a defined physiological or pathological effect within a multicellular organism.
  • This method comprises contacting a cell, which is capable of expressing the gene, with a molecule at a concentration effective to transcriptionally modulate expression of the gene and thereby affect the level of the growth factor encoded by the gene which is expressed by the cell.
  • the molecule (a) does not naturally occur in the cell, (b) specifically transcriptionally modulates expression of the gene encoding the growth factor, and (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with a defined physiological or pathological effect.
  • the invention also provides a method for directly transcriptionally modulating the expression of a gene encoding a growth factor receptor, the expression of which is associated with a defined physiological or pathological effect within a multicellular organism.
  • This method comprises contacting a cell, which is capable of expressing the gene, with a molecule at a concentration effective to transcriptionally modulate expression of the gene and thereby affect the level of the growth factor receptor encoded by the gene which is expressed by the cell.
  • the molecule (a) does not naturally occur in the cell, (b) specifically transcriptionally modulates expression of the gene encoding the growth factor receptor, and (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with a defined physiological or pathological effect.
  • the molecule does not naturally occur in any cell, whether of a multicellular or a unicellular organism. Alternatively, the molecule is naturally occurring, but not normally found in the cell.
  • the molecule is not a naturally occurring molecule, e.g. is a chemically synthesized entity.
  • the cell may be a cell of the multicellular organism, which could included, a fish cell, a avian cell, an animal cell, human cell, bovine cell, or a porcine cell.
  • the transcriptional modulation in the method mentioned above may comprises upregulation or downregulation of expression of the gene encoding the growth factor or receptor. Additionally it may bind to a modulatable transcriptional sequence of the gene.
  • the molecule may an antisense nucleic acid, double-stranded nucleic acid, a nucleic acid capable of forming a triple helix with double-stranded DNA,
  • the growth factor in the above methods may be human growth factor, bovine growth factor, the porcine growth factor, a fish growth factor, an avian growth factor.
  • the growth factor may be a transforming growth factor beta, an epidermal growth factor, a transforming growth factor alpha, platelet derived growth factor, vascular endothelial cell growth factor, fibroblast growth factor, nerve growth factor, a bone morphogenic protein, an insulin, an insulin-like growth factor, an interleukin such as IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7 or a hematopoietic growth factor such as G-CSF, GM-CSF, EPO, IL-3, M-CSF, c-Kit ligand.
  • the growth factor receptor may be a human growth factor receptor, a bovine growth factor receptor, a porcine growth factor receptor, a fish growth factor receptor, or an avian growth factor receptor.
  • the growth factor receptor may be the receptor for a transforming growth factor ß, an epidermal growth factor, a transforming growth factor ⁇ .
  • the growth factor receptor may be erbB2 (neu), platelet derived growth factor receptor, VEGF receptor, FGF receptor, NGF receptor, an interleukin receptor such as IL-1 receptor, IL-2 receptor, IL-2 ⁇ receptor, IL-3 receptor, a hematopoietic growth factor such as G-CSF receptor, GM- CSF receptor, EPO receptor, C-fms (M-CSF receptor), or c- Kit (Kit ligand receptor) or an insulin receptor.
  • the invention further includes a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a growth factor.
  • This method comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested.
  • the cell used contains DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene encoding the growth factor, (ii) a promoter of the gene encoding the growth factor, and (iii) a DNA sequence encoding a polypeptide other than the growth factor, which polypeptide is capable of producing a detectable signal, which DNA sequence is coupled to, and under the control of, the promoter.
  • the method is carried out under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene encoding the growth factor, causes a measurable detectable signal to be produced by the polypeptide so expressed.
  • This aloes on to quantitatively determining the amount of the signal produced by comparing the amount so determined with the amount of produced signal detected in the absence of any molecule being tested or upon contacting the sample with any other molecule.
  • identifying the molecule as one which causes a change in the detectable signal produced by the polypeptide so expressed, and thus identify the molecule as a molecule capable of transcriptionally modulating the expression of the gene encoding the growth factor.
  • a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a growth factor which comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested.
  • the cell used contain DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene encoding the growth factor, (ii) a promoter of the gene encoding the growth factor, and (iii) a reporter gene, which expresses a polypeptide, coupled to, and under the control of, the promoter
  • This is carried out under such conditions that the molecule, if capable of acting as a transcriptional modulator of the gene encoding the growth factor, causes a measurable change in the amount of the polypeptide produced.
  • one is able to identify the molecule as one which causes a change in the amount of the polypeptide expressed, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the gene encoding the growth factor.
  • the invention also provides for a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a growth factor.
  • This method which comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested, each such cell comprising DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene encoding the growth factor, (ii) a promoter of the gene encoding the growth factor, and (iii) a DNA sequence transcribable into mRNA coupled to and under the control of the promoter.
  • the molecule if capable of acting as a transcriptional modulator of the gene encoding the growth factor, causes a measurable difference in the amount of mRNA transcribed from the DNA sequence.
  • This aloes one to quantitatively determine the amount of the mRNA produced.
  • the molecule by comparing the amount so determined with the amount of mRNA detected in the absence of any molecule being tested or upon contacting the sample with any other molecule, one may identify the molecule as one which causes a change in the detectable mRNA amount of.
  • One may thus identify the molecule as a molecule capable of transcriptionally modulating the expression of the gene encoding the growth factor.
  • a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a growth factor receptor is also disclosed in the invention.
  • This method comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested.
  • the cells contain DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene encoding the growth factor receptor, (ii) a promoter of the gene encoding the growth factor receptor, and (iii) a DNA sequence encoding a polypeptide other than the growth factor receptor, which polypeptide is capable of producing a detectable signal, which DNA sequence is coupled to, and under the control of, the promoter.
  • This method is carried out under such conditions that the molecule, if capable of acting as a transcriptional modulator of the gene encoding the growth factor receptor, causes a measurable detectable signal to be produced by the polypeptide so expressed.
  • identify the molecule as one which causes a change in the detectable signal produced by the polypeptide so expressed, and thus identify the molecule as a molecule capable of transcriptionally modulating the expression of the gene encoding the growth factor receptor.
  • the invention includes a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a growth factor receptor.
  • This method comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested.
  • the cell used contains DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene encoding the growth factor receptor, (ii) a promoter of the gene encoding the growth factor receptor, and (iii) a reporter gene, which expresses a polypeptide, coupled to, and under the control of, the promoter.
  • This method is carried out under such conditions that the molecule, if capable of acting as a transcriptional modulator of the gene encoding the growth factor receptor, causes a measurable change in the amount of the polypeptide produced.
  • This allows one to quantitatively determine the amount of the polypeptide so produced, by comparing the amount so determined with the amount of polypeptide produced in the absence of any molecule being tested or upon contacting the sample with any other molecule, and thereby identify the molecule as one which causes a change in the amount of the polypeptide expressed.
  • This allows one to identifying the molecule as a molecule capable of transcriptionally modulating the expression of the gene encoding the growth factor receptor.
  • a method of determining whether a molecule not previously known to be a modulator of protein biosynthesis is capable of transcriptionally modulating the expression of a gene encoding a growth factor receptor comprises contacting a sample which contains a predefined number of cells with a predetermined amount of a molecule to be tested.
  • the cell used contain DNA consisting essentially of (i) a modulatable transcriptional regulatory sequence of the gene encoding the growth factor receptor, (ii) a promoter of the gene encoding the growth factor receptor, and
  • a DNA sequence transcribable into mRNA coupled to and under the control of, the promoter is carried out under conditions such that the molecule, if capable of acting as a transcriptional modulator of the gene encoding the growth factor receptor, causes a measurable difference in the amount of mRNA transcribed from the DNA sequence. From this one may quantitatively determine the amount of the mRNA produced, by comparing the amount so determined with the amount of mRNA detected in the absence of any molecule being tested or upon contacting the sample with any other molecule. Thus one may identify the molecule as one which causes a change in the detectable mRNA amount of, and thus identifying the molecule as a molecule capable of transcriptionally modulating the expression of the gene encoding the growth factor receptor.
  • the sample may comprises cells in monolayers, or in suspension.
  • the cells may comprise animal cells, which may include human cells, bovine cells, murine cells, porcine cells, fish cells, or avian cells.
  • the predefined number of cells may be from about 1 to about 5 ⁇ 10 5 cells, or from about 2 ⁇ 10 2 to about 5 ⁇ 10 4 cells.
  • the predetermined amount of the molecule to be tested may be based upon the volume of the sample, or from about 1.0 pM to about 20 ⁇ M, or from about 10 nM to about 500 ⁇ M.
  • the contacting may be effected from about 1 to about 24 hours, or about 2 to about 12 hours.
  • the contacting may be effected with more than one predetermined amount of the molecule to be tested.
  • the molecule to be tested may be a purified molecule.
  • the modulatable transcriptional regulatory sequence may comprises a cloned genomic regulatory sequence.
  • the DNA may consists essentially of more than one modulatable transcriptional regulatory sequence.
  • the DNA sequence encoding the polypeptide may be inserted downstream of the promoter of the gene encoding a growth factor or receptor by homologous recombination.
  • the invention includes the case where the polypeptide is a luciferase, chloramphenicol acetyltransferase, ⁇ glucuronidase, ⁇ galactosidase, neomycin phosphotransferase, alkaline phosphatase or guanine xanthine phosphoribosyltransferase. Additionally the polypeptide may be capable of complexing with an antibody or biotin. Further, the mRNA may be detected by quantitative polymerase chain reaction.
  • a screening method which comprises separately contacting each of a plurality of substantially identical samples, each sample containing a predefined number of cells under conditions such that contacting is affected with a predetermined amount of each different molecule to be tested.
  • the plurality of samples may comprise more that about 10 4 samples, or more than about 5 ⁇ 10 4 samples.
  • Also included in the disclosure is a method of essentially simultaneously screening molecules to determine whether the molecules are capable of transcriptionally modulating one or more genes encoding growth factors or receptors according to the methods of above. Further provided for is a method of essentially simultaneously screening molecules to determine whether the molecules are capable of transcriptionally modulating one or more genes encoding growth factor receptor(s). This method comprises essentially simultaneously screening the molecules against the genes encoding the growth factor receptor(s) according to the method of above. This method may have more than about 10 3 samples per week contacted with different molecules.
  • plasmid designated pUV106, deposited under ATCC Accession No. 40946
  • human colon adenocarcinoma cell line transfected with pHRA521, designated H21, deposited under ATCC Accession No. CRL 10640;
  • SW 480 human breast carcinoma cell line transfected with pKRAS106, designated K-2, deposited under ATCC Accession No. CRL 10662;
  • NIH Swiss mouse embryo cell line NIH 3T3, transfected with the MMTV reporter plasmid, designated M10, deposited under ATCC Accession No. CRL 10659; and
  • a GC rat pituitary cell line transfected with the growth hormone reporter plasmid, designated 532, deposited under ATCC Accession No. CRL 10663.
  • a method for directly transcriptionally modulating in a multicellular organism the expression of a gene encoding an growth factor, the expression of which is associated with a defined physiological or pathological effect in the organism is also included. This method comprises administering to the organism a molecule at a concentration effective to transcriptionally modulate expression of the gene and thus affect the defined physiological or pathological effect.
  • the molecule (a) does not naturally occur in the organism, (b) specifically transcriptionally modulates expression of the gene encoding the growth factor, and (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with a defined physiological or pathological effect.
  • a method for directly transcriptionally modulating in a multicellular organism the expression of a gene encoding an growth factor receptor, the expression of which is associated with a defined physiological or pathological effect in the organism is also included.
  • This method comprises administering to the organism a molecule at a concentration effective to transcriptionally modulate expression of the gene and thus affect the defined physiological or pathological effect.
  • the molecule (a) does not naturally occur in the organism, (b) specifically transcriptionally modulates expression of the gene encoding the growth factor receptor, and (c) binds to DNA or RNA, or binds to a protein at a site on such protein which is not a ligand-binding domain of a receptor which naturally occurs in the cell, the binding of a ligand to which ligand-binding domain is normally associated with a defined physiological or pathological effect.
  • the molecule in the above methods may be an antisense, nucleic acid, a double stranded nucleic acid molecule, or a nucleic acid capable of forming a triple helix with double stranded DNA.
  • the above method additionally include the case where the multicellular organism is a human being, an animal, which may include a cow, a pig, a fish, a chicken, or a mouse.
  • the defined pathological effect may be a disorder where modulated expression of the gene encoding a growth factor is associated with amelioration of the disorder.
  • the defined pathological effect may be pituitary dwarfism, acute catabolic trauma, obesity, or the combined degenerative disorders of old age.
  • the defined pathological effect may be a disorder where modulated expression of the gene encoding a growth factor receptor is associated with amelioration of the disorder.
  • the defined pathological effect may be bladder cancer, brain cancer, breast cancer, colon cancer, lung cancer or ovarian cancer.
  • FCS Fetal calf serum
  • GC rat pituitary cell line
  • DMEM and Ham's F12 medium (1:1) supplemented with 12.5% FCS.
  • transfected GC clones will be transferred to serum free defined medium consisting of DMEM and Ham's F12 medium (1:1) supplemented with growth factors, hormones and nutrients as described previously.
  • a human breast adenocarcinoma derived cell line, SK-BR-3 (ATCC HTB 30) was used for the experiments concerning expression of the neu (ErbB2) proto-oncogene.
  • This cell line was maintained on DMEM, 15% FCS and 1 ug/ml insulin. Stable transfectants of this cell line were selected in this same medium with the addition of G418 to a final concentration of 0.4 mg/ml.
  • a human colon adenocarcinoma cell line, SW480 (ATCC CCL 228) was used for experiments concerning expression of the K-ras proto-oncogene (as a control for specificity).
  • This cell line was maintained on DMEM, 15% fetal calf serum (FCS), 1% Nonessential amino acids (NEAA).
  • Stable transfectants of this cell line were selected in the same medium with the addition of G418 (Geneticin, Gibco) to a final concentration of 0.6 mg/ml.
  • a murine embryonic fibroblast cell line, NIH 3T3 (ATCC# CCL92), was used for the transfection of plasmids carrying the MMTV promoter. These cells were maintained on DMEM, supplemented with 10% FCS.
  • a mammalian expression shuttle vector was designed to allow the construction of the promoter-reporter gene fusions to be used in high-throughput screens to identify transcriptionally modulating chemicals. Features of the plasmid are shown in Figure 1. The shuttle vector was constructed in several steps.
  • the firefly luciferase gene was removed from the plant expression plasmid pD0432 (58) ( Figure 2) as a 1.9 kb BamHI fragment and cloned into the BamHI site of pSVL (Pharmacia, Piscataway, NJ), a mammalian expression vector containing the SV40 promoter.
  • the resulting plasmid (pSVLuci; Figure 3) was digested with XhoI and Sail to produce a 2.4 kb fragment containing the luciferase coding sequences and the SV40 late polyadenylation site.
  • MMTV promoter-luciferase fusion plasmid (pMLuci; Figure 4) was used to transfect NIH/3T3 cells as described below. Similar constructs can be made using luciferase vectors from Clontech (Palo Alto, CA).
  • oligonucleotides (pUV-1 through pUV-6) (SEQ ID NO: 1- 6) were synthesized (see Figure 5 for sequence).
  • the sequences of pUV-1, pUV-2 and pUV-3 correspond to a multicloning site, the beta-globin leader sequence and the first 53 bases of the firefly luciferase coding region.
  • the sequences of pUV-4, pUV-5 and pUV-6 are complementary to the first three oligonucleotides.
  • the pUV oligonucleotides were annealed, ligated and inserted into the SalI/EcoRI sites of pTZ18R (Pharmacia, Piscataway NJ) ( Figure 6).
  • the resulting vector was then digested with SmaI/PvuII and the oligonucleotide containing fragment was cloned into the pBluescriptKS(+) plasmid (Stratagene, La Jolla, CA), previously digested with PvuII, to yield pUV001 ( Figure 6).
  • pBluescriptKS(+) plasmid Stratagene, La Jolla, CA
  • PvuII PvuII
  • the SV40 early splice site and the SV40 late polyadenylation site were obtained as an 871 bp XmaI/BamHI fragment from pMSG (Pharmacia, Piscataway NJ, Figure 7). Both DNA fragments were cloned into pUV001, previously digested with XbaI/BamHI to yield pUV100 ( Figure 7). A 476 b fragment containing a dimeric SV40 polyadenylation site was then cloned into the BelI site of pUV100 ( Figure 8).
  • a 238 bp BclI/BamHI fragment was obtained from SV40 genomic DNA (BRL), ligated, digested with BclI/BamHI, gel isolated, and inserted into pUV100, resulting in the vector pUV100-3 ( Figure 8).
  • Linkers containing one SfiI and one NotI restriction site were then cloned into the PvuII/BamHI sites of pUV100-3.
  • Two sets of linkers were synthesized containing the SfiI site in opposite orientations (oligonucleotides D-link1 and D-link2 and oligonucleotides R-linkl and R-link2).
  • the sequences of the oligonucleotides (SEQ ID NO: 7-10) were: 5' GATCGGCCCCTAGGGCCGCGGCCGCAT 3' (D-link1)
  • the plasmid that contains D-link oligonucleotides was named pUV102 and the plasmid that contains R-link oligonucleotides was named pUV103 ( Figure 9).
  • neomycin resistance gene (neo) was then placed under control of the Herpes Simplex Virus thymidine kinase
  • HSV-TK HSV-TK promoter
  • HSV-TK promoter was synthesized using four oligonucleotides (Figure 10) (SEQ ID NO: 11-14) designed according to published sequence information (59), and including an SfiI restriction site 5' of the HSV-TK sequences. These oligonucleotides were phosphorylated, annealed, ligated and inserted into pUV100 digested previously with HindIII/NheI, generating the vector pTKL 100 ( Figure 11).
  • the about 3.5 kb NheI/SmaI fragment was isolated from pTKL100, and the about 0.9 kb BstBI/BglII fragment containing the neo coding region was isolated from pRSVNEO (60). These two fragments were filled in with Klenow polymerase and ligated to form pTKNEO ( Figure 12).
  • HGH Reporter Vectors 1. Initial human growth hormone (hGH) promoter-luciferase fusion plasmid
  • the SalI-XhoI fragment of pSVLuci containing the luciferase coding sequences and the SV40 late polyadenylation site was inserted into pUC 8 (Biorad, Richmond, CA), which had been linearized by a SmaI/HinCII digestion and ligated to XhoI linkers (New England Biolabs, Beverly, MA).
  • the new plasmid thus generated (pUXLuci; Figure 15) was linearized by XhoI digestion followed by incubation with the Klenow fragment of E. coli DNA polymerase and the four deoxyribonucleotides to fill in the single-stranded ends of the vector.
  • hGH-1 and hGH-4 Two oligonucleotides, hGH-1 and hGH-4, were used to amplify the human growth hormone region by polymerase chain reaction from human placental genomic DNA.
  • hGH-1 corresponds to bp 4835-4866 (67).
  • hGH-4 corresponds to bp 5557-5586.
  • the PCR reaction yielded a 751 bp DNA fragment comprising the required 5' regulatory elements, the 1st exon. The 1st intron and part of the 2nd exon.
  • fragment A This fragment (called fragment A) was used as a template for a second PCR reaction using oligonucleotides hGH-1 and hGH-3.
  • hGH-3 has the following sequence (SEQ ID NO: 17):
  • the sequence corresponds to bp 5497-5526 except at the two bases indicated by the *. These two changes will create an in-frame NcoI site in the second exon.
  • This PCR reaction generated a 691 bp NcoI fragment which was gel purified and cloned into the NcoI site of puvloz.
  • the TK- NEO 3 cassette was inserted into the Sfi I site. The vector linearized and transfected into RAT GC cell to generate growth hormone reporter cell lines.
  • the resulting plasmid comprises an hGH-luciferase fusion wherein the hGH promoter, first exon, first intron and part of the second exon are fused, in frame.
  • the resulting spliced RNA codes for a chimeric hGH-luciferase fusion protein with luciferase activity.
  • Fragment A was used as a template for a third PCR reaction using oligonucleotides hGH-1 and hGH-2.
  • hGH-2 has the following sequence (SEQ ID NO: 18):
  • plasmids are functionally tested in transient transfections into rat pituitary GC cells for correct response to known modulators of hGH expression. Electroporations are carried out as described below. 24 hour after transfection cells are treated with 10 - 100 nM rat growth hormone releasing factor or 10 ⁇ M forskolin or 1 ⁇ M dexamethasone. 4 - 12 hours after treatment cells are lysed by detergent and luciferase activity determined in a scintillation counter as described below.
  • Additional agents inducing hGH transcription include retinoic acid, 12-O-tetradecanoyl-phorbol-13-acetate, 8-bromo-cAMP, Somatostatin, Activin-A, thyroid hormone, and Insulin-like Growth factor I (IGF-I).
  • Oligonucleotide probes based on the published sequence (61) of the 5' region of the c-ErbB2 gene were synthesized and used to screen a human leukocyte genomic library (Clontech Inc.). A 3.2 kb BglI fragment from a positive plaque, containing the upstream regulatory elements, the 5' untranslated leader and exon 1 was then subcloned into pBluscriptKS (+), generating pNEU001.
  • oligonucleotides were annealed to one another, phosphorylated and ligated into NcoI digested pNEU002, generating pNEU103.
  • the synthetic linker fuses the DNA coding for the neu 5' untranslated leader to the luciferase open reading frame such that the AUG utilized for translation initiation of the neu gene forms the first codon of the luciferase gene.
  • the ScaI-XbaI fragment of pNEU103 containing vector sequences, the upstream regulatory elements, the 5'untranslated leader and a portion of the luciferase open reading frame, was purified by preparative gel electrophoresis and ligated into pUV106 which had previously been digested with ScaI and XbaI, generating pNEU106 ( Figure 18). Linearized pNEU106 was used in the transfections to generate the neu-luciferase reporter cell lines as described below.
  • This adaptor comprised of two oligonucleotides (5'-TCGAGATCTGAGGCCTGCTGACCATGGGGGCC-3' and
  • pGEM715 A 3 kb HinDIII-XhoI fragment from pKS4, comprising 2.2 kb of K-ras untranscribed upstream DNA and sequences coding for exon 0 and part of intron 1 was purified by preparative gel electrophoresis and ligated into pGEM715 which ad been previously digested with HinDIII and XhoI to generate pGEM7.
  • a 7.7 kb HinDIII-NcoI fragment of pGEM7 comprising 2.2 kb of K-ras upstream regulatory elements, exon 0, intron 1, and part of exon 1 (to the ATG at the NcoI site), was purified by preparative gel electrophoresis and ligated int pUV102 which had previously been digested with HinDIII and NcoI to generate pKRAS102.
  • the TK-Neo fragment from pTKNeo3 was then ligated into the SfiI site of pKRAS102 to generate pKRAS106 ( Figure 19), the vector used for transfections to generated the stable reporter cell lines.
  • CMV reporter vector A 580 bp cytomegalovirus genomic fragment containing the immediate early promoters and enhancers (63) was ligated into pUV100 previously digested with NotI and NheI and rendered blunt ended by treatment with Klenow fragment, generating pUVCM.
  • Transfection Cell were transfected by one of three methods, following manufacturer's instructions; by Calcium phosphate precipitation (Pharmacia), Lipofection (Life Technologies Inc.) or electroporation (BioRad). In most cases, 25-75 ⁇ g of plasmid DNA, linearized by a single restriction endonuclease cut within the vector sequences, was electroporated into approximately 5 million cells. When co-transfeetion of a separate neomycin resistant plasmid was employed the molar ratio of luciferase fusion plasmid to neomycin resistant plasmid was either 10:1 or 20:1. Neomycin resistant clones were selected by growth in media containing G418 (Geneticin, Gibco).
  • D-PBS Dulbecco's phosphate-buffered saline
  • Lysis Buffer 1 50 mM Tris acetate pH 7.9, 1 mM EDTA, 10 mM magnesium acetate, 1 mg/ml bovine serum albumin [BSA], 0.5% Brij 58, 2 mM ATP, 100 mM dithiothreitol [DTT]). All reagents were obtained from Sigma except for DTT which was from Boehringer Mannheim.
  • HGH Cell lines phGH-LUCI and pRSVNeo an antibiotic resistance plasmid, were co-transfected into GC rat pituitary cells as described above. Selection of G418-resistant cell clones was described above except for using a concentration of 0.2 mg/ml G418. Analysis of the cell clones was performed as above, except that known inducers of hGH expression (10-100 nM rat growth hormone releasing factor (rGRF, Bachem, Torrance, CA) and 10 ⁇ m forskolin (Sigma, St. Louis, MO) were used in place of dexamethasone. One clone, 532 (ATCC # 10663), was selected for further use in the high throughput screen.
  • inducers of hGH expression 10-100 nM rat growth hormone releasing factor (rGRF, Bachem, Torrance, CA) and 10 ⁇ m forskolin (Sigma, St. Louis, MO) were used in place of dexamethasone.
  • HGH reporter plasmids described above are transfected into the rat pituitary cell line GC by electroporation using a BRL (Gaithersburg, Maryland) Cellporator electroporation device.
  • Cells are trypsinized, treated with Soybean trypsin inhibitor (1 mg/ml), washed three times in Dulbecco's modified Eagle's medium (DMEM) without pH indicator, and 1 ml of cell suspension in DMEM electroporated at room temperature and at a cell density of 5 million cells per ml at a voltage of 250 V and a capacitance of 1180 microFarad with the electroporation device set at low resistance.
  • DMEM Dulbecco's modified Eagle's medium
  • clone N-2 75 micrograms of the pNEU106 plasmid was linearized by a single restriction endonuclease cleavage within the vector backbone and electroporated into HTB30 human breast carcinoma cells.
  • Neomycin resistant clones were isolated and tested for luciferase activity. Clones testing positive for luciferase production were subjected to Southern blot analysis (see below). The best clone (producing the highest signal and carrying a single intact copy of the transfected DNA) was utilized for high throughput screening (designated clone N-2).
  • MMTV control cell line pMluci and pSV2Neo, an antibiotic resistance plasmid (64), were co-transfected into NIH/3T3 mouse fibroblast cells using the calcium phosphate precipitation method (65) with a commercially available kit (Pharmacia, Piscataway NJ). Two days later, cells were transferred to media containing 0.4 mg/ml G418 and were grown for an additional 10-14 days. G418-resistant clones were isolated by standard methods. Once sufficient cell numbers were obtained, clones were analyzed based on several criteria: constitutive luciferase production. induction of luciferase expression by dexamethasone (1 ⁇ m, Sigma, St.
  • Hep3B hepatocellular carcinoma cells were transfected by electroporation with 75 micrograms of pCM106 which had been linearized by a single Seal cut within the vector backbone. Neomycin resistant colonies were isolated and tested for luciferase activity. Luciferase positive, neomycin resistant clones were subjected to Southern blot analysis (see below). The best clone, producing the most luciferase activity from a single, correctly integrated vector was selected for use as the CMV reporter cell line in the high throughput screen (this clone was designated CM1).
  • Dynatech Microliter 96 well plates were custom pretreated for cell attachment by Dynatech Laboratories, Inc. (Chantilly, VA). Alternatively, the 96 well plates were treated with 50 ul per well of human fibronectin (hFN, 15 ⁇ g/ml in PBS, Collaborative Research, Bedford, MA) overnight at 37°C. hFN-treated plates were washed with PBS using an Ultrawash 2 Microplate Washer (Dynatech Labs), to remove excess hFN prior to cell plating.
  • human fibronectin hFN, 15 ⁇ g/ml in PBS, Collaborative Research, Bedford, MA
  • M10 and G21 cells maintained in their respective serum media were washed with PBS, harvested by trypsinization, and counted using a hemocytometer and the Trypan Blue exclusion method according to protocols provided by Sigma, St. Louis, MO Chemical Company.
  • Cells were then diluted into serum free defined media (with 0.2 mg/ml G418), and 0.2 ml of cell suspension per well was plated onto Dynatech treated plates (G21) or hFN-treated plates (M10) using a Cetus Pro/Pette (Cetus, Emeryville CA). Plates were incubated overnight at 37°C in a humidified 5% CO 2 atmosphere.
  • Bioluminescence Assay After incubation with OSI-file chemicals, cell plates were washed 3 times with PBS using an Ultrawash 2 Microplate Washer (Dynatech Labs) and 75 ul of Lysis Buffer 2 were added to each well (Lysis Buffer 2 is the same as Lysis buffer 1 except that the ATP and DTT concentrations were changed to 2.67 mM and 133 mM, respectively). Bioluminescence was initiated by the addition of 25 ul 0.4 ⁇ m Luciferin in Buffer B to each well, and was measured in a Dynatech ML 1000 luminometer following a 1 minute incubation at room temperature. Data were captured using Lotus-Measure (Lotus) software and processed by custom-designed macros written in Lotus.
  • the cell lysis buffer was modified to also contain the luciferin. Therefore, lysis of cells and the bioluminescence reaction begin simultaneously and the production of bioluminescent light reaches a maximum at about 5 min. The level of light output declines by about 20% within further 30 min.
  • bovine serum albumin has been omitted. This improved lysis buffer has been shown to remain fully functional for at least 12 hours, when kept on ice and protected from direct light.
  • the half-life of the reporter molecule becomes a crucial parameter in determining the minimal incubation time that would be necessary to allow enough decay of reporter molecules so that the inhibition of their synthesis became visible.
  • the oncogene reporter cell line were therefore tested for the time dependency of luciferase activity after treatment of the cells with Actinomycin D, an inhibitor of transcription. This experiment measured the combined half-life of luciferase mRNA and of the luciferase protein and compares the rate of signal decay of the H-ras, K-ras and c-erbB2 reporter cell lines to a CMV reporter cell line control.
  • CM1 CMV
  • K-2 K-ras
  • H21 H-ras
  • N-2 c-erbB2
  • Actinomycin D 25 ⁇ g/ml
  • cells were washed with PBS and luciferase activity of Actinomycin-treated cells determined as described in Materials and Methods. The signal from the treated cells was compared to the luciferase activity of untreated controls.
  • the logarithm of the treated/untreated ratio was plotted versus time, this data is shown in Figure 20.
  • the calculated half-life of the signal from each of the four cell lines is shown in table 1. The half-lives were found to range from about 3 to 10 hours indicating that a 24 hour incubation with a 100% efficient inhibitor of transcription would be sufficient to reduce luciferase levels to 6% of the control in the tested cell lines.
  • Figure 21 shows an analysis of the consistency of the luciferase signal on various areas of each plate.
  • the ratios of negative control values from three different areas within each plate are calculated and plotted versus plate number.
  • the expected value is 1.0. Values greater than 1.5 or less than 0.4 indicate uneven signal generation across the plate.
  • 240 plates, representing 1440 compounds, tested against three cell lines, are shown.
  • the coefficient of variance for the 12 negative control values from each of the same 240 plates are represented by the data shown in Figure 22. Values less than 20% are considered acceptable. Similar data for the 12 positive control values of the same plates are shown in figure 23.
  • FIG 24 shows the transcription induction ratio (TIR) for the positive controls of one cell line represented in the same set of 240 plates.
  • TIR is the ratio of the experimental values to the untreated controls.
  • the cell line is the K-ras reporter and the positive control is Actinomycin D a potent general inhibitor of transcription.
  • Three values are shown for each plot, representing three different concentrations of Actinomycin D. The expected value for such an analysis depends on the half life of the signal and the incubation time (here 24 hours), but for this combination, typical values range from 0.4 to 0.3 fold.
  • Screen I Table 1 shows a summary of the results of a one-week, high-throughput screen of 2,000 chemicals to identify those chemicals specifically stimulating or inhibiting transcription from the HGH or MMTV and G-CSF (control) promoters.
  • This screen concurrently tested chemicals at three concentrations on quadruplicate samples of the M10 (MMTV), G21 (G-CSF) and 532 (HGH) cell lines.
  • a minimum stimulation of one promoter, to the degree indicated, and less than 50% activation of the other promoter was required for a chemical to be considered a selective activator.
  • a minimum inhibition of 3 fold of one promoter and less than 20% inhibition of the other promoter was required for a chemical to be considered a selective inhibitor.
  • Table 2 identifies the compounds which scored as positive in the screen and reports their induction ratios.
  • Table 3 presents the data from another, independent screen representing a three week high throughput screen of 2334 compounds.
  • Three cell lines were utilized; CM1 (the CMV reporter cell line) as a control for nonspecific effects.
  • N-2 the c-erbB2 reporter cell line
  • K-2 the K-ras reporter cell line, also used here as a control.
  • Each compound was assayed at three concentrations in quadruplicate.
  • Each microtiter plate included a negative control row (no added compound) and a positive control row (Actinomycin D at three concentrations). The data are reported as TIR (transcription induction ratio) which is the median of the samples quadruplicate values divided by the median of the negative control values.
  • the selection criteria for lead compounds is that the test promoter be inhibited to 0.4 of the negative control while the other cell lines remain within 0.8X of the control value.
  • MOLECULE TYPE DNA (genomic)
  • Xi SEQUENCE DESCRIPTION: SEQ ID NO:1:
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • Xi SEQUENCE DESCRIPTION: SEQ ID NO:4:
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Analytical Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Cette invention concerne un procédé permettant d'effectuer l'expression de facteurs de croissance et de récepteurs de facteurs de croissance dans des cellules ou chez des animaux multicellulaires; ainsi que des procédés de vérification de composés utiles pour effectuer la transcription de facteurs de croissance et de récepteurs de facteurs de croissance.
PCT/US1992/000419 1991-01-18 1992-01-17 Procedes permettant de moduler par transcription l'expression de genes de facteurs de croissance et de genes de recepteurs de facteurs de croissance WO1992013063A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US64429291A 1991-01-18 1991-01-18
US644,292 1991-01-18

Publications (1)

Publication Number Publication Date
WO1992013063A1 true WO1992013063A1 (fr) 1992-08-06

Family

ID=24584278

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1992/000419 WO1992013063A1 (fr) 1991-01-18 1992-01-17 Procedes permettant de moduler par transcription l'expression de genes de facteurs de croissance et de genes de recepteurs de facteurs de croissance

Country Status (2)

Country Link
AU (1) AU1469292A (fr)
WO (1) WO1992013063A1 (fr)

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994028170A1 (fr) * 1993-05-27 1994-12-08 Boehringer Ingelheim International Gmbh Procede de criblage de substances a effet modulateur sur la voie de transmission cellulaire de signaux dependant d'un recepteur a l'interleukine 5
AU655839B2 (en) * 1991-06-27 1995-01-12 Genelabs Technologies, Inc. Screening assay for the detection of DNA-binding molecules
WO1995017507A1 (fr) * 1993-12-23 1995-06-29 Biognostik Gesellschaft für Biomolekulare Diagnostik mbH ACIDES NUCLEIQUES ANTI-SENS DESTINES A LA PREVENTION ET AU TRAITEMENT DE TROUBLES DANS LESQUELS INTERVIENT L'EXPRESSION DE c-erbB
US5445941A (en) * 1993-06-21 1995-08-29 Eli Lilly And Company Method for screening anti-osteoporosis agents
WO1997000957A1 (fr) * 1995-06-23 1997-01-09 President And Fellows Of Harvard College Regulation de la transcription de genes codant des recepteurs du facteur de croissance endotheliale vasculaire
WO1997014812A2 (fr) * 1995-10-16 1997-04-24 Chiron Corporation Procede de criblage pour la recherche de facteurs qui modulent l'expression genique
WO1997015330A1 (fr) * 1995-10-23 1997-05-01 Hyal Pharmaceutical Australia Limited Acide hyaluronique utilise comme porteur d'adn pour une therapie genique et adn anti-sens du facteur de croissance de l'endothelium vasculaire pour le traitement d'une vascularisation anormale de la retine
US5659024A (en) * 1994-01-14 1997-08-19 The Burnham Institute Promotors that regulate the expression of genes involved in cell death
EP0816848A1 (fr) * 1996-06-28 1998-01-07 BOEHRINGER INGELHEIM INTERNATIONAL GmbH Méthode pour le criblage comparatif des substances avec l'activité pharmacologique
EP0826368A1 (fr) * 1996-09-02 1998-03-04 Centre International De Recherches Dermatologiques Galderma, ( Cird Galderma) Utilisation de rétinoides pour la préparation d'un médicament destiné à traiter les affections liées à une surexpression de VEGF
US5753431A (en) * 1993-10-13 1998-05-19 Northeastern Ohio University Cholesterol 7 α-hydroxdylase gene regulatory elements and transcription factors
US5821057A (en) * 1995-11-27 1998-10-13 Northeastern Ohio Universities Assay for agents that affect cholesterol 7alpha-hydroxylase expression and a characterization of its regulatory elements
US5888765A (en) * 1995-06-23 1999-03-30 President And Fellows Of Harvard College Endothelial-cell specific promoter
WO2003004995A3 (fr) * 2001-01-29 2003-05-22 Ivan N Rich Dosage a haut rendement de cellules souches d'une souche hematopoietique et proliferation de cellules progenitrices
US7354730B2 (en) 2002-01-29 2008-04-08 Hemogenix, Inc. High-throughput assay of hematopoietic stem and progenitor cell proliferation
US7666615B2 (en) 2001-01-29 2010-02-23 Hemogenix, Inc. High-throughput assay of hematopoietic stem and progenitor cell proliferation
US7989178B2 (en) 2001-01-29 2011-08-02 Hemogenix, Inc. Colony assay miniaturization with enumeration output

Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0117058A2 (fr) * 1983-01-19 1984-08-29 Genentech, Inc. Procédés de production de protéines matures dans des cellules hôtes de vertébrés
US4601978A (en) * 1982-11-24 1986-07-22 The Regents Of The University Of California Mammalian metallothionein promoter system
US4738922A (en) * 1984-05-25 1988-04-19 Dana Farber Cancer Institute Trans-acting transcriptional factors
US4740461A (en) * 1983-12-27 1988-04-26 Genetics Institute, Inc. Vectors and methods for transformation of eucaryotic cells
US4761371A (en) * 1985-02-12 1988-08-02 Genentech, Inc. Insulin receptor
US4806463A (en) * 1986-05-23 1989-02-21 Worcester Foundation For Experimental Biology Inhibition of HTLV-III by exogenous oligonucleotides
WO1989002472A1 (fr) * 1987-09-21 1989-03-23 Amrad Corporation Limited Regulation de l'expression du gene gm-csf
US4861709A (en) * 1985-05-31 1989-08-29 Technicon Research A.G. Detection and/or identification of microorganisms in a test sample using bioluminescence or other exogenous genetically-introduced marker
US4935363A (en) * 1987-03-30 1990-06-19 Board Of Regents, The University Of Texas System Sterol regulatory elements
US4981783A (en) * 1986-04-16 1991-01-01 Montefiore Medical Center Method for detecting pathological conditions
US5070012A (en) * 1988-03-30 1991-12-03 The Board Of Trustees Of The Leland Stanford Junior University Monitoring of cells and trans-activating transcription elements

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4601978A (en) * 1982-11-24 1986-07-22 The Regents Of The University Of California Mammalian metallothionein promoter system
EP0117058A2 (fr) * 1983-01-19 1984-08-29 Genentech, Inc. Procédés de production de protéines matures dans des cellules hôtes de vertébrés
US4740461A (en) * 1983-12-27 1988-04-26 Genetics Institute, Inc. Vectors and methods for transformation of eucaryotic cells
US4738922A (en) * 1984-05-25 1988-04-19 Dana Farber Cancer Institute Trans-acting transcriptional factors
US4761371A (en) * 1985-02-12 1988-08-02 Genentech, Inc. Insulin receptor
US4861709A (en) * 1985-05-31 1989-08-29 Technicon Research A.G. Detection and/or identification of microorganisms in a test sample using bioluminescence or other exogenous genetically-introduced marker
US4981783A (en) * 1986-04-16 1991-01-01 Montefiore Medical Center Method for detecting pathological conditions
US4806463A (en) * 1986-05-23 1989-02-21 Worcester Foundation For Experimental Biology Inhibition of HTLV-III by exogenous oligonucleotides
US4935363A (en) * 1987-03-30 1990-06-19 Board Of Regents, The University Of Texas System Sterol regulatory elements
WO1989002472A1 (fr) * 1987-09-21 1989-03-23 Amrad Corporation Limited Regulation de l'expression du gene gm-csf
US5070012A (en) * 1988-03-30 1991-12-03 The Board Of Trustees Of The Leland Stanford Junior University Monitoring of cells and trans-activating transcription elements

Non-Patent Citations (29)

* Cited by examiner, † Cited by third party
Title
BIO/TECHNIQUES, Vol. 7, issued November/December 1989, MUNJAAL et al., "In Situ Detection of Progesterone Receptor mRNA in the Chicken Oviduct Using Probe-On Slides", pages 1104-1108. *
BIO/TECHNIQUES, Vol. 7, No. 10, issued November/December 1989, BRASIER et al., "Optimized Use of the Firefly Luciferase Assay as a Reporter Gene in Mammalian Cell Lines", pages 1116-1122. *
BIO/TECHNIQUES, Vol. 7, No. 10, issued November/December 1989, BRENNER et al., "Message Amplification Phenotyping (MAPPing): A Technique to Simultaneously Measure Multiple mRNAs from Small Numbers of Cells", pages 1096-1103. *
BIO/TECHNIQUES, Vol. 7, No. 10, issued November/December 1989, SLACK et al., "Application of the Multiscreen System to Cytokine Radioreceptor Assays", pages 1132-1138. *
BIO/TECHNIQUES, Vol. 7, No. 6, issued June 1989, CAO et al., "A Simple and Inexpensive System to Amplify DNA By PCR", pages 566-567. *
BIO/TECHNIQUES, Vol. 7, No. 6, issued June 1989, LIM et al., "A Simple Assay for DNA Transfection by Incubation of the Cells in Culture Dishes With Substrates for Beta-Galactosidase", pages 576-579. *
BIO/TECHNIQUES, Vol. 8, No. 1, issued January 1990, RAO et al., "A Quantitative Assay for Beta-D-Glucuronidase (GUS) Using Microtiter Plates", pages 38-40. *
BIO/TECHNIQUES, Vol. 8, No. 3, issued March 1990, WILLINGHAM et al., "A Reversible Multi-Well Chamber for Incubation of Cultured Cells With Small Volumes: Application to Screening of Hybridoma Fusions Using Immunofluorescence Microscopy", pages 320-324. *
BIO/TECHNIQUES, Vol. 9, No. 4, issued October 1990, PONS et al., "A New Cellular Model of Response to Estrogens: A Bioluminescent Test to Characterize (Anti)Estrogen Molecules", pages 450-459. *
BIO/TECHNOL., Vol. 7, issued March 1989, MCCALL et al., "Biotherapy: A New Dimension in Cancer Treatment", pages 231-240. *
BIO/TECHNOL., Vol. 7, issued March 1989, RATNER, "Can the Antisense Message be Delivered?", page 207. *
CELL, Vol. 49, issued 19 June 1987, ANGEL et al., "Phorbol Ester-Inducible Genes Contain a Common Cis Element Recognized by a TPA-Modulated Trans-Acting Factor", pages 729-739. *
CELL, Volume 47, issued 10 October 1986, YANG et al., "Human IL-3 (Multi-CSF): Identification by Expression Cloning of a Novel Hematopoietic Growth Factor Related to Murine IL-3", pages 3-10. *
DE SERRES et al., "Chemical Mutagens. Principles and Methods for their Detection", published 1980 by PLENUM PRESS (NEW YORK), pages 331, and 365-473. *
EMBO J., Volume 5, No. 3, issued March 1986, NAGATA et al., "The Chromosomal Gene Structure and Two mRNAs for Human Granulocyte Colony-Stimulating Factor", pages 575-581. *
EMBO J., Volume 6, No. 4, issued April 1987, LEFEVRE et al., "Tissue-Specific Expression of the Human Growth Hormone Gene is Conferred in Part by the Binding of a Specific Trans-Acting Factor", pages 971-981. *
EMBO J., Volume 6, No. 9, issued September 1987, LADNER et al., "Human CSF-1: Gene Structure and Alternative Splicing of mRNA", pages 2693-2698. *
EXP. HEMATOL., Vol. 16, issued 1988, BICKEL et al., "Granulocyte-Macrophage Colony-Stimulating Factor Regulation in Murine T Cells and its Relation to Cyclosporin A", pages 691-695. *
GENE AMPLIFICATION, (SCHIMKE, R.T., ed.), issued 1982, MAYO et al., "Altered Regulation of the Mouse Metallothionein I Gene Following Gene Amplification or Transfection", pages 67-73. *
J. IMMUNOL., Vol. 143, issued 15 July 1989, TOCCI et al., "The Immunosuppressant FK506 Selectively Inhibits Expression of Early T Cell Activation Genes", pages 718-726. *
MOL. CELL. BIOL., Volume 7, No. 6, issued June 1987, ANGEL et al., "12-O-Tetradecanoyl-Phorbol-13-Acetate Induction of the Human Collagenase Gene is Mediated by an Inducible Enhancer Element Located in the 5'-Flanking Region", pages 2256-2266. *
MOLEC. CELL. BIOL., Volume 7, No. 2, issued February 1987, DE WET et al., "Firefly Luciferase Gene: Strucutre and Expression in Mammalian Cells", pages 725-737. *
NATURE, Vol. 346, issued 16 August 1990, STANDAERT et al., "Molecular Cloning and Overexpression of the Human FK506-Binding Protein FKBP", pages 671-674. *
PROC. NATL. ACAD. SCI. USA, Volume 82, issued November 1985, LIN et al., "Cloning and Expression of the Human Erythropoietin Gene", pages 7580-7584. *
PROC. NATL. ACAD. SCI. USA, Volume 83, issued May 1986, KAUSHANSKY et al., "Genomic Cloning, Characterization, Multilineage Growth Promoting Activity of Human Granulocyte-Macrophage Colony-Stimulating Factor", pages 3101-3105. *
PROC. NATL. ACAD. SCI. USA., Vol. 81, issued August 1984, KRONKE et al., "Cyclosporin A Inhibits T-Cell Growth Factor Gene Expression at the Level of mRNA Transcription", pages 5214-5218. *
SCIENCE, Vol. 230, issued 18 October 1985, KAWASAKI et al., "Molecular Cloning of a Complementary DNA Encoding Human Macrophage-Specific Colony-Stimulating Factor (CSF-1)", pages 291-296. *
SCIENCE, Volume 227, issued 15 March 1985, ENGEBRECHT et al., "Measuring Gene Expression with Light", pages 1345-1347. *
SCIENCE, Volume 236, issued 05 June 1987, MANIATIS et al., "Regulation of Inducible Tissue-Specific Gene Expression", pages 1237-1245. *

Cited By (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU655839B2 (en) * 1991-06-27 1995-01-12 Genelabs Technologies, Inc. Screening assay for the detection of DNA-binding molecules
WO1994028170A1 (fr) * 1993-05-27 1994-12-08 Boehringer Ingelheim International Gmbh Procede de criblage de substances a effet modulateur sur la voie de transmission cellulaire de signaux dependant d'un recepteur a l'interleukine 5
US5922549A (en) * 1993-05-27 1999-07-13 Boehringer Ingelheim International Gmbh Process for screening substances having a modulating effect on an interleukin-5 receptor mediated cellular signal transmission pathway
US5445941A (en) * 1993-06-21 1995-08-29 Eli Lilly And Company Method for screening anti-osteoporosis agents
US5753431A (en) * 1993-10-13 1998-05-19 Northeastern Ohio University Cholesterol 7 α-hydroxdylase gene regulatory elements and transcription factors
US6365345B1 (en) 1993-12-23 2002-04-02 Biognostik Gesellscahft Für Biomokekulare Diagnostik mbH Antisense nucleic acids for the prevention and treatment of disorders in which expression of c-erbB plays a role
WO1995017507A1 (fr) * 1993-12-23 1995-06-29 Biognostik Gesellschaft für Biomolekulare Diagnostik mbH ACIDES NUCLEIQUES ANTI-SENS DESTINES A LA PREVENTION ET AU TRAITEMENT DE TROUBLES DANS LESQUELS INTERVIENT L'EXPRESSION DE c-erbB
US5659024A (en) * 1994-01-14 1997-08-19 The Burnham Institute Promotors that regulate the expression of genes involved in cell death
US5908750A (en) * 1994-01-14 1999-06-01 Le Jolla Cancer Research Foundation Screening assays for identifying agents that regulate the expression of genes involved in cell death
WO1997000957A1 (fr) * 1995-06-23 1997-01-09 President And Fellows Of Harvard College Regulation de la transcription de genes codant des recepteurs du facteur de croissance endotheliale vasculaire
US5888765A (en) * 1995-06-23 1999-03-30 President And Fellows Of Harvard College Endothelial-cell specific promoter
WO1997014812A3 (fr) * 1995-10-16 1997-06-19 Chiron Corp Procede de criblage pour la recherche de facteurs qui modulent l'expression genique
WO1997014812A2 (fr) * 1995-10-16 1997-04-24 Chiron Corporation Procede de criblage pour la recherche de facteurs qui modulent l'expression genique
WO1997015330A1 (fr) * 1995-10-23 1997-05-01 Hyal Pharmaceutical Australia Limited Acide hyaluronique utilise comme porteur d'adn pour une therapie genique et adn anti-sens du facteur de croissance de l'endothelium vasculaire pour le traitement d'une vascularisation anormale de la retine
US5821057A (en) * 1995-11-27 1998-10-13 Northeastern Ohio Universities Assay for agents that affect cholesterol 7alpha-hydroxylase expression and a characterization of its regulatory elements
WO1998000713A1 (fr) * 1996-06-28 1998-01-08 Boehringer Ingelheim International Gmbh Procede de criblage comparatif de substances pharmacologiquement actives
EP0816848A1 (fr) * 1996-06-28 1998-01-07 BOEHRINGER INGELHEIM INTERNATIONAL GmbH Méthode pour le criblage comparatif des substances avec l'activité pharmacologique
FR2752734A1 (fr) * 1996-09-02 1998-03-06 Cird Galderma Utilisation de retinoides pour la preparation d'un medicament destine a traiter les affections liees a une surexpression de vegf
EP0826368A1 (fr) * 1996-09-02 1998-03-04 Centre International De Recherches Dermatologiques Galderma, ( Cird Galderma) Utilisation de rétinoides pour la préparation d'un médicament destiné à traiter les affections liées à une surexpression de VEGF
US6001885A (en) * 1996-09-02 1999-12-14 Centre International De Recherches Dermatologiques Retinoid inhibition of expression of VEGF
US7700354B2 (en) 2001-01-29 2010-04-20 Hemogenix, Inc. High throughput stem cell assay for identifying stem cells useful for transplantation
US7354729B2 (en) 2001-01-29 2008-04-08 Hemogenix, Inc. High-throughput stem cell assay of hematopoietic stem and progenitor cell proliferation
US7666615B2 (en) 2001-01-29 2010-02-23 Hemogenix, Inc. High-throughput assay of hematopoietic stem and progenitor cell proliferation
WO2003004995A3 (fr) * 2001-01-29 2003-05-22 Ivan N Rich Dosage a haut rendement de cellules souches d'une souche hematopoietique et proliferation de cellules progenitrices
US7709258B2 (en) 2001-01-29 2010-05-04 Hemogenix, Inc. High throughput assay for identifying compounds capable of modulating the proliferative status of stem cells
US7989178B2 (en) 2001-01-29 2011-08-02 Hemogenix, Inc. Colony assay miniaturization with enumeration output
US7354730B2 (en) 2002-01-29 2008-04-08 Hemogenix, Inc. High-throughput assay of hematopoietic stem and progenitor cell proliferation
US7883861B2 (en) 2002-01-29 2011-02-08 Hemogenix, Inc. High throughput assay of hematopoietic stem and progenitor cell proliferation

Also Published As

Publication number Publication date
AU1469292A (en) 1992-08-27

Similar Documents

Publication Publication Date Title
US6589733B1 (en) Methods of preparing compositions comprising chemicals capable of transcriptional modulators
EP0483249B1 (fr) Methode permettant de moduler l'expression de genes par transcription et de decourvrir des substances chimiques pouvant agir comme modulateurs de l'expression de genes
US6165712A (en) Methods of transcriptionally modulating expression of viral genes and genes useful for production of proteins
WO1992013063A1 (fr) Procedes permettant de moduler par transcription l'expression de genes de facteurs de croissance et de genes de recepteurs de facteurs de croissance
US6376175B1 (en) Methods of discovering chemicals capable of functioning as gene expression modulators
US5846720A (en) Methods of determining chemicals that modulate expression of genes associated with cardiovascular disease
Lichtler et al. Isolation and characterization of the rat α1 (I) collagen promoter: regulation by 1, 25-dihydroxyvitamin D
Südhof et al. 42 bp element from LDL receptor gene confers end-product repression by sterols when inserted into viral TK promoter
Ness et al. Myb and NF-M: combinatorial activators of myeloid genes in heterologous cell types.
Stern et al. Differential responsiveness of myc-and ras-transfected cells to growth factors: selective stimulation of myc-transfected cells by epidermal growth factor
Nedivi et al. A neural-specific GAP-43 core promoter located between unusual DNA elements that interact to regulate its activity
KR100917939B1 (ko) 신규한 발현 벡터
KR19990044683A (ko) 조건성 복제기원을 지닌 환상 디엔에이 분자, 이의 제조방법 및 유전자 요법에 있어서 이의 용도
Sarid Identification of a cis‐acting positive regulatory element of glial fibrillary acidic protein gene
WO1992013091A1 (fr) Procede de modulation par transcription de l'expression genique d'oncogenes et de genes supprimant les tumeurs
WO1993007280A1 (fr) Transcription de genes humains specifique aux astrocytes
US5759806A (en) Coding, promoter and regulator sequences of IRF-1
WO1992012635A1 (fr) Procedes de modulation transcriptionnelle de l'expression genetique de genes viraux et d'autres genes
WO1992013092A1 (fr) Procede servant a moduler par un mecanisme de transcription l'expression des genes de codage des facteurs de croissance hematopoietiques
CA2337088C (fr) Techniques et produits de recombinaison relatifs a une expression de proteine
Leshkowitz et al. Insulin-producing cells contain a cell-specific repressor activity that functions through multiple E-box sequences
JP2003503034A (ja) 核内ｐｐａｒレセプターを使用する発現調節システム
AU2001274266B2 (en) Gene-regulating conjugates
Wurm et al. Use of transfected and amplified Drosophila heat shock promoter construction for inducible production of toxic mouse c-myc proteins in CHO cells
Chang Growth regulation and control of gene expression of the human PCNA gene

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA FI HU JP KR NO RU US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IT LU MC NL SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA