WO1992006186A1 - Cartouches de clonage et vecteurs d'expression dans des bacteries gram negatif - Google Patents

Cartouches de clonage et vecteurs d'expression dans des bacteries gram negatif Download PDF

Info

Publication number
WO1992006186A1
WO1992006186A1 PCT/US1991/006006 US9106006W WO9206186A1 WO 1992006186 A1 WO1992006186 A1 WO 1992006186A1 US 9106006 W US9106006 W US 9106006W WO 9206186 A1 WO9206186 A1 WO 9206186A1
Authority
WO
WIPO (PCT)
Prior art keywords
cloning
gene
plasmid
cartridge
site
Prior art date
Application number
PCT/US1991/006006
Other languages
English (en)
Inventor
Kwang-Mu Yen
Original Assignee
Amgen Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Amgen Inc. filed Critical Amgen Inc.
Publication of WO1992006186A1 publication Critical patent/WO1992006186A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0069—Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/78—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Pseudomonas
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y113/00—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13)
    • C12Y113/11—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13) with incorporation of two atoms of oxygen (1.13.11)
    • C12Y113/11002—Catechol 2,3-dioxygenase (1.13.11.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y113/00—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13)
    • C12Y113/12—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13) with incorporation of one atom of oxygen (internal monooxygenases or internal mixed function oxidases)(1.13.12)
    • C12Y113/12007—Photinus-luciferin 4-monooxygenase (ATP-hydrolysing) (1.13.12.7), i.e. firefly-luciferase

Definitions

  • An expression plasmid vector is an indispensable tool for the study of gene expression in bacterial cells.
  • the need to develop expression vectors is particularly acute for little- studied bacterial strains in which gene expression needs to be assessed.
  • At least two approaches can be imagined for the introduction of an expression vector into these bacterial strains.
  • a native plasmid if it is known, can be converted into an expression vector or a broad host range expression vector can be introduced into these strains.
  • the native plasmid of a poorly- studied strain is usually not very well characterized. Genetic elements essential for regulated gene expression have to be introduced from other sources in order to convert it into an expression vector.
  • NAH7 plasmid has been well studied (for review, see Yen and
  • NAH7 plasmid is a naturally-occurring plasmid in the Pseudomonas nutida (P. putida) strain G7 (ATCC 17485). It carries catabolic genes for the degradation of naphthalene to Krebs cycle intermediates
  • the first operon encodes enzymes for the conversion of naphthalene to salicylate
  • the second operon encodes enzymes for the oxidation of salicylate to acetylaldehyde and pyruvate (lower pathway). Both operons are activated in the presence of the inducer salicylic acid, or some of its analogs , and the product of the regulatory gene, nahR.
  • the nahR gene maps upstream from the lower pathway operon and next to the nahG gene which encodes the enzyme salicylate hydroxylase ( Figure 1).
  • the two genes, nahR and nahG. are transcribed in opposite directions and their promoters, P R and P G , share sequences. While P G is subject to the positive regulation of NahR protein, P R directs the synthesis of NahR protein constitutively.
  • a cloning cartridge and its derivative have been successfully constructed based on the NahR-regulated gene expression system.
  • the two cartridges also called cassettes
  • Plasmid vectors carrying one of the cartridges have allowed cloning and inducible expression of several tested genes in all of the Gram-negative bacteria tested to date.
  • High-level protein production from a cloned gene was also demonstrated.
  • the DNA elements assembled in the cloning cartridges provide previously unavailable convenience and efficiency in gene cloning and expression in Gram-negative bacteria.
  • cloning cartridges according to the present invention contained on an ⁇ 3.6 kb restriction fragment allow efficient (e.g., single-step) construction of expression vectors in a wide variety of Gram- negative bacteria.
  • the present invention is directed to a cloning cartridge or cassette which comprises five elements essential for efficient gene cloning and expression, based on the NahR-regulated expression system.
  • the five elements comprising a cloning cartridge according to the present invention are: a gene encoding drug-resistance, a nahR gene, a promoter P G regulated by the nahR gene product, a multiple cloning site, and a transcription terminator.
  • a useful drug-resistance gene is the gene encoding tetracycline-resistance (tet r ) derived from the pBR322 plasmid.
  • the sequence upstream from the Hind III site in the promoter of the tet r gene was replaced with the nahR sequence.
  • This sequence substitution generated a new hybrid promoter for the tet r in the cartridge and had the effect of stabilizing a plasmid carrying a cloning cartridge according to the present invention in the absence of selection.
  • the nahR gene in the cloning cartridge is derived from the NAH7 plasmid naturally occurring in P. putida. It encodes the protein, NahR, that positively regulates the promoter P G of the lower pathway operon for naphthalene degradation.
  • the promoter P G is activated in the presence of the NahR protein and an innocuous and inexpensive inducer, sodium salicylate at low concentrations (0.35 mM or lower).
  • an innocuous and inexpensive inducer, sodium salicylate at low concentrations (0.35 mM or lower).
  • a sequence of 3 nucleotides upstream of the ATG sequence encoding the initiation codon was altered to create an Ndel cloning site which was followed by a number of other cloning sites in the order of 5' - Hpal - Clal - Xbal - Kpnl - Sacl - Xhol - 3'.
  • the 5' end of a characterized gene can be converted into an Ndel site without altering the coding property and cloned into this cartridge for regulated expression.
  • a transcription terminator derived from plasmid pCFM1146 was placed immediately downstream to the multiple cloning site of P G .
  • a novel five-element portable cloning cartridge according to the present invention was assembled as an ⁇ 3.6 kb EcoRI - Pstl fragment, which can be easily inserted into a variety of different replicons.
  • Such a cloning cartridge when inserted into a replicon of either broad or narrow host range, converts it into an expression vector.
  • the present invention is also directed to plasmid vectors of broad or narrow host range containing the cloning cartridge.
  • a particularly preferred embodiment is the broad host range expression vector pKMY299, constructed by replacing the EcoRI - Pstl fragment of plasmid pKMY286 with the ⁇ 3.6 kb EcoRI - Pstl cloning cartridge.
  • plasmid pKMY299 was precisely designed for cloning and expression of genes that contain, or are engineered to contain an Ndel recognition sequence (CATATG) at the 5' end of the gene.
  • CAATG Ndel recognition sequence
  • the cloning cartridge in pKMY299 was modified by the deletion of the sequence encoding the start codon AUG within the multiple cloning site.
  • This derivative of pKMY299, designated pKMY319 thus comprises a modified cloning cartridge.
  • the sequence deletion prevents false translational initiation in gene expression from the P G promoter in pKMY319.
  • Figure 1 shows a restriction map of an ⁇ 1.7 kb Hindlll/Pstl fragment from a region of plasmid NAH7 containing the nahR gene and part of the nahG gene.
  • P R and P G are promoters of nahR and nahG, respectively, with the arrows indicating direction of transcription.
  • Figure 2 shows the initial steps (from plasmid pKMY256 to pKMY292) in the construction of a cloning cartridge according to the present invention.
  • Figure 3 shows the subsequent steps (from plasmid pKMY292 to pKMY297) leading to the construction of a cloning cartridge in plasmid pKMY297.
  • Figure 4 shows the derivation of an expression vector pKHY319 from the pKMY299 expression vector.
  • Figure 5 shows the SDS-PAGE analysis of protein products from expression vectors pKMY299 and pKMY319, which comprise a cloning cartridge or modified cloning cartridge according to the present invention, in Pseudomonas putida G572.
  • Expression of firefly luciferase under induced and uninduced conditions is shown in lanes 2,8 and 3,9, respectively.
  • Expression of catechol 2,3 dioxygenase under induced and uninduced conditions is shown in lanes 4,6 and 5,7, respectively.
  • a cloning cartridge according to the present invention is designed to contain five elements essential for efficient gene cloning and expression based on the NahR-regulated expression system. These five elements, on a conveniently portable cartridge or cassette, comprise a drug resistance gene tet r , nahR, P G , a multiple cloning site, and a transcription terminator. Such a cloning cartridge can be easily inserted into a variety of vectors for efficient and regulated gene expression.
  • a recognition site for the frequently-cutting restriction endonuclease Rsal is located three base pairs upstream from the nahG coding region ( Figure 1).
  • Plasmid pKMY256 has been described in co-pending and co- assigned U.S. Patent Application Ser. No. __, filed September ____, 1990, and hereby incorporated by reference in its entirety. It is an E. coli plasmid pUC19 (Yanisch-Perron et al., 1985, Gene 33: 103-119), carrying an ⁇ 5.3 kb Pstl insert which contains the nahR gene, P G , and ⁇ 200 base pairs (bp) of the nahG gene.
  • the ⁇ 470 bp Bglll-Scal fragment of pKMY289 carrying P R and P G was used to replace a ⁇ 4.4 kb Bplll-Scal fragment in a pBR322 plasmid carrying a copy of the transposon Tn5 (Sasakawa et al., 1982, Proc. Natl. Acad. Sci. USA 79: 7450-7454; ( Figure 2).
  • the resulting plasmid was designated pKMY291 ( Figure 2).
  • a multiple cloning site was inserted at the newly-created Scal site within P G and a transcription terminator was inserted at the end of the cloning site.
  • the nucleotide sequence ATG specifies the initiation codon.
  • This trinucleotide and the sequence preceding it can be converted by site-specific mutagenesis into the recognition site of the restriction endonuclease Ndel (CATATG) without affecting the coding property of the gene.
  • a Ndel site can be similarly created in an expression vector at the junction between the promoter and the 5' end of a gene coding region.
  • restriction sites can be introduced downstream of the Ndel site for accepting the 3' end of a cloned gene.
  • the distance between the transcription start site and the gene coding region is unaltered, regardless of the gene cloned.
  • the promoter P R was modified to contain a Ndel restriction site at the 3' end, followed by a number of other cloning sites.
  • Insertion of this sequence converted the Scal site into the Rsal site naturally occurring within P G , restored the distance between the Rsal site and the coding region, generated a Ndel cloning site at the 3' end of the P G sequence and placed a number of other cloning sites immediately downstream of the Ndel site.
  • the resulting plasmid was designated pKMY293 ( Figure 3).
  • the E. coli plasmid pCFM1146 has been described in co- pending and co-assigned U.S. Patent Application Ser. No. _ filed September ______, 1990, incorporated by reference in its entirety, carries a transcription terminator that can be easily incorporated into other systems.
  • Other sources of transcription terminators are described in co-assigned U.S. Patent No. 4,710,473, hereby incorporated by reference.
  • Downstream from the transcription terminator there is a restriction site for the enzyme Bglll and immediately upstream from the transcription terminator, there is a multiple cloning site including an EcoRI site, a Xhol site and a number of other restriction sites ( Figure 3).
  • the transcription terminator in pCFM1146 was placed immediately downstream of the multiple cloning site in pKMY293 in two steps.
  • the BspMll-Pstl fragment of pKMY293 carrying the tet r gene, P R , P G , and the multiple cloning site was initially cloned into the Xmal and the Pstl sites of the plasmid pUC9 (Vieira and Messing, 1982, Gene 19: 259-268) to place the EcoRI site of pUC9 downstream of the tet r gene ( Figure 3).
  • the resulting plasmid was designated pKMY294 ( Figure 3).
  • pKMY513 a pUC9 derivative without a Hindlll site, designated pKMY513, was initially constructed by cleaving pUC9 with the enzyme Hindlll followed by end-filling and blunt-end ligation ( Figure 3).
  • the EcoRI-Bglll fragment of pKMY295 carrying the tet r gene, P R , P G , the multiple cloning site, and the transcription terminator was cloned into the EcoRI and BamHI sites of pKMY513 to eliminate the
  • pKMY296 In pKMY296, the part of the nahR gene downstream from the Hindlll site within nahR is still missing.
  • an indicator plasmid designated pKMY512, was constructed which contained the naphthalene dioxygenase gene cluster and its NahR-regulated promoter from the plasmid NAH7.
  • the naphthalene dioxygenase genes of pKMY512 can be turned on, which in turn catalyzes the formation of indigo dye in E. coli (Ensley et al., 1983, Science 222: 167-169).
  • the plasmid pN400 was constructed by cloning the Pvull-Bglll fragment of plasmid pE317 (Ensley et al., 1983, supra) containing the naphthalene dioxygenase genes into the Smal and BamHI sites of the plasmid pUC18 (Yanisch-Perron et al., 1985, supra).
  • the plasmid pKMY239 was constructed by inserting the ⁇ 6.4 kb Sacl fragment of pN400 containing the naphthalene dioxygenase genes into the Sacl site of the broad host range plasmid pKMY223. Plasmid pKMY223 has been described in co- pending and co-assigned U.S. Patent Application Ser. No. __, filed September ______, 1990, incorporated by reference in its entirety. Deletion of the BgllI-EcoRI fragment of pKMY239 carrying a portion of the nahR gene generated pKMY512.
  • Plasmid pKT231 is a derivative of RSF1010 (Bagdasarian et al., 1981, supra) and served as a source of the RSF1010 replicon.
  • a Hnal site is located ⁇ 200 bp from a Sacl site both of which occur in the polylinker of the cloning cartridge.
  • pKMY286 The broad host range expression vector pKM ⁇ 299 was constructed by replacing the EcoRI-Pstl fragment in pKMY286 with the 3.6 kb EcoRI-Pstl cloning cartridge ( Figure 4).
  • Plasmid pKMY299 can be considered, therefore, as an RSF1010 plasmid with nucleotides 1 to 1653 deleted and nucleotides 7768 to 8676 replaced with a 3.6 kb cloning cartridge.
  • Plasmid pKMY299 was designed for precise cloning and regulated expression of genes that contain, or are engineered to contain, an Ndel recognition sequence at the 5' end.
  • the cloning cartridge in pKMY299 was modified.
  • the sequence ATG within the Ndel recognition sequence in pKMY299 was removed to prevent false translational initiation in gene expression from P G . This was achieved by digestion of pKMY299 DNA with Ndel and Hpal followed by treatment with Mung Bean nuclease to remove the overhang, and self-ligation of the remaining plasmid DNA.
  • the resulting plasmid was designated pKMY319 ( Figure 4).
  • the asterisks mark bases complementary to the 3' end of the Pseudomonas aeruginosa 16S RNA and define a coding region for the putative ribosome-binding site (Shine and Delgarno, 1975, Nature 254: 34-38).
  • One of the important bases encoding ribosome- binding site was removed in pKMY319.
  • a disruption of this ribosome binding site might prove advantageous in the use of pKMY319 for the expression of cloned fragments containing genes of unknown sequence.
  • a Shine-Delgarno sequence which is normally located only a few bp upstream from a gene, is usually cloned on a fragment along with the gene.
  • a second ribosome binding site encoded by the expression vector might act to reduce expression (Schauder and McCarthy, 1989, Gene 78 : 59-72).
  • genes of various origins whose products could be easily assayed were cloned into the plasmids and their expression tested.
  • An intronless luciferase gene constructed from Photinus pyralis (firefly) cDNA and genomic clones was reconstructed to contain a Ndel site at the 5' end.
  • the reconstructed luciferase gene was cloned into pKMY299 at the Ndel and Asp718 (Kpnl) sites and the resulting plasmid, pKMY520, was introduced into E. coli and P. putida host cells. Expression of the luciferase gene was analyzed in the presence or absence of sodium salicylate as an inducer in both recombinant host cells. Luciferase activity was determined by measuring the light produced in a reaction catalyzed by this enzyme. Production of luciferase protein in P. putida was also analyzed by SDS polyacrylamide gel electrophoresis (SDS-PAGE) of a crude extract.
  • SDS-PAGE SDS polyacrylamide gel electrophoresis
  • Luciferase production in uninduced recombinan P. putida cells carrying pKMY520 was barely visible on an SDS gel ( Figure 5).
  • the high sensitivity of the luciferase assay allowed detection of relatively high enzyme activity from uninduced recombinant P. putida or E. coli host cells carrying pKMY520 (Table II).
  • the same assay detected a ⁇ 90 fold induction of the luciferase activity in recombinant P. putida host cells (Table II) and an ⁇ 80 fold induction of the same activity in recombinant E. coli host cells.
  • the amount of luciferase produced in induced P. putida cells carrying pKMY520 represented ⁇ 3.7% of the total soluble proteins ( Figure 5).
  • restriction fragments carrying the toluene monooxygenase (TMO) gene cluster tmoABCDEF from Pseudomonas mendocina KR1 or the catechol 2, 3-dioxygenase gene from the plasmid NAH7 were individually cloned into pKMY319 to generate plasmids ⁇ KMY342 and pKMY517, respectively.
  • TMO toluene monooxygenase
  • Recombinant plasmid pKMY342 carrying the TMO gene cluster was introduced into a number of Gram-negative bacterial species and plasmid pKMY517 carrying the catechol 2,3- dioxygenase gene was introduced into P. putida. Expression of these genes was measured under induced and uninduced conditions. Significantly higher specific activities of both toluene monooxygenase and catechol 2, 3-dioxygenase were observed from induced cultures than from uninduced cultures of all bacterial strains tested (Tables I and III). These results demonstrated the wide use of pKMY319 as an expression vector in obtaining regulated gene expression in Gram-negative bacteria.
  • This sequence substitution generated a new hybrid promoter for the tet r gene and stabilized the plasmid carrying either of the cloning cartridges according to the present invention.
  • the hybrid promoter in the cloning cartridges described herein allowed the use of the tet r gene as a selection marker in all of the bacterial strains tested (Tables 2, 3 and 4).
  • P. putida KT2440 and P. putida G572 host cells (Table 1) harboring pKMY299 or pKMY319 were grown in L-broth in the absence of tetracycline for over 50 generations.
  • Plasmid pKMY256 was constructed according to the following series of steps.
  • an ⁇ 4.3 kb Hindlll fragment from plasmid pKMY217 containing the nahR and nahG genes was cloned into the Hindlll site of the pKT240 plasmid described by Bagdasarian et al., 1983, Gene 26- 273-82.
  • the resulting plasmid from this first step was designated pKMY219.
  • an ⁇ 7 kb BamHI - Sacl fragment from pKMY219 containing the nahR and nahG genes was cloned into the BamHI and Sacl sites of the pKT231 plasmid described by Bagdasarian et al., 1981, Gene 16: 237-47.
  • the resulting plasmid was designated pKMY223.
  • an ⁇ 6 kb Pstl fragment from pKMY223 containing the nahR gene, ⁇ 200 base pairs of the nahG gene and the gene conferring kanamycin resistance was cloned into the Pstl site of the pUC19 plasmid described by Yanisch-Perron et al., 1985, supra.
  • the resulting ⁇ 8.0 kb plasmid was designated pKMY256. ( Figure 2).
  • Plasmid pKMY256 was then used to construct intermediate plasmid pKMY289 as follows.
  • Plasmid pKMY256 DNA was digested with Pstl and SaIl, resulting in 4 PstI-Sail fragments of ⁇ 4.9 kb, ⁇ 2.7 kb, ⁇ 420 bp, and ⁇ 10 bp.
  • the digestion mixture was self-ligated and used to transform E. coli JM109 cells.
  • the transformed cells were plated on L-agar with ampicillin (250 ⁇ g/ml), IPTG (isopropyl- ⁇ -D- thiogalactopyranoside) as inducer and X-gal (5-bromo-4-chloro-3- indolyl- ⁇ -D-galactoside)as substrate for the lacZ gene product.
  • the desired construct was screened by picking colorless colonies followed by miniprep analysis. It contained the ⁇ 420 bp Pstl- Sall fragment carrying P R and P G .
  • the resulting ⁇ 3.1 kb plasmid was designated pKMY288 ( Figure 3), and comprises pUC19 ( ⁇ 2.7 kb), ⁇ 60 bp of the nahR gene, P R , P G and ⁇ 200 bp of the nahG gene (originally derived from pKY217 as described above). Plasmid pKMY288 is thus the equivalent of subcloning the ⁇ 420 bp Pstl- Sall fragment of pKMY256 into plasmid pUC19.
  • Plasmid pKMY288 DNA (Section B above) was digested with Sall and Rsal. Plasmid pKMY256 DNA (Section A above) was digested with Sall. Scal (compatible with Rsal) and Xbal (to prevent reformation of original plasmid pKMY256 during subsequent ligation). The digested pKMY288 and pKMY256 DNAs were mixed, ligated, and used to transform E. coli JM109. Transformants were selected by plating on L-agar with kanamycin (50 ⁇ g/ml).
  • the resulting ⁇ 6.8 kb plasmid was designated pKMY289 ( Figure 2), and comprises the ⁇ 6.6 kb Sall-Scal fragment of pKMY256 and the ⁇ 200 bp Sall-Rsal (after ligation, Rsal is converted to Scal) fragment of pKKY288.
  • This ⁇ 200 bp fragment comprises ⁇ 60 bp of the nahR gene, P R , P G (minus the 5 bp sequence ACAGC before the ATG of the nahG gene). None of the nahG gene remains.
  • the RsaI site immediately upstream of the nahG gene has been converted to a Scal site, which allows certain manipulations in the following construction steps.
  • Plasmid pKMY289 DNA (Example 1) was digested with Bglll, Scal and Pstl (to prevent reformation of original plasmid pKMY289 during subsequent ligation).
  • Plasmid pBR322::Tn5 (Sasakawa et al., 1982, Proc. Natl. Acad. Sci. USA 79: 7450-7454) DNA was digested with Bglll and Scal.
  • the digested pKMY289 and pBR322::Tn5 DNAs were mixed, ligated and used to transform E. coli JM109 cells. Transformants were selected by plating on L- agar with tetracycline (10 ⁇ g/ml).
  • the resulting ⁇ 6.1 kb plasmid was designated pKMY291 ( Figure 2) and comprises the ⁇ 5.6 kb Bglll-Scal fragment of pBR322::Tn5 containing DNA regions essential for replication and the ⁇ 470 bp Bglll-Scal fragment of pKMY289 containing ⁇ 330 bp of the nahR gene, P R and P G (minus the 5 bp sequence ACAGC before the ATG of the nahG gene).
  • this step placed a desirable restriction site (Pstl) downstream of the Scal site for unidirectional insertion of a polylinker at the Scal site.
  • deletion eliminated the nucleotide sequences upstream of the tet r promoter and brought the tet r gene of pBR322::Tn5 as close as possible to the nahR gene sequence, and in a desired orientation.
  • Plasmid pKMY292 DNA (Section B above) was digested with Scal and PstI.
  • An ⁇ 240 bp Scal-PstI fragment of pKMY292 was deleted and replaced with a polylinker of the following sequence: 5 ' -ACCATATGGTTAACATCGATTCTAGAGGTACCGAGCTCCTCGAGCCGCGGACAGATCTCTGCA 3 ' -TGGTATACCAATTGTAGCTAAGATCTCCATGGCTCGAGGAGCTCGGCGCCTGTCTAGAG
  • This double-stranded polylinker contains multiple restriction sites in the order of 5 ' -Rsal-Ndel-Hpal-Clal-Xbal-KpnI-SacI-Xhol- SacII-BglII-PstI-3'.
  • the single-stranded DNA fragments used in the construction of the polylinker of the above-described sequence were chemically synthesized by using an ABS 380B DNA synthesizer (Applied Biosystems, Inc., 850 Lincoln Centre Drive, Foster City, CA 94404). Many DNA synthesizing instruments are known in the art and can be used to make the fragments. In addition, the fragments can also be conventionally prepared in substantial accordance with the procedures of Itakura et al., 1977, Science 128: 1056 and Crea et al., 1978, Proc. Natl. Acad. Sci. US 25: 5765.
  • the synthesized single strands were annealed to form the double-stranded polylinker as follows. Four single strands were synthesized for annealing and designated 140-27 (31 mer), 140- 28 (35 mer), 140-29 (32 mer) and 140-30 (24 mer), having the following sequences, respectively:
  • strands 140-28 and 140-29 were kinased (marked with an asterisk below) prior to annealing according to conventional methods, for example, Yansura, et al., 1977, Biochem. 16:1772-1780.
  • the scheme for annealing was:
  • the Scal and Pstl digested pKMY292 DNA was ligated with the above-described 5' -Rsal-Pstl-3' polylinker, and the ligation mixture was used to transformE. coli HB101 cells. Transformants were selected on L-agar plates with tetracycline (10 ⁇ g/ml). The desired ⁇ 4.1 kb plasmid, designated pKMY293 ( Figure 3), was identified by miniprep analysis of Xhol and Asp718 digested DNA. The pKMY292 DNA remains uncut by Xhol and Asp718 digestion.
  • Plasmid pKMY293 comprises the synthetic polylinker, P G , P R , ⁇ 270 bp of the nahR gene, and the tet r gene immediately downstream.
  • the synthetic polylinker replaced the deleted 5 bp sequence ACAGC at the Scal site of plasmid pKMY292 with the sequence ACCAT to generate the Ndel site in the polylinker.
  • the insertion of the synthetic polylinker as described (i) converted the Scal site into the Rsal site naturally occurring within P G ; (ii) restored the distance between the Rsal site and the coding region; (iii) generated an Ndel cloning site at the 3' end of the P G sequence; and (iv) placed a number of other cloning sites immediately downstream of the Ndel site.
  • Plasmid pKMY293 DNA (Example 2) was digested with Pstl and BSPMII.
  • plasmid pUC9 DNA (Vieira and Messing, 1982, Gene 19: 259-268) was digested with Pstl and Xmal.
  • the digested pKMY293 and pUC9 DNAs were mixed, ligated and used to transform E. coli JM109 cells. Transformants were selected by plating on L-agar with tetracycline (10 ⁇ g/ml) and ampicillin (500 ⁇ g/ml).
  • Plasmid pKMY294 comprises the ⁇ 2.0 kb Pstl-BspMII fragment of pKMY293 inserted by ligation into the Pstl and Xmal sites of pUC9. The ligation eliminated the Xmal and BspMII sites and placed an EcoRI site downstream of the tet r gene.
  • Plasmid pKMY294 DNA (Section A above) was digested with Xhol and EcoRI.
  • plasmid pCFM1146 DNA was similarly digested with Xhol and EcoRI.
  • the construction of pCFM1146 is described in co-pending and co-assigned U.S. Patent Application Ser. No. 177,631, which has been incorporated by reference.
  • the XhoI-EcoRI-digested pKMY294 and pCFM1146 DNAs were mixed, ligated and used to transform E. coli FM5 cells.
  • E. coli FM5 cells were derived from a strain of E.
  • coli K-12 and contained an integrated ⁇ phage repression gene, CI 857 (Burnette et al., 1988, Bio/Technology 6: 699-706). Transformants were selected by plating on L-agar with tetracycline (10 ⁇ g/ml) and kanamycin (50 ⁇ g/ml). The resulting ⁇ 6.8 kb plasmid was designated pKMY295 ( Figure 3).
  • Xhol-EcoRI digested pKMY295 confirmed that an ⁇ 2.0 kb fragment of pKMY294 had been successfully inserted in pCEMH46 with the concomitant deletion of a small segment of the pCFM1146 cloning site comprising the EcoRI-Hpal-KpnI-Ncol-Hindlll-Xhol sites.
  • the transcription terminator in pCFM1146 is located immediately downstream of the multiple cloning sites of P G .
  • Plasmid pKMY513 is essentially the pUC9 plasmid (Vieira and Messing, 1982, supra) in which the Hindlll site has been deleted as follows. Hindlll-digested pUC9 DNA was treated with the Klenow fragment of DNA polymerase I to fill in the sticky ends created by the Hindlll digestion. The Klenow-treated DNA was ligated, treated with Hind III, and used to transform E. coli JM109 cells. Transformants were selected on L-agar plates with ampicillin (250 ⁇ g/ml). Miniprep analysis of selected transformants confirmed that the DNA was resistant to Hindlll digestion. The Hindlll resistant plasmid DNA was designated pKMY513.
  • the pKMY513 DNA thus obtained was digested with EcoRI and BamHI.
  • Plasmid pKMY295 DNA (Example 3) was digested with EcoRI and Bglll.
  • the digested DNAs were mixed, ligated, and the ligation mixture used to transform E. coli JM109 cells. Transformants were selected on L-agar plates containing tetracycline (10 ⁇ g/ml) and ampicillin (500 ⁇ g/ml).
  • the desired ⁇ 5.1 kb plasmid designated pKMY296 ( Figure 10), contained the ⁇ 2.4 kb EcoRI-Bglll fragment of pKMY295 ligated with the ⁇ 2.7 kb EcoRI -BamHI fragment of pKMY513.
  • the ligation eliminated the Bglll and BamHI sites and placed a unique Pst I site downstream of the transcription terminator.
  • Plasmid pKMY296 DNA (Section A above) was digested with Hindlll. Similarly, plasmid pKMY289 DNA (Example 1) was digested with Hindlll. The digested pKMY296 and pKMY289 DNAs were mixed, ligated and used to transform E. coli HB101 cells containing plasmid pKMY512. Plasmid pKMY512 was used, in order to specifically select only those transformants that contained a plasmid having the ⁇ 1.1 kb Hindlll fragment of pKMY289 inserted into the unique Hindlll site of pKMY296 to recreate a complete nahR gene. The construction of pKMY512 and its use in the selection of the desired transformant are described as follows.
  • Plasmid pN400 was itself constructed by cloning the ⁇ 7.5 kb PvuII-Bglll fragment of plasmid pE317 (Ensley et al., 1983, Science 222: 167-169), which contains the naphthalene dioxygenase genes from plasmid NAH7 , into the Smal and BamHI sites of plasmid pUC18 (Yanisch-Perron et al., 1985, supra).
  • Plasmid pN400 DNA was digested with Sacl and an ⁇ 6.4 kb Sacl fragment containing the naphthalene dioxygenase genes was inserted by ligation in the same orientation as the nahG gene into SacI-digested pKMY223 DNA to yield intermediate plasmid pKMY239.
  • the desired plasmid pKMY512 was obtained by deletion of an ⁇ 6.1 kb Bglll-EcoRI fragment from pKMY239 to delete a portion of the nahR gene and its activity. Plasmid pKMY512 thus contains all the structural naphthalene dioxygenase genes, but no functional nahR gene.
  • the nahR gene product positively controls the expression of the naphthalene dioxygenase structural genes, and these structural gene products are able to catalyze the production of indigo in E. coli as shown by Ensley et al., 1983, suora. Without the nahR gene product, no expression of naphthalene dioxygenase activity and no indigo production is possible in transformants with pKMY512 alone.
  • a transformant contains plasmid pKMY512, and a derivative of plasmid pKMY296 in which the ⁇ 1.1 kb Hindlll fragment of pKMY289 has been inserted in the correct orientation so as to yield a functional nahR gene
  • such a transformant contains two complementing plasmids and will be able to produce indigo in the presence of an inducer of the naphthalene dioxygenase genes.
  • transformants were initially selected on L-agar plates with 500 ⁇ g/ml ampicillin (pKMY296 selection marker), 50 ⁇ g/ml kanamycin (pKMY512 selection marker), and 1.0 mM sodium salicylate as inducer of the naphthalene dioxygenase genes. Blue colonies, due to indigo production, were selected for further analysis. Miniprep DNA from the blue colonies was used to transform E. coli HB101 cells, and these secondary transformants were selected on L-agar plates with 500 ⁇ g/ml ampicillin only.
  • the cartridge contains a regulatory gene, a promoter regulated by the regulatory gene, a multiple cloning site (polylinker), a transcription terminator, and a gene encoding antibiotic resistance.
  • Plasmid pKT231 DNA (Example 1) was digested with Sacl and Hpal.
  • the Hpal site is between the EcoRI and Sacl sites of pKT231, ⁇ 200 bp from the Sacl site.
  • the SacI- and Hpal-digested pKMY231 DNA was treated with the Klenow fragment of DNA polymerase I to create blunt ends.
  • the Klenow-treated DNA was then ligated and used to transform E. coli HB101 cells. Transformants were selected on L-agar plates with 50 ⁇ g/ml kanamycin.
  • the resulting ⁇ 10.3 kb plasmid was designated pKMY286.
  • the Hpal and Sacl sites from pKT231 were deleted, so that these two sites within the polylinker would be available as cloning sites.
  • Plasmid pKMY286 DNA (Section A above) was digested with EcoRI and PstI. Plasmid pKMY297 DNA (Example .4) was also digested with EcoRI and Pstl. and, in addition, with Scal (to prevent regeneration of plasmid pKMY297). The digested pKMY286 and pKMY297 DNAs were mixed, ligated and used to transform E. coli HB101 cells. Transformants were selected by plating on L- agar with tetracycline (10 ⁇ g/ml).
  • Tetracycline-resistant colonies were picked and tested on L-agar with tetracycline (10 ⁇ g/ml) and ampicillin (500 ⁇ g/ml). Tetracycline-resistant and ampicillin-sensitive colonies were picked and examined by miniprep analysis for the ligation of the ⁇ 3.6 kb EcoRI-Pstl cassette of plasmid pKMY297 with the ⁇ 6.1 kb EcoRI-Pstl fragment of plasmid pKMY286. The desired ⁇ 9.7 kb plasmid containing this cassette was designated pKMY299 ( Figure 4). Plasmid pKMY299 in E. coli HB101 cells has been deposited with the American Type Culture Collection as strain EcY5103 on September 25, 1990 and given accession number A.T.C.C. 68427.
  • Plasmid pKMY299 can be considered, therefore, as an RSF1010 plasmid with nucleotides 1 to 1653 deleted and nucleotides 7768 to 8676 replaced with a 3.6 kb cloning cartridge.
  • the cloning cartridge in pKMY299 was modified to remove the sequence ATG within the Ndel recognition sequence in pKMY299 to prevent false translational initiation in gene expression from P G .
  • the ATG sequence within the Ndel recognition sequence of the polylinker from plasmid pKMY299 was removed as follows.
  • Plasmid pKMY299 DNA (Example 5) was digested with Ndel and Hpal, then treated with Mung Bean nuclease (New England Biolabs, 32 Tozer Road, Beverly, MA 01915) according to the manufacturer's instructions, to remove the overhang. The nuclease-treated DNA was then ligated and used to transform E. coli HB101 cells. Transformants were selected on L-agar plates with tetracycline (10 ⁇ g/ml). The desired plasmid, in which the Ndel and Hpal sites were effectively deleted was designated pKMY319 ( Figure 4). Plasmid pKMY319 in E.
  • coli HB101 cells has been deposited with the American Type Culture Collection as strain EcY5110 on September 25, 1990 and given accession number A.T.C.C. 68426.
  • accession number A.T.C.C. 68426 accession number A.T.C.C. 68426.
  • Mung Bean nuclease had removed 8 bp of sequence, including at least one of the nucleotides thought to be important for encoding the ribosomal binding site 5' to the AUG translation start codon.
  • a disruption of this ribosomal binding site may prove advantageous in the use of pKMY319 for the expression of cloned fragments containing genes of unknown sequences.
  • Such a fragment often contains sequence(s) encoding the ribosomal binding site(s) for the gene(s) it carries.
  • a second ribosome binding site might act to effectively reduce expression (Schauder and McCarthy, 1989, Gene 78 : 59-72).
  • Plasmid pKY67 is the NAH7 plasmid containing a Tn5 insertion in the nahG gene (Yen and Gunsalas, 1982, Proc. Natl.
  • the digested pKY67 and pUC19 DNAs were mixed, ligated and used to transform E. coli HB101 cells. Transformants were selected by plating on L-agar with kanamycin (50 ⁇ g/ml) and ampicillin
  • the desired ⁇ 5.4 kb plasmid designated pKMY514, was pUC19 carrying an ⁇ 2.7 kb Xmal insert containing the Tn5 gene encoding kanamycin resistance and the NAH7 gene nahH encoding catechol 2,3-dioxygenase.
  • pKMY515 The desired ⁇ 5.4 kb plasmid, designated pKMY514, was pUC19 carrying an ⁇ 2.7 kb Xmal insert containing the Tn5 gene encoding kanamycin resistance and the NAH7 gene nahH encoding catechol 2,3-dioxygenase.
  • Ncol and Xhol A Ncol site and an Xhol site have been mapped upstream and downstream of the nahH gene respectively (Ghosal et al., 1987, Gene 33: 19-28).
  • Plasmid pCFM1146 DNA (Example 3) was also treated with Ncol and Xhol. The digested pKMY514 and pCFM1146 DNAs were mixed, ligated and used to transform E. coli
  • catechol 0.5 M catechol.
  • the catechol is converted to a yellow-colored product, 2-hydroxymuconic semialdehyde, to yield yellow colonies.
  • the colonies on the master plate corresponding to the yellow colonies on the replica plate were picked, and grown at 28°C.
  • the desired ⁇ 6.2 kb plasmid designated pKMY515 was thereby obtained, comprising an ⁇ 1.5 kb Ncol-Xhol fragment from pKMY514.
  • This fragment contains the nahH gene inserted into the Ncol and Xhol sites of the ⁇ 4.7 kb pCFMH46.
  • the Xbal site in pKMY514 which was derived from pCIM1146 is thus available for cloning the nahH gene in pKMY319 in the last step in the construction of the plasmid pKMY517 as described in Section C below.
  • plasmid pKMY319 DNA (Example 6) was digested with Xbal and Xhol.
  • DNAs were mixed, ligated, and used to transform E. coli HB101 cells. Transformants were selected on L-agar plates containing tetracycline (10 ⁇ g/ml). To detect those colonies producing catechol 2, 3-dioxygenase, the plates were sprayed with catechol, as described in Section B above, and yellow colonies were selected.
  • the desired ⁇ 11.2 kb plasmid for the expression of the NAH7 catechol 2, 3-dioxygenase gene was obtained and designated pKMY517. It comprised an ⁇ 1.5 kb Xbal-Xhol fragment from pKMY515 containing the nahH gene inserted into the Xbal and Xhol sites of pKMY319.
  • a double-stranded synthetic oligonucleotide was prepared with the following sequence:
  • Each strand was synthesized using an Applied Biosystems Model 380B nucleic acid synthesizer.
  • the two strands were annealed by conventional methods, for example, Yansura et al., 1977, supra.
  • the two termini of the annealed oligonucleotide are compatible with termini generated by cleavage with Ndel and Xbal.
  • This double-stranded oligonucleotide was mixed with pUC19 DNA (Yanisch- Perron et al., supra) that had been digested with Ndel and Xbal. then ligated and used to transform E. coli JM83 cells (Vieira and Messing, 1982, Gene 19: 259-268).
  • Transformants were selected by plating on L-agar with ampicillin (100 ⁇ g/ml), IPTG (1 mM) and ⁇ -gal (2 mg/ml) .
  • the desired transformants in which the ⁇ 230 bp Ndel-Xbal fragment of pUC19 containing the lacZ gene was replaced by the synthetic oligonucleotide during the ligation, were ampicillin resistant and colorless.
  • Miniprep analysis of the DNA from such transformant colonies confirmed the presence of an ⁇ 2.5 kb plasmid with expected Ndel and Xbal sites.
  • One such isolate was designated pAD6.
  • Plasmid pAD6 thus contains a coding sequence for the 5' end of the firefly luciferase gene beginning with the sequence ATG encoding the start codon (within the synthetically derived Ndel site) and ending with the Xbal site at codon 16 (nucleotide 100) (see Figure 1 of deWet et al., 1987, Mol. Cell. Biol. 7:725-737).
  • Plasmid pJD201 (deWet et al., 1987, supra) comprises a full-length, intronless Photinus pyralis (firefly) luciferase gene constructed by a genomic DNA-cDNA fusion cloned into plasmid pUC19. Plasmid pJD201 DNA was digested with Xbal and Kpnl.
  • the ⁇ 1.7 kb fragment containing the majority of the firefly luciferase gene coding sequence i.e. from the Xbal cleavage site at codon 16 (nucleotide 101) to the Kpnl site in the polylinker of pUC19
  • the two purified fragments (Ndel-Xbal and Xbal-Kpnl) encoding the complete firefly luciferase gene were mixed with plasmid pCFM1156 DNA that had been digested with Ndel (at the ATG of pCFM1156) and Kpnl.
  • Plasmid pCFM1156 is identical to plasmid pCFM4722 described by Burnette et al., 1988, Bio/Technology 6: 699-796, and contains an inducible P L promoter, a ribosome binding site, a cloning cluster, E. coli origin of replication, a transcription terminator, genes regulating plasmid copy number, and a kanamycin-resistance gene.
  • the 3- fragment mixture was ligated and used to transform E. coli FM5 cells. Transformants were selected on L-agar plates containing 50 ⁇ g/ml kanamycin. The desired ⁇ 6.4 kb plasmid was designated pLu2.
  • Plasmid pLu2 DNA (Section A above) was digested with Ndel and Asp718 (Boehringer Cat. No. 814253). ASP718 recognizes the same 6 bp sequence as KpnI. but cuts at a different site, as follows:
  • plasmid pKMY299 DNA (Example 5) was digested with Ndel and Asp718. The designated pLu2 and pKMY299 DNAs were mixed, ligated and used to transform E. coli HB101 cells. Transformants were selected on L-agar plates with tetracycline (10 ⁇ g/ml). Colonies were picked, screened for luciferase activity, and tested by miniprep analysis as follows. Each colony picked was grown ⁇ 15 hours in 5 ml of L-broth with 10 ⁇ g/ml tetracycline. Luciferase activity of each was assayed in accordance with the procedure of Example 10.
  • Plasmid pKMY520 thus contains an ⁇ 1.7 kb Ndel-As ⁇ 718 fragment derived from pLu2 comprising the firefly luciferase gene inserted into the Ndel and KpnI sites of pKMY299.
  • the resuspended cells were sonicated using a cell disrupter manufactured by Heat Systems - Ultrasonics, Inc. (Plainview, New York; available as model No. W-375) and giving 5 pulses of 10 seconds/pulse with 1 minute between each pulse. After sonication, the suspension was centrifuged for 30 minutes at 15,000 rpm in a Beckman Instruments, Inc. (Somerset, NJ 08875) J2-21 centrifuge with a JA20 rotor to yield a crude extract for assay and for SDS-PAGE analysis.
  • a cell disrupter manufactured by Heat Systems - Ultrasonics, Inc. (Plainview, New York; available as model No. W-375) and giving 5 pulses of 10 seconds/pulse with 1 minute between each pulse. After sonication, the suspension was centrifuged for 30 minutes at 15,000 rpm in a Beckman Instruments, Inc. (Somerset, NJ 08875) J2-21 centrifuge with a JA20
  • the pellet was discarded and the supernatant (crude extract) was used in the assay for catechol 2, 3-dioxygenase activity essentially according to Sala-Trepat and Evans, 1971, Eur. J. Biochem. 20: 400-413, as follows.
  • the total volume for the assay was 1 ml.
  • One to 10 ⁇ l of crude extract (or an appropriate dilute of extract) was mixed with 100 ⁇ l of 3.3 mM catechol (substrate) and then diluted up to 1 ml with assay buffer (100 mM sodium phosphate, pH 8.3 with 10% (v/v) acetone).
  • Table I shows that when cells from these 2 strains were grown in the presence of an inducer of the P G promoter (e.g., 0.35 mM sodium salicylate), significant amounts of exizymatically active catechol 2, 3-dioxygenase were expressed.
  • the plasmid pKMY517 contains the catechol 2,3-dioxygenase gene derived from the NAH7 plasmid. Even uninduced pKMY517-containing cells exhibit detectable levels of catechol 2,3-dioxygenase activity, indicating that the inducible promoter is somewhat "leaky" (i.e., a small amount of enzyme is made even without an inducer of the nahH gene). Nonetheless, the results shown in Table I clearly demonstrate that when cells containing pKMY517 were grown in the presence of inducer, the highest levels of catechol 2,3- dioxygenase activity were observed.
  • an inducer of the P G promoter e.g. 0.35 mM sodium salicylate
  • Protein samples (crude extracts prepared as described above) were heated at 65°C for 15 minutes in a loading buffer containing 2% SDS, 5% 2-mercaptoethanol, 10% glycerol, 0.02% bromophenol blue and 62.5 mM Tris-Cl (pH 6.8) before they were loaded on the gel.
  • the gel was stained with Coomassie blue and scanned with a laser densitometer (Ultrascan XL, Pharmacia LKB Biotechnology, Inc., Piscataway, NJ 08854) to determine relative protein productions.
  • lanes 1 and 10 are molecular weight standards (hen egg white lysozyme, 14,400; soybean trypsin inhibitor, 21,500; bovine carbonic ahhydrase, 31,000; hen egg white ovalbumin, 42,699; bovine serum albumin, 66,200; and rabbit muscle phosphorylase b, 97,400): lanes 4 and 5 are PpY1006 in PAS, induced and uninduced, respectively: and lanes 8 and 9 are PpY1006 in L-broth, induced and uninduced, respectively. Similar percentages of catechol 2,3-dioxygenase were produced whether the cultures were grown in PAS medium or L-broth. The amount of catechol 2,3-dioxygenase produced represented ⁇ 10% of the total soluble cell proteins ( Figure 5, lanes 4 and 8).
  • Strain PpY1009 cells were grown in 5.0 ml of L-broth with 10 ⁇ g/ml tetracycline at 30°C to a density of O.D. 550 4.5 in the presence or absence of 0.35 mM sodium salicylate as an inducer.
  • Strain PpY1009 is Pseudomas putida G572 (Shaham et al., supra) containing plasmid pKMY520.
  • An aliquot of cell suspension (3-10 ⁇ l) was mixed with water and 30 ⁇ l of assay buffer (0.2 M HEPES, pH 7.7, 50 mM MgSO 4 ) in a total volume of 100 ⁇ l in a cuvette.
  • the cuvette was placed in a luminometer, for example, a LUMAC BIOCOUNTER M 2500 (LUMAC B.V. , P. O. Box 31101, 6370 AC Landgraaf, The Netherlands).
  • the light-emitting reaction was initiated by injection of 100 ⁇ l of 1 mM luciferin (Sigma Chemical, St. Louis, MO 63178) in 5 mM citrate buffer, pH 5.5, and 100 ⁇ l of 100 mM rATP in water.
  • the BIOCOUNTER M 2500 a very sensitive photon counter controlled by a microprocessor, was operated for these analyses in the "A2 mode”].
  • the light produced was displayed in relative light units (RLU) by the luminometer.
  • the photomultiplier is calibrated such that 200 pg ATP in 100 ⁇ l LUMIT-PM gives 7,200 RLU].
  • the data are reported as specific activity of luciferase (RLU/ ⁇ g protein). Protein concentration was measured as described in Example 9, using the method of Bradford, 1976, supra and the Bio-Rad Protein Assay Kit. Cells were resuspended in 0.1 N NaOH and incubated in a boiling water bath for 20 minutes before protein determination.
  • aPlasmid pKMY520 is pKMY299 carrying an insert containing firefly luciferase gene.
  • cCells not carrying the luciferase gene gave a background value of less than 30 RLU per ⁇ g protein.
  • Luciferase production in uninduced P. putida cells harboring pKMY520 was barely visible on SDS gels when the cells were grown in PAS medium ( Figure 5, lane 3) or in L-broth ( Figure 5, lane 7).
  • the high sensitivity of the luciferase assay allowed detection of relatively high enzyme activity from uninduced P. putida or E. coli cells harboring pKMY520, as shown in Table II above. This assay also allowed detection of an ⁇ 90-fold induction of activity in P.
  • pKMY319 As a regulated expression vector in Gram-negative bacteria, restriction fragments carrying the TMO gene cluster from P. mendocina KR1 were cloned into pKMY319. Specifically, pKMY342 was constructed by cloning the ⁇ 4.7 kb Xbal-SacI fragment of pKMY341 carrying the TMO gene cluster into pKMY319. Plasmid pKMY341 was constructed by cloning the ⁇ 4.7 kb Xbal-BamHI fragment of pKMY336 carrying the TMO gene cluster into the E. coli vector pT7-5.
  • pKMY336 The construction of pKMY336 has been described in detail in the above-referenced co-pending and co- assigned application. Analysis of pKMY342 DNA with restriction enzymes demonstrated that two copies of the Xbal-SacI fragment joined by a SacI-KpnI-Xbal linker derived from the multiple cloning site in pKMY319 had been cloned into pKMY319.
  • the pKMY342 recombinant plasmid carrying the TMO gene cluster was then introduced into a number of Gram-negative bacterial species as shown in Table III below. Expression of the TMO genes was measured under induced and uninduced conditions. The toluene monooxygenase assay has been described in co-pending and co- assigned U.S. Patent Application Ser. No. _____ filed September _____, 1990, previously incorporated by reference. As shown in
  • Pseudomonas mendocina Y4075 induced 19.0 a All bacterial strains contain the recombinant plasmid pKMY342 , which is pKMY319 carrying an insert containing the toluene monooxygenase gene cluster from P. mendocina KR1.
  • the parent strains into which pKMY342 was introduced are all natural isolates.
  • Ndel recognition site ends with the sequence ATG
  • altering the 5' end of any gene beginning with the sequence ATG to generate an Ndel site does not lead to a change in the coding property of the gene.
  • This is an ideal manner of generating a suitable 5' end restriction site for precise cloning of a gene for expression and requires the alteration of no more than 3 nucleotides.
  • the 3 nucleotides that are 5' to the sequence ATG encoding the start codon of a gene may be specifically converted by site-directed mutagenesis to CAT, thus creating an Ndel recognition site for cloning into the pKMY299 broad host range expression system.
  • Site-directed mutagenesis is either accomplished according to conventional methods (for example, see Chapter 15 of Sambrook et al., 1989, Molecular Cloning - A Laboratory Manual (Second Edition), Cold Spring Harbor Laboratory Press, N.Y.; Chapter 8 of Current Protocols in Molecular Biology. Ausubel et al., eds., 1989, Greene Publishing Associates and Wiley-Interscience) or accomplished with the following steps: (i) locate a restriction site just inside the coding region; and (ii) attach a synthetic oligonucleotide linker at this restriction site that restores the reading frame of this gene and contains an Ndel site at the 5' end.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Cartouches de clonage comprenant un gène régulateur positif nahR tiré du plasmide NAH7, un promoteur Pg régulé par nahR, un site de clonage multiple, une terminaison de transcription ainsi qu'un gène conférant une résistance à la tétracycline. Lesdites cartouches peuvent être insérées dans des plasmides choisis afin de former de nouveaux vecteurs d'expression dans lesquels on peut induire un haut niuveau d'expression de gènes à l'aide d'un inducteur non toxique peu coûteux à faibles concentrations.
PCT/US1991/006006 1990-09-28 1991-08-22 Cartouches de clonage et vecteurs d'expression dans des bacteries gram negatif WO1992006186A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US59028090A 1990-09-28 1990-09-28
US590,280 1990-09-28

Publications (1)

Publication Number Publication Date
WO1992006186A1 true WO1992006186A1 (fr) 1992-04-16

Family

ID=24361614

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1991/006006 WO1992006186A1 (fr) 1990-09-28 1991-08-22 Cartouches de clonage et vecteurs d'expression dans des bacteries gram negatif

Country Status (5)

Country Link
EP (1) EP0503045A4 (fr)
JP (1) JPH05502590A (fr)
AU (1) AU8728691A (fr)
CA (1) CA2069741C (fr)
WO (1) WO1992006186A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1801212A1 (fr) * 2005-12-21 2007-06-27 Eidgenössische Technische Hochschule Zürich Sélection de biocatalyseurs pour la synthèse chimique

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4710464A (en) * 1984-09-27 1987-12-01 Eli Lilly And Company Transcription terminators
US4710473A (en) * 1983-08-10 1987-12-01 Amgen, Inc. DNA plasmids
US5017495A (en) * 1988-04-05 1991-05-21 Amgen Inc. Plasmid encoding the Pseudomonas mendocina toluene monooxygenase gene

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB8807939D0 (en) * 1988-04-05 1988-05-05 Univ Brunel Regulatory cassette for expression vectors

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4710473A (en) * 1983-08-10 1987-12-01 Amgen, Inc. DNA plasmids
US4710464A (en) * 1984-09-27 1987-12-01 Eli Lilly And Company Transcription terminators
US5017495A (en) * 1988-04-05 1991-05-21 Amgen Inc. Plasmid encoding the Pseudomonas mendocina toluene monooxygenase gene

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
FEBS Letters, Volume 226, Number 2, issued January 1988, RAMOS et al., "Broad-host range expression vectors containing manipulated meta-cleavage pathway regulatory elements of the TOL plasmid", pages 241-246, see entire document. *
Gene, Volume 26, issued December 1983, BAGDASARIN et al., "Activity of the hybrid trp-lac (tac) promoter of Escherichia coli in Pseudomonas putida. Construction of broad-host-range, controlled-expression vectors", pages 273-282, see the entire document. *
Gene, Volume 51, issued April 1987, STARK, "Multicopy expression vectors carrying the lac repressor gene for regulated high-level expression of genes in Escherichia coli", pages 255-267, see the entire document. *
Gene, Volume 75, issued June 1989, SCHOLZ et al., "Complete nucleotide sequence and gene organization of the broad-host-range plasmid RSF1010", pages 271-288, see the entire document. *
Journal of Bacteriology, Volume 171, Number 4, issued April 1989, SCHELL et al., "Evidence that the transcription activator element by the Pseudomonas putida nahR gene is evolutionarily related to the transcription activators encoded by the Rhizobium nodD genes", pages 1952-1959, see the entire document. *
Molecular and Cellular Biology, issued February 1987, DE WIT et al., "Firefly luciferase gene: Structure and expression in mammalian cells", pages 725-737, see the entire document. *
See also references of EP0503045A4 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1801212A1 (fr) * 2005-12-21 2007-06-27 Eidgenössische Technische Hochschule Zürich Sélection de biocatalyseurs pour la synthèse chimique
WO2007073163A1 (fr) * 2005-12-21 2007-06-28 Eidgenössische Technische Hochschule Zürich Selection de biocatalyseurs de synthese chimique

Also Published As

Publication number Publication date
EP0503045A1 (fr) 1992-09-16
AU8728691A (en) 1992-04-28
CA2069741C (fr) 1996-06-18
EP0503045A4 (en) 1994-07-13
JPH05502590A (ja) 1993-05-13

Similar Documents

Publication Publication Date Title
Klug et al. Biological consequences of segmental alterations in mRNA stability: effects of deletion of the intercistronic hairpin loop region of the Rhodobacter capsulatus puf operon.
Chen et al. Controlled expression of the transcriptional activator gene virG in Agrobacterium tumefaciens by using the Escherichia coli lac promoter
Visca et al. Cloning and nucleotide sequence of the pvdA gene encoding the pyoverdin biosynthetic enzyme L-ornithine N5-oxygenase in Pseudomonas aeruginosa
Dikshit et al. Study of Vitreoscilla globin (vgb) gene expression and promoter activity in E. coli through transcriptional fusion
EP0449621A1 (fr) Une luciférase mutante de luciole, gènes de luciférase mutante, nouvel ADN recombinant contenant ces gènes et méthode de production de luciférase mutante
Shanley et al. Cloning and expression of Acinetobacter calcoaceticus catBCDE genes in Pseudomonas putida and Escherichia coli
Tichy et al. Analysis of the Rhodobacter capsulatus puc operon: the pucC gene plays a central role in the regulation of LHII (B800‐850 complex) expression.
Grund et al. Cloning of genes for naphthalene metabolism in Pseudomonas putida
Young et al. Amplification of the respiratory NADH dehydrogenase of Escherichia coli by gene cloning
Polissi et al. In vivo reactivation of catechol 2, 3‐dioxygenase mediated by a chloroplast‐type ferredoxin: a bacterial strategy to expand the substrate specificity of aromatic degradative pathways.
Bloch et al. Paraquat-mediated selection for mutations in the manganese-superoxide dismutase gene sodA
Kahn et al. Genetic analysis of bacteriophage P4 using P4-plasmid ColE1 hybrids
Schweizer et al. Repressor for the sn-glycerol-3-phosphate regulon of Escherichia coli K-12: cloning of the glpR gene and identification of its product
Yen Construction of cloning cartridges for development of expression vectors in gram-negative bacteria
AU608572B2 (en) Recombinant dna expression vectors and dna compounds that encode deacetoxycephalosporin c synthetase and deacetylcephalosporin c synthetase
Lang et al. Rhodobacter capsulatus CycH: a bipartite gene product with pleiotropic effects on the biogenesis of structurally different c-type cytochromes
Kukor et al. Cloning and expression of the catA and catBC gene clusters from Pseudomonas aeruginosa PAO
US6258565B1 (en) Expression vectors based on RK2 and TOL plasmids
JPH05244942A (ja) 耐熱性ホタルルシフェラーゼ、耐熱性ホタルルシフェラーゼ遺伝子、新規な組み換え体ｄｎａ、及び耐熱性ホタルルシフェラーゼの製造法
JPH02227082A (ja) イソペニシリンｎエピメラーゼ（ラセマーゼ）活性をコードする組換えｄｎａ発現ベクター、およびｄｎａ化合物
Aguilar et al. The product of the Rhizobium meliloti ilvC gene is required for isoleucine and valine synthesis and nodulation of alfalfa
JPH05502593A (ja) Ｐｓｅｕｄｏｍｏｎａｓ　ｍｅｎｄｏｃｉｎａ　ｋｒ―１のトルエンモノオキシゲナーゼにより触媒化される生物変換反応
WO1992006186A1 (fr) Cartouches de clonage et vecteurs d'expression dans des bacteries gram negatif
Harkki et al. A lamB expression plasmid for extending the host range of phage λ to other enterobacteria
Spooner et al. Activation of the xylDLEGF promoter of the TOL toluene-xylene degradation pathway by overproduction of the xylS regulatory gene product

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA FI JP KR NO

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 1991917904

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2069741

Country of ref document: CA

WWP Wipo information: published in national office

Ref document number: 1991917904

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1991917904

Country of ref document: EP