WO1991016427A1 - Procedes de creation de phenotype a partir de populations de genes multiples - Google Patents

Procedes de creation de phenotype a partir de populations de genes multiples Download PDF

Info

Publication number
WO1991016427A1
WO1991016427A1 PCT/US1991/002910 US9102910W WO9116427A1 WO 1991016427 A1 WO1991016427 A1 WO 1991016427A1 US 9102910 W US9102910 W US 9102910W WO 9116427 A1 WO9116427 A1 WO 9116427A1
Authority
WO
WIPO (PCT)
Prior art keywords
genes
population
vector
vectors
nucleotide sequences
Prior art date
Application number
PCT/US1991/002910
Other languages
English (en)
Inventor
Jay M. Short
Joseph A. Sorge
Original Assignee
Stratagene
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Stratagene filed Critical Stratagene
Publication of WO1991016427A1 publication Critical patent/WO1991016427A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/034—Fusion polypeptide containing a localisation/targetting motif containing a motif for targeting to the periplasmic space of Gram negative bacteria as a soluble protein, i.e. signal sequence should be cleaved

Definitions

  • the present invention relates to methods for randomly combining populations of nucleotide sequences and select ⁇ ing those combinations coding for a desired predetermined phenotype.
  • genetic recombination includes a variety of processes that produce new linkage relation ⁇ ships of genes or parts of genes. Genetic recombination is often subdivided into general genetic recombination, which takes place between homologous chromosomes, more or less anywhere along their length, and recombination that does not require extensive homology. The latter category includes site-specific recombination, which depends upon the existence of specific sites in one or more molecules and which includes interactions of viral genomes and insertion sequences with chromosomes of prokaryotes and
  • the immune system of a mammal is one of the most versatile biological systems; probably greater than 1.0 x 10 7 antibody specificities can be produced. Indeed, a great deal of contemporary biological and medical research is directed toward tapping this repertoire. During the last decade, furthermore, there has been a dramatic increase in the ability to harness the output of the immune system.
  • monoclonal antibodies i.e.. a composition of antibody molecules of single epitope specificity, from the repertoire of antibodies induced during an immune response.
  • Monoclonal antibodies have been generated in the past from hybridomas, generated by fusing antibody- secreting lymphocytes with an immortal cell line, such as myeloma.
  • TITUTE SHEET are at least 5-10,000 different B-cell clones capable of generating unique antibodies to a small relatively rigid immunogens, such as, for example dinitrophenol. Further, because of the process of somatic mutation during the generation of antibody diversity, essentially an unlimited number of unique antibody molecules may be generated. In contrast to this vast potential for different antibodies, current hybridoma methodologies typically yield only a few hundred different monoclonal antibodies per fusion. A second major drawback in hybridoma technology is that rodent antibodies are highly immunogenic in humans, and can preclude their continued use in patients for diagnostic or therapeutic purposes.
  • CDRs hypervariable regions
  • the immunologic repertoire of vertebrates has recently been found to contain genes coding for immunoglobulins having catalytic activity. Tramontano et al., Sci.. 234:1566-1570 (1986); Pollack et al., Sci. , 234:1570-1573 (1986); Janda et al., Sci. , 244:437-440 (1989) .
  • the presence of, or the ability to induce the repertoire to produce, antibody molecules capable of a catalyzing chemical reaction, i.e., acting like enzymes, had previously been postulated almost 20 years ago by W. P. Jencks in Catalysis in Chemistry and Enzy ology, McGraw-Hill, N.Y. (1969).
  • the present invention is directed to methods for pro- ducing biological agents having a desired novel phenotype wherein this phenotype results from expression of a particular combined nucleotide sequence and wherein said phenotype can be used to identify the biological agents having the particular combined nucleotide sequence and distinguish them from biological agents having other combined nucleotide sequences.
  • the desired phenotype is typically a phenotype which is not normally expressed by the parent nucleotide sequences.
  • these methods comprise first replicating at least portions of two parent nucleotide sequences. The replicating step yields a population of diverse replicas of parent nucleo ⁇ tide sequences.
  • each parent nucleotide sequence initially comprises a population (or family) of diverse nucleotide sequences which is replicated to give a population of diverse replicas.
  • a popu ⁇ lation of diverse replicas is generated by replicating a parent nucleotide sequence under conditions which allow mutations to occur which generates diversity from one parent nucleotide sequence and results in a population of diverse replicas.
  • the parent nucleotide sequences may comprise a single DNA molecule or alterna ⁇ tively the parent nucleotide sequences comprise separate DNA molecules. Where the parent nucleotide sequences com ⁇ prise one DNA molecule, after replication, the resulting populations of diverse replicas derived from each parent nucleotide sequence are separated. The populations of
  • T diverse replicas are then brought together, preferably in a random manner, to produce combined nucleotide sequences wherein each combined nucleotide sequence comprises one member of each population of diverse replicas.
  • the parent nucleotide sequences may be suitably replicated and brought together according to the various methods described herein for replication and recombination of nucleotide sequences and generation of combinatorial libraries.
  • the combined nucleotide sequences are expressed in biological agents.
  • biological agents may comprise a host cell, or alternatively, a plasmid, bacteriophage or virus, or nucleic acid vector, and such suitable means for expression are described herein. In one embodiment ⁇ expression may constitute the mere exist- ence of th enucleotide sequences in the same biological agent.
  • the biological agents which express the desired phenotype are identified.
  • the pheno ⁇ type is used to distinguish those biological agents expressing the particular combined nucleotide sequence from biological agents expressing other combined nucleo ⁇ tide sequences.
  • the desired phenotype may comprise a polypeptide, more than one polypeptide, or a multimeric polypeptide, the expression of which is detectable.
  • the phenotype may comprise synthesis of one or more RNA molecules.
  • either the polypep ⁇ tides or RNA may exhibit enzymatic activity or receptor activity; or the DNA or RNA may simply act as a target for interaction with other molecules.
  • the present invention provides novel methods for the cloning of cells having novel phenotypes. These methods generally include the use of a combinatorial library selection system to generate a diverse collection of clones. In one aspect, the methods utilize at least two starting populations of nucleotide sequences which can be recombined to form a library of clones containing nucleo ⁇ tide sequences from each of the parent populations. These methods can be utilized, therefore, to create cells having
  • ET novel phenotypes that is, cells having a new and desired combination of expressed polypeptides.
  • These methods can also be used for the production of new combinations of polypeptides, including the polypeptides utilized in the formation of biologically competent immunoglobulin mole ⁇ cules.
  • these methods can be used to screen a larger portion of the immunological repertoire for receptors having a preselected activity than has heretofore been possible, thereby overcoming the before-mentioned inadequacies of the hybridoma technique.
  • the present invention contemplates a gene library comprising an isolated admix ⁇ ture of at least about 10 3 , preferably at least about 10 4 and more preferably at least 10 5 V H -and/or V L -coding DNA homologs, a plurality of which share a conserved antigenic determinant.
  • the homologs are present in a medium suitable for in vitro manipulation, such as water, phosphate buffered saline and the like, which maintains the biological activity of the homologs.
  • At least two starting populations of DNA sequence-containing vectors are physically combined by any of several techniques, including those described herein, to form a library of clones containing DNA sequences from each of the parent populations.
  • These vectors can then be transferred to desired host cells to create in vivo novel combinations of phenotypic characteristics in the host cell.
  • Methods of combining desired DNA sequences include the use of restriction digestion and ligation, homologous recombination, and site-specific recombination by methods including intergrase-related proteins, flp recombinase- catalyzed recombination, the cre-lox system of bacterio ⁇ phage PI, and the use of transposons.
  • the present invention contemplates vectors for use in the methods which comprise, in addition to random DNA sequences from the starting gene family populations, DNA sequences which facilitate the region-specific, random recombination together of at least one gene from each starting gene family population.
  • Sequences enabling the recombination of these vectors include the use of functional flp recom ⁇ bination sequences, functional loxp recombination sequences, at sequences recognized by integrase-related proteins from lambdoid bacteriophages, and terminal repeat sequences recognized by transposases.
  • the present invention also includes methods for the combinatorial generation of phenotypes, including a method of producing a nucleic acid vector encoding two or more desired genes each from a family of genes, said genes being capable of producing a characteristic that can be used to identify the vector encoding said genes from other vectors encoding other members of the families of genes, which method comprises: a) randomly inserting into vectors one member of a first family of genes and one member from one or more other families of genes so that a population of vectors are created wherein each vector may contain one of the genes from said first gene family and one of the genes from each of said other gene families; b) identifying within said population of vectors a vector capable of detectably producing a desired charac ⁇ teristic resulting from the inclusion of one gene from said first gene family and one gene from each of said other gene families, and using said characteristic to distinguish the vector from other vectors within the population containing undesired combinations of gene members from said gene families.
  • Suitable vectors for use according to the methods of the present invention include plasmid or cos id vectors or, alternatively, phage vectors.
  • Suitable host cells for expressing the vectors comprise either eukaryotic cells or prokaryotic cells.
  • Preferred eukaryotic cells include mammalian cells.
  • the vectors comprise lambda bacteriophage and host cells comprise E. Coli.
  • the genes are combined in vivo.
  • Various suitable methods may be used for the identi ⁇ fication of a particular vector within the recombinant vector population. These methods include (a) the inter- action of sequence-specific nucleic acids with genes from the individual families which were combined: (b) the hybridization of nucleic acid probes with genes from the gene families; (c) the expression of one or both genes from the gene families as an RNA molecule; and (d) the expression of one or both genes as an identifiable protein molecule.
  • such an identifiable protein molecule may contain a binding site for another molecule, an epitope recognized by an antibody, or an immune molecule binding site for an epitope.
  • both genes express an RNA and/or polypeptide and said RNAs and/or polypeptides physically interact with a host to create an identifiable character ⁇ istic.
  • Both genes may express polypeptides that physic ⁇ ally interact to form a neo-epitope recognized by an immune molecule or polypeptides that physically interact to form a binding site for another molecule.
  • those polypeptides are derived from antibody genes such that the interaction of both polypeptides forms an antigen binding site.
  • the vectors produced according to the present invention contain a single promoter that expresses the genes from the gene families. Alternatively, the genes from the gene families are each expressed from their own promoter.
  • the present invention contemplates the creation of combinations of two or more nucleotide sequence families (or populations) by in vitro recombination.
  • in vitro recombination could be carried out using specific recombination target sequences and specific recombinases (like flp recombinase) , or by using homologous sequences shared by both nucleotide sequence populations to facilitate homologous recombination.
  • PCR polymerase chain reac- tion
  • nucleotide sequences can participate in such recombination.
  • a combinatorial population of fusion nucleotide sequences can be produced, and subsequently inserted into a single expression vector for expression of the nucleotide sequence from both sequence families.
  • Such a combinatorial population of expressed sequences can then be screened for new phenotypes that would not be present if the sequences from only one population of nucleotide sequences were expressed, and would be present only with expression of particular combinations comprising a nucleo ⁇ tide sequence from each population.
  • such phenotypes could comprise the creation of heterodimeric proteins where one subunit of the dimer is encoded by one nucleotide sequence family and the other subunit of the dimer is encoded by the other nucleotide sequence family.
  • the present invention is directed to methods of creating diversity, namely populations of diverse replicas
  • Such diversity may be generated starting with a single DNA molecule which is treated to create diversity, such as by mutagenesis or by starting with a family of nucleotide sequences (or genes) or a combinatorial library.
  • the nucleotide sequences coding for the light chain and the heavy chain may be individually amplified (using a method such as PCR) under conditions that mutated sequences are generated to create a population of mutated sequences.
  • the individual populations of mutated sequences may be used to make com ⁇ binatorial libraries which are then used to create novel phenotypes.
  • these individual populations of mutated sequences may be combined using techniques such as fusion polynucleotide amplification (for example) fusion PCR (as described herein) and used to generate novel phenotypes.
  • novel phenotypes may include antibodies having enhanced antigen binding characteristics.
  • one or more genetically distinct phage may be lytically replicated, conditions which are somewhat mutagenic, to generate a population(s) of diverse phage. Phage having phenotypes distinct from the originals may be generated by cleavage such as by a restriction endonuclease, followed by mixing of phage populations, and ligation, followed by selection for expression of desired phenotypes.
  • phage having diverse phenotypes distinct from the parental phage may be generated combinatorially.
  • the methods are utilized to produce novel human antibody-expressing DNA sequences.
  • an immunoglobulin heavy chain variable region V H gene library containing a substantial portion of the V H gene repertoire of a vertebrate is synthesized.
  • the V H -coding gene library contains at least about 10 3 and more preferably at least about 10 4 and more preferably at least about 10 5 different V H -coding nucleic acid strands referred to herein as V H -coding DNA homologs.
  • the gene library can be synthesized by various methods, depending on the starting material.
  • the starting material is a plurality of V H -coding genes
  • the repertoire is subjected to two distinct primer extension reactions.
  • the first primer extension reaction uses a first polynucleotide synthesis primer capable of initiat ⁇ ing the first reaction by hybridizing to a nucleotide sequence conserved (shared by a plurality of genes) within the repertoire.
  • the first primer extension reaction produces a plurality of different V H -coding homolog complements (nucleic acid strands complementary to the genes in the repertoire) .
  • the second primer extension reaction produces, using the complements as templates, a plurality of different V H -coding DNA homologs.
  • the second primer extension reaction uses a second polynucleotide synthesis primer that is capable to initiating the second reaction by hybridizing to a nucleotide sequence conserved among a plurality of V H -coding gene complements.
  • the repertoire is subjected to the above-discussed second primer extension reaction. That is, where the starting material is a plurality of different V H -coding gene complements produced by a method such as denaturation of double strand genomic DNA, chemical synthesis and the like, the complements are subjected to a primer extension reaction using a polynucleotide synthesis primer that hybridizes to a plurality of the different V H -coding gene complements provided.
  • the starting material is a plurality of different V H -coding gene complements produced by a method such as denaturation of double strand genomic DNA, chemical synthesis and the like
  • the complements are subjected to a primer extension reaction using a polynucleotide synthesis primer that hybridizes to a plurality of the different V H -coding gene complements provided.
  • T V-coding genes and their complements are present in the starting material, both approaches can be used in combination.
  • a V H -coding DNA ho olog i.e.. a gene coding for a receptor capable of binding the preselected ligand, is then segregated from the library to produce the isolated gene. This may be accomplished by operatively linking for expression a plurality of the different V H -coding DNA homologs of the library to an expression vector.
  • the V H - expression vectors so produced are introduced into a popu ⁇ lation of compatible host cells, i.e., cells capable to expressing a gene operatively linked for expression to the vector.
  • the transformants are cultured under conditions for expressing the receptor coded for by the V H -coding DNA homolog.
  • the transformants are cloned and the clones are screened for expression of a receptor that binds the pre ⁇ selected ligand. Any of the suitable methods well known in the art for detecting the binding of a ligand to a receptor can be used. A transformant expressing the desired activity is then segregated from the population to produce the isolated gene.
  • a receptor having a preselected activity produced by a method of the present invention preferably a V H or F v as described herein, is also contemplated.
  • the present invention also encompasses products produced by the methods of the invention, such as the biological agents produced thereby, also the expression products of these methods such as polypeptides and nucleic acids, vectors produced and kits comprising any of the products of the claimed methods.
  • Figure 1 illustrates a schematic diagram of the immunoglobulin molecule showing the principal structural features.
  • the circled area on the heavy chain represents the variable region (V H ) , a polypeptide containing a biologically active (ligand binding) portion of that region, and a gene coding for that polypeptide, are produced by the methods of the present invention. Sequences L03, L35, L47 and L48 could not be classified into any predefined subgroups.
  • Figure 2A is a diagrammatic sketch of an H chain of human igG (IgGl subclass) . Numbering is from the N- terminus on the left to the C-terminus on the right. Note the presence of four domains, each containing an intra- chain disulfide bond (S-S) spanning approximately 60 amino acid residues.
  • S-S intra- chain disulfide bond
  • the symbol CHO stands for carbohydrate.
  • the V region of the heavy (H) chain (V H ) resembles V L in having three hypervariable CDR (not shown) .
  • Figure 2B is a diagrammatic sketch of a human K chain (Panel 1) . Numbering is from the N-terminus on the left to the C-terminus on the right. Note the intrachain disulfide bond (S-S) spanning about the same number of amino acid residues in the V L and C L domains. Panel 2 shows the locations of the complementarily-determining regions (CDR) in the V L domain. Segments outside the CDR are the framework segments (FR) .
  • CDR complementarily-determining regions
  • Figure 3 depicts the amino acid sequence of the V H regions of 19 mouse monoclonal antibodies with specificity for phosphorylcholine.
  • HP indicates that the protein is the product of a hybridoma.
  • the remainder are myeloma proteins. (From Gearhart et al., Nature, 291:29, 1981.)
  • Figure 4 illustrates the results obtained from PCR amplification of mRNA obtained from the spleen of a mouse immunized with FITC.
  • Lanes R17-R24 correspond to ampli ⁇ fication reactions with the unique 5 1 primers (2-9, Table 1) and the 3 1 primer (12, Table 1)
  • R16 represents the PCR reaction with the 5 1 primer containing inosine (10, Table 1) and 3 1 primer (12, Table 1).
  • Z and R9 are the a pli- fication controls; control Z involves the amplification of V H for a plasmid (PLR2) and R9 represents the amplification
  • Figure 5 depicts nucleotide sequences of clones from the cDNA library of the PCR amplified V H regions in Lambda ZAP vector.
  • the N-terminal 110 bases are listed here and the underlined nucleotides represent CDR1 (complementary determining region) .
  • Figures 6A and 6B depict the sequence of the synthetic DNA insert inserted into Lambda ZAP vector to produce Lambda Zap II V H (6A) and Lambda Zap V L (6B) expression vectors.
  • the various features required for this vector to express the V H and V L -coding DNA homologs include the Shine-Dalgarno ribosome binding site, a leader sequence to direct the expressed protein to the periplasm as described by Mouva et al., J. Biol. Chem.. 255:27, 1980, and various restriction enzyme sites used to opera ⁇ tively link the V H and V L homologs to the expression vector.
  • V H expression-vector sequence also contains a short nucleic acid sequence that codes for amino acids typically found in variable regions heavy chain (V H Backbone) .
  • V H Backbone is just upstream and in the proper reading as the V H DNA homologs that are operatively linked into the Xho I and Spe I.
  • the V L DNA homologs are operatively linked into the V L sequence (6B) at the Nco I and Spe I restriction enzyme sites and thus the V H Backbone region is deleted when the V L DNA homologs are operatively linked into the V L vector.
  • FIG. 7 depicts the major features of the bacterial expression vector Lambda Zap II V H (V H -expression vector) are shown.
  • the synthetic DNA sequence from Figure 6 is shown at the top along with the T 3 polymerase promoter from Lambda Zap II vector.
  • the orientation of the insert in Lambda Zap II vector is shown.
  • the V H DNA homologs are inserted into the Xho I and Spe I restriction enzyme sites.
  • the V H DNA are inserted into the Xho I and Spe I site and the read through transcription produces the
  • T decapeptide epitope (tag) that is located just 3* of the cloning sites.
  • FIG 8 depicts the major features of the bacterial expression vector Lambda Zap II V L (V L expression vector) are shown.
  • the synthetic sequence shown in Figure 6B is shown at the top along with the T 3 polymerase promoter from Lambda Zap II vector.
  • the orientation of the insert in Lambda Zap vector II is shown.
  • the V L DNA homologs are inserted into the phagemid that is produced by the in vivo excision protocol described by Short et al., Nucleic Acids Res.. 16:7583-7600, 1988.
  • the V L DNA homologs are inserted into the Nco I and Spe I cloning sites of the Phagemid.
  • Figure 9 depicts a modified bacterial expression vector Lambda Zap II V L II. This vector is constructed by inserting this synthetic DNA sequence,
  • FIG. 10 depicts the sequence of the synthetic DNA segment inserted into Lambda Zap II vector to produce the lambda V L II-expression vector. The various features and restriction endonuclease recognition sites are shown.
  • Figure 11 depicts the vectors for expressing V H and V L separately and in combination. The various essential components of these vectors are shown.
  • the light chain vector or V L expression vector can be combined with the V H
  • TITUTE SHEET expression vector to produce a combinatorial vector con ⁇ taining both V H and V L operatively linked for expression to the same promoter.
  • Figure 12 depicts the labelled proteins immuno- precipitated from E. coli containing a V H and a V L DNA homolog are shown.
  • Lane 1 the background proteins immunoprecipitated from E. coli that do not contain a V H or V L DNA homolog are shown.
  • Lane 2 contains the V H protein immunoprecipitated from E. coli containing only a V H DNA homolog.
  • lanes 3 and 4 the commigration of a V H protein a V L protein immunoprecipitated from E. coli containing both a V H and a V L DNA homolog is shown.
  • lane 5 the presence of V H protein and V L protein expressed from the V H and V L DNA homologs is demonstrated by the two distinguishable protein species.
  • Lane 5 contains the background proteins immunoprecipitated by anti-E. coli antibodies present in mouse ascites fluid.
  • Figure 13 depicts the transition state analogue (formula 1) which induces antibodies for hydrolyzing carboxamide substrate (formula 2) .
  • the compound of formula 1 containing a glutaryl spacer and a N- hydroxysuccinimide-1inker appendage is the form used to couple the hapten (formula 1) to protein carriers KLH and BSA, while the compound of formula 3 is the inhibitor.
  • the phosphonamidate functionality is a mimic of the stereoelectronic features of the transition state for hydrolysis of the amide bond.
  • Figure 14 illustrates the PCR amplification of Fd and kappa regions from the spleen mRNA of a mouse immunized with NPN. Amplification was performed as described in Example 17 using RNA cDNA hybrids obtained by the reverse transcription of the mRNA with primer specific for ampli ⁇ fication of light chain sequences (Table 2) or heavy chain sequences (Table 1) . Lanes F1-F8 represent the product of heavy chain amplification reactions with one of each of the eight 5' primers (primers 2-9, Table 1) and the unique 3* primer (primer 15, Table 2). Light chain (k) amplifi-
  • EET cations with the 5' primers are shown in lanes F9-F13. A band of 700 bps is seen in all lanes indicating the successful amplification of Fd and k regions.
  • Figure 15 depicts the screening of phage libraries for antigen binding is depicted according to Example 17C.
  • Duplicate plague lifts of Fab filters A,B
  • heavy chain filters E,F
  • light chain filters G,H
  • Filters C and D illustrate the duplicate secondary screening of a cored positive from a primary filter A (arrows) as discussed in the text.
  • XL1 Blue cells infected with phage were incubated on 150mm plates for 4 hours at 37 ⁇ C, protein expression induced by overlay with nitrocellulose filters soaked in lOmM isopro- pyl thiogalactoside (IPTG) and the plates incubated at 25° for 8 hours. Duplicate filters were obtained during a second incubation employing the same conditions.
  • Figure 16 depicts the specificity of antigen binding as shown by competitive inhibition is illustrated accord ⁇ ing to Example 17C. Filter lifts from positive plaques were exposed to 125 I-BSA-NPN in the presence of increasing concentrations of the inhibitor NPN.
  • Figure 17 depicts the characterization of an antigen binding protein is illustrated according to Example 17D.
  • the concentrated partially purified bacterial supernate of an NPN-binding clone was separated by gel filtration and aliquots from each fraction applied to microtitre plates coated with BSA-NPN. Addition of either anti-decapeptide ( ) or anti-kappa chain antibodies conjugated with alka ⁇ line phosphatase was followed by color development. The arrow indicates the position of elution of a known Fab fragment. The results show that antigen binding is a property of 50 kD protein containing both heavy and light chains.
  • Proteins synthesis was induced by the addition of IPTG to a final concentration of ImM and the cultures incubated for 10 hours at 25°C. 200 ml of cells supernate were concentrated to 2 ml and applied to a TSK-G4000 column. 50 ⁇ l. aliquots from the eluted fractions were assayed by ELISA.
  • Figure 18A depicts the major features of the bacterial expression vector HCFLP containing a V H DNA homolog and a flp recombination site.
  • Figure 18B depicts the major features of the bacterial expression vector LCFLP containing a V L DNA homolog and a flp recombination site properly oriented for recombination with the HCFLP vector.
  • Figure 19 depicts a diagrammatic sketch of bacterial coinfection with HCFLP and LCFLP vectors for the produc ⁇ tion of recombinant expression vectors containing V L and V H DNA homologs.
  • Figure 20 depicts an outline showing arm selection for heavy and light chain recombinant vector products using flp recombinase in conjunction with selection based on the inclusion of genes having amber mutations.
  • Figure 21 shows an outline of a method of phenotype creation using the fusion PCR process described herein.
  • Figure 22 illustrates human fusion PCR inside primers.
  • the heavy chain C H 1' inside primer sequence is written 3' to 5* and the light chain V L inside primer sequence is written 5• to 3 ' . Note that it is not the primer strands that cross-prime to create the fusion molecule, but the complementary PCR product strands. Boxed nucleotides represent regions where the C H 1' primer hybridizes to the 3' end of C H 1 on human IgG heavy chain
  • V L primer hybridizes to the 5 1 end of V L framework-1 on human kappa light chain cDNA.
  • Underlined sequences indicate the two stop condons.
  • the italicized amino acid and nucleotides indicate changes in sequence from the original pelB leader sequence.
  • the mouse fusion- PCR internal primers overlap in a similar manner.
  • Figure 23 illustrates an ethidium bromide stained agarose gel. After PCR amplification from human cloned DNA of heavy chain alone (HC) , light chain alone (LC) , and the heavy/light dicistronic DNA molecule (H/L) , DNA sam ⁇ ples were electrophoresed. The expected sizes of the HC, LC, and H/L products visualized on the gel were approxi ⁇ mately 730, 690, and 1,390 base pairs, respectively.
  • HC heavy chain alone
  • LC light chain alone
  • H/L heavy/light dicistronic DNA molecule
  • Figures 24A and 24B illustrate the major features of the bacterial expression vector Lambda ZAP II Modified V H (Modified ImmunoZAP H) (V H -expression vector) (IZ H) .
  • the amino acids encoded by the synthetic DNA sequence from Figure 24A is shown along with the T 3 polymerase promoter from Lambda ZAP II.
  • the orientation of the insert in Lambda ZAP II is as presented.
  • the insert was modified by the elimination of the Sac I site between the T 3 polymerase and Not I site and by the change of amino acids at the 5• end of the heavy chain from QVKL to QVQL (alysine residue was changed to a gluta ine residue) .
  • V H and V L DNA homologs were inserted into the Xho I and Xba I cloning sites of the phagemid as described in Figure 26 and shown in Figure 24B.
  • the modifications were made to create a fusion-PCR library from hybridoma RNA, to overcome decreased efficiency of secretion of positively charged amino acids in the amino terminus of the protein. Inouye et al., Proc. Natl. Acad. Sci.. USA. 85:7685-7689 (1988), and to make the V L Sac I cloning site a unique restriction site.
  • Figures 25A and 25B illustrate the sequences of the synthetic DNAs inserted into Lambda ZAP to produce Lambda
  • V H and V L -coding DNA homologs include the Shine-Dalgarno ribosome binding site, a leader sequence to direct the expressed protein to the periplasm as described by Mouva et al. , J. Biol. Chem.. 255:27, 1980, and various restriction enzyme sites used to operatively link the V H and V L homologs to the expression vector.
  • the V H expression-vector sequence also contains a short nucleic acid sequence that codes for amino acids typically found in variable regions of the heavy chain (V H Backbone) . This V H Backbone is just upstream and in the proper reading frame as the V H DNA homologs that are operatively linked into the Xho I and Spe I restriction sites.
  • the V L DNA homologs are opera ⁇ tively linked into the V L sequence (25B) at the Sac I and Xba I restriction enzyme sites.
  • Figure 26 illustrates the major features of the bacterial expression vector Lambda Zap II V H (ImmunoZAP H) (V H - expression vector) .
  • the amino acids encoded by the synthetic DNA sequence from Figure 25A is shown at the top along with the T 3 polymerase promoter from Lambda Zap II.
  • the orientation of the insert in Lambda Zap II is as pre ⁇ sented.
  • the V H DNA homologs were inserted into the phagemid that is produced by the in vivo excision protocol described by Short et al., Nucleic Acids Res. , 16:7583- 7600, 1988.
  • the V H DNA homologs were inserted into the Xho I and Spe I restriction enzyme sites.
  • the read through transcription produces the decapeptide epitope (tag) that is located just 3' of the cloning sites.
  • Figure 27 illustrates the major features of the bacterial expression vector Lambda Zap II V L (ImmunoZAP L) (V L expression vector) .
  • the amino acids encoded by the synthetic DNA sequence shown in Figure 25B is shown at the top along with the T 3 polymerase promoter from Lambda Zap II.
  • the orientation of the insert in Lambda Zap II is as presented.
  • the V L DNA homologs are inserted into the Sac I and Xba I cloning sites of the phagemid as described in Figure 26.
  • TITUTE SHEET Figure 28 illustrated an autoradiogram showing signals obtained from human phage clones. Approximately 100 lambda phage were spotted onto E. coli lawns, creating plaques that were overlaid with nitrocellulose filters previously soaked in 10 mM isopropylbeta-D-thiogalacto- pyranoside (IPTG) to induce Fab expression. Following overnight incubation, the filters were reacted with 125 I- tetanus toxoid probe. After washing, the filters were exposed to X-ray film. The column on the right represents the parental clones that were selected form a combina ⁇ torial library. Mullinax et al., Proc. Natl. Acad.
  • Nucleotide a monomeric unit of DNA or RNA consist ⁇ ing of a sugar moiety (pentose) , a phosphate, and a nitro ⁇ genous heterocyclic base.
  • the base is linked to the sugar moiety via the glycosidic carbon (l 1 carbon of the pentose) and that combination of base and sugar is a nucleoside.
  • the nucleoside contains a phosphate group bonded to the 3' or 5* position of the pentose it is referred to as a nucleotide.
  • Base Pair (bp) a pairing (by hydrogen bonding) of adenine (A) with thymine (T) , or of cytosine (C) with guanine (G) in a double stranded DNA molecule.
  • adenine (A) with thymine (T) or of cytosine (C) with guanine (G) in a double stranded DNA molecule.
  • cytosine C
  • G guanine
  • Nucleic Acid a polymer of nucleotides, either single or double stranded.
  • Gene a nucleic acid whose nucleotide sequence codes for an RNA or polypeptide.
  • a gene can be either RNA or DNA.
  • Complementary Bases nucleotides that normally pair up when DNA or RNA adopts a double stranded configuration.
  • Complementary Nucleotide Sequence a sequence of nucleotides in a single-stranded molecule of DNA or RNA that is sufficiently complementary to that on another single strand to specifically hybridize to it with consequent hydrogen bonding.
  • nucleotide sequence is conserved with respect to a preselected (reference) sequence if it non- randomly hybridizes to an exact complement of the preselected sequence.
  • Hybridization the pairing of substantially complementary nucleotide sequences (strands of nucleic acid) to form a duplex or heteroduplex by the establish- ment of hydrogen bonds between complementary base pairs. It is a specific, i.e. non-random, interaction between two complementary polynucleotides that can be competitively inhibited.
  • Nucleotide Analog a purine or pyrimidine nucleotide that differs structurally from A, T, G, C, or U, but is sufficiently similar to substitute for the normal nucleo ⁇ tide in a nucleic acid molecule.
  • DNA Homolog is a nucleic acid having a preselected conserved nucleotide sequence and a sequence coding for a receptor capable of binding a preselected ligand.
  • a receptor is a molecule, such as a protein, glycoprotein and the like, that can specifically (non-rando ly) bind to another molecule.
  • Antibody in its various grammati- cal forms is used herein to refer to immunoglobulin molecules and immunologically active portions of immuno ⁇ globulin molecules, i.e., molecules that contain an
  • TE SHEET antibody combining site or paratope.
  • exemplary antibody molecules are intact immunoglobulin molecules, substan ⁇ tially intact immunoglobulin molecules and portions of an immunoglobulin molecule, including those portions known in the art as Fab, Fab', F(ab*) 2 and F(v) .
  • An antibody combining site is that structural portion of an antibody molecule com ⁇ prised of a heavy and light chain variable and hypervari ⁇ able regions that specifically binds (immunoreacts with) an antigen.
  • the term immunoreact in its various forms means specific binding between an antigenic determinant- containing molecule and a molecule containing an antibody combining site such as a whole antibody molecule or a portion thereof.
  • Monoclonal Antibody The phrase monoclonal antibody in its various grammatical forms refers to a population of antibody molecules that contains only one species of anti ⁇ body combining site capable of immunoreacting with a particular antigen. A monoclonal antibody thus typically displays a single binding affinity for any antigen with which it immunoreacts.
  • a monoclonal antibody may there ⁇ fore contain an antibody molecule having a plurality of antibody combining sites, each immunospecific for a different antigen, e.g., a bispecific monoclonal antibody.
  • Upstream In the direction opposite to the direction of DNA transcription, and therefore going from 5 1 to 3' on the non-coding strand, or 3' to 5' on the mRNA.
  • Downstream Further along a DNA sequence in the direction of sequence transcription or read out, that is traveling in a 3 1 - to 5'-direction along the non-coding strand of the DNA or 5'- to 3 '-direction along the RNA transcript.
  • Cistron Sequence of nucleotides in a DNA molecule coding for an amino acid residue sequence. Stop Codon: Any of three codons that do not code for an amino acid, but instead cause termination of protein synthesis. They are UAG, UAA and UGA. Also referred to as a nonsense or termination codon.
  • Leader Polypeptide A short length of amino acid sequence at the amino end of a protein, which carries or directs the protein through the inner membrane and so ensures its eventual secretion into the periplasmic space and perhaps beyond. The leader sequence peptide is commonly removed before the protein becomes active.
  • Reading Frame Particular sequence of contiguous nucleotide triplets (codons) employed in translation. The reading frame depends on the location of the translation initiation codon.
  • An inside primer is a polynucleotide that has a priming region located at the 3' terminus of the primer which typically consists of 15 to 30 nucleotide bases.
  • the 3' terminal-priming portion is capable of acting as a primer to catalyze nucleic acid synthesis.
  • the 5•-terminal priming portion comprises a non-priming portion.
  • An outside primer comprises a 3'- terminal priming portion and a portion that may define an endonuclease restriction site which is typically located in a 5'-terminal non-priming portion of the outside primer.
  • Fusion Polynucleotide Amplification refers to in vitro techniques of generating a multiple complementary copies of a nucleic acid template which comprises nucleo ⁇ tide sequences which have been randomly combined to give a combined nucleic sequence. These techniques typically employ complementary primers which hybridize to the template and are extended in a primer extension reaction.
  • the polyu erase chain reaction (PCR) techniques described herein comprise a preferred method of nucleotide sequence amplifications. Generation and amplification of a combined nucleotide sequence using fusion PCR is further described herein.
  • TE SHEET Vector refers to a nucleic acid molecule capable to transporting between different genetic environments another nucleic acid to which it has been operatively linked.
  • One type of pre- ferred vector is an episome, i.e., a nucleic acid molecule capable of extra-chromosomal replication.
  • Other suitable vectors include plasmid and cosmid vectors and phage, especially bateriophage such as lambda.
  • Preferred vectors are those capable of autonomous replication and/or expres- sion of nucleic acids to which they are linked.
  • Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors”.
  • each member of the library will normally contain a different gene or DNA sequence. However, the vector portion of such a vector-gene fusion is typically identical from member to member. (Maniatis et al.. supra) .
  • Individual members within the library may often be, and typically are, amplified before screening to identify and isolate a desired member. Amplification occurs so that each library member grows as a bacterial colony (for plasmid libraries) or phage plaques (for bacteriophage libraries, such as lambda) . These amplified members are usually referred to as "clones,” since each colony or plaque is made up of many identical host cells or phage particles.
  • the search for a particular clone containing a single gene or DNA sequence of interest can be accomplished in many different ways.
  • the clone may be identified because its vector-gene specifically hybridizes with a nucleic acid probe. It may also be identified by expression of an RNA species that can be identified, for example by nucleic acid hybridization.
  • the RNA species may, furthermore, be translated into a protein, typically by the host cell, that may be identified, for example, by reactivity with an antibody probe.
  • the protein may be recog ⁇ nized because it binds a substrate, or catalyzes a reaction, or allows the host cell to survive under selective conditions, and so on.
  • Described herein are libraries in which two or more families (or populations) of genes are expressed in a vector or a host cell in such a way that the gene combi ⁇ nations are randomly represented and subsequently detected on the basis of some property or characteristic in the event that a particular combination of one member from a first gene family and one gene from a one or more other gene families are combined in a vector host cell. For example, in the general case if there are "i" members of the gene family "A” and "j" members of the gene family "B”, there will be (i) x (j) combinations of selected gene members A and B in the randomly created vector-gene population.
  • the total number of combinations of genes will be the product of the number of A genes times the number of B genes times the number of C genes.
  • methods are provided wherein at least two genes may randomly be combined, preferably on the same vector molecule, having been identified within a population of vectors containing other combinations of different genes from the same two or more gene families.
  • This approach may be broadly accomplished by means other than recombi ⁇ nation, for example, the use of a vector having at least two independent insertion sites for two foreign genes or inserting in a vector a nucleotide sequence comprising nucleotide sequences from each gene family.
  • the recombi ⁇ nation of at least two separate library populations to make a combinatorial population for example, using a
  • the invention also provides for vectors having characteristics and sequences useful for the preparation of combinatorial vectors encoding random DNA sequences from two or more gene families.
  • vectors include plasmids and phage containing common restriction sites or sequences enabling the in vivo recombination of said DNA sequences from said gene families.
  • the first repeat also has a one bp mismatch relative to the first two.
  • Deletion analysis has demonstrated that the third repeat is unnecessary for recombination in vitro, although it may have a slight effect on the reac ⁇ tion jLn vivo. Additional deletions indicate that most, but not all, of the first and second repeats (those flanking the spacer) are required. While deletion of three bp from the distal ends of one or both of these repeats has no detectable effect on the reaction, further deletion leads to a gradual reduction in site function, with complete loss of site function occurring (in vitro) with deletions of eight bp or more from either end.
  • the minimal site required for a full function in vitro is therefore relatively small (approximately 28 bp including the spacer and the proximal 10 bp of each flanking repeat) . Accordingly, it will be seen that the full, intermediate, or minimal FRT sequences can be utilized to accomplish flp-mediated site-specific recombination.
  • the lambda phage attachment site is responsible for integration of lambda into the host chromosome. It also acts as a hot spot of recombination and lytic crosses between wild lambda chromosomes.
  • loxP acts as a hot spot of recombination. This site is recognized by the PI ere protein, a known site-specific protein.
  • the site- specific recombination system is responsible for the rare integration of PI into the host chromosome.
  • the cre-lox system of bacteriaphage PI is also useful for the site- specific recombination contemplated by the invention described and claimed herein.
  • a transposon can jump from one vector to another vector or from a vector to a bacterial chromosome.
  • Different transposons having different inverted repeat sequences and carrying, for example, different drug- resistance genes can be used to carry out the desired random combination of genes as described herein either in vivo or in vitro.
  • the transposon may, but need not, also contain a sequence encoding the transposase enzyme which catalyzes the "hop.”
  • Various suitable transposon systems have been described in the literature. (See, Mobile DNA, Douglas E. Berg and Martha M. Howe, eds., American Society for Microbiology, Washington, D.C, 1989).
  • One suitable transposon system is the gamma-delta transposon system which has been isolated from E. Coli.
  • a transposon system in addition to restriction digestion and ligation, use of flp type recombination systems, and homologous recombination, a transposon system can also be used to integrate a light (or heavy) antibody chain clone, into a heavy (or light) antibody chain clone. For example, this can be accomplished by flanking the light chain expression and cloning region with transposon terminal sequences.
  • a library constructed in this light chain vector could be used to co-infect bacteria with
  • TUTE SHEET clones from the heavy chain library The light chain inserts between the terminal sequences would hop from the light chain lambda phage vector into other DNA sequences in the presence of transposase activity. Selection for hopping into the heavy chain clone can be accomplished by placing a selectable marker within the light chain, posi ⁇ tioned between the transposon hopping sequences. Subsequently, phage recovered from the co-infected culture is plated with a strain enabling selection for the heavy chain vector and for the light chain marker gene. Because this second plating is performed under conditions of a high cell to phage ratio, only one lambda phage will typically be introduced into each cell.
  • the lambda phage should grow only if the phage contains genes from both the heavy and light chain clones; most efficiently resulting from the transposon hop. If the hop occurs in the essen ⁇ tial genes of the heavy chain clone, the phage will not grow. Only phage containing the transposon in the proper position within the heavy chain will grow. A collection of these clones comprises a library of combinatorial heavy and light chain antibody clones.
  • fusion PCR is used to generate two PCR-amplified DNA fragments, each of which have one of their ends modified by directed mispriming so that those ends share regions of complementarity, i.e., cohesive termini.
  • cohesive termini regions of complementarity
  • PCR amplification methods are described in detail in U.S. Patent Nos. 4,863,192, 4,683,202, 4,800,159, and 4,965,188, and at least in several texts including "PCR Technology: Principles and Applications for DNA Amplification", H. Erlich, ed. , Stockton Press, New York (1989) ; and "PCR Protocols” A Guide to Methods and Applications", Innis et al., eds., Academic Press, San Diego, California (1990) .
  • fusion PCR is used to produce a library of dicistronic DNA mole ⁇ cules ocntaining upstream and downstream cistrons wherein first and second PCR amplification products are produced using respective first and second PCR primer pairs.
  • the first PCR primer pair comprises a first polypeptide outside primer and a first polypeptide inside primer.
  • the second PCR primer pair comprises a second polypeptide outside primer and a second polypeptide inside primer.
  • the first and second polypeptide inside primers contain complementary 5'-terminal sequences that allow their DNA complements to hybridize and form an internally- primed duplex having 3'-overhanging termini.
  • the internally-primed duplex is then subjected to primer extension reaction conditions to produce a double stranded, dicistronic DNA having substantially blunt or blunt ends.
  • the dicistronic DNA is then PCR amplified using the outside primers as a PCR primer pair.
  • the dicistronic DNA molecule comprises two amino acid residue-coding sequences on the same strand separated by at least one stop codon and at least one signal sequence necessary for translation of the downstream cistron, such as a translation initiation codon, ribosome binding site, and the like.
  • the upstream and downstream cistrons of the dicistronic DNA molecule are operatively linked by a cistronic bridge.
  • the cistronic bridge comprises the genetic elements necessary to terminate translation of the upstream cistron and initiate translation of the down ⁇ stream cistron.
  • the coding strand of the bridge codes for one or more stop codons, preferably two, in the same translational reading frame as the upstream cistron.
  • the cistronic bridge coding strand preferably also encodes a ribosome binding site for the dowstream cistron located downstream from the upstream cistron's
  • the coding strand of the cistronic bridge will also encode a leader polypeptide segment in the same translational reading frame as the downstream cistron.
  • the nucleotide base sequence encoding the leader usually begins with an initiation codon located within an operative distance, i.e. is operatively linked, to the ribosome binding site.
  • the illustrated method can be used with other families of conserved genes which each for one unit of a dimeric receptor, whether obtained directly from a natural source, such naive or in vivo immunized cells, or from cells or one or more genes that have been treated or mutagenized in vitro.
  • the method combines the following elements:
  • the present invention also provides a novel method for screening variants of a parental clone or clones. If the parental clone or clones contain two nucleotide sequences that, when expressed together, create a phenotype, then such nucleotide sequences can be altered to create populations of variants of such nucleotide sequences.
  • the methods combine the following elements: 1. Replicating at least portions of two nucleotide sequences contained within a single clone under conditions that allow mutations to occur in either nucleotide sequence.
  • TUTE SHEET For example, assume a parent clone containing two nucleotide sequences A and B is replicated under mutating conditions such that variant clones are formed:
  • Variant 5 A3/B However, within this mutated population, the combinations A1/B2, A2/B, A2/B2, A3/B1, and A3/B2, do not occur. If the mutant population (including some non-mutated parent clones) is allowed to recombine sequences A and B and their variants, then combinations such as A1/B2, A2/B etc. can be created. Such new combinations may express a desired phenotype that was not present in the parental or the variant population.
  • the present invention is related to methods for tapping the immunological repertoire by isolating from V H -coding and V L -coding gene repertoires genes coding for a heterodimeric antibody receptor capable of binding a preselected ligand.
  • the method combines the following elements:
  • V H and V L polypeptides are expressed in a suitable host, including prokaryotic and eukaryotic hosts, on the same expression vector.
  • the expressed phenotype produced by the methods by the present invention comprises a multi- meric polypeptide product (i.e. a heterodimer, etc.) which assumes a conformation having a binding site specific for, as evidenced by its ability to be competitively inhibited, a preselected or predetermined ligand such as an antigen, enzymatic substrate and the like.
  • the multimeric polypeptide is an antibody that forms an anti ⁇ gen binding site which specifically binds to .a preselected antigen to form an immunoreaction product (complex) having a sufficiently strong binding between the antigen and the binding site for the immunoreaction product to be iso ⁇ lated.
  • the antibody typically has an affinity or avidity is generally greater than 10 5 -M "1 .
  • a multimeric polypeptide produced according to the present invention is capable of binding a substrate and catalyzes the formation of a product from the substrate.
  • the useful catalytic multimeric polypeptides typically have an association constant for the preselected substrate generally greater than 10 3 M "1 , more usually greater than 10 5 M “1 or 10 6 M “1 and preferably greater than 10 7 M "1 .
  • the multimeric polypeptide produced according to the present invention is heterodimeric and is therefore normally comprised of two different polypeptide chains, which together assume a conformation having a binding affinity, or association constant for the pre ⁇ selected ligand that is different, preferably higher, than, the affinity or association constant of either of the polypeptides alone, i.e., as monomers.
  • one or both of the different polypeptide chains is derived from the variable region of the light and heavy chains of an immunoglobulin.
  • TE SHEET peptides comprising the light (V L ) and heavy (V H ) variable regions are employed together for binding the preselected ligand.
  • a V H or V L produced by the methods of the subject invention can be active in monomeric as well as multimeric forms, either homomeric or heteromeric, preferably hetero ⁇ dimeric.
  • a V H and V L ligand binding polypeptide produced by the present invention can be advantageously combined in a heterodimer (antibody molecule) to modulate the activity of either or to produce an activity unique to the hetero ⁇ dimer.
  • the individual ligand binding polypeptides will be referred to as V H and V L and the heterodimer will be referred to as an antibody molecule.
  • V H binding polypeptide may contain in addition to the V H , substan ⁇ tially all or a portion of the heavy chain constant region.
  • a V L binding polypeptide may contain, in addition to the V L , substantially all or a portion of the light chain constant region.
  • a heterodimer comprised of a V H binding polypeptide containing a portion of the heavy chain constant region and a V L binding containing substan ⁇ tially all of the light chain constant region is termed a Fab fragment.
  • the production of a Fab can be advantageous in some situations because the additional constant region sequences contained in a Fab as compared to a F v could stabilize the V H and V L interaction. Such stabilization could cause the Fab to have higher affinity for antigen.
  • the Fab is more commonly used in the art and thus there are more commercial antibodies available to specifically recognize a Fab.
  • the individual V H and V L polypeptides may be produced in lengths equal or substantially equal to their naturally, occurring lengths.
  • the individual V H and V L poly ⁇ peptides will generally have fewer than 125 amino acid residues, more usually fewer than about 120 amino acid residues, while normally having greater than 60 amino acid residues, usually greater than about 95 amino acid residues, more usually greater than about 100 amino acid residues.
  • the V H will be from about 110 to about 125 amino acid residues in length while V L will from about 95 to about 115 amino acid residues in length.
  • the amino acid residue sequences of the polypeptides will vary widely, depending upon the particular idiotype involved.
  • polypeptides produced by the subject invention will normally be substantial copies of idiotypes of the variable regions of the heavy and/or light chains of immunoglobulins, but in some situations a polypeptide may contain random mutations in amino acid residue sequences in order to advantageously improve the desired activity.
  • V H and V L polypeptides are covalent cross linking of the V H and V L polypeptides, which can be accomplished by providing cysteine resides at the carboxyl termini.
  • the polypeptide will normally be pre- pared free of the immunoglobulin constant regions, however a small portion of the J region may be included as a result of the advantageous selection of DNA synthesis primers.
  • the D region will normally be included in the transcript of the V H .
  • This single-chain antigen-binding protein would be synthesized as a single protein chain.
  • Such a single- chain antigen binding proteins have been described by Bird et al., Science, 242:423-426 (1988).
  • the design of suitable peptide linker regions is described in U.S. Patent No. 4,704,692 by Robert Landner.
  • Such a peptide linker may be designed as part of the nucleic acid sequences contained in the expression vector.
  • the nucleic acid sequences coding for the peptide linker would be between the V H and V L DNA homologs and the
  • E SHEET restriction endonuclease sites used to operatively link the V H and V L DNA homologs to the expression vector.
  • Such a peptide linker also may be coded for nucleic acid sequences that are part of the polynucleotide primers used to prepare the various gene libraries.
  • the nucleic acid sequence coding for the peptide linker can be made up of nucleic acids attached to one of the primers or the nucleic acid sequence coding for the peptide linker may be derived from nucleic acid sequences that are attached to several polynucleotide primers used to create the gene libraries.
  • V H and V L polypeptides will have a greater variety of the sequences than the N terminus and, based on the present strategy, can be further modified to permit a variation of the normally occurring V H and V L chains.
  • a synthetic polynucleotide and be employed by vary one or more amino in an hypervariable region.
  • a gene repertoire useful in the methods the present inven ⁇ tion contains at least 10 3 , preferably at least 10 4 , more preferably at least 10 5 , and most preferably at least 10 7 different consderved genes. Methods for evaulating the diversity of a repertoire of conserved genes are well known to one skilled in the art.
  • a source of genes coding for the V H and/or V L polypeptides is required.
  • the source will be heterogeneous population of antibody producing cells, i.e. , B lymphocytes (B cells) , preferably rearranged B cells such as those found in the circulation or spleen of a vertebrate.
  • B cells B lymphocytes
  • Rearranged B cells are those in which immunoglobulin gene transloca- tion, i.e., rearrangement, has occurred as evidenced by the presence in the cell of mRNA with the immunoglobulin gene V, D and J region transcripts adjacently located thereon.
  • the repertoire for a preselected activity such as by using as a source of nucleic acid cells (source cells) from vertebrates in any one of various stages of age, health and immune response.
  • source cells nucleic acid cells
  • repeated immunization of a healthy animal prior to collecting rearranged B cells results in obtaining a repertoire enriched for genetic material producing a ligand binding polypeptide of high affinity.
  • a source of nucleic acid cells source cells
  • the source cells are obtained from a vertebrate, preferably a mammal, which has been immunized or partially immunized with an anti ⁇ genic ligand (antigen) against which activity is sought, i.e., a preselected antigen.
  • the immunization can be carried out conventionally.
  • Antibody titer in the animal can be monitored to determine the stage of immunization desired, which stage corresponds to the amount of enrich ⁇ ment or biasing of the repertoire desired.
  • Partially immunized animals typically receive only one immunization
  • UTE SHEET and cells are collected therefrom shortly after a response is detected.
  • Fully immunized animals display a peak titer, which is achieved with one or more repeated injec ⁇ tions of the antigen into the host mammal, normally at 2 to 3 week intervals.
  • the spleen is removed and the genetic repertoire of the spleenocytes, about 90% of which are rearranged B cells, is isolated using standard procedures. See, Current Protocols in Molecular Biology, Ausubel et al., eds. , John Wiley & Sons, NY.
  • Nucleic acids coding for V H and V L polypeptides can be derived from cells producing IgA, IgD, IgE, IgG or IgM, most preferably from IgM and IgG, producing cells.
  • the desired gene repertoire can be isolated from either genomic material containing the gene expressing the variable region or the messenger RNA (mRNA) which repre ⁇ sents a transcript of the variable region.
  • the difficulty in using the genomic DNA from other than non-rearranged B lymphocytes is in juxtaposing the sequences coding for the variable region, where the sequences are separated by intervening regions.
  • the DNA fragment(s) containing the proper variable regions must be isolated, the intervening regions excised, and the variable regions then spliced in the proper order and in the proper orientation. For the most part, this will be difficult, so that the alternative technique employing rearranged B cells will be the method of choice because the V, D and J immunoglobulin gene regions have translocated to become adjacent, so that the sequence is continuous for the variable regions.
  • the cells will be lysed under RNase inhibiting conditions.
  • the first step is to isolate the total cellular mRNA by hybridiza ⁇ tion to an oligo-dT cellulose column.
  • the presence of mRNAs coding for the heavy and/or light chain polypeptides can then be assayed by hybridization with DNA single strands of the appropriate genes.
  • the sequences coding for the constant portion of the V H and V L can be used as polynucleotide probes, which sequences can be obtained from available sources. See for example, Early and Hood, Genetic Engineering, Setlow and Hollaender, eds., Vol.
  • the preparation containing the total cellular mRNA is first enriched for the presence of V H and/or V L coding mRNA. Enrichment is typically accomplished by subjecting the total mRNA preparation or partially purified mRNA product thereof to a primer extension reaction employing a polynucleotide synthesis primer of the present invention.
  • a gene repertoire may be generated from one or a few nucleotide sequences by replicating those sequences under mutagenesis conditions so that a plurality of different nucleotide sequences or genes may be generated.
  • Suitable mutagenesis conditions are known to those skilled in the art.
  • polynucleotide as used herein in reference to primers, probes and nucleic acid fragments or segments to be synthesized by primer extension is defined as a molecule comprised of two or more deoxyribonucleotides or ribonucleotides, preferably more than 3. Its exact size will depend on many factors, which in turn depends on the ultimate conditions of use.
  • primer refers to a poly- nucleotide whether purified from a nucleic acid restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a nucleic acid strand is induced, i.e., in the presence of nucleotides and an agent for polymerization such as DNA polymerase, reverse transcriptase and the like, and at a suitable temperature and pH.
  • the primer is preferably single stranded for maximum efficiency, but may alterna- tively be stranded. If double stranded, the primer is first treated to separate its strands before being used to prepare extension products.
  • the primer is a polydeoxyribonucleotide.
  • the primer must be suffi ⁇ ciently long to prime the synthesis of extension products in the presence of the agents for polymerization.
  • the exact lengths of the primers will depend on many factors, including temperature and the source of primer.
  • a polynucleotide primer typically contains 15 to 25 or more nucleotides, although it can contain fewer nucleotides. Short primer molecules generally require cooler temperatures to form sufficiently stable hybrid complexes with template.
  • the primers used herein are selected to be “substantially" complementary to the different strands of each specific sequence to be synthesized or amplified. This means that the primer must be sufficiently comple- mentary to nonrandomly hybridize with its respective template strand. Therefore, the primer sequence need not reflect the exact sequence of the template.
  • a non-complementary nucleotide fragment can be attached to the 5 1 end of the primer, with the remainder of the primer sequence being substantially complementary to the strand.
  • Such noncomplementary fragments typically code for an endonuclease restriction site.
  • noncomple ⁇ mentary bases or longer sequences can be interspersed into the primer, provided the primer sequence has sufficient complementarily with the sequence of the strand to be syn ⁇ thesized to amplified to non-randomly hybridize therewith and thereby form an extension product under polynucleotide synthesizing conditions.
  • Primers of the present invention may also contain a DNA-dependent RNA polymerase promoter sequence or its complement. See for example, Krieg et al., Nucleic Acids Research, 12:7057-70 (1984); Studier et al., J. Mol. Biol.. 189:113-130 (1986); and Molecular Cloning: A Laboratory Manual, Second Edition. Maniatis et al., eds., Cold Spring Harbor, NY (1989) .
  • the primer When a primer containing a DNA-dependent RNA poly ⁇ merase promoter is used, the primer is hybridized to the polynucleotide strand to be amplified and the second polynucleotide strand of the DNA-dependent RNA polymerase promoter is completed using an inducing agent such as _____ coli DNA polymerase I, or the Klenow fragment of E. coli DNA polymerase.
  • the starting polynucleotide is amplified by alternating between the production of an RNA poly- nucleotide and DNA plynucleotide.
  • Primers may also contain a template sequence or replication initiation site for a RNA-directed polymerase.
  • Typical RNA-directed RNA polymerase include the QB repli- case described by Lizardi et al. Biotechnology. 6:1197- 1202 (1988) .
  • RNA-directed polymerases produce large numebrs of RNA strands from a small number of template RNA strands that contain a template sequence or replication
  • TUTE SHEET initiation site These polymerases typically give a one million-fold amplification of the template strand, as has been described by Kramer et al., J. Mol. Biol.. 89:7819- 736 (1974).
  • the polynucleotide primers can be prepared using any suitable method, such as, for example, the phosphotriester on phosphodiester methods see Narang et al. , Meth. Enzvmol.. 68:90, (1979); U.S. Patent No. 4,356,270; and Brown et al., Meth. Enzvmol. , 68:109, (1979).
  • primers nucleotide sequence depends on factors such as the distance on the nucleic acid from the region coding for the desired receptor, its hybrid ⁇ ization site on the nucleic acid relative to any second primer to be used, the number of genes in the repertoire it is to hybridize to, and the like.
  • V H and V L gene repertoires can be separately prepared prior to their use in the methods of the present inven ⁇ tion.
  • Repertoire preparation is typically done by primer extension (or other in vitro amplificaiton method) , preferably by primer extension in a PCR format.
  • the nucleotide sequence of a primer is selected to hybridize with a plurality of immunoglobulin heavy chain genes at a site substantially adjacent to the V H -coding region so that a nucleotide sequence coding for a functional (capable of finding) polypeptide is obtained.
  • the primer To hybridize to a plurality of different V H -coding nucleic acid strands, the primer must be a substantial complement of a nucleotide sequence conserved among the different strands.
  • sites include nucleotide sequences in the constant region, any of the variable region framework regions, preferably the third framework region, leader region, promoter region, J region and the like.
  • V H -coding and V L -coding DNA homologs are to be produced by polymerase chain reaction (PCR) amplification, two primers must be used for each coding strand of nucleic acid to be amplified.
  • the first primer becomes part of the nonsense (minus or complimentary) strand and hybrid ⁇ izes to a nucleotide sequence conserved among V H (plus) strands within the repertoire.
  • first primers are therefore chosen to hybridize to (i.e. be complementary to) conserved regions within the J region, CHI region, hinge region, C H 2 region, or C H 3 region of immunoglobulin genes and the like.
  • first primers are chosen to hybridize with (i.e. be complementary to) a conserved region with the J region or constant region of immuno ⁇ globulin light chain genes and the like.
  • Second primers become part of the coding (plus) strand and hybridize to a nucleotide sequence conserved among minus strands.
  • second primers are therefore chosen to hybridize with a conserved nucleotide sequence at the 5' end of the V H -coding immunoglobulin gene such as in that area coding for the leader or first frame- work region.
  • the conserved 5' nucleotide sequence of the second primer can be comple ⁇ mentary to a sequence exogenously added using terminal deoxynucleotidyl transferase as described by Loh et al., Science 243:217-220 (1989).
  • One or both of the first and second primers can contain a nucleotide sequence defining an endonuclease recognition site. The site can be heter ⁇ ologous to the immunoglobulin gene being amplified and typically appears at or near the 5' end of the primer.
  • the present invention utilizes a set of polynucleotides that form inside primers comprised of an upstream inside primer and a downstream inside primer.
  • Each of the inside primers has a priming region located at the 3'-terminus of the primer.
  • the priming region is typically the 3'-most (3'-terminal) 15 to 30
  • each inside primer is capable of acting as a primer to catalyze nucleic acid synthesis, i.e., initiate a primer extension reaction off its 3* terminus.
  • One or both of the inside primers is further characterized by the presence of a 5 '- terminal (5 '-most) non-priming portion, i.e., a region that does not participate in hybridization to repertoire template.
  • each inside primer works in combination with an outside primer to amplify a target nucleic acid sequence.
  • the choice of PCR primer pairs for use in fusion PCR as described herein is governed by the same considerations as previously discussed for choosing PCR primer pairs useful in producing gen repertoires. That is, the primers have a nucleotide sequence that is complementary to a sequence conserved in the repertoire.
  • Useful V L and V H inside priming sequences are shown in Tables 1 and 2, respectively, below.
  • Nucleotides sequences 1-10 are unique 5 ' primers for the amplification of kappa light chain variable regions. Table 2
  • 3' primer for amplifying the Fd region of mouse IgM 3' primer located in the CH3 region of human IgGl to amplify the entire heavy chain.
  • 10 3 ' primer for amplifying mouse Fd including part of the mouse IgG first constant region and part of the hinge region.
  • 11 3 for amplifying human IgGl Fd including part of the human IgG first constant region and part of the hinge region including the two cysteines which create the disulfide bridge for producing Fab'2 (the primer corresponds to Kabat number 241QQ to 247) .
  • a preferred set of inside primers used herein has primers with complementary 5'-terminal non-priming regions, the complementary strands of which are capable of hybridizing to each other to form a duplex with 3 • over- hangs.
  • the duplex encodes all or part of a double stranded cistronic bridge. That is, if the 3* overhangs of the duplex are filled in with complementary bases so as to define a double stranded DNA extending from the 3'- terminus of one of the inside primers to the 3 '-terminus of the other of the inside primers, that double stranded DNA segment forms a sequence of nucleotides that opera ⁇ tively links the upstream and downstream cistrons for polycistronic expression.
  • the two inside primers in combination encode both the plus and minus strands of all or part of the bridge.
  • one inside upstream primer can have a sequence that forms a portion of the plus strand of the bridge, and the other inside primer encodes the sequence, through complementarity, of the downstream portion of the plus strand.
  • the plus strand of the cistronic bridge contains, in the translational reading frame and from an upstream position to a downstream position, sequences coding for (i) at least one stop codon, preferably two, in the same reading frame as the upstream cistron, (ii) a ribosome binding site, and (iii) a polypeptide leader, the translation initiation codon of which is in the same reading frame as the downstream cistron.
  • the stop codon is present to terminate transla ⁇ tion of the upstream cistron.
  • the ribosome binding site is present to initiate translation of the downstream cistron from the polycistronic mRNA.
  • the ribosome binding site includes an initi ⁇ ation codon (AUG) and a sequence 3- nucleotides long located 3 11 nucleotides upstream from the initiation codon [Shine et al.. Nature. 254:34 (1975)].
  • AGGAGGU which is called the Shine-Dalgarno (SD) sequence, is complementary to the 3' end of E. coli 16S mRNA. Binding of the ribosome to mRNA and the sequence at the 3 ' end of the mRNA can be affected by several factors:
  • the complementary (overlapping) region of the inside primers and the priming portion of the inside primers have about the same denaturation temperature, Td.
  • a Td for the above-identified hybridizing region of about 45- 55°C, preferably about 50°C, is preferred.
  • overlapping regions in the range of about 15 to 20 nucleotides works well in conjunction with the priming regions in the range of 15-30 nucleotides.
  • the set of outside primers forms the termini of the dicistronic DNA molecule.
  • the set of outside primers comprises an upstream outside primer and a downstream outside primer.
  • the outside primers each comprise a 3'- terminal priming portion, and preferably a portion that defines an endonuclease restriction site.
  • the restriction site-defining portion is typically located in a 5'-terminal non-priming portion of the outside primer.
  • the restriction site defined by the upstream outside primer is typically chosen to be one recognized by
  • UTE SHEET a restriction enzyme that does not recognize the restric ⁇ tion site defined by the downstream outside primer, the objective being to be able to produce a dicistronic DNA having cohesive termini that are non-compelementary to each other and thus allow directional insertion into a vector.
  • Nucleotide sequences 21-28 are unique 5* primers for the amplification of mouse V H genes.
  • Nucleotide sequences 29-32 are unique 5' primers for amplification of nucleic acids coding for human variable regions.
  • V H and/or V L genes contained within the isolated repertoire will depend, as is well known in the art, on the type, complexity, and purity of the nucleic acids making up the repertoire. Other factors include whether or not the genes are contained in one or a plurality of repertoires or populations and whether or not they are to be amplified and/or mutagnized.
  • the object is to clone the V H - and/or V L -coding genes from a repertoire comprised of polynucleo ⁇ tide coding strands, such as mRNA and/or the sense strand of genomic DNA.
  • the repertoire is in the form of double stranded genomic DNA, it is usually first dena ⁇ tured, typically by melting, into single strands.
  • the repertoire is subjected to a first primer extension reaction by treating (contacting) the repertoire with a first polynucleotide synthesis primer having a preselected nucleotide sequence.
  • the first primer is capable of ini ⁇ tiating the first primer extension reaction by hybridizing to a nucleotide sequence, preferably at least about 10 nucleotides in length and more preferably at least about 20 nucleotides in length, conserved within the repertoire.
  • the first primer is sometimes referred to herein as the "sense primer” because it hybridizes to the coding or sense strand of a nucleic acid.
  • the second primer is sometimes referred to herein as the "anti-sense primer” because it hybridizes to a non-coding or anti- sense strand to a nucleic acid, i.e., a strand complementary to a coding strand.
  • the PCR reaction is performed by mixing the PCR pair, preferably a predetermined amount thereof, with the nucleic acids of the repertoire, preferably a predeter ⁇ mined amount thereof, in a PCR buffer to form a first PCR admixture.
  • the admixture is maintained under polynucleo ⁇ tide synthesizing conditions for a time period, which is typically predetermined, sufficient for the formation of a PCR reaction product, thereby producing a gene library containing a plurality of different V H - and/or V L -coding DNA homologs.
  • a plurality of first primer and/or a plurality of second primers can be used in each amplification, e.g., one species of first primer can be paired with a number of second primers to form several different primer pairs. Alternatively, an individual pair of first and second
  • T primers can be used.
  • the amplification products of amplifications using the same or different combinations of first and second primers can be combined to increase the diversity of the gene library.
  • the object is to clone the V H - and/or V L -coding gene from a repertoire by providing a polynucleotide complement of the repertoire, such as the anti-sense strand of genomic dsDNA or the polynucleotide produced by subjecting mRNA to a reverse transcriptase reaction. Methods for producing such complements are well known in the art.
  • the complement is subjected to a primer extension reaction similar to the above-described second primer extension reaction, i.e., a primer extension reaction using a polynucleotide synthesis primer capable to hybridizing to a nucleotide sequence conserved among a plurality of different V H -coding gene complements.
  • the primer extension reaction is performed using any suitable method. Generally it occurs in a buffered aque ⁇ ous solution, preferably at a pH of 7-9, most preferably about 8.
  • a molar excess for genomic nucleic acid, usually about 10 6 :1 primer:template
  • a large molar excess is preferred to improve the efficiency of the process.
  • the deoxyribonucleotide triphosphates dATP, dCTP, dGTP, and dTTP are also admixed to the primer extension (polynucleotide synthesis) reaction admixture in adequate amounts and the resulting solution is heated to about 90 o C-100°C for about 1 to 10 minutes, preferably from 1 to 4 minutes. After this heating period the solution is allowed to cool to room temperature, which is preferable for primer hybridization. To the cooled mixture is added an appropriate agent for inducing or catalyzing the primer extension reaction, and the reaction is allowed to occur under conditions known in the art. The synthesis reaction may occur at from room temperature up to a temperature above which the inducing agent no longer functions effi-
  • ITUTE SHEET ciently if DNA polymerase is used as inducing agent, the temperature is generally no greater than about 40°C.
  • the inducing agent may be any compound or system which will function to accomplish the synthesis of primer extension products, including enzymes. Suitable enzymes for this purpose include, for example, E. coli. DNA poly ⁇ merase I, Klenow fragment of E. coli DNA polymerase I, T4 DNA polymerase, other available DNA polymerases, reverse transcriptase, and other enzymes, including heat-stable enzymes, which will facilitate combination of the nucleo ⁇ tides in the proper manner to form the primer extension products which are complementary to each nucleic acid strand. Generally, the synthesis will be initiated at the 3' end of each primer and proceed in the 5' direction along the template strand, until synthesis terminates, producing molecules of different lengths. There may be inducing agents, however, which initiate synthesis at the 5' end and proceed in the above direction, using the same process as described above.
  • the inducing agent also may be a compound or system which will function to accomplish the synthesis of RNA primer extension products, including enzymes.
  • the inducing agent may be a DNA-dependent RNA polymerase such as T7 RNA polymerase, T3 RNA polymerase or SP6 RNA polymerase. These polymerases produce a complementary RNA polynucleotide. The high turn overrate of the RNA polymerase amplifies the starting polynucleotide as has been described by Chamberlin et al., The Enzymes, ed. P. Boyer, PP. 87-108 ⁇ Academic Press, New York (1982) .
  • T7 RNA polymerase Another advantage of T7 RNA polymerase is that mutations can be introduced into the polynucleotide synthesis by replacing a portion of cDNA with one or more mutagenic oligodeoxynucleotides (polynucleotides) and transcribing the partially-mismatched template directly as has been previously described by Joyce et al. , Nucleic Acid Research. 17:711-722 (1989). Amplification systems based on transcription have been described by Gingeras et al., in PCR Protocols. A Guide to Methods and Applications. PP. 245-252, Academic Press, Inc., San Diego, CA (1990) .
  • the inducing agent is a DNA-dependent RNA polymerase and therefore incorporates ribonucleotide triphosphates
  • sufficient amounts of ATP, CTP, GTP and UTP are admixed to the primer extension reaction admixture and the resulting solution is treated as described above.
  • the newly synthesized strand and its complementary nucleic acid strand form a double-stranded molecule which can be used in the succeeding steps of the process.
  • the first and/or second primer extension reaction discussed above can advantageously be used to incorporate into the multimeric polypeptide a preselected epitope useful in immunologically detecting and/or isolating a multimeric polypeptide. This is accomplished by utilizing a first and/or second polynucleotide synthesis primer or expression vector to incorporate a predetermined amino acid residue sequence into the amino acid residue sequence of the receptor.
  • V H - and/or V L -coding DNA homologs After producing V H - and/or V L -coding DNA homologs for a plurality of different V H - and/or V L -coding genes within the repertoire, the homologs are typically amplified. While the V H and/or V L -coding DNA homologs can be amplified by classic techniques such as incorporation into an auto ⁇ nomously replicating vector, it is preferred to first amplify the DNA homologs by subjecting them to a polymer ⁇ ase chain reaction (PCR) prior to inserting them into a vector. In fact, in preferred strategies, the first and/or second primer extension reactions used to produce the gene library are the first and second primer extension reactions in a polymerase chain reaction.
  • PCR polymer ⁇ ase chain reaction
  • PCR is typically carried out by cycling i.e., simultaneously performing in one admixture, the above described first and second primer extension reactions, each cycle comprising polynucleotide synthesis followed by
  • PCR is carried out by thermocycling i.e., repeatedly increasing and decreasing the temperature of a PCR reaction admixture within a temperature range whose lower limit is about 10°C to about 50"C and whose upper limit is about 90 ⁇ C to about 100"C.
  • the increasing and decreasing can be continuous, but is preferably phasic with time periods of relative temperature stability at each of temperatures favoring polynucelotide synthesis, denaturation and hybridization.
  • only one pair of first and second primers is used per amplification reaction.
  • the amplification reaction products obtained from a plurality of different amplifications, each using a plurality of different primer pairs, are then combined.
  • the present invention also contemplated DNA homolog production via co-amplification (using two pairs of primers) , and multiplex amplification (using up to about 8, 9 or 10 primer pairs).
  • V H - and V L -coding DNA homologs produced by PCR amplification are typically in double-stranded form and have contiguous or adjacent to each of their termini a nucleotide sequence defining an endonuclease restriction site. Digestion of the V H - and V L -coding DNA homologs having restriction sites at or near their termini with one or more appropriate endonucleases results in the produc ⁇ tion of homologs having cohesive termini of predetermined specificity.
  • the PCR process is used not only to amplify the V H - and/or V L -coding DNA homologs of the library, but also to induce mutations within the library and thereby provide a library having a greater heterogeneity.
  • the PCR processes itself is inherently mutagenic due to a variety of factors well known in the art.
  • the PCR reaction admixture i.e., the combined first and second primer extension reaction admixtures
  • the PCR reaction proceeds to produce nucleo ⁇ tide substitutions within the extension product as a result of the scarcity of a particular base.
  • approximately equal molar amounts of the nucleotides can be incorporated into the initial PCR reaction admixture in an amount to efficiently perform X number of cycles, and then cycling the admixture through a number of cycles in excess of X, such as, for instance, 2X.
  • mutations can be induced during the PCR reaction by incor ⁇ porating into the reaction admixture nucleotide deriva ⁇ tives such as inosine, not normally found in the nucleic acids of the repertoire being amplified.
  • the nucleotide derivative will be replaced with a substitute nucleotide thereby inducting a point mutation.
  • a library of dicistronic DNA molecules containing upstream and downstream cistrons operatively linked by a cistronic bridge can be produced by the following steps:
  • first polypeptide genes e.g., V H -coding genes
  • first outside and first inside primers i.e., a first PCR primer pair
  • TITUTE SHEET Hybridizing the first and second primary PCR products to form internally (self) primed duplexes, i.e., duplexes having 3 '-hybridized and 5 '-overhanging termini.
  • V H - and V L -coding gene repertoires are comprised of polynucleotide coding strands, such as mRNA and/or the sense strand of genomic DNA. If the repertoire is in the form of double stranded genomic DNA, it is usually first denatured, typically by melting, into single strands. A repertoire is subjected to a PCR reaction as described in Section 3a hereinabove.
  • the ratio of gene molecules and their respective primers is as follows: about 1 x 10 3 V H gene molecules to about 1 x 10 8 outside V H gene molecules to about 1 x 10 8 outside V H primer molecules, about 1 x 10 3 V H gene molecules, to about 1 x 10 7 inside V H gene primer molecules, about 1 x 10 3 V L gene molecules to about 1 x 10 8 outside V L gene primer molecules, about 1 x 10 4 V L gene molecules to about 1 x 10 7 V L gene primer molecules.
  • 10 4 outside V H gene primer molecules and 10 3 inside V H gene primer molecules are used for every V H gene molecule present in the PCR admixture.
  • 10 4 outside V L gene primer molecules and 10 3 V L gene molecule present in the PCR admixture are typically a 10 fold molar excess of outside primer to inside primer.
  • the gene repertoires are admixed with outside and inside primers, the outside primers being present in excess relative to the inside primers.
  • the initial PCR thermocycles produce intermedi- ate products having complementary termini from each of the first and second gene repertoires. That is, the end of one strand from one primary PCR product is capable of hybridizing with the complementary end from the other primary PCR product.
  • the strands having the overlap at their 3' ends can act as primers for one another, i.e., from an internally primed duplex, and be extended by the polymerase to form the full length final product.
  • the final product is then amplified by the set of outside primers, which act as a third PCR pair when the inside primers have been exhausted, to form a secondary PCR product.
  • the molar ratio of outside primers to inside primers is such that the inside primers are effectively exhausted within about 2 to about 12, preferably about 5, 6 or 7 thermocycles.
  • the PCR buffer also contains the deoxyribonucleotide triphosphates dATP, dCTP, dGTP, and a polymerase, typic ⁇ ally thermostable, all in adequate amounts for primer extension (polynucleotide synthesis) reaction.
  • the resulting solution (PCR admixture) is heated to about 90 ⁇ C - 100°C for about 1 to 10 minutes, preferably from 1 to 4 minutes. After this heating period the solution is allowed to cool to 54°C, which is preferably for primer hybridization.
  • the synthesis reaction may occur at from room temperature up to a temperature above which the poly- merase (inducing agent) no longer functions efficiently. Thus, for example, if DNA polymerase is used as inducing agent, the temperature is generally no greater than about 40°C.
  • An exemplary PCR buffer comprises the following: 50 mM KCl; 10 mM Tris-HCl; pH 8.3; 1.5 mM MgCl 2 ; 0.001% (wt/vol) gelatin, 200 ⁇ M dATP; 200 ⁇ M dTTP; 200 ⁇ M dCTP; 200 ⁇ M dGTP; and 2.5 units Thermus acguaticus DNA poly-
  • the dicistronic DNA molecules are typically further amplified. While the dicistronic DNA molecules can be amplified by classic techniques such as incorporation into an autonomously replicating vector, it is preferred to first amplify the molecules by subjecting them to a polymerase chain reac ⁇ tion (PCR) prior to inserting them into a vector. In fact, in preferred strategies, the first and second PCR reactions are performed in the same admixture that is subject to a multiplicity of PCR thermocycles where the outside primers are in molar excess.
  • PCR polymerase chain reac ⁇ tion
  • the number of PCR thermocycles is at least n+5, wherein n is the number of PCR thermocycles necessary to decrease by a factor of 10, and preferably exhaust, the number of inside primers by consumption in the formation of inside primer- primed products.
  • a diverse library of dicistronic DNA molecules having upstream and downstream cistrons can also be produced by combining, in a PCR buffer, double stranded V H and V L repertoires, V H and V L outside primers, and an inside primer having a 3'-teminal priming portion, a cistronic bridge coding portion, and a 5'-terminal inside primer- template (primer-coding) portion.
  • the 3'-terminal priming portion has a nucleotide base sequence complementary to a portion of the primer extension product of one of the outside primers.
  • the 5'-terminal primer-template portion has a nucleotide base sequence homologous (identical) to a protion of the primer extension product of the other of the outside primers. That is, the linking primer has terminal sequences homologous to sequences in both reper- toires.
  • the cistronic bridge coding portion codes for, either directly or through complementarily, at least one stop codon in the same reading frame as the
  • EET cistron and sequences for the expression of the downstream cistron.
  • the dicistronic DNA molecules containing operatively linked V H - and V L -coding DNA homologs produced by PCR amplification are typically in double-stranded in form and may have contiguous or adjacent to each of their termini a nucleotide sequence defining an endonuclease restriction site. Digestion of the dicistronic DNA molecules having restriction sites at or near their temini with one or more appropriate endonucleases results in the production of DNA molecules having cohesive termini of predetermined specificity.
  • the present invention produces many non-natural occurring antibodies, i.e., combinations of V H and V L in a heterodimer.
  • the present invention also contemplates using fusion PCR to operatively link, and thereby recover, naturally occurring V H and V L combinations.
  • a fusion PCR method is performed on repertoires comprising a plurality of substantially isolated cells containing genes coding for a heterodimeric receptor.
  • a plurality of PCR admixtures is formed, each of which contains (i) a sample of substantially isolated B lymphocytes from a mammal pro ⁇ ducing antibody molecules against a preselected antigen, (ii) a PCR buffer, and (iii) either the previously described V H and V L PCR primer pairs or the set of outside V H and V L PCR primers in combination with the linking primer(s) , also as previously described.
  • the plurality of PCR admixtures is then subjected to a multiplicity of PCR thermocycles as described herein.
  • substantially isolated is meant a sample containing less than about 100 target cells, such as B lymphocytes, T cells, and the like.
  • target cells such as B lymphocytes, T cells, and the like.
  • the plurality of PCR admixtures contain only about
  • BSTITUTE SHEET one cell The cells are typically obtained from an indi ⁇ vidual mammal whose serum contains antibody molecules against the preselcted antigen.
  • the collected cells are typically seeded, usually at densities in the range of 0.5 to 100 cells per unit volume, into a plurality of indi ⁇ vidual PCR vessels, such as microtiter plate wells and the like.
  • the plurality of PCR admixtures is in the range of 800 to 1200, and preferably is about 1000, separate admixtures.
  • fewer cells are needed in each PCR admixture where the cells are obtained from individuals expressing a high serum antibody titer against the pre ⁇ selected antigen.
  • each of about 800 to 1200 individual PCR admixtures need only contain about one B lymphocyte to result in isolation of the desired anti ⁇ body.
  • the circulating B cell frequency is in the range of 1/500,000, a density of about 100 cells per PCR admixture in each of about 800 to 1200 individual PCR admixtures will be needed before the process will result in isolation of the desired antibody.
  • the PCR process is used not only to produce a library of dicistronic DNA molecules, but also to induce mutations within the library or to create diversity from a single parental clone and thereby provide a library having a greater heterogeneity as noted in Section 3a hereinabove.
  • V H - and/or V L -coding DNA homologs contained within the library produced by the above-described method can by operatively linked to a vector for amplification and/or expression.
  • the choice of vector to which a V H - and/or V L -coding DNA homolog is operatively linked depends directly, as is well known in the art, on the functional properties desired, e.g., replication or protein expression, and the host cell to be transformed, these being limitations inherent in the art of constructing recombinant DNA molecules.
  • the vector utilized includes a procaryotic replicon i.e., a DNA seguence having the ability to direct autonomous replication and maintenance of the recombinant DNA molecule extra chromo- somally in a procaryotic host cell, such as a bacterial host cell, transformed therewith.
  • a procaryotic replicon i.e., a DNA seguence having the ability to direct autonomous replication and maintenance of the recombinant DNA molecule extra chromo- somally in a procaryotic host cell, such as a bacterial host cell, transformed therewith.
  • a procaryotic host cell such as a bacterial host cell
  • those embodiments that include a procaryotic replicon also include a gene whose expression confers a selective advantage, such as drug resistance, to a bacterial host transformed therewith.
  • Typical bacterial drug resistance genes are those that confer resistance to ampicillin or tetracycline.
  • Those vectors that include a procaryotic replicon can also include a procaryotic promoter capable of directing the expression (transcription and translation) of the V H - and/or V L -coding homologs in a bacterial host cell, such as E. coli transformed therewith.
  • a promoter is an expression control element formed by a DNA sequence that permits binding of RNA polymerase and transcription to occur. Promoter sequences compatible with bacterial hosts are typically provided in plasmid vectors containing convenience restriction sites for insertion of a DNA segment of the present invention.
  • Typical of such vector plasmids are pUC8, pUC9, pBR322, and pBR329 available from BioRad Laboratories, (Richmond, CA) and pPL and pKK223 available from Pharmacia, (Piscataway, NJ) .
  • Promoters contain two highly conserved regions, one located about 10 bp (-10 region on Priberrow box) and the other about 35 bp (-35 region) upstream from the point at which transcription starts. These two regions typically determine promoter strength. In addition, the number of
  • BSTITUTE SHEET nucleotides atht separate the conserved sequences is important for efficient promoter function. For example, 16 to 19 nucleotides typically separate the -10 and -35 regions, and changes in that psacing can change the efficiency of a promoter.
  • Promoters useful in this invention include Ptac ⁇ 1.1A, ⁇ 1.1B and ⁇ 10, which are recognized by T7 polymerase. See U.S. Patent No. 4,946,786.
  • Useful regulatable promoters include the E. coli lac promoter described in U.S. Patent No. 4,936,786 and the promoters for the temperature sensitive genes in U.S. Patent No. 4,806,471. See also U.S. Patent No. 4,711,845.
  • Eukaryotic cell expression vectors are well known in the art and are available from several commercial sources. Typically, such vectors are provided containing convenient restriction sites for insertion of the desired DNA homologue. Typical of such vectors are pSV L and pKSV- 10 (Pharmacia) , pBPV-l/PML2d (International Biotechnologies, Inc.), and pTDTl (ATCC, No. 31255).
  • the eukaryotic cell expression vectors used include a selection marker that is effective in an eukaryotic cell, preferably a drug resist- ance selection marker.
  • a preferred drug resistance marker is the gene whose expression results in neomycin resist ⁇ ance, i.e., the neomycin phosphotransferase (neo) gene. Southern et al., J. Mol. Appl. Genet., 1:327-341 (1982).
  • the use of retroviral expression vectors to express the genes of the V H and/or V L -coding DNA homologs is also contemplated.
  • the term "retroviral expression vector” refers to a DNA molecule that includes a promoter sequences derived from the long terminal repeat (LTR) region of a retrovirus genome.
  • the expression vector is typically a retroviral expression vector that is prefer ⁇ ably replication-incompetent in eukaryotic cells.
  • complementary cohesive termini can be engineered into the V H - and/or V L -coding DNA homologs during the primer extension reaction by use of an appro ⁇ priately designed polynucleotide synthesis primer, as previously discussed.
  • the vector, and DNA homolog if necessary, is cleaved with a restriction endonuclease to produce termini complementary to those of the DNA homolog.
  • the complementary cohesive termini of the vector and the DNA homolog are then operatively linked (ligated) to produce a unitary double stranded DNA molecule.
  • the V H -coding and V L -coding DNA homologs of diverse libraries are randomly combined in vitro for polycistronic expression from individual vectors. That is, a diverse population of double stranded DNA expression vectors is produced wherein each vector expresses, under the control of a single promoter, one V H - coding DNA homolog and one V L -coding DNA homolog, the diversity of the population being the result of different V H - and V L -coding DNA homolog combinations. Random combination in vitro can be accomplished using two expression vectors distinguished from one another by the location on each of a restriction site common to both.
  • the vectors are linear double stranded DNA, such as a Lambda Zap derived vector as described herein.
  • the site is located between a promo ⁇ ter and a polylinker, i.e., 5' terminal (upstream relative to the direction of expression) to the polylinker by 3' terminal (downstream relative to the direction of expres ⁇ sion) .
  • the polylinker is located between a promoter and the restriction site, i.e., the restriction site is located 3' terminal to the polylinker, and polylinker is located 3' terminal to the promoter.
  • each of the vectors defines a nucleotide sequence coding for a ribosome binding and a leader, the sequence being located between the promoter and the polylinker, but downstream (3' terminal) from the shared restriction site if that site is between the promo ⁇ ter and polylinker. Also preferred are vectors containing a stop codon downstream from the polylinker, but upstream from any shared restriction site if that site is down ⁇ stream from the polylinker.
  • the first and/or second vector can also define a nucleotide seguence coding for a peptide tag.
  • the tag sequence is typically located down ⁇ stream from the polylinker but upstream from any stop codon that may be present.
  • the vectors contain selectable markers such that the presence of a portion of that vector, i.e. a particular lambda arm, can be selected for or selected against.
  • selectable markers are well known to those skilled in the art. Examples of such markers are antibiotic resistance genes, genetically selectable markers, mutation suppressors such as amber suppressors and the like.
  • the selectable markers are typically located upstream of the promoter and/or down ⁇ stream of the second restriction site. In preferred embodiments, one selectable marker is located upstream of the promoter on the first vector containing the V H -coding DNA homologs. A second selectable marker is located down ⁇ stream of the second restriction site on the vector con ⁇ taining the V L -coding DNA homologs.
  • This second selectable marker may be the same or different from the first as long as when the V H -coding vectors and the V L -coding vectors are randomly combined via the first restriction site the resulting vectors containing both V H and V L and both selectable markers can be selected.
  • the polylinker is a nucleotide sequence that defines one or more, preferably at least two, restriction sites, each unique to the vector, i.e., if it is on the first vector, it is not on the second vector.
  • the polylinker restriction sites are oriented to permit ligation of V H - or V L -coding DNA homologs into the vector in same reading frame as any leader, tag or stop codon sequence present. Random combination is accomplished by ligating V H - coding DNA homologs into the first vector, typically at a restriction site or sites within the polylinker. Similarly, V L -coding DNA homologs are ligated into the second vector, thereby creating two diverse populations of expression vectors.
  • V H or V L DNA homologs
  • V H or V L DNA homologs
  • all V H -coding DNA homologs are ligated to either the first of second vector
  • all of the V L -coding DNA homologs are ligated to the other of the first or second vector.
  • the members of both popula ⁇ tions are then cleaved with an endonuclease at the shared restriction site, typically by digesting both populations with same enzyme.
  • the resulting product is two diverse populations of restriction fragments where the members of one have cohesive termini complementary to the cohesive termini of the members of the other.
  • restriction fragments of the two populations are randomly ligated to one another, i.e., a random, interpopulation ligation is performed, to produce a diverse population of vectors each having a V H -coding and V L -coding DNA homolog located in the same reading frame and under the control of second vector's promoter.
  • subsequent recombinations can be effected through cleavage at the shared restriction site, which is typically reformed upon ligation of members from the two populations, followed by subsequent religations.
  • the resulting construct is then introduced into an appropriate host to provide amplification and/or expres ⁇ sion of the V H - and/or V L -coding DNA homologs, either separately or in combination.
  • a functionally active Fv is produced.
  • UBSTITUTE SHEET V H and V L polypeptides are expressed in different organ ⁇ isms, the respective polypeptides are isolated and then combined in an appropriate medium to form a Fv.
  • Cellular hosts into which a V H - and/or V L -coding DNA homolog- containing construct has been introduced are referred to herein as having been "transformed” or as "transformants".
  • the host cell can be either procaryotic or eucary- otic.
  • Bacterial cells are preferred procaryotic host cells and typically are a strain of E. coli such as, for example, the E. coli strain DH5 available from Bethesda Research Laboratories, Inc., Bethesda, MD.
  • Preferred eucaryotic host cells include yeast and mammalian cells, preferably vertebrate cells such as those from a mouse, rat, monkey or human cell line. Transformation of appropriate cell hosts with a recombinant DNA molecule of the present invention is accomplished by methods that typically depend on the type of vector used. With regard to transformation of procary ⁇ otic host cells, see, for example, Cohen et al., Proceedings National Academy of Science, USA Vol. 69, P. 2110 (1972); and Maniatis et al., Molecular Cloning, a Laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1982) .
  • the dicistronic DNA molecules produced by the above- described method can be operatively linked to a vector for amplification and/or expression.
  • EET the primer extension reaction by use of an appropriately designed polynucleotide synthesis primer, as previously discussed.
  • the dicistronic DNA molecule, and vector if necessary, is cleaved with a restriction endonuclease to produce termini complementary to htose of the vector.
  • the complementary cohesive termini of the vector and the dicistronic DNA molecule are then operatively linked (ligated) to produce a unitary double stranded DNA molecule.
  • the present method produces a diverse population of double stranded DNA expression vectors wherein each vector expresses, under the control of a single promoter, one V H - coding DNA homolog and one V L -coding DNA homolog, the diversity of the populuation being the result of different V H - and V L -coding DNA homolog combination that occurs during the PCR reaction where both outside and both inside primers are present in effective amounts.
  • the vectors are linear double stranded DNA, such as a Lambda Zap derived vector as described herein.
  • the vector defines a nucleotide sequence coding for a ribosome binding site and a leader, the sequence being located downstream from a promoter and upstream from a sequence ocding for apoly- peptide leader.
  • the vector contains a selectable marker such that the presence of a dicistronic DNA molecule of this invention inserted into the vector, can be selected.
  • selectable markers are well known to those skilled in the art. Examples of such markers are antibiotic resistance genes, genetically selectable markers, mutation suppressors such as amber supppressors and the like. The selectable markers are typically located upstream of the promoter.
  • the resulting construct is then introduced into an appropriate host to provide amplification and/or expres- sion of the V H - and V L -coding DNA homologs.
  • a functionally active heterodimeric receptor such as an F v , is produced.
  • BSTITUTE SHEET Cellular hosts into which a V H - and V L -coding DNA homolog- containing constructu has been introduced are referred to herein as having been "transformed” or as "transformants".
  • the host cell can be either prokaryotic or eukaryotic.
  • Bacterial cells are preferred prokaryotic host cells for library screening, and typically are a strain of E. coli such as, for example, the E. coli strain DH5 available from Bethesda Research Laboratories, Inc., Bethesda, MD.
  • Preferred eukaryotic host cells include yeast and mammalian cells, preferably vertebrate cells such as those from a mouse, rat, monkey or human cell line.
  • Transformation of appropriate cell hosts with a recombinant DNA molecule of the present invention is accomplished by methods that typically depend on the type of vector used.
  • transformation of prokary ⁇ otic host cells see, for example, Cohen et al., Proc. Natl. Acad. Sci.. USA, 69:2110 (1972); and Maniatis et al., Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY (1982) .
  • transformation of vertebrate cells with retorviral vectors containing rDNAs see for example, Sorge et al., Mol. Cell. Biol.. 4:1730- 1737 (1984); Graham et al., Virol.. 52:456 (1973); and Wigler et al., Proc. Natl. Acad. Sci.. USA, 76:1373-1376 (1979) .
  • V M and/or V L Polypeptides Successfully transformed cells, i.e., cells contain ⁇ ing a V H - and/or V L -coding DNA homolog or a dicistromic DNA molecule operatively linked to a vector, can be identified by any suitable well known technique for detecting the binding of a receptor to a ligand or the presence of a polynucleotide coding for the receptor, preferably its active site.
  • Preferred screening assays are those where the binding of ligand by the receptor produces a detect- able signal, either directly or indirectly. Such signals include, for example, the production of a complex,
  • SHEET formation of a catalytic reaction product the release or uptake of energy, and the like.
  • cells from a population subjected to transformation with a subject rDNA can be cloned to produce monoclonal colonies. Cells form those colonies can be harvested, lysed and their DNA content examined for the presence of the rDNA using a method such as that described Southern, J. Mol. Biol.. 98:503 (1975) or Berent et al., Biotech. 3:208 (1985).
  • V H and/or V L -coding DNA homolog or a dicistronic DNA molecule In addition to directly assaying for the presence of a V H - and/or V L -coding DNA homolog or a dicistronic DNA molecule, successful transformation can be confirmed by well known immunological methods, especially when the V H and/or V L polypeptides produced contain a preselected epitope. For example, samples of cells suspected of being transformed are assayed for the presence of the preselected epitope using an antibody against the epitope.
  • the present invention contemplates a gene library, preferably produced by a primer extension reaction or combination of primer extension reactions as described herein, containing at least about 10 3 , preferably at least about 10 4 and more preferably at least about 10 s different V H - and/or V L - coding DNA homologs.
  • the homologs are preferably in an isolated form, that is, substantially free of materials such as, for example, primer extension reaction agents and/or substrates, genomic DNA segments, and the like.
  • a substantial portion of the homologs present in the library are operatively linked to a vector, preferably operatively linked for expression to an expression vector.
  • the homologs are present in a medium suitable for in vitro manipulation, such as water, water containing buffering salts, and the like.
  • a medium suitable for in vitro manipulation such as water, water containing buffering salts, and the like.
  • the medium should be compatible with maintaining the activity of the homologs.
  • the homologs should be present at
  • STITUTE SHEET a concentration sufficient to allow transformation of a host cell compatible therewith at reasonable frequencies. It is further preferred that the homologs be present in compatible host cells transformed therewith.
  • the present invention also contemplates various expression vectors useful in performing, inter alia, the methods of the present invention.
  • Each of the expression vectors is a novel derivative of Lambda Zap vector.
  • Lambda Zap II is prepared by replacing the Lambda s gene of the vector Lambda Zap with the Lambda S gene from the Lambda gtlO vector, as described in Example 6.
  • Lambda Zap II V is prepared by inserting the synthetic DNA sequences illustrated in Figure 6A into the above-described Lambda Zap II vector.
  • the inserted nucleotide sequence advantageously provides a ribosome binding site (Shine-Dalgarno sequence) to permit proper initiation of mRNA translation into protein, and a leader sequence to efficiently direct the translated protein to the periplasm.
  • the preparation of Lambda Zap II V H is described in more detail in Example 9, and its features illustrated in Figures 6A and 7.
  • Lambda Zap II V L is prepared as described in Example 12 by inserting into Lambda Zap II the synthetic DNA sequence illustrated in Figure 6B. Important features of Lambda Zap II V L are illustrated in Figure 8.
  • Lambda Zap II V L II is prepared as described in Example 11 by inserting into Lambda Zap II the synthetic DNA sequence illustrated in Figure 10.
  • HCFLP is prepared as described in Example 20 by inserting a flp sequence containing EcoRI compatible ends into the EcoRI site of the lambda Zap II V H vector.
  • LCFLP LCFLP is prepared as described in Example 20 by inserting a flp sequence containing EcoRI compatible ends into the EcoRI site of the lambda Zap II V L vector.
  • Lambda ImmunoZAP H is prepared by inserting the synthetic DNA sequences illustrated in Figure 25A into the above-described Lambda Zap II vector.
  • the inserted nucleotide sequence advantageously provides a ribosome binding site (Shine-Dalgarno sequence) to permit proper initiation of mRNA translation into protein, and a leader sequence to effieicntly direct the translated protein to the periplasm.
  • the preparation of Lambda ImmunoZAP H is described in more detail in Example 28, and its features illustrated in Figures [25A] and [26].
  • Modified Lambda ImmunoZAP H is prepared by inserting the modified synthetic DNA sequences illustrated in Figure 8A into the above-described Lambda ZAP II vector. The preparation of modified Lambda ImmunoZAP H and the details of the modifications are described in Example 28B. Its features are illustrated in Figure [24A] and [24B] .
  • Lambda ImmunoZAP L is prepared as described in Example 29 by inserting into Lambda ZAP II the synthetic DNA sequence illustrated in Figure 6B. Important features of Lambda ImmunoZAP L are illustrated in Figure 27.
  • the above-described vectors are compatible with E. coli hosts, i.e. , they can express for secretion into the periplasm proteins coded for by genes to which they have been operatively linked for expression.
  • a combinatorial library selection system was used to generate a diverse collection of clones.
  • This approach utilized two starting populations of lambda phage clones which can be restriction digested, mixed, ligated, and packaged to form a library of clones containing DNA sequences from each of the two populations of parent phage.
  • the following example outlines the method for rapid construction and selection of lambda phage clones containing properties from each of the two parent phage populations derived from lambda WT (cI857 indl, Sam7) and lambda gtll (SamlOO) .
  • the packaged phage library contained a mixture of many lambda phage constructions. In order to select for desired constructions, phenotypic selection was used to identify those members of the library displaying vigorous growth on supE bacterial hosts. As described by Maniatis et al. , supra, dilutions of the phage library was plated with E. coli C600 cells (Stratagene Cloning Systems, San Diego, CA) to generate a lawn of E. coli with isolated lambda plaques. These isolated plaques are result of clonal expansion from a single lambda phage clone.
  • C600 cells are supE, the growth vigor of the individual lambda phage clones could be assessed by the size of the lambda phage plague on the E. coli lawn.
  • the parental WT phage do not form plaques on E. coli C600.
  • At least three classes of phage were identified and subsequently categor ⁇ ized as small, medium, or large plaque size.
  • the large plague size was an indication of vigorous growth on the phage lawn, while small plaque size indicated poor growth. This demonstrates selection for the phenotype of the S gene based on plaque size. Other pehnotypes could be used for selection.
  • UBSTITUTE SHEET (Sam7) or lambda gtll (C5100) parent phage.
  • S2 contained the left arm of lambda WT gene and the right arm of lambda gtll containing the Sami00 gene.
  • This Sa lOO mutation is known to grow poorly on supE hosts and is optimal on a supF strain, with no growth on a supO host.
  • the remaining library of clones displayed several different phenotypes, dictated by the diversity of the two starting populations of phage. Some clones also exhibited phenotypes that resulted from the random assortment of two mutant DNA fragments derived from just one of the parent DNA molecules.
  • THis illustrates the concept that the two genes that give rise to the populations of interest need not be on separate DNA molecules at the start of the method. Due to the phenotypic selection applied following the ligation and packaging of the phage library, the large diversity of these two populations of phage was not com ⁇ pletely analyzed. However, the range of clones identified with alternate S gene phenotypes demonstrated some of this diversity. The diversity in these two populations of lambda phage is believed to be derived from the low level of spontaneous mutations which occur through repeated rounds of replication required in large scale preparations of lambda phage.
  • nucleotide sequences encoding the immunoglobulin protein CDR's are highly variable. However, there are several regions of conserved sequences that flank the V H domains. For instance, contain substantially conserved nucleotide sequences, i.e. , sequences that will hybridize
  • EET to the same primer seguence. Therefore, polynucleotide synthesis (amplification) primers that hybridize to the conserved sequences and incorporate restriction sites into the DNA homolog produced that are suitable for operatively linking the synthesized DNA fragments to a vector were constructed. More specifically, the DNA homologs were inserted into lambda Zap II vector (Stratagene Cloning System, San Diego, CA) at the Xhol and EcoRI sites. For amplification of the V H domains, the 3' primer (primer 67 in Table 7) , was designed to be complementary to the mRNA in the J H region.
  • the 5' primers (primers 56-65,, Table 7) were chosen to be complementary to the first strand cDNA in the conserved N-terminus region (antisense strand) . Initially amplification was performed with a mixture of 32 primers (primer 56, Table 7) that were degenerate at five positions. Hybridoma mRNA could be amplified with mixed primers, but initial attempts to amplify mRNA from spleen yielded variable results. Therefore, several alternatives to amplification using the mixed 5' primers were compared.
  • the first alternative was to construct multiple unique primers, eight of which are shown in Table 7, corresponding to individual members of the mixed primer pool.
  • the individual primers 52-64 of Table 7 were constructed by incorporating either of the two possible nucleotides at three of the five degenerate positions.
  • the second alternative was to construct a primer containing inosine (primer 65, table 7) at four of the variable positions based on the published work of Takahashi, et al., Proc. Natl. Acad. Sci. (U.S.A.), 82:1931-1935, (1985) and Ohtsuka et al., J. Biol. Chem., 260:2605-2608, (1985) .
  • This primer has the advantage that it is not degenerate and, at the same time minimizes the negative effects of mismatches at the unconserved posi- tions as discussed by Martin et al., Nu. Acids Res. , 13:8927 (1985) .
  • V H amplification primers including the unique 3' primer were designed to be complementary to a portion of the first constant region domain of the gamma 1 heavy chain mRNA (Primers 70 and 71, Table 7) . These primers will produce DNA homologs containing polynucleo- tides coding for amino acids from the V H and the first constant region domains of the heavy chain. These DNA homologs can therefore be used to produce Fab fragments rather than an F v .
  • a set of primers hybridizing to a highly conserved region within the constant region IgG, heavy chain gene were constructed.
  • the 5' primer (primer 66, Table 7) is complementary to the cDNA in the C H 2 region whereas the 3' primer (primer 68, Table 7) is complement ⁇ ary to the mRNA in the C H 3 region. It is believed that no mismatches were present between these primers and their templates.
  • the nucleotide sequences encoding the V L CDRs are highly variable. However, there are several regions of conserved sequences that flank the V L CDR domains including the J L , V L framework regions and V L leader/promoter. Therefore, amplification primers that hybridize to the conserved sequences and incorporate restriction sites that allowing cloning the amplified fragments into the pBluescript SK-vector cut with Nco I and Spel were con ⁇ structed.
  • the 3 1 primer (primer 69 in Table 7) , was designed to be comple ⁇ mentary to the mRNA in the J L regions.
  • the 5' primer (primer 70, Table 7) was chosen to be complementary to the first strand cDNA in the conserved N-terminus region (antisense strand) .
  • EET A second set of amplification primers for amplifica ⁇ tion of the V L CDR domains the 5* primers (primers 73-80 in Table 8) were designed to be complementary to the first strand cDNA in the conserved N-terminus region. These primers also introduced a Sac I restriction endonuclease site to allow the FLDNA homolog to be cloned into the V L II- expression vector.
  • the 3' V L amplification primer (primer 81 in Table 8) was designed to be complementary to the mRNA in the J L regions and to introduce the Xbal restric- tion endonuclease site required to insert the V L DNA homolog into the V L II-expression vector ( Figure 8) .
  • Additional 3' V L amplification primers were designed to hybridize to the constant region of either kappa or lambda mRNA (primers 82 and 83 in Table 8) . These primers allow a DNA homolog to be produced containing polynucleo ⁇ tide sequences coding for constant region amino acids of either kappa or lambda chain. These primers make it possible to produce an Fab fragment rather than an F v .
  • the primers used for amplification of kappa light chain sequences for construction of Fabs are shown at least in Table 8. Amplification with these primers was performed in 5 separate reactions, each containing one of the 5' primers (primers 75-78, and 84) and one of the 3' primer (primer 81) has been used to construct F v fragments.
  • the 5' primers contain a Sac I restriction site and the 3 1 primers contain a Xbal restriction site.
  • the primers used for amplification of heavy chain Fd fragments for construction of Fabs are shown at least in Table 7. Amplification was performed in eight separate reactions, each containing one of the 5' primers (primers 57-64) and one of the 3* primers (primer 70) . The remain ⁇ ing 5' primers that have been used for amplification in a single reaction are either a degenerate primer (primer 56) or a primer that incorporates inosine at four degenerate positions (primer 66, Table 7, and primers 89 and 90, Table 8). The remaining 3' primer (primer 86, Table 8) has been used to construct F v fragments. Many of the 5' primers that have been used for amplification in a single reaction are either a degenerate primer (primer 56) or a primer that incorporates inosine at four degenerate positions (primer 66, Table 7, and primers 89 and 90, Table 8). The remaining 3' primer (primer 86, Table 8) has been
  • BSTITUTE SHEET primers incorporate a Xho I site, and 3' primers include a Spel restriction site.
  • V L amplification primers designed to amplify human light chain variable regions of both the lambda and kappa isotypes are also shown in Table 8.
  • Fluorescein isothiocyanate was selected as a ligand for receptor binding. It was further decided to enrich by immunization the immunological gene repertoire, i.e., V H - and V L -coding gene repertoires, for genes coding for anti-FITC receptors. This was accomplished by linking FITC to keyhole limpet hemocyanin (KLH) using the tech ⁇ niques described in Antibodies A Laboratory Manual, Harlow and Lowe, eds., Cold Spring Harbor, New York, (1988).
  • KLH keyhole limpet hemocyanin
  • the KLH-FITC conjugate was prepared for injunction into mice by adding 100 ⁇ g of the conjugate to 250 ⁇ l of phosphate buffered saline (PBS) . An equal volume of com ⁇ plete Freund's adjuvant was added and the entire solution was emulsified for 5 minutes. A 129 G I ⁇ + mouse was injected with 300 ⁇ l of the emulsion. Injections were given subcutaneously at several sites using a 21 gauge needle. A second immunization with KLH-FITC was given two week later.
  • PBS phosphate buffered saline
  • This injection was prepared as follows: fifty ⁇ g of KLH-FITC were diluted in 250 ⁇ L of PBS and an equal volume of alum was admixed to the KLH-FITC solution. The mouse was injected intraperitoneally with 500 ⁇ l of the solution using a 23 gauge needle. One month later the mice were given a final injection of 50 _g of the KLH- FITC conjugate diluted to 200 _L in PBS. This injection was given intravenously in the lateral tail vein using a 30 gauge needle. Five days after this final injection the mice were sacrificed and total cellular RNA was isolated from their spleens. Hybridoma PCP 8D11 producing an antibody immuno- specific for phosphonate ester was cultured in DMEM media (Gibco Laboratories, Grand Island, New York) containing 10
  • EET percent fetal calf serum supplemented with penicillin and streptomycin was prepared from these isolated hybridoma cells.
  • Total cellular RNA was prepared from the spleen of a single mouse immunized with KLH-FITC as described in Example 3 using the RNA preparation methods described by Chomczynski et al., Anal Biochem.. 162:156-159 (1987) using the manufacturer's instructions and the RNA isola ⁇ tion kit produced by Stratagene Cloning Systems, La Jolla, CA. Briefly, immediately after removing the spleen from the immunized mouse, the tissue was homogenized in 10 ml of a denaturing solution containing 4.0 M guanine isothio- cyanate, 0.25 M sodium citrate at pH 7.0, and 0.1 M 2- mercaptoethanol using a glass homogenizer.
  • the solution was centrifuged at 10,000 x g for 20 minutes at 4°C.
  • the upper RNA-containing aqueous layer was transferred to a fresh 50 ml polypropylene centrifuge tube and mixed with an equal volume of isopropyl alcohol. This solution was maintained at -20°C for at least one hour to precipitate the RNA.
  • the solution containing the precipi ⁇ tated RNA was centrifuged at 10,000 x g for twenty minutes at 4°C. The pelleted total cellular RNA was collected and dissolved in 3 ml of the denaturing solution described
  • UBSTITUTE SHEET above. Three ml of isopropyl alcohol was added to the resuspended total cellular RNA and vigorously mixed. This solution was maintained at -20°C for at least 1 hour to precipitate the RNA. The solution containing the precipi- tated RNA was centrifuged at 10,000 x g for ten minutes at 4°C. The pelleted RNA was washed once with a solution containing 75% ethanol. The pelleted RNA was dried under vacuum for 15 minutes and then resuspended to dimethyl pyrocarbonate (DEPC) treated H 2 0 (DEPC-H 2 0) .
  • DEPC dimethyl pyrocarbonate
  • RNA messenger RNA (mRNA) enriched for sequences contain ⁇ ing long poly A tracts was prepared from the total cellular RNA using methods described in Molecular Cloning A Laboratory Manual. Maniatias et al., eds. Cold Spring Harbor Laboratory, New York, (1982) . Briefly, one half of the total RNA isolated from a single immunized mouse spleen prepared as described above was resuspended in one ml of DEPC-H 2 0 and maintained at 65"C for five minutes.
  • the eluate was collected in a sterile polypropylene tube and reapplied to the same column after heating the eluate for 5 minutes at 65°C.
  • the oligo dT column was then washed with 2 ml of high salt loading buffer consisting of 50 mM Tris-HCl at pH 7.5, 500 mM sodium chloride, 1 mM EDTA at pH 7.5 and 0.1% SDS.
  • the oligo dT column was then washed with 2 ml of 1 X medium salt buffer consisting of 50 mM Tris-HCl at pH 7.5, 100 mM sodium chloride 1 mM EDTA and 0.1% SDS.
  • the messenger RNA was eluted from the oligo dT column with l l of buffer consisting of 10 mM Tris-HCL at pH 7.5, 1 mM
  • HEET EDTA at pH 7.5 and 0.05% SDS.
  • the messenger RNA was puri ⁇ fied by extracting this solution with phenol/chloroform followed by a single extraction with 100% chloroform.
  • the messenger RNA was concentrated by ethanol precipitation and resuspended in DEPC- H 2 0.
  • the messenger RNA isolated by the above process contains a plurality of different V H coding polynucleo- tides, i.e., greater than about 10 4 different V H -coding genes.
  • Polynucleotides coding for a single V H were isolated according to Example 4 except total cellular RNA was extracted from monoclonal hybridoma cells prepared in Example 3. The polynucleotides isolated in this manner code for a single V H .
  • mRNA prepared according to the above examples was used as a template for cDNA synthesis by a primer extension reaction.
  • 5-10 ug of spleen or hybridoma mRNA in water was first hybridized (annealed) with 500 ng (50.0 pmol) of the 3' V H primer (primer 67, Table 7), at 65°C for five minutes. Subsequently, the mixture was adjusted to 1.5 mM dATP, dCTP, dGTP and dTTP, 40 mM Tris-HCl at pH 8.0, 8 mM MgCl 2 , 50 mM NaCl, and 2 mM spermidine. Moloney-Murine Leukemia virus Reverse transcriptase (Stratagene Cloning Systems) , 26 units, was added and the solution was maintained for 1 hours at 37°C.
  • PCR amplification was performed in a 100 ul reaction containing the products of the reverse transcription reaction (approximately 5 ug of the cDNA/RNA hybrid) , 300 ng of 3' V H primer (primer 67 of Table 7), 300 ng each of the 5' V H primers (primer 57-65 of Table 7) 200 mM of a mixture of dNTP's, 50 mM KCl, 10 mM Tris-HCl pH 8.3, 15 mM MgCl 2 , 0.1% gelatin and 2 units of Tag DNA polymerase.
  • the reverse transcription reaction approximately 5 ug of the cDNA/RNA hybrid
  • 300 ng of 3' V H primer primer 67 of Table 7
  • 300 ng each of the 5' V H primers primer 57-65 of Table 7
  • 200 mM of a mixture of dNTP's 50 mM KCl, 10 mM Tris-HCl pH 8.3, 15 mM MgCl 2 , 0.1%
  • BSTITUTE SHEET reaction mixture was overlaid with mineral oil and sub ⁇ jected to 40 cycles of amplification. Each amplification cycle involved denaturation at 92 ⁇ C for 1 minute, anneal ⁇ ing at 52°C for 2 minutes and polynucleotide synthesis by Primer extension (elongation) at 72°C for 1.5 minutes.
  • the amplified V H -coding DNA homolog containing samples were extracted twice with phenol/chloroform, once with chloro ⁇ form, ethanol precipitated and were stored at -70°C in 10 mM Tris-HCl, (pH, 7.5) and 1 mM EDTA.
  • V H -coding DNA homolog synthesis and amplification from the spleen mRNA was achieved as shown in Figure 3, lanes R17- R24.
  • the amplified cDNA (V H -coding DNA homolog) is seen as a major band of the expected size (360 bp) .
  • the intensi- ties of the amplified V H -coding polynucleotide fragment in each reaction appear to be similar, indicating that all of these primers are about equally efficient in initiating amplification. The yield and quality of the amplification with these primers was reproducible.
  • the primer containing inosine also synthesized ampli ⁇ fied V H -coding DNA homologs from spleen mRNA reproducibly, leading to the production of the expected sized fragment, of an intensity similar to that of the other amplified cDNAs ( Figure 4, lane R16) .
  • This result indicated that the presence of inosine also permits efficient DNA homolog synthesis and amplification.
  • DNA homologs of the V L were prepared from the purified mRNA prepared as described above.
  • mRNA prepared according to the above examples was used as a template for cDNA synthesis.
  • 5-10 ug of spleen or hybridoma mRNA in water was first annealed with 300 ng (50.0 pmol) of the 3' V L primer (primer 69, Table 7), at 65"C for five minutes. Subsequently, the mixture was adjusted to 1.5 mM dATP, dCTP, dGTP, and dTTP, 40 mM Tris-
  • HCL HCL at pH 8.0, 8 mM MgCl 2 , 50 mM NaCl, and 2 mM spermidine.
  • the PCR amplification was performed in a 100 ul reaction contain ⁇ ing approximately 5 ug of the cDNA/RNA hybrid produced as described above, 300 ng of the 3' V L primer (primer 69 of Table 7), 300 ng of the 5* V L primer (primer 70 of Table 7), 200 mM of a mixture of dNTP's, 50 mM KCl, 10 mM Tris- HCl pH 8.3, 15 mM MgCl 2 , 0.1% gelatin and 2 units of Taq DNA polymerase. The reaction mixture was overlaid with mineral oil and subjected to 40 cycles of amplification.
  • Each amplification cycle involved denaturation at 92"C for 1 minute, annealing at 52°C for 2 minutes and elongation at 72"C for 1.5 minutes.
  • the amplified samples were extracted twice with phenol/chloroform, once with chloro ⁇ form, ethanol precipitated and were stored at 70°C in 10 mM Tris-HCl at pH 7.5 and 1 mM EDTA.
  • PCR amplified products 2.5 mg/30 ul of 150 mM NaCl, 8 mM Tris-HCl (pH 7.5), 6 MM MgSo 4 , 1 mM DTT, 200 mg/ml bovine serum albumin (BSA) at 37°C were digested with restriction enzymes Xho I (125 units) and EcoR I (10 U) and purified on a 1% agarose gel.
  • restriction enzymes Xho I 125 units
  • EcoR I EcoR I
  • SUBSTITUTE SHEET ments which required a mixture of the products of the amplification reactions, equal volumes (50 ul, 1-10 ug concentration) of each reaction mixture were combined after amplification but before restriction digestion. After gel electrophoresis of the digested PCR amplified spleen mRNA, the region of the gel containing DNA frag ⁇ ments of approximately 350 bps was excised, electroeluted into a dialysis membrane, ethanol precipitated and resus ⁇ pended in 10 mM Tris-HCl pH 7.5 and 1 mM EDTA to a final concentration of 10 ng/ul.
  • Lambda Zap II is a derivative of the original Lambda Zap (ATCC # 40,298) that maintains all of the characteristics of the original Lambda Zap including 6 unique cloning sites, fusion protein expres ⁇ sion, and the ability to rapidly excise the insert in the form of a phagemid (Bluescript SK-) , but lacks the SAM 100 mutation, allowing growth on many Non-Sup F strains, including XLl-Blue.
  • the Lambda Zap II was constructed as described in Short et al., Nucleic Acids Res..
  • PCR amplified products In preparation of cloning a library enriched in V L sequences, 2 ug of PCR amplified products (2.5 mg/30 ul of 150 mM NaCl, 8 mM Tris-HCl (pH 7.5), 6 mM MgSo 4 , 1 mM DTT, 200 mg/ml BSA) were digested with restriction enzymes Nco I (30 unites) and Spe I (45 units) at 37 ⁇ C for 2 hours. The digested PCR amplified products were purified on 1% agarose gel using standard electroelution technique des ⁇ cribed in Molecular Cloning A Laboratory Manual. Maniatis et al., eds., Cold Spring Harbor, New York, (1982).
  • the region of the gel containing the V L - coding DNA fragment of the appropriate size was excised, electroelution into a dialysis membrane, ethanol precipi ⁇ tated and resuspended at a final concentration of 10 ng per ml in a solution containing 10 mM Tris-HCL at pH 7.5 and 1 mM EDTA.
  • An equal molar amount of DNA representing a plurality of different V L -coding DNA homologs was ligated to a pBluescript SK- phagemid vector that had been previously cut with Nco I and Spe I.
  • a portion of the ligation mix ⁇ ture was transformed using the manuf cturer's instructions into Epicuian Coli XLl-Blue competent cells (Stratagene Cloning Systems, La Jolla, CA) .
  • the transformant library was determined to consist of 1.2 x 10 3 colony forming units/ug of V L homologs with less than 3% non-recombinant background.
  • phage plaques were cored from the agar plates and transferred to sterile microfuge tubes containing 500 ul a buffer containing 50 mM Tris-HCL at pH
  • Clones were first screened for DNA inserts by restriction digests with either Pvu II or Bgl I and clones containing the putative V H insert were sequenced using reverse transcriptase according to the general method described by Sanger et al., Proc. Natl. Acad. Sci., USA. 74:5463-5467, (1977) and the specific modifications of this method provided in the manufacturer's instruction in the AMV reverse transcript ⁇ ase 35 S-dATP sequencing kit from Stratagene Cloning Systems, La Jolla, CA.
  • the clones exhibited from 80 to 90% homology with sequences of known heavy chain origin and little homology with sequences of light chain origin when compared with the sequences available in Sequences of Proteins of Immunological Interest by Kabot et al., 4th ed. , U.S. Dept. of Health and Human Sciences, (1987) . This demonstrated that the library was enriched
  • E SHEET for the desired V H sequence in preference to other sequences, such as light chain sequences.
  • Mouse V H sequences are classified into eleven subgroups ( Figure 5) .
  • Mouse V H sequences are classified into eleven subgroups [I (A,B,), II (A,B,C) , III (A,B,C,D( V (A,B)] based on framework amino acid sequences described in Sequences of proteins of Immunological Interest by Kabot et al., 4th ed. , U.S. Dept. of Health and Human Sciences, (1987); Dildrop, Immunology Today, 5:84, (1984); and Brön et al., Eur. J. Immunol.. 14:922, (1984).
  • Bacteriophage lambda was selected as the expression vector for three reasons. First, m vitro packaging of phage DNA is a highly efficient method of reintroducing DNA into host cells. Second, it is possible to detect protein expres ⁇ sion at the level of single phage plagues. Finally, the screening of phage libraries typically involve less difficulty with nonspecific binding.
  • SUBSTITUTE SHEET plasmid cloning vectors are only advantageous in the analysis of clones after they have been identified. This advantage is not lost in the present system because of the use of lambda Zap, thereby permitting a plasmid containing the heavy chain, light chain, or Fab expressing inserts to be excised.
  • V H -coding DNA homologs To express the plurality of V H -coding DNA homologs in an E. coli host cell, a vector was constructed that placed the V H -coding DNA homologs in the proper reading frame, provided a ribosome binding site as described by Shine et al., Nature, 254:34, 1975, provided a leader sequence directing the expressed protein to the periplasmic space, provided a polynucleotide sequence that coded for a known epitope (epitope tag) and also provided a polynucleotide that coded for a spacer protein between the V H -coding DNA homolog and the polynucleotide coding for the epitope tag.
  • epitope tag epitope
  • a synthetic DNA sequence containing all of the above polynucleotides and features was constructed by designing single stranded polynucleotide segments of 20-40 bases that would hybridize to each other and form the double stranded synthetic DNA sequence shown in Figure 6.
  • the individual single-stranded polynucleotides (N1-N12) are shown in Table 9.
  • Polynucleotides N2, N3, N9-4' , Nil, N10-5', N6, N7 and N8 were kinased by adding 1 ul of each polynucleotide (0.1 ug/ul) and 20 units of T4 polynucleotide kinase to a solution containing 70 mM Tris-HCl at pH 7.6, 10 mM MgCl 2 5 mM DTT, 10 mM 2-mercaptoethanol (2ME) , 500 micrograms per ml of BSA. The solution was maintained at 37°C for 30 minutes and the reaction stopped by maintaining the solu ⁇ tion at 65°C for 10 minutes.
  • EET a 500 ml beaker of water. During this time period all 10 polynucleotides annealed to form the double stranded synthetic DNA insert shown in Figure 6A. The individual polynucleotides were covalently linked to each other to stabilize the synthetic DNA insert by adding 40 ul of the above reaction to a solution containing 50 mM Tris-HCl at pH 7.5, 7 mM MgCl 2 , 1 mM DTT, 1 mM adenosine triphosphate
  • the ligation mixture was packaged according to the manufacture's instructions using Gigapack II Gold packing extract available from Stratagene Cloning Systems, La Jolla, CA.
  • the packaged ligation mixture was plated on XL1 blue cells (Stratagene Cloning Systems, San Diego, CA) .
  • Individual lambda Zap II plaques were cored and the inserts excised according to the in vivo excision protocol provided by the manufacturer, Stratagene Cloning Systems, La Jolla, CA. This in vivo excision protocol moves the cloned insert from the lambda Zap II vector into a plasmid vector to allow easy manipulation and sequencing.
  • V L Expression Vector Construction To express the plurality of V L coding polynucleotides in an E. coli host cell, a vector was constructed that placed the V L coding polynucleotide in the proper reading frame, provided a ribosome binding site as described by Shine et al., Nature . 254:34, (1975), provided a leader sequence directing the expressed protein to the piro- plas ic space and also provided a polynucleotide that coded for a spacer protein between the V L polynucleotide and the polynucleotide coding for the epitope tag.
  • a synthetic DNA seguence containing all of the above poly- nucleotides and features was constructed by designing single stranded polynucleotide segments of 20-40 bases that would hybridize to each other and form the double stranded synthetic DNA sequence shown in Figure 6B.
  • the individual single-stranded polynucleotides (N1-N8) are shown in Table 9.
  • Polynucleotides N2, N3, N4, N6, N7 and N8 were kinased by adding 1 ul of each polynucleotide and 20 units of T4 polynucleotide kinase to a solution containing 70 mM Tris-HCL at pH 7.6, 10 mM MgCl 2 , 5 mM DTT, 10 mM 2ME, 500 micrograms per ml of BSA. The solution was maintained at 37°C for 30 minutes and the reaction stopped by maintain-
  • the individual polynucleotides were covalently linked to each other to stabilize the synthetic DNA insert with adding 40 ul of the above reaction to a solution containing 50 ul Tris- HCL at pH 7.5, 7 mM MgCl 2 , 1 mM DTT, 1 mM ATP and 10 units to T4 DNA ligase.
  • This solution was maintained at 37°C for 30 minutes and then the T4 DNA ligase was inactivated by maintaining the solution at 65°C for 10 minutes.
  • the end polynucleotides were kinased by mixing 52 ul of the above reaction, 4 ul of a solution recontaining 10 mM ATP and 5 units of T4 polynucleotide kinase.
  • the completed synthetic DNA insert was ligated directly into a lambda Zap II vector that had been previously digested with the restric ⁇ tion enzymes Not I and Xho I.
  • the ligation mixture was packaged according to the manufacture's instructions using Gigapack II Gold packing extract available from Stratagene Cloning Systems, La Jolla, CA.
  • the packaged ligation mixture was plated on XLl-Blue cells (Stratagene Cloning Systems, La Jolla, CA) .
  • UBSTITUTE SHEET allow easy manipulation and sequencing and also produces the phagemid version of the V L expression vectors.
  • the accuracy of the above cloning steps was confirmed by sequencing the insert using the Sanger dideoxide method described by Sanger et al., Proc. Natl. Acad. Aci. USA. 24:5463-5467, (1977) and using the manufacturer's instruc ⁇ tions in the AMV reverse transcriptase 35 S-dATP sequencing kit from Stratagene Cloning Systems, La Jolla, CA.
  • the sequence of the resulting V L expression vector is shown in Figure 6 and Figure 8.
  • the V L expression vector used to construct the V L library was the phagemid produced to allow the DNA of the V L expression vector to be determined.
  • the phagemid was produced, as detailed above, by the in vivo excision process from the Lambda Zap V L expression vector ( Figure 8) .
  • the phagemid version of this vector was used because the Nco I restriction enzyme site is unique in this version and thus could be used to operatively linked the V L DNA homologs into the expression vector.
  • V L -coding DNA homologs To express the plurality of V L -coding DNA homologs in an E. coli host cell, a vector was constructed that placed the V L -coding DNA homologs in the proper reading frame, provided a ribosome binding site as described by Shine et al., Nature, 254:34, 1975, provided the Pel B gene leader seguence that has been previously used to successfully secrete Fab fragments in E. coli by Lei et al., J. Bac. , 169:4379 (1987) and Better et al., Science. 240:1041 (1988) , and also provided a polynucleotide containing a restriction endonuclease site for cloning.
  • a synthetic DNA seguence containing all of the above polynucleotides and features was constructed by designing single stranded polynucleotide segments of 20-60 bases that would hybrid ⁇ ize to each other and form the double stranded synthetic DNA sequence shown in Figure 10. The sequence of each individual single-stranded polynucleotides (01-08) within
  • Polynucleotides 02, 03, 04, 05, 06 and 07 were kinased by adding 1 ul (0.1 ug/ul) of each polynucleotide and 20 units of T4 polynucleotide kinase to a solution containing 70 mM Tris-HCL at pH 7.6, 10 mM magnesium chloride (MgCl) , 5 mM dithiothreitol (DTT) , 10 mM 2- mercaptoethanol (2ME) , 500 micrograms per ml of bovine serum albumin. The solution was maintained at 37°C for 30 minutes and the reaction stopped by maintaining the solution at 65°C for 10 minutes.
  • MgCl magnesium chloride
  • DTT dithiothreitol
  • 2ME 2- mercaptoethanol
  • the individual polynucleotides were covalently linked to each other to stabilize the synthetic DNA insert by adding 40 ul of the above reaction to a solution containing 50 ml Tris-HCl at pH 7.5, 7 ml MgCl, 1 mm DTT, 1 mm ATP and 10 units of T4 DNA ligase. This solution was maintained at 37"C for 30 minutes and then the T4 DNA ligase was inactivated by maintaining the solution at 65°C for 10 minutes.
  • the end polynucleotides were kinased by mixing 52 ul of the above reaction, 4 ul of a solution containing 10 mM ATP and 5 units of T4 polynucleotide kinase.
  • the packaged ligation mixture was plated on XL1 blue cells (Stratagene Cloning Systems, San Diego, CA) .
  • Individual lambda Zap II plaques were cored and the inserts excised according to the in vivo excision protocol provided by the manufac ⁇ turer, Stratagene Cloning Systems, La Jolla, CA. This in vivo excision protocol moves the cloned insert from the lambda Zap II vector into a plasmid vector to allow easy manipulation and sequencing.
  • DNA homologs enriched in V H sequences were prepared according to Example 7 using the same set of 5' primers but with primer 62A (Table 7) as the 3' primer. These . homologs were then digested with the restriction enzymes Xho I and Spe I and purified on a 1% agarose gel using the standard electroelution technique described in
  • V H DNA homologs were then directly inserted into the V H expression vector that had been previously digested with Xho I and Spe I.
  • the ligation mixture containing the V H DNA homologs were packaged according to the manufacturers specifica ⁇ tions using Gigapack Gold II Packing Extract (Stratagene Cloning Systems, La Jolla, CA) .
  • the expression libraries were then ready to be plated on XL-1 Blue cells.
  • V L DNA homologs were digested with restriction enzymes Nco I and Spe I.
  • the digested V L DNA homologs were purified on a 1% agarose gel using standard electrelusion techniques described in Molecular Cloning A Laboratory Manual, Maniatis et al., eds., Cold Spring Harbor, NY (1982) .
  • the prepared V L DNA homologs were directly inserted into the V L expression vector that had been previously digested with the restriction enzymes Nco I and Spe I.
  • the ligation mixture containing the V L DNA homologs were transformed into XL-1 blue competent cells using the manufacturer's instructions (Stratagene Cloning Systems, La Jolla, CA) .
  • PCR amplified products (2.5 ug/30 ul of 150 mM NaCl, 8 mM Tris-HCl (pH 7.5), 6 mM MgCl 4 , 1 mM DTT, 200 ug/ml BSA at 37"C were digested with restriction enzymes Sac I (125 units) and Xba I (125 units) and purified on a 1% agarose gel.
  • restriction enzymes Sac I 125 units
  • Xba I 125 units
  • the V L II-expression DNA vector was prepared for cloning by admixing 100 ug of this DNA to a solution containing 250 units each of the restriction endonucleases Sac 1 and Xba 1 (both from Boehringer Mannheim, Indianapolis, IN) and a buffer recommended by the manu ⁇ facturer. This solution was maintained at 37°C for 1.5 hours. The solution was heated at 65°C for 15 minutes to inactivate the restriction endonucleases. The solution was chilled to 30 ⁇ C and 25 units of heat-killable (HK) phosphatase (Epicenter, Madison, WI) and CaCl 2 were admixed to it according to the manufacturer's specifications. This solution was maintained at 30"C for 1 hour. The DNA was purified by extracting the solution with a mixture of phenol and chloroform followed by ethanol precipitation. The V L II expression vector was now ready for ligation to the V L DNA homologs prepared in the above examples.
  • V L homolog enriched in V L sequences were prepared according to Example 6 but using a 5' light chain primer and 3' light chain primer shown in Table 9. Individual amplification reactions were carried out using each 5' light chain primer in combination with the 3 ' light chain primer. These separate V L homolog-containing reaction mixtures were mixed and digested with the restriction endonucleases Sac 1 and Xba 1 according to Example 7. The V L homologs were purified on a 1% agarose gel using the standard electroelution technique described in Molecular Cloning A Laboratory Manual, Maniatis et al., eds., Cold Spring Harbor, New York, (1982) . These prepared V L DNA homologs were then directly inserted into the Sac 1 - Xba cleaved V L II-expression vector that was prepared above by ligating 3 moles of V L DNA homolog inserts with each mole
  • V L II-expression library prepared in Example 13 was amplified and 500 ug of V L II-expression library phage DNA prepared from the amplified phage stock using the proce- dures described in Molecular Cloning: A Laboratory Manual, Maniatis et al., eds., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1982) , 50 ug of this V L II-expression library phage DNA was maintained in a solution containing 100 units of Lul restriction endo- nuclease (Boehringer Mannheim, Indianapolis, IN) in 200 ul of a buffer supplied by the endonuclease manufacturer for 1.5 hours at 37 ⁇ C. The solution was then extracted with a mixture of phenol and chloroform.
  • Lul restriction endo- nuclease Boehringer Mannheim, Indianapolis, IN
  • the DNA was then ethanol precipitated and resuspended in 100 ul of water.
  • This solution was admixed with 100 units of the restric ⁇ tion endonuclease EcoR I (Boehringer Mannheim, Indianapolis, IN) in a final volume of 200 ul of buffer containing the components specified by the manufacturer. This solution was maintained at 37 ⁇ C for 1.5 hours and the solution was then extracted with a mixture of phenol and chloroform.
  • the DNA was ethanol precipitated and the DNA resuspended in TE.
  • V H expression library prepared in Example 13 was amplified and 500 ug of V H expression library phage DNA prepared using the methods detailed above. 50 ug of the V H expression library phage DNA was maintained in a solu ⁇ tion containing 100 units of Hind III restriction endo ⁇ nuclease (Boehringer Mannheim, Indianapolis, IN) in 200 ul of a b ⁇ ffer supplied by the endonuclease manufacturer for 1.5 hours at 37°C. The solution was then extracted with a mixture of phenol and chloroform saturated with 0.1
  • the restriction digested V H and V L II-expression Libraries were ligated together.
  • the ligation reaction consisted of 1 ug of V H and 1 ug of V L II phage library DNA in a 10 ul reaction using the reagents supplied in a liga- tion kit purchased from Stratagene Cloning Systems (La Jolla, CA) .
  • a liga- tion kit purchased from Stratagene Cloning Systems (La Jolla, CA) .
  • 1 ul of the ligated the phage DNA was packaged with Gigapack Gold II packaging extract and plated on XL 1-blue cells prepared according the manufacturer's instructions. A portion of the 3X10 6 clones obtained were used to determine the effectiveness of the combination.
  • the resulting V H and V L expression vector is shown in Figure 11.
  • Clones containing both V H and V L were excised from the phage to pBluescript using the in vitro excision protocol described by Short et al.. Nucleic Acid Research. 16L7583- 7600 (1988) . Clones chosen for excision expressed the decapeptide tag and did not cleave X-gal in the presence of 2mM IPTG, thus remaining white. Clones with these characteristics represented 30% of the library. 50% of the clones chosen for excision contained a V H and V L as determined by restriction analysis.
  • SHEET was 15% of the library indicating that the process of combination was very efficient.
  • the titre of the V H expression library prepared according to Example 12 was determined. This library titration was performed using methods well known to one skilled in the art. Briefly, serial dilutions of the library were made into a buffer containing 100 mM NaCl, 50 mM Tris-HCL at pH 7.5 and 10 mM MgCl 4 , 5 g/L yeast extract, 10 g/L NZ amine (casein hydrolysate) and 0.7% melted, 50°C agarose.
  • the phage, the bacteria and the top agar were mixed and then evenly distributed across the surface of a prewarmed bacterial agar plate (5 g/L NaCl, 2 g/L MgCl 4 , 5 g/L yeast extract, 10 g/L NZ amine (casein hydrolysate) and 15 g/L Difco agar.
  • the plates were maintained at 37"C for 12 to 24 hours during which time period the lambda plaques developed on the bacterial lawn. The lambda plaques were counted to determine the total number of plaque forming units per ml in the original library.
  • the titred expression library was then plated out so that replica filters could be made from the library.
  • the replica filters will be used to later segregate out the individual clones in the library that are expressing the antigens binding proteins of interest.
  • a volume of the titred library that would yield 20,000 plaques per 150 millimeter plate was added to 600 ul of exponentially growing E. coli cells and maintained at 37°C for 15 min ⁇ utes to allow the phage to absorb to the bacterial cells.
  • the 7.5 ml of top agar was admixed to the solution containing the bacterial cells and the absorbed phage and the entire mixture distributed evenly across the surface of a prewarmed bacterial agar plate. This process was repeated for a sufficient number of plates to plate out a
  • IPTG isopropyl-beta-D-thiogalactopyanoside
  • nitrocellulose filters were removed with forceps and washed once in a TBST solution containing 20 mM Tris-HCl at pH 7.5, 150 mM NaCl and 0.05% monolaurate (tween-20) .
  • a second nitrocellulose filter that had also been soaked in a solution containing 10 mM IPTG was reapplied to the bacterial plates to produce duplicate filters.
  • the filters were further washed in a fresh solution of TBST for 15 minutes. Filters were then placed in a blocking solution consisting 20 mM Tris-HCl at pH 7.5, 150 mM NaCl and 1% BSA and agitated for 1 hour at room temperature.
  • the nitrocellulose filters were trans ⁇ ferred to a fresh blocking solution containing a 1 to 500 dilution of the primary antibody and gently agitated for at least 1 hour at room temperature. After the filters were agitated in the solution containing the primary antibody the filters were washed 3 to 5 times in TBST for 5 minutes each time to remove any of the residual unbound primary antibody. The filters were transferred into a solution containing fresh blocking solution and a 1 to 500 to a 1 to 1,000 dilution of alkaline phosphatase conju- gated secondary antibody. The filters were gently agitated in the solution for at least 1 hour at room temperature. The filters were washed 3 to 5 times in a solution of TBST for at least 5 minutes each time to remove any residual unbound secondary antibody. The filters were washed once in a solution containing 20 mM Tris-HCl at pH 7.5 and 150 mM NaCl. The filters were removed from this solution and excess moisture blotted
  • HEET from them with filter paper.
  • the color was developed by placing the filter in a solution containing 100 mM Tris- HCl at pH 9.5, 100 mM NaCl, 5 mM MgCl 2 , 0.3 mg/ml of nitro Blue Tetrazolium (NBT) and 0.15 mg/ml of 5-bromo-4-chloro- 3-indolyl-phosphate (BCIP) for at least 30 minutes at room temperature.
  • NBT nitro Blue Tetrazolium
  • BCIP 5-bromo-4-chloro- 3-indolyl-phosphate
  • the residual color development solution was rinsed from the filter with a solution containing 20 mM Tris-HCl at pH 7.5 and 150 mM NaCl.
  • the filter was then placed in a stop solution consisting of 20 mM Tris-HCl at pH 2.9 and 1 mM EDTA.
  • the filters are used to locate the phage plaque that produced the desired protein. That phage plaque is segregated and then grown up for further analysis.
  • Several different combinations of primary antibodies and second antibodies were used.
  • the first combination used a primary antibody immunospecific for a decapeptide that will be expressed only if the V H antigen binding protein is expressed in the proper reading frame to allow read through translation to include the decapeptide epi ⁇ tope covalently attached to the V H antigen binding protein.
  • This decapeptide epitope and an antibody immunospecific for this decapeptide epitope was described by Green et al. , Cell 28:477 (1982) and Niman et al., Proc. Nat. Acad. Sci.
  • UBSTITUTE SHEET expressing the decapeptide and therefore these clones were assumed to also be expressing a V H antigen binding protein.
  • the anti-decapeptide mouse monoclonal was used as the primary antibody and an affin- ity purified goat anti-mouse Ig, commercially available as part of the picoBlue immunoscreening kit from Stratagene Cloning System, La Jolla, CA, was use as the secondary antibody.
  • This combination resulted in a large number of false positive clones because the secondary antibody also immunoreacted with the V H of the heavy chain. Therefore this antibody reacted with all clones expressing any V H protein and this combination of primary and secondary antibodies did not specifically detect clones with the V H polynucleotide in the proper reading frame and thus allowing expressing of the decapeptide.
  • the secondary antibody used with this primary antibody is a goat anti-mouse Ig 6 (Fisher Scientific, Pittsburgh, PA) conjugated to alkaline phos- phatase using the method described in Antibodies: A Laboratory Manual, Harlow and Lowe, eds., Cold Spring Harbor, New York, (1988) . If a particular clone in the V H expression, library, expresses a V H binding protein that binds the FITC covalently coupled to the primary antibody, the secondary antibody binds specifically and when devel ⁇ oped the alkaline phosphate causes a distinct purple color to form.
  • the second combination of antibodies of the type uses a primary antibody that is FITC conjugated rabbit anti-
  • EET human IgG (Fisher Scientific, Pittsburgh, PA) .
  • the secon ⁇ dary antibody used with this primary antibody is a goat anti-rabbit IgG conjugated to alkaline phosphatase using the methods described in Antibodies A Laboratory Manual. Harlow and Lane, eds., Cold Spring Harbor, New York, (1988) . If a particular clone in the V H expression library expresses a V H binding protein that binds the FITC conju ⁇ gated to the primary antibody, the secondary antibody binds specifically and when developed the alkaline phosphatase causes a distinct purple color to form.
  • Another primary antibody was the mouse monoclonal antibody p2 5764 (ATCC # HB-9505) conjugated to both FITC and 125I.
  • the anti•body would be bound by any V H anti.gen binding proteins expressed.
  • an autoradi•ogram of the filter i•s made instead of using a secondary antibody that is conju ⁇ gated to alkaline phosphatase. This direct production of an autoradiogram allows segregation of the clones in the library expressing a V H antigen binding protein of interest.
  • an V H and V L expression library was titred according to Example 15. The titred expression library was then screened for the presence of the decapeptide tag expressed with the V H using the methods described in Example 16. DNA was then prepared from the clones to express the decapepide tag. This DNA was digested with the restriction endonuclease Pvu II to determine whether these clones also contained a V L DNA homolog. The slower migration of a PvuII restriction endonuclease fragment indicated that the particular clone contained both a V H and a V L DNA homolog.
  • BSTITUTE SHEET The clones containing both a V H and a V L DNA homolog were analyzed to determine whether these clones produced an assembled F v protein molecule from the V H and V L DNA homologs.
  • the F v protein fragment produced in clones containing both V H and V L was visualized by immune precipitation of radiolabeled protein expressed in the clones.
  • the culture was maintained at 37°C with shaking until the optical density measured at 550 nm was 0.5.
  • the culture then was centrifuged at 3,000 g for 10 minutes and resuspended in 50 ml of M9 media (6 g/L Na 2 HP0 4 , 3 g/L KH 2 P0 4 , 0.5 g/L NaCl, 1 g/L NH 4 C1, 2g/L glucose, 2 mM MgS0 4 and 0.1 mMgS0 4 CaCl 2 supplemented with amino acids without methionine or cysteine.
  • M9 media 6 g/L Na 2 HP0 4 , 3 g/L KH 2 P0 4 , 0.5 g/L NaCl, 1 g/L NH 4 C1, 2g/L glucose, 2 mM MgS0 4 and 0.1 mMgS0 4 CaCl 2 supplemented with amino acids without methionine or cysteine.
  • This solution was maintained at 37 ⁇ C for 5 minutes and then 0.5 mCi of 35 S as HS0 4 (New England Nuclear, Boston, MA) was added and the solution was further maintained at #&C for an addi ⁇ tional 2 hours. The solution was then centrifuged at 300 x g and the supernatant discarded. The resulting bacter ⁇ ial cell pellet was frozen and thawed and then resuspended for 10 minutes and the resulting pellet discarded. The supernatant was admixed with 10 ul of anti-decapeptide monoclonal antibody and maintained for 30-90 minutes on ice.
  • HEET according to the manufacturer's directions. The gel was dried and used to expose X-ray film.
  • Lambda Zap II V L II ( Figure 9) is designed to serve as a cloning vector for light chain fragments and Lambda Zap II V H ( Figure 7) is designed to serve as a cloning vector for heavy chain sequences in the initial step of library construction. These vectors are engi ⁇ neered to efficiently clone the products of PCR amplification with specific restriction sites incorporated at each end.
  • PCR Amplification of Antibody Fragments The PCR amplification of mRNA isolated from spleen cells with oligonucleotides which incorporate restriction sites into the ends of the amplified product can be used to clone and express heavy chain sequences including Fd and kappa chain sequences.
  • the oligonucleotides primers used for these amplifications are presented in Tables 1
  • the primers are analogous to those which have been successfully used in Example 6 for amplifications of V H sequences.
  • the set of 5' primers for heavy chain ampli ⁇ fication were identical to those previously used to amplify V H and those for light chain amplification were chosen on similar principles, Sastry et al., Proc. Natl. Acad. Sci. USA, 8G: 5728 (1989) and Orland et al., Proc Natl. Acad. Sci. USA. 8G:3833 (1989).
  • the unique 3' primers of heavy (IgGl) and light (k) chain sequences were chosen to include the cysteines involved in heavy-light chain disulfide bond formation.
  • Fv fragments have been constructed using a 3' primer which is complementary to the to the mRNA in the J (joining) region (amino acid 128) and a set of unique 5' primers which are complementary to the first strand cDNA in the conserved N-terminal region of the processed protein. Restriction endonuclease recognition sequences are incorporated into the primers to allow for the cloning of the amplified fragment into a lambda phage vector in a predetermined reading frame for expression.
  • NPN-KLH conjugate was prepared by admixture of 250 ul of a solution containing 2.5 mg of NPN according to formula 1 ( Figure 12) in dimethylfor amide with 750 ul of a solution containing 2 mg of KLH in 0.01 M sodium phos ⁇ phate buffer (pH 7.2). The two solutions were admixed by slow addition of the NPN solution to the KLH solution while the KLH solution was being agitated by a rotating stirring bar.
  • the conjugated NPN-KHL was isolated from the nonconjugated NPN and KLH by gel filtration through Sephadex G-25. The isolated NPN-KLH conjugate was used in mouse immunizations as described in Example 3.
  • the spleen mRNA resulting from the above immuniza ⁇ tions was isolated and used to create a primary library of V H gene sequences using the Lambda Zap II V H expression vector.
  • the primary library contains 1.3 x 10 6 pfu and has been screened for' the expression of the decapeptide tag to determine the percentage of clones expressing Fd sequences.
  • the sequence for this peptide is only in frame for expression following the cloning of an Fd (or V H ) fragment into the vector. At least 80% of the clones in the library express Fd fragments based on immuno-detection of the decapeptide tag.
  • the light chain library was constructed in the same way as the heavy chain and shown to contain 2.5 x 10 6 members. Plaque screening, using the anti-kappa chain antibody, indicated that 60% of the library contained expressed light chain inserts. This relatively small percentage of inserts probably resulted from incomplete dephosphorylation of vector after cleavage with Sac I and Xba I.
  • TITUTE SHEET Once obtained, the two libraries were used to construct a combinatorial library by crossing them at the EcoRI site. To accomplish the cross, DNA was first purified from each library. The light chain library was cleaved with Mlul restriction endonuclease, the resulting 5* ends dephosphorylated and the product digested with EcoRI. This process cleaved the left arm of the vector into several pieces but the light arm containing the light chain sequences, remained intact. In a parallel fashion, the DNA of heavy chain library was cleaved with Hindlll, dephosphorylated and cleaved with EcoR I, destroying the right arm but leaving the left arm containing the heavy chain sequences intact. The DNA's so prepared were then combined and ligated.
  • Flp recombinase-catalyzed Recombination Experiments directed to the m vivo recombination of two lambda vectors using flp recombinase-catalyzed recom ⁇ bination are described.
  • the flp recombination site was introduced into the phage vectors using 39mer synthetic oligonucleotides.
  • the sequence of the flp site utilized for recombination was derived from several references (e.g. Senecoff et al.. Proc. Nat. Acad. Sci. USA 82:7220- 7224 (1985)).
  • the Xbal site within the 8bp core was elim ⁇ inated as this site was to be used in the cloning strategy. This was accomplished by making a point muta- tion which has little or no effect on its ability to allow recombination (McLeod et al.. Mol. Cell. Biol. 6:3357-
  • Vectors were constructed as follows. The first two oligonucleotides were mixed (0.5 ⁇ g oligo 79, 0.5 ⁇ g oligo 80, 1 ⁇ l 200 mM Tris, pH 7.4, 20 mM MgCl, 500 mM NaCl, and H 2 0 to 10 ⁇ l) , heated to 85 ⁇ C 5 min., and allowed to cool to room temperature over 1 hour in a water bath. The procedure was repeated using oligos 81 and 82. Ligation into vector arms was accomplished by digesting Lambda Zap V H and Lambda Zap II V L with 3U/ ⁇ g EcoRI according to standard digestion procedure. After phenol/chloroform extraction, DNA was precipitated with EtOH.
  • the vector was not phosphatase treated so that the oligonucleotides could be inserted without kinase treat ⁇ ment, thus preventing multiple tandem oligonucleotide inserts.
  • Ligations were performed in 5 ⁇ l volumes using 1 ⁇ g of lambda DNA and 1 ng of annealed oligonucleotides according to standard ligation protocol (see Maniatis et al.. supra) . Ligation mixes were packaged using Gigapack
  • the vectors were screened.
  • HEET promoter on a plasmid, pCS3, in E. coli MM294 strain (Lebreton et al. 1988) .
  • This is a low copy number plasmid with the pACYC origin of replication and contains a chloramphenicol resistance gene.
  • 5 x 10 8 cells were coinfected with FLPHC and FLPLC vectors at an moi of 5 and 10 pfu each per cell. Combinations of FLPHC+ and FLPLV+, or FLPHC- and FLPLC-, or FLPHC+ and FLPLC- were tested.
  • the Lambda Zap II V H left arm probe had the following sequence:
  • This sequence hybridizes to the sequence from the Sacl site to the former Notl site of the Lambda Zap II V L vector.
  • the screening procedure used was the same as that used to identify the flp vectors, as described above, with the exception of washing conditions. Filters were washed with 6XSSC, 1%SDS 3 times at room temperature and twice at 60°C. Plaques which hybridized to both probes were identified by X-ray autoradiography, cored, excised and
  • Efficiency of recombination according to the number of plaques identified as hybridizing to both probes was initially between about 5-10%. Changes to the protocol can be made, however, which will improve the efficiency of recovery of recombined vectors. For example, by adding selectable marker sequences to the left and right arms of the vectors, up to 100% of target recombinants can be identified ( Figure 20) . Adding selection systems to ensure that all recombinants contain inserts will also increase the efficiency of identifying the desired clones.
  • Example 19 a relatively restricted library was prepared because only a limited number of primers were used for PCR amplification of Fd sequences.
  • the library is expected to contain only clones expressing kappa/gamma sequences.
  • additional primers can be added to amplify any antibody class or subclass.
  • a phage library prepared as described herein compares with the in vivo antibody repertoire in terms of size, characteristics of diversity, and ease of access.
  • EET modification of the current method In fact once an initial combinatorial library has been constructed, heavy and light chains can be shuffled to obtain libraries of exceptionally large numbers.
  • the diversity characteristics of the naive (unimmunized) in vivo repertoire and corresponding phage library are expected to be similar in that both involve a random combination of heavy and light chains.
  • different factors will act to restrict the diversity expressed by an in vivo repertoire and phage library. For example a physiological modification such as tolerance will restrict the expression of certain anti ⁇ genic specificities from the in vivo repertoire but these specificities may still appear in the phage library.
  • the representation of mRNA for sequences expressed by stimulated B-cells can be expected to predominate over those of unstimulated cells because of higher levels of expression.
  • Different source tissues e.g.. peripheral blood, bone marrow or regional lymph nodes
  • different PCR primers e.g.. ones expected to amplify different antibody classes
  • TITUTE SHEET genesis may be performed on the CDR's and the resulting Fabs can be assayed for increased function.
  • a heavy or a light chain of a clone which binds antigen can be recombined with the entire light or heavy chain libraries respectively in a procedure identical to the one used to construct the combinatorial library.
  • iter ⁇ ative cycles of the two above procedures can be performed to further optimize the affinity or catalytic properties of the immunoglobulin. It should be noted that the latter two procedures are not permitted in B-cell clonal selec ⁇ tion which suggests that the methods described here may actually increase the ability to identify optimal sequences.
  • Access is the third area where it is of interest to compare the in vivo antibody repertoire and phage library.
  • the phage library is much easier to access.
  • the screening methods allow one to survey at least 50,000 clones per plate so that 10 6 antibodies can be readily examined in a day. This factor alone should encourage the replacement of hybridoma technology with the methods described here.
  • the most powerful screening methods utilize selection which may be accomplished by incorporating selectable markers into the antigen such as leaving groups necessary for replication of auxotrophic bacterial strains or toxic substituents susceptible to catalytic inactivation.
  • selectable markers such as leaving groups necessary for replication of auxotrophic bacterial strains or toxic substituents susceptible to catalytic inactivation.
  • the phage library is not similarly restricted.
  • the methods disclosed herein describe generation of Fab fragments which are clearly different in a number of important respects from intact (whole) antibodies. There is undoubtedly a loss of a affinity in having monovalent Fab antigen binders but this can be compensated by selec ⁇ tion of suitably tight binders. For a number of applica ⁇ tions such as diagnostics and biosensors it may be prefer ⁇ able to have monovalent Fab fragments. For applications requiring Fc effector functions, the technology already exists for extending the heavy chain gene and expressing the glycosylated whole antibody in mammalian cells.
  • ITUTE SHEET complete antigen binding domain of a Fab protein fragment composed of a heavy and a light chain.
  • Schematic diagrams of an immunoglobulin molecule composed of heavy and light chains containing constant and variable regions is shown in Figure 1.
  • Human heavy chain IgG and human kappa light chain are diagrammatically sketched in Figures 2A and 2B, respectively.
  • immunoglobu ⁇ lin heavy and light chain primers were designed to produce a region of homology between two polymerase chain reaction (PCR) products. The complementary regions have been shown to hybridize predominantly under conditions where one set of primers ("inside primer pair”) is used in a limiting amount relative to the other set of primers (“outside primer pair”) .
  • the DNA polymerase After the 3• ends of the PCR products have hybridized, the DNA polymerase has been shown to extend the ends creating a fusion seguence carrying the unique sequences of both PCR fragments separated by one copy of region X cistronic bridge. A two-step cloning procedure is thus avoided.
  • an expression vector such as ImmunoZAP, a fusion production capable of simultaneously expressing the heavy and light chains can be produced.
  • Regions of the immunoglobulin heavy chain coding strand are designated V H , C H 1, C H 2, and C H 3 corres ⁇ ponding to functional regions in the protein.
  • the corres ⁇ ponding regions of the non-coding strand are designated by a prime ( ') .
  • Regions V L and C L are similarly labelled for the kappa light chain. This procedure can also be per ⁇ formed using lambda light chain specific regions.
  • a region, X, unrelated to the natural immunoglobulin sequences, is introduced into the fusion product by attaching X to the 5' ends of both of the C H 1' and V L inside primers.
  • SHEET designed to encode the following: amino acids of 225 to 230 of the IgG heavy chain hinge region which are common to all human IgG isotypes; an Spe I restriction site; two stop codons; a ribosome binding site; a periplasmic (pelB) leader sequence (Better, et al., Science. 240:1041-1043 (1988); Lei, et al., J. Bacteriol.. 169:4379-4383 (1988)); a Sac I restriction site which encodes amino acids 1 and 2 of the mature kappa light chain; and amino acids 3 to 8 of the mature kappa light chain.
  • the X region was designed to contain a ribosome binding site and a pelB leader to ensure expression of the light chain.
  • Nucleotide sequences for all human and mouse PCR primers, both inside and outside, are listed in Table 11. Primers followed by a prime ( ') represent non-coding strand sequences.
  • the overlapping regions of the human C H 1' inside and V L inside primers are illustrated in Figure 22.
  • the heavy chain downstream C H 1' inside primer sequence is written 3 ' to 5' and the light chain upstream V L inside primer sequence is written 5' to 3• .
  • the complementary PCR product strands, and not the primer strands, cross-prime to create the dicistronic molecule.
  • Bold nucleotides represent regions where the C H 1' inside primer hybridizes to the 3' end of C H 1 on human IgG heavy chain mRNA or where the V L inside primer hybridizes to the 5' end of V L frame ⁇ work on human kappa light chain cDNA.
  • the amino acid and nucleotides in italics represent changes in sequence from the original pelB leader sequence.
  • Thermus aguaticus (Taq) DNA polymerase may add a dATP to the 3' end of the PCR product because of terminal transferase activity.
  • the additional dATP would then cause a mismatch between the overlapping PCR products at the 3 ' terminus and inhibit elongation by Taq DNA polymerase.
  • EET The kappa light chain PCR product was designed to termi ⁇ nate at a position where two dTTPs occur 5* of the end of the product and did not require alterations of the nucleo ⁇ tide sequence. Nucleotides were changed in the kappa light chain primer encoding the pelB leader sequence with ⁇ out introducing amino acid changes in order to decrease the number of mismatches between the primer and the leader sequence of the kappa light chain mRNA as shown in Figure 22 and Table 11. All primers were synthesized on an Applied Biosystems DNA synthesizer. Model 381A, following the manufacturer's instructions.
  • Volunteer donors who had been pre ⁇ viously immunized against tetanus but had not received booster injections within the last year, received injec ⁇ tions on 2 consecutive days of 0.5 milliliters (ml) of alum-absorbed tetnus toxoid (TT) (40 microgram/ml (ug)/ml) (Connaught Laboratories, Swiftwater, Pennsylvania) .
  • TT tetnus toxoid
  • PBLs peripheral blood lymphocytes
  • Histopaque-1077 Sigma, St. Louis, Missouri
  • centrifuging 400 x g for 30 minutes at 25 degrees Celsius (25°C) .
  • Isolated PBLs were washed twice with phosphate buffered saline (PBS) (150 mM sodium chloride and 150 mM sodium phosphate, pH 7.2 at 25 ⁇ C) .
  • PBS phosphate buffered saline
  • RNA was then purified from the PBLs (10 6 B cells per ml blood per 100 ml of blood) for an enriched source of B-cell mRNA coding for antiTT IgG using an RNA isola ⁇ tion kit according to manufacturer's instructions (Stratagene, La Jolla, California) and also described by Chomczynski et al., Anal. Biochem.. 162:156-159 (1987). Briefly, the isolated PBLs were homogenized in 10 ml of a denaturing solution containing 4.0 M guanine isothiocyan- ate, 0.25 M sodium citrate at pH 7.0, and 0.1 M beta- mercaptoethanol.
  • the solution was centrifuged at 10,000 x g for 20 minutes at 4 ⁇ C.
  • the upper RNA- containing aqueous layer was transferred to a fresh 50 ml polypropylene centrifuge tube and mixed with an equal volume of isopropyl alcohol. This solution was maintained at -20°C for at least one hour to precipitate the RNA.
  • the solution containing the precipitated RNA was centri ⁇ fuged at 10,000 x g for twenty minutes at 4°C.
  • the pelleted total cellular RNA was collected and dissolved in 3 ml of the denaturing solution described above. Three ml of isopropyl alcohol was added to the re-suspended total cellular RNA and inverted to mix.
  • This solution was main ⁇ tained at -20°C for at least 1 hour to precipitate the RNA.
  • the solution containing the precipitated RNA was centrifuged at 10,000 x g for ten minutes at 4°C.
  • the pelleted RNA was washed once with a solution containing 75% ethanol.
  • the pelleted RNA was dried under vacuum for
  • RNA messenger RNA
  • IX sample buffer (1 mM Tris-HCl, (Tris [hydroxylmethyl-aminomethane]) pH 7.5; 0.1 mM EDTA (disodium ethylene diamine tetra-acetic acid) , 0.5 M NaCl) and maintained at 65"C for five minutes and then on ice for five more minutes.
  • the mixture was then applied to an oligo-dT (Stratagene) column that was previously prepared by washing the oligo-dT with a solution containing 10 mM Tris-HCl, pH 7.5; 1 mM EDTA, 0.5 M NaCl.
  • the eluate was collected in a sterile polypropylene tube and reapplied to the same column after heating the eluate for five minutes at 65°C.
  • the oligo dT column was then washed with 0.4 ml of high salt loading buffer consisting of 10 mM Tris-HCl at pH 7.5, 500 mM sodium chloride, and 1 mM EDTA.
  • the oligo dT column was then washed with 2 ml of 1 X low salt buffer consisting of 10 mM Tris-HCl at pH 7.5, 100 mM sodium chloride, and 1 mM EDTA.
  • the messenger RNA was eluted from the oligo dT column with 0.6 ml of buffer consisting of 10 mM Tris-HCl at pH 7.5, and ImM EDTA.
  • the messenger RNA was purified by extracting this solution with phenol/chloroform followed by a single extraction with 100% chloroform.
  • the messenger RNA was concentrated by ethanol precipitation and re-suspended in DEPC H 2 0.
  • the messenger RNA isolated by the above process contains a plurality of different V H and V L coding poly ⁇ nucleotides, i.e., greater than about 10 4 different V H - and V L -coding genes.
  • RNA was converted to cDNA by a primer exten- sion reaction with a first-strand synthesis kit according to manufacturer's instructions (Stratagene) by using an oligo (dT) primer for the light chain and a specific
  • 5 ug of PBL mRNA in water was first hybridized (annealed) with 200 ng (50.0 pmol) of an oligo (dT) primer for the light chain.
  • 5 ug of PBL mRNA in water was first hybridized (annealed with 200 ng (20 pmol) of the heavy chain primer, C H 1', at 65 ⁇ C for five minutes.
  • the mixture was adjusted to 0.5 mM each of dATP, dCTP, dGTP and dTTP, 50 mM Tris-HCl at pH 8.3, 3 mM MgCl 2 75 mM KCl, 10 mM DTT, 20 units of RNase block II
  • PCR amplification of the heavy and light chain sequences was done separately using 0.25-0.5 ug of first- strand synthesis product as template with sets of primer pairs using Taq DNA polymerase as described in Example 23.
  • the PCR amplified light chain DNA fragments were then digested with Sac I and Xba I and ligated into a modified Lambda Zap II vector as prepared in Example 29 to form a light chain ImmunoZap Library (ImmunoZAP L; Stratacyte, La Jolla, California) .
  • the PCR amplified heavy chain DNA was digested with Spe I and Sho I and ligated into a different modified Lambda Zap II vector as prepared in Example 27 to form a heavy chain ImmunoZap Library (ImmunoZAP H; Stratacyte) .
  • the resulting libraries were amplified and the resulting DNA was packaged into bacteriophage with in vitro packaging extract, Gigapack II gold (Stratagene) and used to infect E. coli strain XLl-Blue (Stratagene) .
  • the right art of the heavy chain library phage DNA was digested with Hind III, preserving the left arm of ImmunoZAP H with a heavy chain inserts.
  • the left arm of the light chain library phage DNA was digested with Mlu I resulting in a right arm of ImmunoZAP with kappa light chain inserts. Both products were then digested with EcoRI and ligated to create a combinatorial library that encoded human Fab
  • HEET fragments including those specific for TT. Mullinax, et al. , supra.
  • Reactive plaques were first identified by binding to tetanus toxoid as described in Example 31. Bacteriophage from purified reactive plaques were then converted to the plasmid format by in vivo excision with R408 helper phage (Stratagene) following methods described in Example 31 and familiar to one skilled in the art. Short, et al., Nucl. Acids. Res.. 16:7583-7600 (1988). The resulting purified plasmid DNA encoding heavy and light chain was then used in PCR reactions as described below in Example 23.
  • V ⁇ - and V L -Coding Repertoire from mRNA from Tissues and Cells
  • PBLs, other lymphocytes, and hybridomas which express immunoglobulins including IgG, IgM, IgE, IgD, and IgA are used as sources for isolating mRNA encoding immunoglobulins.
  • PBL's and other immuno ⁇ globulin expressing lymphocytes are isolated from either spleen, lymphoid tissue or plasma. Following purification of the cells, total RNA is then purified from these cells using a RNA isolation kit (Stratagene) as described in Example 22a.
  • the purified RNA is then converted to cDNA with a first-strand synthesis kit as described in Example 22a.
  • the resultant cDNA is then used as a template in PCR amplification reactions as described below in Example 23 for the production of dicistronic molecules expressing heavy and light chains.
  • Mouse Populations of cells described above can be isolated from other mammalian sources such as mouse or rabbit. Both mRNA and rearranged DNA can be isolated as described above and used as templates in PCR amplification reac ⁇ tions. cDNA synthesized from mRNA isolated from a mouse anti-human fibronectin hybridoma (ATCC, CRL-1606) was used
  • BSTITUTE SHEET as a preferred template for the production of dicistronic molecules expressing heavy and light chain.
  • V n -Coding Repertoire Preparation of a V n -Coding Repertoire from Rearranged DNA Rearranged DNA isolated from PBLs, other lymphocytes, and hybridomas which express immunoglobulins can be used to prepare a V H - ⁇ oding repertoire.
  • the amplification procedure for preparing a v H -coding repertoire using rearranged DNA is performed as described in Example 23.
  • Cloned DNA prepared in Example 22 from a combina ⁇ torial library that encodes human Fab fragments which bind tetanus toxoid (TT) , was used as a template for preparing a V H -coding double stranded DNA homolog.
  • Human heavy chain containing both the V H and C H 1 coding region and designated as Fd, was amplified in a PCR reaction.
  • THe amplification was performed in a 100 ul reaction contain ⁇ ing 5 nanograms (ng) of the cloned DNA in PCR buffer consisting of the following: 10 mM Tris-HCl, pH 8.3; 50 mM KCl, 1.5 mM MgCl 2 ; 0.001% (w/v) gelatin; 200 mM of each dNTP; 200 nanomolar (nM) of each primer; and 2.5 units of Taq DNA polymerase.
  • the human V H outside primer and C H 1' inside primer were used as a PCR primer pair for amplifi- cation of the heavy chain (Table 11 and Figure 21) .
  • the reaction mixture was overlaid with mineral oil and sub ⁇ jected to 40 cycles of amplification.
  • Each amplification cycle (thermocycle) involved denaturation at 94°C for 1.5 minutes, annealing at 54°C for 2.5 minutes and poly- nucleotide synthesis by primer extension (elongation) at 72°C for 3.0 minutes followed by a return to the denatur ⁇ ation temperature.
  • the resultant amplified V H -coding DNA homolog containing samples were then gel purified, extracted twice with phenol/chloroform, once with chloro-
  • T form followed by ethanol precipitation and were stored at -70°C in 10 mM Tris-HCl, pH 7.5, and 1 mM EDTA.
  • the PCR purified products were electrophoresed in an agarose gel.
  • the expected size of the heavy chain was approxi ⁇ mately 730 base pairs as shown in Figure 23.
  • the V H - coding double stranded DNA homologs were then used in subsequence PCR amplification reactions with V L -coding counterparts prepared below for the production of dicis- tronic DNA molecules having V H and V L cistronic portions as illustrated in Example 24.
  • V L and C L Human light chain, containing the entire coding region of kappa light chain (V L and C L ) , was amplified using the same PCR condi ⁇ tions described for human heavy chain with the exception that a human V L inside primer and C L ' outside primer were used as the PCR primer pair (Table 11 and Figure 21) .
  • the resultant V L -coding double stranded DNA homolog was gel purified and stored as described above.
  • the PCR purified products were electrophoresed in an agarose gel.
  • the expected size of the light chain was approxi ⁇ mately 690 base pairs as shown in Figure 23.
  • the V L - coding double stranded DNA homologs were then used in subsequent PCR amplification reactions with V H -coding counterparts prepared above for the production of dicistronic DNA molecules as illustrated in Example 24.
  • V H - and V L -coding double stranded DNA homologs prepare in Examples 23A and 23B, respectively, were admixed together and denatured at 95 ⁇ C for 5 minutes to separate the strands of each homolog.
  • the denatured V H - and V L -coding DNA strands in the admixture were then annealed at 54"C for 5 minutes to form a V H - and V L -coding duplex DNA molecule hybridized at the 3' ends at region X of each original homolog.
  • One strand of the X region (cistronic) bridge encodes at least one stop codon in the same reading frame as the upstream cistron, a ribosome binding site downstream from the stop codon, and a polypeptide leader (pelB) having a translation initiation codon in the same reading frame as the downstream cistron located downstream from the ribosome binding site.
  • a polypeptide leader having a translation initiation codon in the same reading frame as the downstream cistron located downstream from the ribosome binding site.
  • V H - and V L -coding DNA molecules were subjected to primer extension and then amplified with only the V H and C L ' primers following the PCR reaction procedure described in Example 23A.
  • This second PCR reaction is schematically represented in Figure 21.
  • the PCR reaction products were gel electrophoresed to verify the presence of the result ⁇ ant V H - and V L -coding dicistronic DNA molecules.
  • the expected size of the dicistronic molecule was about 1390 base pairs and is shown in Figure 23.
  • the resultant V H - and V L -coding dicistronic DNA molecules were then ligated into the modified ImmunoZAP H vector ( Figures 24A and 24B) for the construction of expression vectors as described in Example 30.
  • Example 22B Reaction Mouse hybridoma heavy and light chain cDNA prepared in Example 22B was amplified in a single PCR reaction using the reaction conditions given above with an excess of the outside primers (200 nM concentration of both the mouse V H primer and C L * primer) and a limiting amount of the inside primers (20 nM concentration of both the mouse
  • Another approach to producing a library of dicis ⁇ tronic DNA molecules is to use a single internal primer instead of using two separately internal primers.
  • the process of creating a dicistronic molecule comprising an upstream V H cistron and a downstream V L cistron is to combine in a PCR buffer the following: a repertoire of V H genes consisting of at least 10 s different genes; a reper- toire of V L genes consisting of at least l ⁇ 4 different genes; an outside V H primer; an outside V L ; and a poly ⁇ nucleotide strand having a 3'-terminal priming portion, a cistronic bridge coding portion, and a 5' terminal primer- template portion.
  • the PCR reaction is performed as described in Example 22A.
  • the 3*-terminal priming portion of a polynucleotide strand has a nucleotide base sequence homologous to a portion of the primer extension product of one of the outside primers.
  • the 5'-terminal priming portion encodes a nucleotide base seguence homologous to a portion of the primer extension product of the other outside primer.
  • TITUTE SHEET cistronic bridge coding portion encodes at least one stop codon in the same reading frame as the upstream cistron, a ribosome binding site downstream from the stop codon and a polypeptide leader (pelB) having a translation initia- tion codon in the same reading frame as the downstream cistron where the initiation codon is located downstream from the ribosome binding site.
  • Polynucleotide strand (linker) primers useful in this invention are listed in Table 12.
  • the vector Lambda Zap TM II (Stratagene) is a derivative of the original Lambda Zap (ATCC # 40,298) that maintains all of the characteristics of the original Lambda Zap including 6 unique cloning sites, fusion protein expression, and the ability to rapidly excise the insert in the form of a phagemid (Bluscript SK-) , but lacks the SAM 100 mutation, allowing growth on many Non- Sup F strains, including XLl-Blue.
  • the Lambda Zap II was constructed as described in Short et al., Nucleic Acids Res..
  • Bacteriophage lambda was selected as the expression vector for three reasons. First, in vitro packaging of phage DNA is the most efficient method of reintroducing DNA into host cells. Second, it is possible to detect protein expres ⁇ sion at the level of single phage plaques. Finally, the screening of phage libraries typically involve less diffi- culty with nonspecific binding. The alternative, plasmid cloning vectors, are only advantageous in the analysis of
  • V H -coding DNA homologs To express the plurality of V H -coding DNA homologs in an E. coli host cell, a vector was constructed that placed the V H -coding DNA homologs in the proper reading frame, provided a ribosome binding site as described by Shine et al., Nature, 254:34, (1975), provided a leader sequence directing the expressed protein to the periplasmic space, provided a polynucleotide seguence that coded for a known epitope (epitope tag) and also provided a polynucleotide that coded for a spacer protein between the V H -coding DNA homolog and the polynucleotide coding for the epitope tag.
  • epitope tag epitope
  • a synthetic DNA sequence containing all of the above polynucleotides and features was constructed by designing single stranded polynucleotide segments of 20-40 bases that would hybridize to each other and form the double stranded synthetic DNA sequence shown in Figure 25A.
  • the individual single-stranded polynucleotides (N-,-N 12 ) are shown in Table 13 below.
  • CAGTTTCACCTGGGCCATGGCTGGTTGGG 3' CAGCGAGTAATAACAATCCAGCGGCTGCCGTAGGCAATAG 3 ⁇ GTATTTCATTATGACTGTCTCCTTGAAATAGAATTTGC 3 ' » AGGTGAAACTGCTCGAGATTTCTAGACTAGTTACCCGTAC 3' (100) Nil) 5' GACGTTCCGGACTACGGTTCTTAATAGAATTCG 3' (101) N12) 5' TCGACGAATTCTATTAAGAACCGTAGTC 3'
  • the solution was maintained at 37°C for 30 minutes and the reaction stopped by maintaining the solution at 65°C for 10 minutes.
  • the two end polynucleotides, 20 ng, of poly- nucleotides Nl and polynucleotides N12, were added to the above kinasing reaction solution together with 1/10 volume of a solution containing 20 mM Tris-HCl, pH 7.4, 2 mM MgCl 2 and 50 mM NaCl.
  • This solution was heated to 70°C for 5 minutes and allowed to cool to room temperature, approxi- mately 25°C, over 1.5 hours in a 500 ml beaker of water.
  • the end polynucleotides were kinased by mixing 52 ⁇ l of the above reaction, 4 ⁇ l of a solution containing 10 mM ATP and 5 units of T4 polynucleotide kinase. This solution was maintained at 37°C for 30 minutes and then the T4 polynucleotide kinase was inactivated by maintaining the solution at 65°C for 10 minutes.
  • the completed synthetic DNA insert was ligated directly into a lambda Zap II vector prepared in Example 27 that had been previously digested with the restriction enzymes NotI and Xhol.
  • the ligation mixture was packaged according to the manufacturer's instructions using Gigapack II Gold packing extract (Stratagene) .
  • a vector based on the ImmunoZAP H vector described above was constructed.
  • the procedure for con- structing the vector was performed as described above with the following modifications: elimination of the Sad site between the T 3 polymerase and NotI sites and changing the nucleotide base residue sequence from AAA to CAG which resulted in an amino acid residue change from lysine to glutamine as shown in Figures 24A and 24B.
  • the modified ImmunoZAP H vector was created to eliminate an unnecessary SacI site in the ImmunoZAP H vector, (Example 28a, when the heavy and light chain vectors were combined.
  • the modifications also improved the efficiency of secretion of positively changed amino acids in the amino terminus of the expressed protein. Inouye et al., Proc. Natl. Acad. Sci. USA. 85:7685-7689 (1988) .
  • V L Expression Vector ImmunoZAP L Construction To express the plurality of V L coding polynucleotides in an E. coli host cell, a vector was constructed that placed the V, coding polynucleotide in the proper reading frame, provided a ribosome binding site as described by Shine et al., Nature, 254:34, (1975), provided a leader sequence directing the expressed protein to the peri ⁇ plasmic space and also provided a polynucleotide that coded for a spacer protein between the V L polynucleotide.
  • a synthetic DNA sequence containing all of the above polynucleotides and features was constructed by designing single stranded polynucleotide segments of 20-40 bases that would hybridize to each other and form the double stranded synthetic DNA sequence shown in Figure 25B.
  • the individual single-stranded polynucleotides (N,,-N 8 ) are shown in Table 13 above.
  • Polynucleotides N2, N3, N4, N6, N7 and N8 were kinased by adding 1 ⁇ l of each polynucleotide and 20 units
  • the solution was maintained at 37°C for 30 minutes and the reaction stopped by maintain- ing the solution at 65°C for 10 minutes.
  • the two end polynucleotides 20 ng of polynucleotides Nl and poly ⁇ nucleotides N5 were added to the above kinasing reaction solution together with 1/10 volume of a solution contain ⁇ ing 20 mM Tris-HCl, pH 7.4, 2 mM MgCl 2 and 50 mM NaCl. This solution was heated to 70°C for 5 minutes and allowed to cool to room temperature, approximately 25°C, over 1.5 hours in a 500 ml beaker of water. During this time period all of the polynucleotides annealed to form the double stranded synthetic DNA insert.
  • the individual polynucleotides were covalently linked to each other to stabilize the synthetic DNA insert with adding 40 ⁇ l of the above reaction to a solution containing 50 ⁇ l Tris- HCl, pH 7.5, 7 mM MgCl 2 1 mM DTT, 1 mM ATP and 10 units of T4 DNA ligase. This solution was maintained at 37°C for 30 minutes and then the T4 DNA ligase was inactivated by maintaining the solution at 65°C for 10 minutes.
  • the end polynucleotides were kinased by mixing 52 ⁇ l of the above reaction, 4 ⁇ l of a solution recontaining 10 mM ATP and 5 units of T4 polynucleotide kinase. This solution was maintained at 37°C for 30 minutes and then the T4 poly ⁇ nucleotide kinase was inactivated by maintaining the solution at 65°C for 10 minutes.
  • the completed synthetic DNA insert was ligated directly into a Lambda Zap II vector prepared in Example 27 that had been previously digested with the restriction enzymes NotI and Xhol.
  • the ligation mixture was packaged according to the manufacturer's instructions using Gigapack II Gold packing extract and the packaged ligation mixture was plated on XLl-Blue cells as described in Example 28A.
  • Individual lambda Zap II plaques were cored and the inserts excised according to the in vovo excision protocol as described in Example 28A. This in vivo
  • EET excision protocol converts the cloned insert from the Lambda Zap II vector into a phagemid vector to allow easy manipulation and sequencing and also produces the phagemid version of the V L expression vectors.
  • the accuracy of the above cloning steps was confirmed by sequencing the insert using the Sanger dideoxy method described by Sanger et al., Proc. Natl. Acad. Sci. USA. 74:5463-5467, (1977) and using the manufacturer's instructions in the AMV reverse transcriptase 35 S-dATP sequencing kit (Stratagene) .
  • the sequence of the resultin V L expression vector is shown in Figure 25B and Figure 27) .
  • the V L expression vector used to construct the V L library was the phagemid produced to allow the DNA of the V L expression vector to be determined.
  • the phagemid was produced, as detailed above, by the in vivo excision pro ⁇ cess from the Lambda Zap V L expression vector ( Figure 27) .
  • V HL V H - V L -coding (V HL ) dicistronic DNA molecules
  • PCR amplified products human or mouse
  • Examples 24, 25, and 26 50 mM NaCl, 25 mM Tris-HCl, pH 7.7, 10 mM MgCl 2 , 10 mM jS-mercaptoethanol, 100 ug/ml BSA, at 37'C were digested with restriction enzymes Xhol and Xbal at a concentration of 60 units of enzyme per ug of DNA, and purified on a 1% agarose gel.
  • BSTITUTE SHEET portion of the ligation mixture (1 ul) was packaged for 2 hours at room temperature using Gigapack Gold packaging extract (Stratagene) and the packaged material was plated on a permissive E. coli (strain XLl-blue) lawn to generate plaques.
  • the library was determined to consist of predom ⁇ inantly V HL with less than 5% non-recombinant background.
  • V HL dicistronic molecules E. coli were infected to yield approximately 100 plaques per plate.
  • Replica filter lifts of the plaques on an agar plate were produced by overlaying a nitrocellulose filter that had been soaked in 10 mM isopropyl beta- dithiogalactopyranoside on each plate with transfer for 15 hours at 23°C.
  • the filters were screened with rabbit anti- human heavy and light chain antibodies followed by goat anti-rabbit antibody coupled to alkaline phsophatase (Cappel Laboratories, Malver, Pennsylvania) . The detec- tion of immunoreactive product confirmed the presence and expression of V HL antibody fragments.
  • plaques were plated and proteins expressed as described above. Replica filters were incubated with 0.2 nN 125I-tetanus toxoi•d and washed. Posi•ti.ve plaques were identified by autoradiography and isolated. The frequency of positive clones in the library was equivalent to (number of positive clones)/[number of plaques screened) X (fraction of plaques expressing V HL ) . Concentrated non- adsorbed tetanus toxoid was iodinated with sodium iodide 15 I (ICN, Irvine, California) by the Choramine-T method as described in Botton et al., Biochem. I.
  • Mouse antibody-producing plaques prepared in Example 27 were screened for antibody expression with rabbit anti- mouse heavy and light chain antibody (Cappel Laboratories) as described above.
  • Bacteriophage from purified reactive plaques prepared in Example 3OB were converted to the plasmid format by in vivo excision with R408 helper phage according to manufac ⁇ turer's protocol (Stratagene) and also described in Short et al., Nucl. Acids Res.. 16:7583-7600 (1988).
  • R408 helper phage according to manufac ⁇ turer's protocol (Stratagene) and also described in Short et al., Nucl. Acids Res.. 16:7583-7600 (1988).
  • the cloned insert from the ImmunoZAP H vector was converted into a phagemid vector to allow easy manipulation and sequencing.
  • phage plaques were cored from the agar plates and transferred to sterile microfuge tubes containing 500 ul of a buffer containing 50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 10 mM MgS0 4 , and 0.01% (w/v) gelatin and 20 ul of chloroform.
  • Clones containing the putative V HL insert were sequenced using reverse transcriptase according to the general method described by Sanger et al. , Proc. Natl. Acad. Sci.. USA. 74:5463-5467, (1977) and the specific modifications of this method provided in the manufac ⁇ turer's instructions in the AMV reverse transcriptase 35 S- dATP sequencing kit (Stratagene) . Nucleotide sequence analysis of several fusion clones indicated that the sequence of the fusion region was identical to that shown in Figure 22, proving that the clones were actually generated through a fusion PCR intermediate.
  • PCR amplification can, therefore, be used to fuse sequences responsible for encoding subunits of a hetero ⁇ dimeric protein together into a single DNA fragment that can then direct the expression of both subunits from one expression vector.
  • the source of nucleic acid template comes from hybridoma mRNA, there is only one heavy and light chain sequence to choose from, and thus the heavy:light pair is a "natural" pair.
  • HEET HEET
  • peripheral blood B-cell, or other lymphocyte mRNA is used as the source of template
  • the PCR fusion reaction to form a dicistronic DNA molecule can randomly pair heavy and light chains from different cells, producing a combinatorial library.
  • a combinatorial library only a small fraction of the clones contain the original heavy and light chain pairs. This may not be a problem if the desired natural pair is well represented in the orig ⁇ inal B-cell population, as is the case with hyperimmunized donors.
  • one wishes to find a naturally occurring rare specificity in a combinatorial library one may have to screen a large number of clones.
  • the fusion method presented here may offer a solution to the random combinatorial problem. If one begins with a very dilute population of B-cells (possibly in a medium that limits diffusion) , it may be possible for the dicis ⁇ tronic event to occur between naturally paired heavy and light chain sequences before significant mixing between B- cell RNA occurs. Thus, the fused heavy and light chain sequences would be the original pairs, and the resulting library would express predominantly the naturally occur ⁇ ring antibody specificities. Such a library would be highly preferable when rare natural specificities are sought. Another advantage to this method is that only one vector and one cloning step are necessary. This saves a substantial amount of time, resources, and effort. Moreover, the ease of the single PCR reaction greatly simplified the process of going from B-cell RNA to an ⁇ L. coli library, making this approach a noteworthy alterna ⁇ tive to standard hybridoma technology.

Abstract

Procédés de production d'agents biologiques exprimant un phénotype identifiable voulu. Ces procédés consistent à réunir des populations de répliques diverses de séquences de nucléotides afin d'obtenir une pluralité de séquences de nucléotides combinées, comprenant chacune un membre de chaque population, à exprimer les séquences de nucléotides combinées afin de donner un phénotype, et à identifier les agents biologiques exprimant le phénotype voulu.
PCT/US1991/002910 1990-04-24 1991-04-24 Procedes de creation de phenotype a partir de populations de genes multiples WO1991016427A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US51395790A 1990-04-24 1990-04-24
US513,957 1990-04-24

Publications (1)

Publication Number Publication Date
WO1991016427A1 true WO1991016427A1 (fr) 1991-10-31

Family

ID=24045249

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1991/002910 WO1991016427A1 (fr) 1990-04-24 1991-04-24 Procedes de creation de phenotype a partir de populations de genes multiples

Country Status (3)

Country Link
EP (1) EP0528881A4 (fr)
AU (1) AU7791991A (fr)
WO (1) WO1991016427A1 (fr)

Cited By (88)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999021977A1 (fr) * 1997-10-24 1999-05-06 Life Technologies, Inc. Clonage recombinatoire au moyen d'acides nucleiques possedant des sites de recombinaison
US5939250A (en) * 1995-12-07 1999-08-17 Diversa Corporation Production of enzymes having desired activities by mutagenesis
US5958672A (en) * 1995-07-18 1999-09-28 Diversa Corporation Protein activity screening of clones having DNA from uncultivated microorganisms
US5965408A (en) * 1996-07-09 1999-10-12 Diversa Corporation Method of DNA reassembly by interrupting synthesis
US6004788A (en) * 1995-07-18 1999-12-21 Diversa Corporation Enzyme kits and libraries
US6117679A (en) * 1994-02-17 2000-09-12 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6143557A (en) * 1995-06-07 2000-11-07 Life Technologies, Inc. Recombination cloning using engineered recombination sites
US6153410A (en) * 1997-03-25 2000-11-28 California Institute Of Technology Recombination of polynucleotide sequences using random or defined primers
US6165793A (en) * 1996-03-25 2000-12-26 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6171861B1 (en) 1995-06-07 2001-01-09 Life Technologies, Inc. Recombinational cloning using engineered recombination sites
WO2001048175A2 (fr) 1999-12-29 2001-07-05 Diversa Corporation METHODES DESTINEES A LA PRODUCTION D'ACIDES CARBOXYLIQUES α-SUBSTITUES ENANTIOMERIQUEMENT PURS
US6277638B1 (en) 1994-02-17 2001-08-21 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6303344B1 (en) 1996-12-18 2001-10-16 Maxygen, Inc. Methods and compositions for polypeptide engineering
US6309883B1 (en) 1994-02-17 2001-10-30 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US6344328B1 (en) 1995-12-07 2002-02-05 Diversa Corporation Method for screening for enzyme activity
US6358709B1 (en) 1995-12-07 2002-03-19 Diversa Corporation End selection in directed evolution
US6361974B1 (en) 1995-12-07 2002-03-26 Diversa Corporation Exonuclease-mediated nucleic acid reassembly in directed evolution
US6391640B1 (en) 1994-02-17 2002-05-21 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US6455254B1 (en) 1995-07-18 2002-09-24 Diversa Corporation Sequence based screening
US6489145B1 (en) 1996-07-09 2002-12-03 Diversa Corporation Method of DNA shuffling
US6495321B1 (en) 1997-06-16 2002-12-17 Bioinvent International Ab Method for in vitro molecular evolution of protein function
US6537776B1 (en) 1999-06-14 2003-03-25 Diversa Corporation Synthetic ligation reassembly in directed evolution
US6632600B1 (en) 1995-12-07 2003-10-14 Diversa Corporation Altered thermostability of enzymes
US6713281B2 (en) 1995-12-07 2004-03-30 Diversa Corporation Directed evolution of thermophilic enzymes
US6713279B1 (en) 1995-12-07 2004-03-30 Diversa Corporation Non-stochastic generation of genetic vaccines and enzymes
US6720140B1 (en) 1995-06-07 2004-04-13 Invitrogen Corporation Recombinational cloning using engineered recombination sites
US6740506B2 (en) 1995-12-07 2004-05-25 Diversa Corporation End selection in directed evolution
US6790605B1 (en) 1995-12-07 2004-09-14 Diversa Corporation Methods for obtaining a desired bioactivity or biomolecule using DNA libraries from an environmental source
WO2004090099A2 (fr) 2003-04-04 2004-10-21 Diversa Corporation Pectate lyases, acides nucleiques codant ces dernieres et procedes de fabrication et d'utilisation
US6828093B1 (en) 1997-02-28 2004-12-07 Baylor College Of Medicine Rapid subcloning using site-specific recombination
WO2005021714A2 (fr) 2003-08-11 2005-03-10 Diversa Corporation Laccases, acides nucleiques codant pour ces enzymes et procedes permettant de les produire et de les utiliser
US6939689B2 (en) 1995-12-07 2005-09-06 Diversa Corporation Exonuclease-mediated nucleic acid reassembly in directed evolution
US6958213B2 (en) 2000-12-12 2005-10-25 Alligator Bioscience Ab Method for in vitro molecular evolution of protein function
US6964861B1 (en) 1998-11-13 2005-11-15 Invitrogen Corporation Enhanced in vitro recombinational cloning of using ribosomal proteins
WO2006009676A2 (fr) 2004-06-16 2006-01-26 Diversa Corporation Compositions et procedes pour la decoloration enzymatique de la chlorophylle
WO2006101584A2 (fr) 2005-03-15 2006-09-28 Diversa Corporation Cellulases, acides nucleiques codant pour ces cellulases, et procedes de production et d'utilisation de ces cellulases
WO2007095398A2 (fr) 2006-02-14 2007-08-23 Verenium Corporation Xylanases, acides nucléiques codant pour elles et leurs procédés de préparation et d'utilisation
WO2008036863A2 (fr) 2006-09-21 2008-03-27 Verenium Corporation Phospholipases, acides nucléiques codant pour elles et leurs méthodes d'obtention et d'utilisation
WO2008080093A2 (fr) 2006-12-21 2008-07-03 Verenium Corporation Amylases et glucoamylases, acides nucléiques les codant, et leurs procédés de fabrication
WO2008095033A2 (fr) 2007-01-30 2008-08-07 Verenium Corporation Enzymes pour le traitement de matières lignocellulosiques, des acides nucléiques les codant et procédés pour leur fabrication et leur utilisation
WO2008106662A2 (fr) 2007-03-01 2008-09-04 Verenium Corporation Nitrilases, acides nucléiques les codant et procédés de fabrication et d'utilisation de ceux-ci
WO2009045627A2 (fr) 2007-10-03 2009-04-09 Verenium Corporation Xylanases, acides nucléiques codant pour elles et leurs méthodes d'obtention et d'utilisation
WO2009088949A1 (fr) 2008-01-03 2009-07-16 Verenium Corporation Transférases et oxydoréductases, acides nucléiques codant pour celles-ci, et leurs procédés de fabrication et d'utilisation
EP2112227A1 (fr) 2006-03-07 2009-10-28 Cargill, Incorporated Aldolases, acides nucléiques les codant et procédés de fabrication et d'utilisation de celles-ci
US7662551B2 (en) 2000-12-22 2010-02-16 Alligator Bioscience Ab Synthesis of hybrid polynucleotide molecules using single-stranded polynucleotide molecules
WO2010025395A2 (fr) 2008-08-29 2010-03-04 Verenium Corporation Hydrolase, acides nucléiques les codant et procédés de fabrication et d’utilisation associés
EP2169076A2 (fr) 2001-02-21 2010-03-31 Verenium Corporation Enzymes dotées d'une activité alpha amylase et leurs procédés d'utilisation
EP2194133A2 (fr) 2003-03-06 2010-06-09 Verenium Corporation Amylases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2216403A2 (fr) 2006-02-02 2010-08-11 Verenium Corporation Estérases et acides nucléiques associés et procédés
US7795030B2 (en) 1994-02-17 2010-09-14 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
WO2010135588A2 (fr) 2009-05-21 2010-11-25 Verenium Corporation Phytases, acides nucléiques codant pour elles et procédés de fabrication et d'utilisation associés
EP2298871A1 (fr) 2002-04-19 2011-03-23 Verenium Corporation Phospholipases, acides nucléiques les codant, et méthodes pour leur production et leur utilisation
WO2011046815A1 (fr) 2009-10-16 2011-04-21 Bunge Oils, Inc. Procédés de démucilagination d'huile
WO2011046812A1 (fr) 2009-10-16 2011-04-21 Verenium Corporation Phospholipases, acides nucléiques codant pour celles-ci et leurs procédés de fabrication et d'utilisation
EP2319919A1 (fr) 2001-06-21 2011-05-11 Verenium Corporation Nitralases
WO2011100667A1 (fr) 2010-02-14 2011-08-18 Ls9, Inc. Tensio-actif et compositions nettoyantes comprenant des alcools gras ramifiés produits par voie microbienne
EP2385108A1 (fr) 2006-03-07 2011-11-09 Verenium Corporation Aldolases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2397486A1 (fr) 2006-09-21 2011-12-21 Verenium Corporation Phytases, acides nucléiques encodant celles-ci et méthodes pour leur fabrication et leur utilisation
EP2404930A1 (fr) 2003-07-02 2012-01-11 Verenium Corporation Glucanases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
WO2012009660A2 (fr) 2010-07-15 2012-01-19 The Procter & Gamble Company Compositions détergentes contenant des alcools gras et des dérivés de ceux-ci produits par voie microbienne
EP2415864A1 (fr) 2006-02-10 2012-02-08 Verenium Corporation Enzymes Oligomerase-2 (ou beta-xylosidase), acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2444413A1 (fr) 2006-08-04 2012-04-25 Verenium Corporation Procédé pour forage de puits de pétrole ou de gaz, injection et/ou fracturation
WO2012096686A1 (fr) 2011-01-14 2012-07-19 Ls9, Inc. Production d'acides gras à chaîne ramifiée et de leurs dérivés dans des cellules microbiennes recombinantes
WO2012135760A1 (fr) 2011-03-30 2012-10-04 Ls9, Inc. Compositions comportant des esters d'acides gras bêta-hydroxy et procédés de fabrication de ces esters
WO2012154329A1 (fr) 2011-04-01 2012-11-15 Ls9, Inc. Procédés et compositions pour une production améliorée des acides gras et leurs dérivés
WO2013019647A1 (fr) 2011-08-03 2013-02-07 Ls9, Inc. Production d'acide gras et de leurs dérivés présentant de meilleures caractéristiques de longueur de chaine aliphatique et de saturation
WO2013039563A1 (fr) 2010-09-15 2013-03-21 Ls9, Inc. Production de dérivés d'acide gras à chaîne paire dans cellules microbiennes recombinantes
WO2013152052A2 (fr) 2012-04-02 2013-10-10 Ls9, Inc. Nouvelles enzymes car et production améliorée d'alcools gras
WO2013152051A2 (fr) 2012-04-02 2013-10-10 Ls9, Inc. Production améliorée de dérivés d'acides gras
EP2706122A2 (fr) 2008-01-03 2014-03-12 Verenium Corporation Isomérases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
WO2014042693A1 (fr) 2012-09-14 2014-03-20 Ls9, Inc. Variants d'enzyme dont les propriétés d'ester synthase sont améliorées
WO2014058866A2 (fr) 2012-10-11 2014-04-17 Brandeis University Traitement de la sclérose latérale amyotrophique
WO2014093505A2 (fr) 2012-12-12 2014-06-19 Ls9, Inc. Production médiée par acp de dérivés d'acides gras
WO2014113571A2 (fr) 2013-01-16 2014-07-24 Ls9, Inc. Acyl-acp réductase présentant des propriétés améliorées
EP2796559A1 (fr) 2008-10-28 2014-10-29 LS9, Inc. Procédés et compositions pour la production d'alcools gras
US8883988B2 (en) 1999-03-02 2014-11-11 Life Technologies Corporation Compositions for use in recombinational cloning of nucleic acids
US8945884B2 (en) 2000-12-11 2015-02-03 Life Technologies Corporation Methods and compositions for synthesis of nucleic acid molecules using multiplerecognition sites
WO2015038970A2 (fr) 2013-09-13 2015-03-19 REG Life Sciences, LLC Variants d'acétyl-coa carboxylase améliorés
EP2853593A1 (fr) 2003-03-07 2015-04-01 DSM IP Assets B.V. Hydrolases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2886658A1 (fr) 2005-03-10 2015-06-24 BASF Enzymes LLC Enzymes de lyase, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2910630A1 (fr) 2009-09-25 2015-08-26 REG Life Sciences, LLC Production de dérivés d'acides gras
EP2927315A1 (fr) 2008-05-16 2015-10-07 REG Life Sciences, LLC Procédés et compositions pour la production des alcools et aldéhydes gras
WO2015195697A1 (fr) 2014-06-16 2015-12-23 REG Life Sciences, LLC Polypeptides de fusion associés à oméga-hydroxylase à propriétés améliorées
EP2975122A2 (fr) 2008-10-07 2016-01-20 REG Life Sciences, LLC Procédés et compositions pour la production d'aldéhydes gras
US9534252B2 (en) 2003-12-01 2017-01-03 Life Technologies Corporation Nucleic acid molecules containing recombination sites and methods of using the same
WO2017106205A1 (fr) 2015-12-15 2017-06-22 REG Life Sciences, LLC Variants de polypeptides de fusion associés à oméga-hydroxylase, et ayant des propriétés améliorées
EP3190182A1 (fr) 2004-03-08 2017-07-12 DSM IP Assets B.V. Phospholipases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
US10711288B2 (en) 2013-06-14 2020-07-14 Genomatica, Inc. Methods of producing omega-hydroxylated fatty acid derivatives

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4642334A (en) * 1982-03-15 1987-02-10 Dnax Research Institute Of Molecular And Cellular Biology, Inc. Hybrid DNA prepared binding composition
US4683195A (en) * 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4816397A (en) * 1983-03-25 1989-03-28 Celltech, Limited Multichain polypeptides or proteins and processes for their production

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2016841C (fr) * 1989-05-16 1999-09-21 William D. Huse Methode de production de polymeres ayant une activite choisie

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4642334A (en) * 1982-03-15 1987-02-10 Dnax Research Institute Of Molecular And Cellular Biology, Inc. Hybrid DNA prepared binding composition
US4816397A (en) * 1983-03-25 1989-03-28 Celltech, Limited Multichain polypeptides or proteins and processes for their production
US4683195A (en) * 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683195B1 (fr) * 1986-01-30 1990-11-27 Cetus Corp

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Proceedings of the National Academy of Sciences, Volume 82, issued November 1985, J.F. SENECOFF et al., "The FLP recombinase of the yeast 2-um plasmid: characterization of its recombination site", pages 7270-7274, see entire article. *
See also references of EP0528881A4 *

Cited By (204)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6117679A (en) * 1994-02-17 2000-09-12 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6277638B1 (en) 1994-02-17 2001-08-21 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6309883B1 (en) 1994-02-17 2001-10-30 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US8048674B2 (en) 1994-02-17 2011-11-01 Codexis Mayflower Holdings, Llc Methods and compositions for cellular and metabolic engineering
US7795030B2 (en) 1994-02-17 2010-09-14 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US6344356B1 (en) 1994-02-17 2002-02-05 Maxygen, Inc. Methods for recombining nucleic acids
US6506603B1 (en) 1994-02-17 2003-01-14 Maxygen, Inc. Shuffling polynucleotides by incomplete extension
US6372497B1 (en) 1994-02-17 2002-04-16 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6287861B1 (en) 1994-02-17 2001-09-11 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6291242B1 (en) 1994-02-17 2001-09-18 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US7105297B2 (en) 1994-02-17 2006-09-12 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US6391640B1 (en) 1994-02-17 2002-05-21 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US6180406B1 (en) 1994-02-17 2001-01-30 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6413774B1 (en) 1994-02-17 2002-07-02 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
EP1229113A3 (fr) * 1995-06-07 2002-11-27 Invitrogen Corporation Clonage recombinatoire au moyen d'acides nucléiques possédant des sites de recombinaison
US6270969B1 (en) 1995-06-07 2001-08-07 Invitrogen Corporation Recombinational cloning using engineered recombination sites
EP1227147A2 (fr) * 1995-06-07 2002-07-31 Invitrogen Corporation Clonage de recombinaison au moyen de sites de recombinaison obtenus par génie génétique
EP1229113A2 (fr) * 1995-06-07 2002-08-07 Invitrogen Corporation Clonage recombinatoire au moyen d'acides nucléiques possédant des sites de recombinaison
US6171861B1 (en) 1995-06-07 2001-01-09 Life Technologies, Inc. Recombinational cloning using engineered recombination sites
EP1227147A3 (fr) * 1995-06-07 2002-08-14 Invitrogen Corporation Clonage de recombinaison au moyen de sites de recombinaison obtenus par génie génétique
US6143557A (en) * 1995-06-07 2000-11-07 Life Technologies, Inc. Recombination cloning using engineered recombination sites
US6720140B1 (en) 1995-06-07 2004-04-13 Invitrogen Corporation Recombinational cloning using engineered recombination sites
US6455254B1 (en) 1995-07-18 2002-09-24 Diversa Corporation Sequence based screening
US6528249B1 (en) 1995-07-18 2003-03-04 Diversa Corporation Protein activity screening of clones having DNA from uncultivated microorganisms
US6656677B2 (en) 1995-07-18 2003-12-02 Diversa Corporation Enzyme kits and libraries
US6566050B2 (en) 1995-07-18 2003-05-20 Diversa Corporation Enzyme kits and libraries
US5958672A (en) * 1995-07-18 1999-09-28 Diversa Corporation Protein activity screening of clones having DNA from uncultivated microorganisms
US6280926B1 (en) 1995-07-18 2001-08-28 Diversa Corporation Gene expression library produced from DNA from uncultivated microorganisms and methods for making the same
US6849395B2 (en) 1995-07-18 2005-02-01 Diversa Corporation Gene cluster screening of clones having DNA from mixed populations of organisms
US6004788A (en) * 1995-07-18 1999-12-21 Diversa Corporation Enzyme kits and libraries
US6790605B1 (en) 1995-12-07 2004-09-14 Diversa Corporation Methods for obtaining a desired bioactivity or biomolecule using DNA libraries from an environmental source
US6344328B1 (en) 1995-12-07 2002-02-05 Diversa Corporation Method for screening for enzyme activity
US6740506B2 (en) 1995-12-07 2004-05-25 Diversa Corporation End selection in directed evolution
US6713279B1 (en) 1995-12-07 2004-03-30 Diversa Corporation Non-stochastic generation of genetic vaccines and enzymes
US6054267A (en) * 1995-12-07 2000-04-25 Diversa Corporation Method for screening for enzyme activity
US6939689B2 (en) 1995-12-07 2005-09-06 Diversa Corporation Exonuclease-mediated nucleic acid reassembly in directed evolution
US6713281B2 (en) 1995-12-07 2004-03-30 Diversa Corporation Directed evolution of thermophilic enzymes
US5939250A (en) * 1995-12-07 1999-08-17 Diversa Corporation Production of enzymes having desired activities by mutagenesis
US7018793B1 (en) 1995-12-07 2006-03-28 Diversa Corporation Combinatorial screening of mixed populations of organisms
US6713282B2 (en) 1995-12-07 2004-03-30 Diversa Corporation End selection in directed evolution
US6361974B1 (en) 1995-12-07 2002-03-26 Diversa Corporation Exonuclease-mediated nucleic acid reassembly in directed evolution
US6632600B1 (en) 1995-12-07 2003-10-14 Diversa Corporation Altered thermostability of enzymes
US6635449B2 (en) 1995-12-07 2003-10-21 Diversa Corporation Exonuclease-mediated nucleic acid reassembly in directed evolution
US6358709B1 (en) 1995-12-07 2002-03-19 Diversa Corporation End selection in directed evolution
US6165793A (en) * 1996-03-25 2000-12-26 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6489145B1 (en) 1996-07-09 2002-12-03 Diversa Corporation Method of DNA shuffling
US5965408A (en) * 1996-07-09 1999-10-12 Diversa Corporation Method of DNA reassembly by interrupting synthesis
US6440668B1 (en) 1996-07-09 2002-08-27 Diversa Corporation Method of DNA shuffling with polynucleotides produced by blocking or interrupting a synthesis or amplification process
US6303344B1 (en) 1996-12-18 2001-10-16 Maxygen, Inc. Methods and compositions for polypeptide engineering
US6828093B1 (en) 1997-02-28 2004-12-07 Baylor College Of Medicine Rapid subcloning using site-specific recombination
US6177263B1 (en) * 1997-03-25 2001-01-23 California Institute Of Technology Recombination of polynucleotide sequences using random or defined primers
US6153410A (en) * 1997-03-25 2000-11-28 California Institute Of Technology Recombination of polynucleotide sequences using random or defined primers
US6495321B1 (en) 1997-06-16 2002-12-17 Bioinvent International Ab Method for in vitro molecular evolution of protein function
US6277608B1 (en) 1997-10-24 2001-08-21 Invitrogen Corporation Recombinational cloning using nucleic acids having recombination sites
WO1999021977A1 (fr) * 1997-10-24 1999-05-06 Life Technologies, Inc. Clonage recombinatoire au moyen d'acides nucleiques possedant des sites de recombinaison
US6964861B1 (en) 1998-11-13 2005-11-15 Invitrogen Corporation Enhanced in vitro recombinational cloning of using ribosomal proteins
US8883988B2 (en) 1999-03-02 2014-11-11 Life Technologies Corporation Compositions for use in recombinational cloning of nucleic acids
USRE45349E1 (en) 1999-06-14 2015-01-20 Bp Corporation North America Inc. Synthetic ligation reassembly in directed evolution
US6537776B1 (en) 1999-06-14 2003-03-25 Diversa Corporation Synthetic ligation reassembly in directed evolution
WO2001048175A2 (fr) 1999-12-29 2001-07-05 Diversa Corporation METHODES DESTINEES A LA PRODUCTION D'ACIDES CARBOXYLIQUES α-SUBSTITUES ENANTIOMERIQUEMENT PURS
US9309520B2 (en) 2000-08-21 2016-04-12 Life Technologies Corporation Methods and compositions for synthesis of nucleic acid molecules using multiple recognition sites
US8945884B2 (en) 2000-12-11 2015-02-03 Life Technologies Corporation Methods and compositions for synthesis of nucleic acid molecules using multiplerecognition sites
US7282334B2 (en) 2000-12-12 2007-10-16 Alligator Bioscience, Ab Method for in vitro molecular evolution of protein function
US6958213B2 (en) 2000-12-12 2005-10-25 Alligator Bioscience Ab Method for in vitro molecular evolution of protein function
US7662551B2 (en) 2000-12-22 2010-02-16 Alligator Bioscience Ab Synthesis of hybrid polynucleotide molecules using single-stranded polynucleotide molecules
EP3305894A1 (fr) 2001-02-21 2018-04-11 BASF Enzymes LLC Enzymes dotées d'une activité alpha amylase et leurs procédés d'utilisation
EP2292784A2 (fr) 2001-02-21 2011-03-09 Verenium Corporation Enzymes dotées d'une activité alpha amylase et leurs procédés d'utilisation
EP2169076A2 (fr) 2001-02-21 2010-03-31 Verenium Corporation Enzymes dotées d'une activité alpha amylase et leurs procédés d'utilisation
EP2327767A1 (fr) 2001-06-21 2011-06-01 Verenium Corporation Nitralases
EP2327765A1 (fr) 2001-06-21 2011-06-01 Verenium Corporation Nitralases
EP2319919A1 (fr) 2001-06-21 2011-05-11 Verenium Corporation Nitralases
EP2327766A1 (fr) 2001-06-21 2011-06-01 Verenium Corporation Nitralases
EP2298871A1 (fr) 2002-04-19 2011-03-23 Verenium Corporation Phospholipases, acides nucléiques les codant, et méthodes pour leur production et leur utilisation
EP3023498A1 (fr) 2003-03-06 2016-05-25 BASF Enzymes LLC Amylases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2194133A2 (fr) 2003-03-06 2010-06-09 Verenium Corporation Amylases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP3508578A1 (fr) 2003-03-06 2019-07-10 BASF Enzymes, LLC Amylases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2853593A1 (fr) 2003-03-07 2015-04-01 DSM IP Assets B.V. Hydrolases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2341136A1 (fr) 2003-04-04 2011-07-06 Verenium Corporation Pectate lyases, acides nucléiques codant ces dernières et procédés de fabrication et d'utilisation
WO2004090099A2 (fr) 2003-04-04 2004-10-21 Diversa Corporation Pectate lyases, acides nucleiques codant ces dernieres et procedes de fabrication et d'utilisation
EP2404931A1 (fr) 2003-07-02 2012-01-11 Verenium Corporation Glucanases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2409981A1 (fr) 2003-07-02 2012-01-25 Verenium Corporation Glucanases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2404928A1 (fr) 2003-07-02 2012-01-11 Verenium Corporation Glucanases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2404929A1 (fr) 2003-07-02 2012-01-11 Verenium Corporation Glucanases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2404930A1 (fr) 2003-07-02 2012-01-11 Verenium Corporation Glucanases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
WO2005021714A2 (fr) 2003-08-11 2005-03-10 Diversa Corporation Laccases, acides nucleiques codant pour ces enzymes et procedes permettant de les produire et de les utiliser
US9534252B2 (en) 2003-12-01 2017-01-03 Life Technologies Corporation Nucleic acid molecules containing recombination sites and methods of using the same
EP3190182A1 (fr) 2004-03-08 2017-07-12 DSM IP Assets B.V. Phospholipases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2468853A1 (fr) 2004-06-16 2012-06-27 Verenium Corporation Composition et procédés de décoloration enzymatique de la chlorophylle
WO2006009676A2 (fr) 2004-06-16 2006-01-26 Diversa Corporation Compositions et procedes pour la decoloration enzymatique de la chlorophylle
EP2886658A1 (fr) 2005-03-10 2015-06-24 BASF Enzymes LLC Enzymes de lyase, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
WO2006101584A2 (fr) 2005-03-15 2006-09-28 Diversa Corporation Cellulases, acides nucleiques codant pour ces cellulases, et procedes de production et d'utilisation de ces cellulases
EP2949756A2 (fr) 2005-03-15 2015-12-02 BP Corporation North America Inc. Cellulases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2216403A2 (fr) 2006-02-02 2010-08-11 Verenium Corporation Estérases et acides nucléiques associés et procédés
EP2420570A1 (fr) 2006-02-10 2012-02-22 Verenium Corporation Enzyme Arabinofuranosidases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2444487A1 (fr) 2006-02-10 2012-04-25 Verenium Corporation Enzymes cellulolytiques, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2450439A1 (fr) 2006-02-10 2012-05-09 Verenium Corporation Enzymes cellulolytiques, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2415864A1 (fr) 2006-02-10 2012-02-08 Verenium Corporation Enzymes Oligomerase-2 (ou beta-xylosidase), acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2444490A1 (fr) 2006-02-10 2012-04-25 Verenium Corporation Enzymes cellulolytiques, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2447363A1 (fr) 2006-02-10 2012-05-02 Verenium Corporation Enzymes cellulolytiques, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2444488A1 (fr) 2006-02-10 2012-04-25 Verenium Corporation Enzymes cellulolytiques, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2444489A1 (fr) 2006-02-10 2012-04-25 Verenium Corporation Enzymes cellulolytiques, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2548954A1 (fr) 2006-02-14 2013-01-23 Verenium Corporation Xylanases, acides nucléiques les codant et leurs procédés de fabrication et dýutilisation
EP2548956A1 (fr) 2006-02-14 2013-01-23 Verenium Corporation Xylanases, acides nucléiques les codant et leurs procédés de fabrication et dýutilisation
EP2548955A1 (fr) 2006-02-14 2013-01-23 Verenium Corporation Xylanases, acides nucléiques les codant et leurs procédés de fabrication et dýutilisation
WO2007095398A2 (fr) 2006-02-14 2007-08-23 Verenium Corporation Xylanases, acides nucléiques codant pour elles et leurs procédés de préparation et d'utilisation
EP2388316A2 (fr) 2006-03-07 2011-11-23 Verenium Corporation Aldolases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2112227A1 (fr) 2006-03-07 2009-10-28 Cargill, Incorporated Aldolases, acides nucléiques les codant et procédés de fabrication et d'utilisation de celles-ci
EP2316962A1 (fr) 2006-03-07 2011-05-04 Cargill, Incorporated Aldolases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2385108A1 (fr) 2006-03-07 2011-11-09 Verenium Corporation Aldolases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2322643A1 (fr) 2006-03-07 2011-05-18 Cargill, Incorporated Aldolases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP3153580A2 (fr) 2006-03-07 2017-04-12 BASF Enzymes LLC Aldolases, acides nucléiques les codant et procédés de fabrication et d'utilisation de celles-ci
EP2444413A1 (fr) 2006-08-04 2012-04-25 Verenium Corporation Procédé pour forage de puits de pétrole ou de gaz, injection et/ou fracturation
EP2617823A2 (fr) 2006-09-21 2013-07-24 Verenium Corporation Phytases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2617815A2 (fr) 2006-09-21 2013-07-24 Verenium Corporation Phytases, acides nucléiques encodant celles-ci et méthodes pour leur fabrication et leur utilisation
EP2620495A2 (fr) 2006-09-21 2013-07-31 Verenium Corporation Phytases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2617821A2 (fr) 2006-09-21 2013-07-24 Verenium Corporation Phytases, acides nucléiques encodant celles-ci et méthodes pour leur fabrication et leur utilisation
EP2617816A2 (fr) 2006-09-21 2013-07-24 Verenium Corporation Phytases, acides nucléiques encodant celles-ci et méthodes pour leur fabrication et leur utilisation
WO2008036863A2 (fr) 2006-09-21 2008-03-27 Verenium Corporation Phospholipases, acides nucléiques codant pour elles et leurs méthodes d'obtention et d'utilisation
EP2397486A1 (fr) 2006-09-21 2011-12-21 Verenium Corporation Phytases, acides nucléiques encodant celles-ci et méthodes pour leur fabrication et leur utilisation
EP2617819A2 (fr) 2006-09-21 2013-07-24 Verenium Corporation Phytases, acides nucléiques encodant celles-ci et méthodes pour leur fabrication et leur utilisation
EP2617820A2 (fr) 2006-09-21 2013-07-24 Verenium Corporation Phytases, acides nucléiques encodant celles-ci et méthodes pour leur fabrication et leur utilisation
EP2617728A2 (fr) 2006-09-21 2013-07-24 Verenium Corporation Phytases, acides nucléiques encodant celles-ci et méthodes pour leur fabrication et leur utilisation
EP2617817A2 (fr) 2006-09-21 2013-07-24 Verenium Corporation Phytases, acides nucléiques encodant celles-ci et méthodes pour leur fabrication et leur utilisation
EP2617729A2 (fr) 2006-09-21 2013-07-24 Verenium Corporation Phytases, acides nucléiques encodant celles-ci et méthodes pour leur fabrication et leur utilisation
EP2479267A1 (fr) 2006-12-21 2012-07-25 Verenium Corporation Amylases et glucoamylases, acides nucléiques les codant, et leurs procédés de fabrication
EP2479266A1 (fr) 2006-12-21 2012-07-25 Verenium Corporation Amylases et glucoamylases, acides nucléiques les codant, et leurs procédés de fabrication
EP3540053A1 (fr) 2006-12-21 2019-09-18 BASF Enzymes, LLC Amylases et glucoamylases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
WO2008080093A2 (fr) 2006-12-21 2008-07-03 Verenium Corporation Amylases et glucoamylases, acides nucléiques les codant, et leurs procédés de fabrication
EP3101128A1 (fr) 2006-12-21 2016-12-07 BASF Enzymes LLC Amylases et glucoamylases, acides nucleiques les codant, et leurs procedes de fabrication
WO2008095033A2 (fr) 2007-01-30 2008-08-07 Verenium Corporation Enzymes pour le traitement de matières lignocellulosiques, des acides nucléiques les codant et procédés pour leur fabrication et leur utilisation
WO2008106662A2 (fr) 2007-03-01 2008-09-04 Verenium Corporation Nitrilases, acides nucléiques les codant et procédés de fabrication et d'utilisation de ceux-ci
WO2009045627A2 (fr) 2007-10-03 2009-04-09 Verenium Corporation Xylanases, acides nucléiques codant pour elles et leurs méthodes d'obtention et d'utilisation
EP2708602A2 (fr) 2007-10-03 2014-03-19 Verenium Corporation Xylanases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
EP2706122A2 (fr) 2008-01-03 2014-03-12 Verenium Corporation Isomérases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
WO2009088949A1 (fr) 2008-01-03 2009-07-16 Verenium Corporation Transférases et oxydoréductases, acides nucléiques codant pour celles-ci, et leurs procédés de fabrication et d'utilisation
EP2865750A2 (fr) 2008-01-03 2015-04-29 BASF Enzymes LLC Transférases et oxydoréductases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
US9481899B2 (en) 2008-05-16 2016-11-01 REG Life Sciences, LLC Methods and compositions for producing hydrocarbons
US10563231B2 (en) 2008-05-16 2020-02-18 Genomatica, Inc. Methods and compositions for producing hydrocarbons
US9670512B2 (en) 2008-05-16 2017-06-06 REG Life Sciences, LLC Methods and compositions for producing fatty alcohols or fatty aldehydes
EP3483265A1 (fr) 2008-05-16 2019-05-15 REG Life Sciences, LLC Procédés et compositions pour la production des alcools et aldéhydes gras
EP2927315A1 (fr) 2008-05-16 2015-10-07 REG Life Sciences, LLC Procédés et compositions pour la production des alcools et aldéhydes gras
US11186854B2 (en) 2008-05-16 2021-11-30 Genomatica, Inc. Methods and compositions for producing hydrocarbons
EP2998393A1 (fr) 2008-05-16 2016-03-23 REG Life Sciences, LLC Procédés et compositions pour la production d'hydrocarbures
WO2010025395A2 (fr) 2008-08-29 2010-03-04 Verenium Corporation Hydrolase, acides nucléiques les codant et procédés de fabrication et d’utilisation associés
EP2975122A2 (fr) 2008-10-07 2016-01-20 REG Life Sciences, LLC Procédés et compositions pour la production d'aldéhydes gras
EP2796559A1 (fr) 2008-10-28 2014-10-29 LS9, Inc. Procédés et compositions pour la production d'alcools gras
WO2010135588A2 (fr) 2009-05-21 2010-11-25 Verenium Corporation Phytases, acides nucléiques codant pour elles et procédés de fabrication et d'utilisation associés
EP2698374A1 (fr) 2009-05-21 2014-02-19 Verenium Corporation Phytases, acides nucléiques les codant et leurs procédés de fabrication et d'utilisation
US10316298B2 (en) 2009-09-25 2019-06-11 REG Life Sciences, LLC Production of fatty acid derivatives
EP2910630A1 (fr) 2009-09-25 2015-08-26 REG Life Sciences, LLC Production de dérivés d'acides gras
WO2011046812A1 (fr) 2009-10-16 2011-04-21 Verenium Corporation Phospholipases, acides nucléiques codant pour celles-ci et leurs procédés de fabrication et d'utilisation
US9045712B2 (en) 2009-10-16 2015-06-02 Bunge Global Innovation, Llc Oil degumming methods
US9512382B2 (en) 2009-10-16 2016-12-06 Bunge Global Innovation, Llc Oil degumming methods
WO2011046815A1 (fr) 2009-10-16 2011-04-21 Bunge Oils, Inc. Procédés de démucilagination d'huile
WO2011100667A1 (fr) 2010-02-14 2011-08-18 Ls9, Inc. Tensio-actif et compositions nettoyantes comprenant des alcools gras ramifiés produits par voie microbienne
WO2012009660A2 (fr) 2010-07-15 2012-01-19 The Procter & Gamble Company Compositions détergentes contenant des alcools gras et des dérivés de ceux-ci produits par voie microbienne
EP3957736A1 (fr) 2010-09-15 2022-02-23 Genomatica, Inc. Production de dérivés d'acide gras à chaîne paire dans cellules microbiennes recombinantes
WO2013039563A1 (fr) 2010-09-15 2013-03-21 Ls9, Inc. Production de dérivés d'acide gras à chaîne paire dans cellules microbiennes recombinantes
EP3456814A2 (fr) 2011-01-14 2019-03-20 REG Life Sciences, LLC Production d'acides gras à chaîne ramifiée et de leurs dérivés dans des cellules microbiennes recombinantes
WO2012096686A1 (fr) 2011-01-14 2012-07-19 Ls9, Inc. Production d'acides gras à chaîne ramifiée et de leurs dérivés dans des cellules microbiennes recombinantes
EP4282972A2 (fr) 2011-01-14 2023-11-29 Genomatica, Inc. Production d'acides gras à chaîne ramifiée et de leurs dérivés dans des cellules microbiennes recombinantes
WO2012135760A1 (fr) 2011-03-30 2012-10-04 Ls9, Inc. Compositions comportant des esters d'acides gras bêta-hydroxy et procédés de fabrication de ces esters
WO2012154329A1 (fr) 2011-04-01 2012-11-15 Ls9, Inc. Procédés et compositions pour une production améliorée des acides gras et leurs dérivés
EP3702363A1 (fr) 2011-04-01 2020-09-02 Genomatica, Inc. Les cellules bactériennes surexprimant fadr pour une production améliorée des acides gras et leurs dérivés
WO2013019647A1 (fr) 2011-08-03 2013-02-07 Ls9, Inc. Production d'acide gras et de leurs dérivés présentant de meilleures caractéristiques de longueur de chaine aliphatique et de saturation
WO2013152051A2 (fr) 2012-04-02 2013-10-10 Ls9, Inc. Production améliorée de dérivés d'acides gras
EP3674400A1 (fr) 2012-04-02 2020-07-01 Genomatica, Inc. Production améliorée de dérivés d'acide gras
US9758769B2 (en) 2012-04-02 2017-09-12 REG Life Sciences, LLC Car enzymes and improved production of fatty alcohols
EP4186974A1 (fr) 2012-04-02 2023-05-31 Genomatica, Inc. Enzymes car et production améliorée d'alcools gras
US11060099B2 (en) 2012-04-02 2021-07-13 Genomatica, Inc. Production of fatty acid derivatives
US11034937B2 (en) 2012-04-02 2021-06-15 Genomatica, Inc. Car enzymes and improved production of fatty alcohols
EP3985108A1 (fr) 2012-04-02 2022-04-20 Genomatica, Inc. Enzymes car et production améliorée d'alcools gras
EP3153579A1 (fr) 2012-04-02 2017-04-12 REG Life Sciences, LLC Enzymes car et production améliorée d'alcools gras
WO2013152052A2 (fr) 2012-04-02 2013-10-10 Ls9, Inc. Nouvelles enzymes car et production améliorée d'alcools gras
EP3385374A1 (fr) 2012-04-02 2018-10-10 REG Life Sciences, LLC Enzymes car et production améliorée d'alcools gras
EP3674399A1 (fr) 2012-04-02 2020-07-01 Genomatica, Inc. Enzymes car et production améliorée d'alcools gras
US9879239B2 (en) 2012-09-14 2018-01-30 REG Life Sciences, LLC Enzyme variants with improved ester synthase properties
WO2014042693A1 (fr) 2012-09-14 2014-03-20 Ls9, Inc. Variants d'enzyme dont les propriétés d'ester synthase sont améliorées
EP3299455A1 (fr) 2012-09-14 2018-03-28 REG Life Sciences, LLC Enzymvarianten mit verbesserten estersynthaseeigenschaften
US10894953B2 (en) 2012-09-14 2021-01-19 Genomatica, Inc. Enzyme variants with improved ester synthase properties
WO2014058866A2 (fr) 2012-10-11 2014-04-17 Brandeis University Traitement de la sclérose latérale amyotrophique
EP3657168A1 (fr) 2012-10-11 2020-05-27 Brandeis University Traitement de la sclérose latérale amyotrophique
WO2014093505A2 (fr) 2012-12-12 2014-06-19 Ls9, Inc. Production médiée par acp de dérivés d'acides gras
EP3385375A1 (fr) 2013-01-16 2018-10-10 REG Life Sciences, LLC Acyl-acp réductase présentant des propriétés améliorées
US11130944B2 (en) 2013-01-16 2021-09-28 Genomatica, Inc. Acyl-ACP reductase with improved properties
WO2014113571A2 (fr) 2013-01-16 2014-07-24 Ls9, Inc. Acyl-acp réductase présentant des propriétés améliorées
US9873865B2 (en) 2013-01-16 2018-01-23 REG Life Sciences, LLC Acyl-ACP reductase with improved properties
EP3103867A1 (fr) 2013-01-16 2016-12-14 REG Life Sciences, LLC Acyl-acp réductase présentant des propriétés améliorées
US10208294B2 (en) 2013-01-16 2019-02-19 REG Life Sciences, LLC Acyl-ACP reductase with improved properties
US9683219B2 (en) 2013-01-16 2017-06-20 REG Life Sciences, LLC Acyl-ACP reductase with improved properties
US10711288B2 (en) 2013-06-14 2020-07-14 Genomatica, Inc. Methods of producing omega-hydroxylated fatty acid derivatives
EP3745133A1 (fr) 2013-06-14 2020-12-02 Genomatica, Inc. Procédés de production de dérivés d'acides gras oméga-hydroxylés
EP3739042A1 (fr) 2013-09-13 2020-11-18 Genomatica, Inc. Variantes améliorées d'acétyl-coa carboxylase
EP3255145A1 (fr) 2013-09-13 2017-12-13 REG Life Sciences, LLC Variants d'acétyl-coa carboxylase améliorés
WO2015038970A2 (fr) 2013-09-13 2015-03-19 REG Life Sciences, LLC Variants d'acétyl-coa carboxylase améliorés
WO2015195697A1 (fr) 2014-06-16 2015-12-23 REG Life Sciences, LLC Polypeptides de fusion associés à oméga-hydroxylase à propriétés améliorées
US11421206B2 (en) 2014-06-16 2022-08-23 Genomatica, Inc. Omega-hydroxylase-related fusion polypeptides with improved properties
US11441130B2 (en) 2014-06-16 2022-09-13 Genomatica, Inc. Omega-hydroxylase-related fusion polypeptides with improved properties
EP3690035A2 (fr) 2014-06-16 2020-08-05 Genomatica, Inc. Polypeptides de fusion associés à oméga-hydroxylase à propriétés améliorées
WO2017106205A1 (fr) 2015-12-15 2017-06-22 REG Life Sciences, LLC Variants de polypeptides de fusion associés à oméga-hydroxylase, et ayant des propriétés améliorées
WO2017101987A1 (fr) 2015-12-15 2017-06-22 REG Life Sciences, LLC Variants de polypeptides de fusion liés à oméga-hydroxylase, à propriétés améliorées
US10787648B2 (en) 2015-12-15 2020-09-29 Genomatica, Inc. Omega-hydroxylase-related fusion polypeptide variants with improved properties
US11384341B2 (en) 2015-12-15 2022-07-12 Genomatica, Inc. Omega-hydroxylase-related fusion polypeptide variants with improved properties
EP4026899A1 (fr) 2015-12-15 2022-07-13 Genomatica, Inc. Variants de polypeptides de fusion associés à oméga-hydroxylase, et ayant des propriétés améliorées

Also Published As

Publication number Publication date
EP0528881A1 (fr) 1993-03-03
EP0528881A4 (en) 1993-05-26
AU7791991A (en) 1991-11-11

Similar Documents

Publication Publication Date Title
WO1991016427A1 (fr) Procedes de creation de phenotype a partir de populations de genes multiples
US6291158B1 (en) Method for tapping the immunological repertoire
US8338107B2 (en) Method for producing polymers having a preselected activity
AU643948B2 (en) A new method for tapping the immunological repertoire
US6291161B1 (en) Method for tapping the immunological repertiore
CA2016841C (fr) Methode de production de polymeres ayant une activite choisie
US6291160B1 (en) Method for producing polymers having a preselected activity
US6969586B1 (en) Method for tapping the immunological repertoire
US7118866B2 (en) Heterodimeric receptor libraries using phagemids
US6680192B1 (en) Method for producing polymers having a preselected activity
IE84214B1 (en) Heterodimeric receptor libraries using phagemids

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA FI JP KR NO

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 1991909118

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1991909118

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: CA

WWW Wipo information: withdrawn in national office

Ref document number: 1991909118

Country of ref document: EP