WO1991018989A1

WO1991018989A1 - Hybrid plasminogen activator mutants

Info

Publication number: WO1991018989A1
Application number: PCT/GB1991/000801
Authority: WO
Inventors: Ian Dodd
Original assignee: Beecham Group Plc
Priority date: 1990-05-26
Filing date: 1991-05-21
Publication date: 1991-12-12
Also published as: GB9011861D0; AU7874591A

Abstract

Fibrinolytic enzyme, their preparation, pharmaceutical compositions containing them and their use in the treatment of thrombotic disease.

Description

HYBRID PLASMINOGEN ACTIVATOR MUTANTS

The present invention relates to fibrinolytic enzymes, their preparation, pharmaceutical compositions containing them and their use in the treatment of thrombotic disease. The invention also relates to derivatives of the fibrinolytic enzymes for use in the treatment of thromboembolic diseases, in particular acute myocardial infarction.

The sequence of amino acids making up the enzyme tissue-type plasminogen activator (t-PA) and the nucleotide sequence for the cDNA which codes for t-PA are known (see Pennica et_. al., 1983; Nature, 301, 214) . t-PA is known to have fibrinolytic activity.

As used herein, the term tissue-type plasminogen activator (t-PA) denotes a plasminogen activator of the group having the immunological properties defined for t-PA at the XXVIII Meeting of the International Committee on Thrombosis and Haemostasis, Bergamo, Italy, 27 July 1982.

The amino acid sequence of various forms of t-PA are known. The abovementioned Nature 1983 reference discloses the sequence for the L-chain and the mature S-chain forms of t-PA, also discussed by Vehar et a_l., Biotechnology, 1984, 2, 1051-7 in which the processing of initially formed t-PA by removal of a pro-sequence to give the S-chain form is reported. Pohl et al., FEBS letters, 1984, Vol. 168 No.l, 29-32, refers to the N-terminal multiplicity of t-PA and discloses the U-chain form. The numbering system for the amino acid sequence of t-PA used herein is that described in the Nature 1983 reference for mature (S-chain) t-PA in which the N-terminal serine is numbered 1. By this system, L-chain t-PA has an N-terminal glycine residue at position -3 and U-chain t-PA has an N-terminal valine at position 4. References to t-PA herein are understood to include all such variant forms.

Native t-PA is composed of a B or light (L) and an A or heavy (H) chain. The B-chain contains the active site of the enzyme. The cleavage site for the conversion of t-PA from the single to the two-chain form is located between residues arg-275 and ile-276. In the two-chain form the chains are held together by a disulphide bridge formed between residues cys-264 in the A-chain and cys-395 in the B-chain.

Fibronectin has twelve finger-domains per monomer, responsible for fibrin-affinity (Eur. J. Biochem. 154, 15-29 (1986) ) . The amino acid sequences of these finger domains are known (EMBO J.4_, 1755 - 1759 (1985); Eur. J. Biochem. 128, 605-623 (1982); Proc. Natl. Acad. Sci. USA 80_/ 137-141 (1983)). It has been shown (J. Biol. Chem. 260, 5328-5341 and 13666-13676 (1985)) that part of Factor XII shows structural homolog .with the finger-domains of fibronectin. It has also been shown (Banyai, L. e_t a^, 1983; FEBS Lett., 163, 37)that a part of the t-PA enzyme shows structural homology with the finger-domains of fibronectin. This region from amino acid residue 6 to 43 has been termed the t-PA finger domain. The genetic information for this domain lies on a single exon (Ny, T. et al, 1984; Proc. Natl. Acad. Sci. U.S.A., 8__, 5355). The term "finger domain'' will be used herein to refer to an amino acid sequence showing structural homology with the finger-domains of fibronectin, or the sequence of a fibronectin finger-domain itself.

In addition to the native forms of t-PA described above, various muteins are also known, see for example EP-A-0201153, EP-A-0233013, EP-A-0199574, WO 86/01538, EP-A-0227462, EP-A-0253582, WO 86/04351, EP-A-0236040, EP-A-0200451, EP-A-0238304, EP-0225286, DE 3537176, WO 87/04722, EP-A-0236289 and WO 90/02798. References herein to t-PA species include both native forms and muteins.

Plasmin is a two-chain serine protease which may be obtained 5 by the cleavage of the single chain precursor, plasminogen, at a specific internal peptide bond. The amino acid sequence of human plasminogen is known (Wiman and Walters (1975) Eur.J. Biochem. 50., 489-494 and 58., 539-547; Wiman (1977) Eur. J. Biochem. 7_6, 129-137; Sottrup-Jensen et al.

10 (1978) Fibrinolysis and Thrombolysis Vol. 3, 191-209, Raven Press, New York; and Sottrup-Jensen e_t al.. (1978) Atlas of Protein Sequence and Structure Vol. 5, Suppl. 3, p91, National Biomedical Research Foundation, Silver Spring, MD) . A partial nucleotide sequence coding for amino acid residues

15272-790 of human plasminogen has also been described (Malinowski, D.P. et_. aJL., 1984, Biochemistry, 23, 4243-4250) . The cleavage site of human plasminogen is located between residues arg-560 and val-561 (according to the sequence numbering of Sottrup-Jensen et. al_^. (1978) Atlas

20 of Protein Sequence (op.cit.) ) . Two species of plasminogen have been identified ( F.J. Castellino, Chemical Reviews Vol. 81 p431 (1981)): glu-*_ which has an N-terminal glutamic acid residue at position 1 and lys₇₇ which has an N-terminal lysine residue at position 77. Glu-plasminogen is also

25 easily converted by limited plasmic digestion to other modified forms with N-terminal valine (val-_™) or methionine (metgg) (C. Miyashita, E. Wenzel and M. Heiden,. Haemostasis 18, supp.l pp 7-13 (1988)). References to plasminogen herein are understood to include all these species.

30 References to lys N-terminal forms herein are understood to include lys, val and met forms.

The complete nucleotide sequence has been described (Forsgren, M., et al., 1987, FEBS Letters 213, 254-260) . 35 The nucleotide sequence predicts the existence of an extra, previously unreported, isoleucine residue near the N-terminus of the A-chain. This finding has been independently confirmed (McLean, J.N., et al., 1987, Nature 330, 132-137) . Accordingly all sequence numbering (amino acid and nucleotide) below follows Forsgren e_t a__. (1987) . In this numbering sequence the plasminogen cleavage site is located between residues arg-561 and val-562 and the N-terminal modified forms are termed metgo, lys-g and val_7q.

Plasminogen has five kringle structures. The region from the first to the last cysteine residue of each kringle structure, residues 84 to 162, 166 to 243, 256 to 333, 358 to 435 and 462 to 541 inclusive will be referred to herein as the K*_]_P, Y..- ', K3P, K^ and K^P domains respectively.

European Patent No 0009879 discloses derivatives of j-n vivo fibrinolytic enzymes which are useful therapeutic agents for treating venous thrombosis. The derivatives are characterised by the active catalytic site on the enzymes being blocked by a group which is removable by hydrolysis such that the pseudo first order rate constant for hydrolysis is in the range 10 to 10 sec .

EP-0155387A discloses a fibrinolytically active hybrid protein which comprises one chain of a 2-chain protease linked to a chain of a different 2-chain protease, or to the same chain of the same protease, at least one of the chains in the hybrid protein being derived from a fibrinolytically active protease, such that the hybrid protein has a catalytic site essential for fibrinolytic activity which is optionally blocked by a removable blocking group. Examples of the hybrid protein include plasmin A-chain linked to tissue-type plasminogen activator (t-PA) B-chain.

EP-0297882A discloses a hybrid plasminogen activator which comprises the five kringle domains of plasminogen linked to the B-chain of t-PA via an amino acid sequence comprising the t-PA cleavage site between residues 275 and 276 and the cysteine residue 264 of t-PA.

WO 90/02798 (Genentech) discloses certain t-PA muteins modified in the B-chain including K296E, R298E, R299E t-PA, K296A, H297A, R298A, R299A t-PA, R298E t-PA and R299E t-PA.

It has been found that t-PA B chain-containing hybrid plasminogen activators of the kind generally described in EP-0297882 when modified to provide an amino acid other than arginine at position 299 of t-PA retain fibrinolytic activity.

According to the present invention there is provided a fibrinolytically active plasminogen activator (PA) comprising the five kringle domains of plasminogen linked via an amino acid sequence comprising the t-PA cleavage site between residues 275 and 276 and the cysteine residue 264 of t-PA to a t-PA B-chain which has been modified to provide an amino acid other than arginine at position 299 of t-PA.

It will be understood that by the term t-PA 'B-chain' is meant at least that portion of the B-chain containing the functional active centre of t-PA and preferably comprises residues 276-527.

As used herein the term 'modified t-PA B-chain' is used to describe a t-PA B-chain which has been modified to provide an amino acid other than arginine at position 299 of t-PA.

Preferred amino acids for substitution in the t-PA B-chain at position 299 of t-PA are those similar to arginine in hydrophilicity and size. Histidine, threonine, serine, asparagine, aspartic acid, glutamine and glutamic acid are preferred. Other suitable amino acids include alanine and glycine.

In a particular preferred aspect the amino acid is glutamine.

It will be understood that additional modifications to the t-PA B-chain may optionally be made and that the term 'modified t-PA B chain' can include such additional modifications.

In one preferred aspect the sequence of said PA is modified to provide an amino acid other than arginine at position 298 of t-PA. Suitable amino acids include those listed above as preferred for the replacement of the arginine residue at position 299 of t-PA.

In a second particular preferred aspect the amino acids at positions 298 and 299 in the t-PA B-chain are both glutamine.

In a preferred aspect, the PA of the invention may be represented symbolically as:

(Y-)_m(KP-Z^t-)₅B^t*

where B^t* is the modified t-PA B-chain as hereinabove defined, m is 0 or 1, preferably 1, each of the 5 values of RP represents a kringle domain derived from plasminogen in sequence and Y and each of the 5 values of Z - independently represents a bond or a linking sequence of amino acids which may be introduced synthetically during the preparation of the hybrid PA and/or derived from native plasminogen and/or t-PA sequences, the sequence Zc comprising at least residues cys-264 and arg-275 of t-PA. When m is 1, the sequence Y may take one of the values found in various forms of native plasminogen, such as the glu-^ or lys₇g forms, that is plasminogen residues 1 to 83 or 78 to 83 respectively.

Optionally, as taught generally in EP-A-0241210, the sequence Y may commence with one or more finger domains, defined herein as an amino acid sequence showing structural homology with the finger-domains of fibronectin, such as a fibronectin finger domain itself or a t-PA finger domain, preferably a t-PA finger domain.

Where a finger domain is derived from t-PA, the finger domain sequence may optionally extend at the N-terminus to include residues preceding residue 6 of native t-PA, such as residues 4 and 5, 1 to 5 or -3 to 5 respectively of the U-, S- or L-chain forms of native t-PA. The finger domain sequence preferably extends at the N-terminus to comprise residues 1 to 5 of native t-PA.

Each finger domain sequence may optionally be linked to a second sequence of amino acids which corresponds to the^" growth-factor domain of native t-PA. Thus, representing the finger domain sequence (for example residues 6 to 43 of t-PA) as F and the growth-factor domain sequence (residues 51 to 84 of t-PA) as G, Y comprises one or more N-terminal units of the form A-F-X_- and/or A-F-X2-G-X3-, where X-_ , X₂ and X3 represent bonds or linking sequences of amino acids which may be introduced synthetically during the preparation of the hybrid PA and/or be derived from native t-PA sequences adjacent the F and G domains and A is an optional N-terminal extension of the F domain.

In a preferred aspect, the linking sequence X-^ comprises amino acid residues selected from the residues 44 to 50 and 85 to 91, and more preferably comprises residues 44 to 50 and 88 to 91, of native t-PA, optionally linked at the C-terminus to a sequence of amino acids, such as -pro-gly-. The linking sequence X₂ preferably comprises residues selected from the residues 44 to 50 of native t-PA, and more preferably comprises residues 44 to 50. The linking sequence X3 preferably comprises residues selected from the residues 85 to 91 of native t-PA and more preferably comprises residues 85 to 91, optionally linked at the C-terminus to a sequence of amino acids such as -pro-gly-.

It will be appreciated that to prevent cleavage of the additional domain(s) from one another or from the remainder of the hybrid plasminogen activator in vivo, inter-domain linking sequences and linking sequences between the additional domain(s) and the plasminogen activator molecule should be chosen so as to avoid the presence of a site susceptible to proteolytic cleavage. Thus, in particular, the linking sequence X-_j^ or X3 will preferably end with a residue other than arginine or lysine.

Y preferably comprises up to 6 additional finger domains, more preferably up to 2, most preferably 1, each of which may optionally be linked to a growth factor domain.

Z-_ , Z₂, Z3 and Z₄ preferably represent the native plasminogen inter-domain sequences between plasminogen kringle domains 1 and 2, 2 and 3, 3 and 4 and 4 and 5, respectively.

A suitable sequence (Z_,-) linking the C-terminal plasminogen kringle domain to the modified t-PA B-chain is:

[STCGLRQYSQPQFR]

The above sequence consists of residues 262 to 275 of t-PA (single letter amino acid notation) . A particular PA of the invention has the following structure:

Pig 1-541/ [arg 298->gln, arg 299->gln]t-PA 262-527;

wherein Pig 1-541 represents residues 1-541 of plasminogen (that is, including kringles 1 to 5) and arg and gin represent arginine and glutamine residues respectively; including one and two chain variants, lys₇g and glu-^ variants and mixtures thereof.

The PA of the invention may be derivatised to provide pharmaceutically useful conjugates analogous to known PA-containing conjugates, for example:

(a) an enzyme-protein conjugate as disclosed in EP-A-0 155 388, in which the catalytic site on the enzyme which is responsible for fibrinolytic activity is blocked by a human protein attached thereto by way of a reversible linking group;

(b) an enzyme-protein conjugate as disclosed in EP-A-0152 736, comprising at least one optionally blocked fibrinolytic enzyme linked by way of a site other than the catalytic site responsible for fibrinolytic activity to at least one human protein;

(c) a protein-polymer conjugate as disclosed in EP-A-0183503 comprising a pharmaceutically useful protein linked to at least one water soluble polymer by means of a reversible linking group; or

(d) an enzyme conjugate as disclosed in EP-A-0184363 comprising a plurality of fibrinolytic enzymes linked together through the active centres thereof by means of a removable blocking group. The PA of the invention may take the place of a PA as the enzyme or (human) protein component, as appropriate, of any of the conjugates described above.

The above mentioned derivatives of the PA of the invention may be used in any of the methods and compositions described hereinafter for the PA of the invention itself.

In a further aspect, the invention provides a process for preparing a plasminogen activator according to the invention which process comprises expressing DNA encoding said plasminogen activator in a recombinant host cell and recovering the plasminogen activator product.

The DNA polymer comprising a nucleotide sequence that encodes the PA also forms part of the invention.

The process of the invention may be performed by conventional recombinant techniques such as described in Maniatis et,. al., Molecular Cloning - A Laboratory Manual; Cold Spring Harbor, 1982 and DNA Cloning vols I, II and III (D.M. Glover ed., IRL Press Ltd).

In particular, the process may comprise the steps of:

i) preparing a replicable expression vector capable, in a host cell, of expressing a DNA polymer comprising a nucleotide sequence that encodes said plasminogen activator;

ii) transforming a host cell with said vector;

iii) culturing said transformed host cell under conditions permitting expression of said DNA polymer to produce said plasminogen activator; and iv) recovering said plasminogen activator.

The invention also provides a process for preparing the DNA polymer by the condensation of appropriate mono-, di- or oligomeric nucleotide units.

The preparation may be carried out chemically, enzymatically, or by a combination of the two methods, in vitro or in. vivo as appropriate. Thus, the DNA polymer may be prepared by the enzymatic ligation of appropriate DNA fragments, by conventional methods such as those described by D. M. Roberts et al in Biochemistry 1985, 24, 5090-5098.

The DNA fragments may be obtained by digestion of DNA containing the required sequences of nucleotides with appropriate restriction enzymes, by chemical synthesis, by enzymatic polymerisation, or by a combination of these methods.

Digestion with restriction enzymes may be performed in an appropriate buffer at a temperature of 20°-70°C, generally in a volume of 50μl or less with 0.1-10μg DNA.

Enzymatic polymerisation of DNA may be carried out in. vitro using a DNA polymerase such as DNA polymerase I (Klenow fragment) in an appropriate buffer containing the nucleoside triphosphates dATP, dCTP, dGTP and dTTP as required at a temperature of 10°-37°C, generally in a volume of 50μl or less.

Enzymatic ligation of DNA fragments may be carried out using a DNA ligase such as T4 DNA ligase in an appropriate buffer at a temperature of 4°C to ambient, generally in a volume of 50μl or less.

The chemical synthesis of the DNA polymer or fragments may be carried out by conventional phosphotriester, phosphite or phosphoramidite chemistry, using solid phase techniques such as those described in 'Chemical and Enzymatic Synthesis of Gene Fragments - A Laboratory Manual' (ed. H.G. Gassen and A. Lang), Verlag Chemie, Weinheim (1982),or in other scientific publications, for example M.J. Gait, H.W.D. Matthes, M. Singh, B.S. Sproat, and R.C. Titmas, Nucleic Acids Research, 1982, lfj, 6243; B.S. Sproat and W. Bannwarth, Tetrahedron Letters, 1983, 2_4, 5771; M.D. Matteucci and M.H Caruthers, Tetrahedron Letters, 1980, 2_1, 719; M.D. Matteucci and M.H. Caruthers, Journal of the American Chemical Society, 1981, 103, 3185; S.P. Adams et al., Journal of the American Chemical Society,1983, 105, 661; N.D. Sinha, J. Biernat, J. McMannus, and H. Koester, Nucleic Acids Research, 1984, JL2., 4539; and H.W.D. Matthes et al. , EMBO Journal, 1984, 2, 801. Preferably an automated DNA synthesizer is employed.

The DNA polymer is preferably prepared by ligating two or more DNA molecules which together comprise a DNA sequence encoding the PA.

The DNA molecules may be obtained by the digestion with suitable restriction enzymes of vectors carrying the required coding sequences.

The precise structure of the DNA molecules and the way in which they are obtained depends upon the structure of the desired hybrid PA product. The design of a suitable strategy for the construction of the DNA molecule coding for the hybrid PA is a routine matter for the skilled worker in the art. Normally the modification in the t-PA B-chain in the PA of the invention is introduced by conventional in vitro mutagenesis techniques.

The expression of the DNA polymer encoding the PA in a recombinant host cell may be carried out by means of a replicable expression vector capable, in the host cell, of expressing the DNA polymer. The expression vector is novel and also forms part of the invention.

The replicable expression vector may be prepared in accordance with the invention, by cleaving a vector compatible with the host cell to provide a linear DNA segment having an intact replicon, and combining said linear segment with one or more DNA molecules which, together with said linear segment, encode the PA, under ligating conditions.

The ligation of the linear segment and more than one DNA molecule may be carried out simultaneously or sequentially as desired.

Thus, the DNA polymer may be preformed or formed during the construction of the vector, as desired.

The choice of vector will be determined in part by the host cell, which may be prokaryotic, such as E__ coli, or eukaryotic, such as mouse C127, mouse myeloma, Chinese hamster ovary, fungi e.g. filamentous fungi or unicellular 'yeast' or an insect cell such as Drosophila. The host cell may also be in a transgenic animal. Suitable vectors include plasmids, bacteriophages, cosmids and recombinant viruses, derived from, for example, baculoviruses or vaccinia.

The preparation of the replicable expression vector may be carried out conventionally with appropriate enzymes for restriction, polymerisation and ligation of the DNA, by procedures described in, for example, Maniatis e aj-.., cited above. Polymerisation and ligation may be performed as described above for the preparation of the DNA polymer. Digestion with restriction enzymes may be performed in an appropriate buffer at a temperature of 20°-70°C, generally in a volume of 50μl or less with 0.1-10μg DNA.

The recombinant host cell is prepared, in accordance with the invention, by transforming a host cell with a replicable expression vector of the invention under transforming conditions. Suitable transforming conditions are conventional and are described in, for example, Maniatis e al., cited above, or "DNA Cloning'' Vol. II, D.M. Glover ed., IRL Press Ltd, 1985.

The choice of transforming conditions is determined by the host cell. Thus, a bacterial host such as E. coli may be treated with a solution of CaCl₂ (Cohen et al, Proc. Nat. Acad. Sci., 1973, 69, 2110) or with a solution comprising a mixture of RbCl, MnCl₂/ potassium acetate and glycerol, and then with 3-[N-morpholino]- propane-sulphonic acid, RbCl and glycerol. Mammalian cells in culture may be transformed by calcium co-precipitation of the vector DNA onto the cells. Where the host cell is in a transgenic animal, transformation may be effected by microinjection (see, for example, Gordon, K. e a_l. Biotechnology 1987 .5 1183) . The transformation of filamentous fungi has been reviewed (Timberlake, W.E. and Marshall, M.A., Science 1989 244 1313) .

The invention also extends to a host cell transformed with a replicable expression vector of the invention.

Culturing the transformed host cell under conditions permitting expression of the DNA polymer is carried out conventionally, as described in, for example, Maniatis et al and ''DNA Cloning'' cited above. Thus, preferably the cell is supplied with nutrient and cultured at a temperature below 45°C. The PA expression product is recovered by conventional methods according to the host cell. Thus, where the host cell is bacterial, such as E. coli it may be lysed physically, chemically or enzymatically and the protein product isolated from the resulting lysate. Where the host cell is mammalian, the product may generally be isolated from the nutrient medium.

The DNA polymer may be assembled into vectors designed for isolation of stable transformed mammalian cell lines expressing the hybrid PA; e.g. bovine papillomavirus vectors or amplified vectors in Chinese hamster ovary cells (DNA cloning Vol.II D.M. Glover ed. IRL Press 1985; Kaufman, R.J. et al., Molecular and Cellular Biology 5, 1750-1759, 1985; Pavlakis G.N. and Hamer, D.H., Proceedings of the National

Academy of Sciences (USA) 80, 397-401, 1983; Goeddel, D.V. et_. al., European Patent Application No. 0093619, 1983).

It will be appreciated that, depending upon the host cell and culture conditions including duration, the PA prepared in accordance with the invention may be glycosylated to varying degrees. Furthermore, as observed by Pohl et.a^'l., Biochemistry, 1984, 23, 3701-3707, varying degress of glycosylation may also be found in unmodified, naturally occurring t-PA. Plasminogen also exhibits varying degrees of glycosylation (Hayes M.L, J. Biol. Chem. 254: 8768, 1979) . Mutant forms of the PA are also contemplated in which glycosylation sites are removed by genetic engineering techniques, for example as taught in EP-A-0238304, EP-A-0225286, DE-3537176, WO 87/04722 or EP-0236289. The PA of the invention is understood to include such glycosylated variations.

It will also be appreciated that, depending upon the expression conditions, the PA prepared in accordance with the invention may exist in the single or two chain forms or mixtures thereof. The invention extends to all such forms.

The PA of the invention or conjugate thereof can be further derivatised to give a derivative in which any catalytic site essential for fibrinolytic activity is optionally blocked by a removable blocking group. Such derivatives form a further aspect of the present invention.

As used herein the expression 'removable blocking group' includes groups which are removable by hydrolysis at a rate such that the pseudo-first order rate constant for hydrolysi .s is m the range of 10—fi - sec—1 to 10—9 sec—1 , more preferably 10^~° sec- to 10^-3 sec^-1, in isotonic aqueous media at pH 7.4 at 37°C.

Such blocking groups are described in European Patent No.0009879 and include acyl groups such as optionally substituted benzoyl or optionally substituted acryloyl.

Suitable optional substituents for benzoyl blocking groups include halogen, C-_j__g alkyl, C-*__g alkoxy, C^__Q alkanoyl xy, C*_]__g alkanoylamino, amino or p-guanidino.

Suitable optional substituents for acryloyl blocking groups include C--__g alkyl, furyl, phenyl or ^~-__ alkylphenyl.

In one aspect, the removable blocking group is a 2-aminobenzoyl group substituted in the 3- or 4-position with a halogen atom and optionally further substituted with one or more weakly electron-withdrawing or electon-donating groups, wherein the pseudo first order rate constant for hydrolysis of the derivative is in the range 6.0 x 10 to 4.0 x 10 sec- when measured in a buffer system consisting of 0.05M sodium phosphate, 0.1M sodium chloride, 0.01% v/v detergent comprising polyoxyethylenesorbitan monoleate having a molecular weight of approximately 1300, at pH 7.4 at 37°C. A suitable detergent for use in the buffer is the product having the tradename Tween 80.

Suitable blocking groups of this type include 4-fluoro-2-aminobenzoyl, 4-chloro-2-aminobenzoyl and 4-bromo-2-aminobenzoyl, as described in EP 0297882A.

Derivatisation of the plasminogen activator according to the invention with a removable blocking group may be carried out as described, for example, in European Patent No. 0009879 and EP 0297882A.

The PA and derivatives of the invention are suitably administered in the form of a pharmaceutical composition.

Accordingly the present invention also provides a pharmaceutical composition comprising a PA or derivative of the invention in combination with a pharmaceutically acceptable carrier.

The compositions according to the invention may be formulated in accordance with routine procedures as pharmaceutical compositions adapted for intravenous administration to human beings.

Typically compositions for intravenous administration are solutions of the sterile enzyme in sterile isotonic aqueous buffer. Where necessary the composition may also include a solubilising agent to keep the PA or derivative in solution and a local anaesthetic such as lignocaine to ease pain at the site of injection. Generally, the PA or derivative will be supplied in unit dosage form for example as a dry powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of protein in activity units. Where composition comprises a derivative of the invention or where the PA includes a removable blocking group, an indication of the time within which the free protein will be liberated may be given. Where the protein is to be administered by infusion, it will be dispensed with an infusion bottle containing sterile pharmaceutical grade 'Water for Injection' or saline. Where the protein is to be administered by injection, it is dispensed with an ampoule of sterile water for injection or saline. The injectable or infusable composition will be made up by mixing the ingredients prior to administration.

The quantity of material administered will depend upon the amount of fibrinolysis required and the speed with which it is required, the seriousness of the thromboembolic condition and position and size of the clot. The precise dose to be employed and mode of administration must per force in view of the nature of the complaint be decided^" according to the circumstances by the physician supervising treatment. However, in general, a patient being treated for a thrombus will generally receive a daily dose of from 0.1 to 10 mg/kg of body weight, such as 0.1 to 2.0mg/kg, either by injection in for example up to five doses or by infusion.

Within the above indicated dosage range, no adverse toxicological effects are indicated with the compounds of the invention.

Accordingly, in a further aspect of the invention there is provided a method of treating thrombotic diseases, in particular myocardial infarction, which comprises administering to the sufferer an effective non-toxic amount of a PA or derivative of the invention.

In another aspect the invention provides the use of a PA or derivative of the invention for the manufacture of a medicament for the treatment of thrombotic diseases, in particular myocardial infarction.

The invention also provides a PA or derivative of the invention for use as an active therapeutic substance and in particular for use in the treatment of thrombotic diseases, in particular myocardial infarction.

The following Methods and Examples illustrate the invention.

I. General Methods used in Examples

(i) DNA cleavage

In general the cleavage of about lμg of plasmid DNA or DNA fragments is effected using about 5 units of a restriction enzyme (or enzymes) in about 20μl of an appropriate buffer solution.

(ii) Generation of blunt ends: If blunt ends are required they are produced by treating the DNA preparation with DNA Polymerase I, Klenow fragment as described by Maniatis et a__, (Molecular Cloning-A Laboratory Manual, Cold Spring Harbor Laboratory, 1982) , or alternatively (where indicated) by digestion using Mung Bean nuclease (Molecular Cloning-A Laboratory Manual, Cold Spring Harbor Laboratory, 1982) .

(iii) Generation of 'Sticky ends' using linkers: Short kinased oligonucleotide linkers encoding single or multiple restriction sites are ligated onto blunt ended fragments, the linker(s) is digested with the appropriate restriction endonuclease producing the required 'sticky end' necessary for further manipulation. (Molecular Cloning-A Laboratory Manual, Cold Spring Harbor Laboratory, 1982)

(iv) Ligation of DNA Fragments: Ligation reactions are carried out as described in Maniatis e a__, (Molecular Cloning - A Laboratory Manual, Cold Spring Harbor Laboratory, 1982) .

(v) Transformation of plasmid DNA into E.coli HB101 or E.coli DH5α cells uses competent HB101 or DH5α cellssupplied by Gibco BRL (Paisley, Scotland) , according to the manufacturers instructions.

(vi) Plasmid preparation: Large scale preparation of plasmid DNA and plasmid mini-preparations are carried out as described in Maniatis et al, (Molecular Cloning - A Laboratory Manual, Cold Spring Harbor Laboratory, (1982) ) .

(vii) Isolation of DNA fragments from low-melting-point (LMP) agarose gels: DNA fragments are isolated from LMP agarose gels as described by Maniatis et a__, (Molecular Cloning-A Laboratory Manual, Cold Spring Harbor Laboratory, 1982) . Alternatively the excised gel band is purified using GENECLEAN ™, (Stratech Scientific, London) used according to the manufacturers instructions.

(viii) Oligonucleotides: Oligonucleotides are made on Applied Biosystems 381A DNA Synthesizer according to the manufacturers instructions and are kinased as described in Maniatis et al, op. cit. When used in plasmid construction the oligonucleotides are annealed by heating together and cooling slowly to room temperature. The annealed oligonucleotides are then ready for ligation. If four oligonucleotides are to be annealed the annealing reaction as described above is followed but may be carried out as 2 reactions each containing a pair of complementary oligonucleotides. After cooling the 2 reactions are mixed prior to ligation. If six oligonucleotides are to be annealed, there are initially 3 reactions, and so on.

(ix) DNA sequencing using the double strand method

Sequencing is carried out using 'Sequenase™ (United States Biochemical Corporation) essentially according to the manufacturers instructions.

(x) Transient expression of plasminogen activators from HeLa cells

(a) Small-scale

Cell preparation: cells are trypsinised and plated out at approx. 2.4 x 10 cells per 35mm dish and incubated in 1.5ml growth medium (this is Hepes buffered RPM1 1640 medium ^" (041-2400) containing 10% Serum (021-6010), 1% stock solution of penicillin/streptomycin (043-5070) , 2% sodium bicarbonate solution (043-5080) , 1% stock Glutamine (043-5030); Gibco, Paisley, Scotland) at 37°C in a humidified incubator in an atmosphere of 5% C0₂/95% air. After 72h the cells are refed, and used for transfection 24h later.

Transfection procedure: Cultures are changed to Eagles MEM (041-1095) , 10% serum, 1% penicillin/streptomycin, 1% Glutamine and 1% non-essential amino acids (043-1140) 3h before transfection. The transfections use calcium coprecipitation as described in 'DNA Cloning' Ed. D.M. Glover (Chap. 15, C. Gorman) . Glycerol shock and 5mM butyrate treatments are used. Plasminogen activator(s) secreted by transfected cells is harvested in 1.0ml RPMI 1640 medium (as above but serum-free, containing 4% soybean peptone (Sigma) ) for 24h and activity is measured using fibrin plates with reference to normal t-PA (see xii) .

Alternatively the HeLa cells are plated at 5 x 10^ per dish, in which case the cells are refed after only 24h and then used as above.

(b) Large-scale

Cell preparation: cells are trypsinised and plated out at a density of approx. 2.5 x 10⁶ cells per 175cm² flask in 30ml growth medium (above) . After 72h an extra 25ml of growth medium is added and the cells are used for DNA transfection 24h later (as above) . 25ml of harvest medium are used per flask.

Alternatively the cells are plated at a density of approximately 2.0 x 10° cells per flask and 25ml of growth medium is added after 96h incubation and the cells used as above.

The two seeding rates and feed times used in the small and large-scale protocols are designed to allow convenient timing of experiments. Both sets of protocols allow efficient expression of activator(s) .

(xi) Chromogenic substrate assays

Hybrid plasminogen activator is assayed against the chromogenic substrate S-2288 (KabiVitrum, Sweden) at a substrate concentration of ImM in 0.1 M triethanolamine.HCl pH 8.0 at 25°C. An SU is defined as the amount of activity that gives an O.D. increase at 405nm of 0.001/min in 0.5 ml substrate in a 1 cm pathlength cell. In another form of the assay, specifically designed for the semi-quantitative assay of chromatography column fractions, lOμl of each fraction is mixed with lOOμl ImM S-2288 (as above) in wells of a microtitre plate and the plate incubated at 37°C until such time as yellow colour is visible. The solutions are read at 410 nm using a Dynatech MR700 Microplate reader.

(xii) Fibrinolytic activity assay

The fibrinolytic activity of hybrid plasminogen activator solutions is measured on human plasminogen-containing fibrin plates as described (Dodd, I., and Carr, K., Thrombosis Res. 1989 5_5 79-85) . Dose-responses of hybrid plasminogen activators have slightly different slopes to those of the tissue-type plasminogen activator standard so all activities are approximate. Activities are expressed in IU with reference to the 2nd International standard for t-PA, Lot 86/670.

(xiii) Sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS PAGE)

SDS PAGE is carried out to determine the apparent molecular weigh (s) of hybrid plasminogen activators using essentially the method of Laemmli (Nature 1970 227 680-685) . The activators were identified either by staining for protein or by a fibrin zymography technique (Dodd, I. et al Thromb. Haemostasis 1986, 55_. 94-97) . Using these methods it is possible to determine chain nature (sc v tc) and deduce likely N-termini (Glu-^ v Lys₇g) , although it is recognised that these methods probably do not differentiate between lys₇g and the other truncated forms. II. Identification of nucleotides, amino acid residues and vectors in the examples

(i) Sequences

All t-PA numbering follows Pennica et al.. (1983) op. cit.; plasminogen amino acid numbering is based on Sottrup-Jensen et al (1978) Atlas of Protein Sequence and Structure Vol. 5, Suppl. 3, p91. National Biomedical Research Foundation, Silver Spring, MD., but updated to include the extra amino acid residue identified by Forsgren, M. et al (1987) FEBS Letters, 213, 254-260.

(ii) N-terminus of hybrid plasminogen activators

Glu--_ indicates the protein is believed to comprise the native (nascent) plasminogen N-terminus i.e. amino acid residues 1 onwards.

Lys₇g indicates the protein is believed to comprise the processed lys₇g N-terminus. Alternative processed N-termini e.g. met g and val₇g are known in nature (Miyashita et al 1988, Haemostasis .18_. supp. 1, pp 7-13) .

(iii) Vectors

pTRH37 - encodes hybrid plasminogen activator plasminogen 1-541/t-PA 262-527. The preparation of this vector is described in European Patent Application Publication No. 0 297 882. Example 1

Plasminogen 1-541/ [arg 298 -> gin, arg 299 -> glnlt- PA 262 - 527 (HOQ2)

(a) Construction of the plasmid pDB H002

Two fragments were prepared from plasmid pTRH37 by restriction digestion and agarose gel electrophoresis. These fragments were as follows:-

Fragment I. Approximately 7.5 kb: from a Mra I plus Sst 1 digest [Mra I 2203 to Sst 1 2686] of pTRH37. Fragment 1 thus encodes all the vector sequences.

Fragment II. Approximately 300bp: from an AlwNl plus Sstl digest [AlwNl 2394 to Sstl 2686] of pTRH37.

These two fragments were ligated together with an oligonucleotide linker (Linker III) to form plasmid pDBH002. Linker III (designed to encode amino acid residues 531 to 541 of plasminogen and 262 to 313 in the t-PA moiety in^" protein H002) was formed by annealing 6 oligonucleotides (A,B,C,D,E, and F) of sequence:- - *

5'GGAAACTTTACGACTACTGTGATGTCCCTCAGTGTTCCACCTGCGGCTT

AAGACAGTACAGCCAGCC 3' A

* * 5'GCTGTACTGTCTTAAGCCGCAGGTGGAACACTGAGGGACATCACAGTAGTCG TAAAGTTTCCGC 3' B 5'TCAGTTTCGCATCAAAGGAGGGCTCTTCGCCGACATCGCCTCCCACCCCTGGC AGGCTGCCATCTT 3' C

5'GGCAGCCTGCCAGGGGTGGGAGGCGATGTCGGCGAAGAGCCCTCCTTTGATGC GAAACTGAGGCTG 3' D

5'TGCCAAGCACCAGCAGTCGCCCGGAGAGCGGTTCCTGTGCGGGGGCATAC TCATCAGCTC 3' E

5'CTGATGAGTATGCCCCCGCACAGGAACCGCTCTCCGGGCGACTGCTGGTG CTTGGCAAAGAT 3' F

Bases marked with an * have been changed from the native t-PA sequence to encorporate a unique Aflll restriction site; these changes do not alter the encoded amino-acid sequence. The underlined triplets indicate the positions where the native arginine codon (AGG) has been changed to the codon CAG encoding glutamine.

A plasmid (pDB H002) was isolated which has the structure shown in Fig. 1. The plasmid, when introduced into HeLa cells, directed the expression of a novel plasminogen activator (H002) which has the same amino-acid sequence as protein H37 (European Patent Application Publication No. 0 297 882) except for the following amino acid substitutions: arg₂g -> gin, arg₂gg -> gin. It is important to recognise that the numbering refers to the t-PA moiety using the usual t-PA numbering system. The equivalent residue numbers for the mature H002 or H37 proteins are 578 and 579. (b) Expression of protein H002

Protein H002 was expressed from the plasmid pDB H002 in HeLa cells in culture according to the protocol described in 5 Section (x) (b) of General Methods used in Examples.

(c) Purification and characterisation of protein H002

Conditioned medium (500 ml) from 20 x 175 cm' HeLa cultures ιo that had been transfected with pDBH002 was centrifuged

(9000g/30min) to remove cell debris and the supernatant (480 ml) was decanted and stored at - 0°C for 12d.

The material was thawed and then applied to a column (i.d., 15 90 mm; h, 220 mm) of Sephadex G25 equilibrated in phosphate-buffered saline/0.01% Tween 80 (PBS/TW) . The first approx. 0.35 Vt was discarded. The following approx. 720 ml was retained and was chromatographed on zinc chelate Sepharose (Vt, 73ml) and lysine Sepharose (Vt, 12 ml) 20 essentially as described previously (Dodd, I. et al, (1986) FEBS Lett 209 13) . Active fractions that were eluted from the lysine Sepharose column by the 0.5M arginine-contaihing buffer were identified by amidolytic assay using S2288. These fractions were pooled and were ultrafiltered using a 5 membrane with a nominal molecular weight cut-off of 10,000 (Amicon, YM10) to a final volume of 1.5 ml.

All characterisation data was obtained on this 1.5 ml solution. 0

S2288 assay gave 6500 SU/ml. Analysis by SDS PAGE followed by fibrin zymography showed the preparation contained two major fibrinolytically active species, one identical in apparent M_r to the glu-^ form of protein H37, the other with a slightly smaller apparent M_r; the two species are believed to be the glu--_ and lys₇g forms respectively of protein H002. Analysis by SDS PAGE under reducing conditions followed by staining for protein showed major stainable bands at M_r approx. 60-70,000 and approx. 36,000 indicating the product was mainly in the two chain form.

(d) Purification and characterisation of protein HOQ2

A second expression (as in Example 1(b) ) and purification (as in Example 1 (c) ) was carried out to verify the results obtained from that first experiment.

The conditions of the expression and purification were essentially identical to those in the first experiment.

The purified concentrate (after ultrafiltration) had a volume of 2.5ml and all the analyses were carried out on this concentrate.

S2288 assay gave a figure of 2400 SU/ml. Analysis by SDS PAGE followed by fibrin zymography showed two lysis zones; the one at apparent M_r~ 100,000 was significantly bigger than the one at apparent M_r~ 90,000, indicating the glu-L (mature) form was present in greater amount than the truncated (presumed lys₇g) form.

Analysis by SDS PAGE under reducing conditions followed by silver staining showed major bands at M_r~ 70,000 and 35,000 and a less intense band at M_r~ 100,000. These results suggest that the material was mainly in the two-chain form.

Claims

1. A fibrinolytically active plasminogen activator (PA) comprising the five kringle domains of plasminogen linked 5 via an amino acid sequence comprising the t-PA cleavage site between residues 275 and 276 and the cysteine residue 264 of t-PA to a t-PA B-chain which has been modified to provide an amino acid other than arginine at position 299 of t-PA

102. A plasminogen activator according to claim 1 wherein the sequence of said PA is modified to provide an amino acid other than arginine at position 298 of t-PA.

3. A plasminogen activator according to claim 1 or 2 15 wherin said amino acid other than arginine is selected from the group consisting of histidine, threonine, serine, asparagine, aspartic acid, glutamine, glutamic acid, alanine and glycine.

204. A plasminogen activator according to claim 3 wherein the amino acids at position 298 and 299 in the t-PA B-chain are both glutamine.

5. A plasminogen activator according to claim 1 5 represented by the formula:

(Y-)_m(KP-Z^t-)₅B^t*

where B^~* is the modified t-PA B-chain as defined in claim 0 1, m is 0 or 1, preferably 1, each of the 5 values of K^p represents a kringle domain derived from plasminogen in sequence and Y and each of the 5 values of X independently represents a bond or a linking sequence of amino acids which may be introduced synthetically during the preparation of 5 the hybrid PA and/or derived from native plasminogen and/or t-PA sequences, the sequence Z₅ ^t comprising at least residues cys-264 and arg-275 of t-PA.

6. Pig 1-541/ [arg 298->gln, arg 299->gln]t-PA 262-527; 5 wherein Pig 1-541 represents residues 1-541 of plasminogen (that is, including kringles 1 to 5) and arg and gin represent arginine and glutamine residues respectively; including one and two chain variants, lys g and glu^ 10 variants and mixtures thereof.

7. A plasminogen activator according to any one of claims 1 to 6 in which any catalylic site essential for fibrinolytic activity is blocked by a removable blocking

15 group.

8. A pharmaceutical composition comprising a plasminogen activator according to any one of claims 1 to 7 in combination with a pharmaceutically acceptable carrier.

20

9. Use of a plasminogen activator according to any of claims 1 to 7 for the manufacture of a medicament for the treatment of thrombotic diseases.

25 10. A process for preparing a plasminogen activator according to claim 1, which process comprises expressing DNA encoding said plasminogen activator in a recombinant host cell and recovering the plasminogen activator product.

30