WO1991015596A1 - Inhibiteurs de la protease du virus de l'hepatite c - Google Patents

Inhibiteurs de la protease du virus de l'hepatite c Download PDF

Info

Publication number
WO1991015596A1
WO1991015596A1 PCT/US1991/002209 US9102209W WO9115596A1 WO 1991015596 A1 WO1991015596 A1 WO 1991015596A1 US 9102209 W US9102209 W US 9102209W WO 9115596 A1 WO9115596 A1 WO 9115596A1
Authority
WO
WIPO (PCT)
Prior art keywords
gly
leu
ala
thr
val
Prior art date
Application number
PCT/US1991/002209
Other languages
English (en)
Inventor
Steven Rosenberg
Original Assignee
Protos, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Protos, Inc. filed Critical Protos, Inc.
Publication of WO1991015596A1 publication Critical patent/WO1991015596A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/24011—Flaviviridae
    • C12N2770/24211—Hepacivirus, e.g. hepatitis C virus, hepatitis G virus
    • C12N2770/24222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • This invention relates to the molecular biology and virology of the hepatitis C virus (HCV). More specifically, this invention relates to a novel protease produced by HCV, methods of expression, recombinant protease, protease mutants, and inhibitors of HCV protease.
  • Non-A, Non-B hepatitis is a transmissible disease (or family of diseases) that is believed to be virally induced, and is distinguishable from other forms of virus-associated liver disease, such as those caused by hepatitis A virus (HAV), hepatitis B virus (HBV), delta hepatitis virus (HDV), cytomegalovirus (CMV) or Epstein-Barr virus (EBV).
  • HAV hepatitis A virus
  • HBV hepatitis B virus
  • HDV delta hepatitis virus
  • CMV cytomegalovirus
  • EBV Epstein-Barr virus
  • HCV hepatitis C virus
  • BB-NANBH blood-associated NANBH
  • viruses including adenoviruses, baculoviruses, comoviruses, picornaviruses, retroviruses, and togaviruses, rely on specific, virally-encoded proteases for processing polypeptides from their initial translated form into mature, active proteins.
  • picornaviruses all of the viral proteins are believed to arise from cleavage of a single polyprotein (B.D. Korant, CRC Crit Rev Biotech (1988) 8:149-57).
  • HIV protease found in HIV-1.
  • the HIV protease was obtained in the form of a fusion protein, by fusing DNA encoding an HIV protease precursor to DNA encoding human superoxide dismutase (hSOD), and expressing the product in E. coli.
  • hSOD human superoxide dismutase
  • Transformed cells expressed products of 36 and 10 kDa (corresponding to the hSOD-protease fusion protein and the protease alone), suggesting that the protease was expressed in a form capable of autocatalytic proteolysis.
  • HCV protease HCV protease fusion proteins, truncated and altered HCV proteases, cloning and expression vectors therefore, and methods for identifying antiviral agents effective for treating HCV.
  • FIG. 1 shows the sequence of HCV protease.
  • Figure 2 shows the polynucleotide sequence and deduced amino acid sequence of the clone C20c.
  • Figure 3 shows the polynucleotide sequence and deduced amino acid sequence of the clone C26d.
  • Figure 4 shows the polynucleotide sequence and deduced amino acid sequence of the clone C8h.
  • Figure 5 shows the polynucleotide sequence and deduced amino acid sequence of the clone C7f.
  • Figure 6 shows the polynucleotide sequence and deduced amino acid sequence of the clone C31.
  • Figure 7 shows the polynucleotide sequence and deduced amino acid sequence of the clone C35.
  • Figure 8 shows the polynucleotide sequence and deduced amino acid sequence of the clone C33c.
  • Figure 9 schematically illustrates assembly of the vector C7fC20cC300C200.
  • Figure 10 shows the sequence for cflSODp600. Modes of Carrying Out The Invention
  • Hepatitis C Virus and "HCV” refer to the viral species that is the major etiological agent of BB-NANBH, the prototype isolate of which is identified in PCT WO89/046699; EPO publication 318,216; USSN 7/355,008, filed
  • ' ⁇ CV as used herein includes the pathogenic strains capable of causing hepatitis C, and attenuated strains or defective interfering particles derived therefrom.
  • the HCV genome is comprised of RNA. It is known that RNA-containing viruses
  • RNA viruses per incorporated nucleotide (Fields & Knipe, "Fundamental Virology” (1986, Raven Press, N.Y.)).
  • heterogeneity and fluidity of genotype are inherent character ⁇ istics of RNA viruses, there will be multiple strains/isolates, which may be virulent or avirulent, within the HCV species.
  • strain or isolate CDC/HCVI also called HCV1
  • Information from one strain or isolate is sufficient to allow those skilled in the art using standard techniques to isolate new strains isolates and to identify whether such new strains/isolates are HCV.
  • strains isolates are described below. These strains, which were obtained from a number of human sera (and from different geographical areas), were isolated utilizing the information from the genomic sequence of HCV1.
  • Flavivirus family contains a large number of viruses which are small, enveloped pathogens of man.
  • the morphology and composition of Flavivirus particles are known, and are discussed in M.A. Brinton, in "The Viruses: The Togaviridae And Flaviviridae” (Series eds. Fraenkel-Conrat and Wagner, vol. eds. Schlesinger and Schlesinger, Plenum Press, 1986), pp. 327-374.
  • Flaviviruses contain a central nucleocapsid surrounded by a lipid bilayer.
  • Virions are spherical and have a diameter of about 40-50 nm. Their cores are about 25-30 nm in diameter. Along the outer surface of the virion envelope are projections measuring about 5-10 nm in length with terminal knobs about 2 nm in diameter.
  • Typical examples of the family include Yellow Fever virus, West Nile virus, and Dengue Fever virus. They possess positive-stranded RNA genomes (about 11,000 nucleotides) that arc slightly larger than that of HCV and encode a polyprotein precursor of about 3500 amino acids. Individual viral proteins are cleaved from this precursor polypeptide.
  • the genome of HCV appears to be single-stranded RNA containing about 10,000 nucleotides.
  • the genome is positive-stranded, and possesses a continuous translational open reading frame (ORF) that encodes a polyprotein of about 3,000 amino acids.
  • ORF continuous translational open reading frame
  • the structural proteins appear to be encoded in ap ⁇ proximately the first quarter of the N-terminal region, with the majority of the polyprotein attributed to non-structural proteins.
  • FIG. 1 A schematic alignment of possible regions of a flaviviral polyprotein (using Yellow Fever Virus as an example), and of a putative polyprotein encoded in the major ORF of the HCV genome, is shown in Figure 1. Possible domains of the HCV polyprotein are indicated in the figure.
  • the Yellow Fever Virus polyprotein contains, from the amino terminus to the carboxy terminus, the nucleocapsid protein (C), the matrix protein (M), the envelope protein (E), and the non-structural proteins 1, 2 (a+b), 3, 4 (a+b), and 5 (NS1, NS2, NS3, NS4, and NS5).
  • HCV Based upon the putative amino acids encoded in the nucleotide sequence of HCV1, a small domain at the extreme N-terminus of the HCV polyprotein appears similar both in size and high con ⁇ tent of basic residues to the nucleocapsid protein (C) found at the N-terminus of flavi ⁇ viral polyproteins.
  • C nucleocapsid protein
  • NS2-5 non-structural proteins 2,3,4, and 5 (NS2-5) of HCV and of yellow fever virus (YFV) appear to have counterparts of similar size and hydropath- icity, although the amino acid sequences diverge.
  • the region of HCV which would correspond to the regions of YFV polyprotein which contains the M, E, and NSl protein not only differs in sequence, but also appears to be quite different in size and hydropathicity.
  • putative HCV strains and isolates are identifiable by their homology at the polypeptide level.
  • new HCV strains or isolates are expected to be at least about 40% homologous, some more than about 70% homologous, and some even more than about 80% homologous: some may be more than about 90% homologous at the polypeptide level.
  • the techniques for determining amino acid sequence homology are known in the art. For example, the amino acid sequence may be determined directly and compared to the sequences provided herein. Alternatively the nucleotide sequence of the genomic material of the putative HCV may be determined (usually via a cDNA intermediate), the amino acid sequence encoded therein can be determined, and the corresponding regions compared.
  • ' ⁇ CV protease refers to an enzyme derived from HCV which exhibits proteolytic activity, specifically the polypeptide encoded in the NS3 domain of the HCV genome. At least one strain of HCV contains a protease believed to be sub ⁇ stantially encoded by or within the following sequence:
  • N and C termini are putative, the actual termini being defined by expression and processing in an appropriate host of a DNA construct encoding the entire NS3 domain. It is understood that this sequence may vary from strain to strain, as RNA viruses like HCV are known to exhibit a great deal of variation. Further, the actual N and C termini may vary, as the protease is cleaved from a precursor polyprotein: variations in the protease amino acid sequence can result in cleavage from the polyprotein at different points. Thus, the amino- and carboxy-termini may differ from strain to strain of HCV.
  • the first amino acid shown above corresponds to residue 60 in Figure 1. However, the minimum sequence necessary for activity can be determined by routine methods.
  • the sequence may be truncated at either end by treating an appropriate expression vector with an exonucle- ase (after cleavage at the 5' or 3' end of the coding sequence) to remove any desired number of base pairs.
  • the resulting coding polynucleotide is then expressed and the sequence determined.
  • the activity of the resulting product may be correlated with the amino acid sequence: a limited series of such experiments (removing progressively greater numbers of base pairs) determines the minimum internal sequence necessary for protease activity.
  • the sequence may be substantially truncated, particularly at the carboxy terminus, apparently with full retention of protease activity. It is presently believed that a portion of the protein at the carboxy terminus may exhibit heHcase activity. However, helicase activity is not required of the HCV proteases of the invention.
  • the amino terminus may also be truncated to a degree without loss of protease activity.
  • the amino acids underlined above are beHeved to be the residues necessary for catalytic activity, based on sequence homology to putative flavivirus serine proteases.
  • Table 1 shows the alignment of the three serine protease catalytic residues for HCV protease and the protease obtained from Yellow Fever Virus, West Nile Fever virus, Murray Valley Fever virus, and Kunjin virus.
  • the other four flavivirus protease sequences exhibit higher homology with each other than with HCV, a degree of homology is still observed with HCV. This homology, however, was not sufficient for indication by currently available alignment software.
  • the indicated amino acids are numbered His ⁇ , Asp 103 , and Ser 161 in the sequence listed above (His 139 , Asp 163 , and Ser ⁇ in Figure 1).
  • catalytic residue assignments based on structural homology.
  • Table 2 shows alignment of HCV with against the catalytic sites of several well-characterized serine proteases based on structural considerations: protease A from Streptomyces griseus, ⁇ -lytic protease, bovine trypsin, chymotrypsin, and eiasiase (M. James et ai, Can J Biochem (1978) 56:396). Again, a degree of homology is observed.
  • the HCV residues identified are numbered His ⁇ , Asp ⁇ , and Ser 161 in the sequence listed above.
  • HCV protease analogs refer to polypeptides which vary from the full length protease sequence by deletion, alteration and/or addition to the amino acid sequence of the native protease.
  • HCV protease analogs include the truncated proteases described above, as weU as HCV protease muteins and fusion proteins comprising HCV protease, truncated protease, or protease muteins.
  • Alterations to form HCV pro ⁇ tease muteins are preferably conservative amino acid substitutions, in which an amino acid is replaced with another naturally-occurring amino acid of similar character. For example, the following substitutions are considered "conservative":
  • Nonconservative changes are generaUy substitutions of one of the above amino acids with an amino acid from a different group (e.g., substituting Asn for Glu), or substituting Cys, Met, His, or Pro for any of the above amino acids.
  • Substitutions involving common amino acids are conveniently performed by site specific mutagenesis of an expression vector encoding the desired protein, and subsequent expression of the altered form.
  • One may also alter amino acids by synthetic or semi- synthetic methods. For example, one may convert cysteine or serine residues to selenocysteine by appropriate chemical treatment of the isolated protein. Alternatively, one may incorporate uncommon amino acids in standard in vitro protein synthetic methods.
  • the total number of residues changed, deleted or added to the native sequence in the muteins wiU be no more than about 20, preferably no more than about 10, and most preferably no more than about 5.
  • fusion protein generally refers to a polypeptide comprising an amino acid sequence drawn from two or more individual proteins.
  • fusion protein is used to denote a polypeptide comprising the HCV protease, truncate, mutein or a functional portion thereof, fused to a non-HCV protein or polypeptide ("fusion partner"). Fusion proteins are most conveniently produced by expression of a fused gene, which encodes a portion of one polypeptide at the 5' end and a portion of a different polypeptide at the 3' end, where the different portions are joined in one reading frame which may be expressed in a suitable host.
  • HCV protease or analog it is presently preferred (although not required) to position the HCV protease or analog at the car- boxy terminus of the fusion protein, and to employ a functional enzyme fragment at the amino terminus.
  • a functional enzyme fragment As the HCV protease is normally expressed within a large polyprotein, it is not expected to include cell transport signals (e.g., export or secretion signals).
  • Suitable functional enzyme fragments are those polypeptides which exhibit a quantifiable activity when expressed fused to the HCV protease.
  • Exemplary enzymes include, without limitation, ⁇ -galactosidase ( ⁇ -gal), ⁇ -lactamase, horseradish per- oxidase (HRP), glucose oxidase (GO), human superoxide dismutase (hSOD), urease, and the like. These enzymes are convenient because the amount of fusion protein produced can be quantified by means of simple colorimetric assays. Alternatively, one may employ antigenic proteins or fragments, to permit simple detection and quantification of fusion proteins using antibodies specific for the fusion partner. The presently preferred fusion partner is hSOD.
  • prokaryotic and eukaryotic host cells are useful for expressing desired coding sequences when appropriate control sequences compatible with the des ⁇ ignated host are used.
  • prokaryotic hosts E. coli is most frequently used.
  • Expression control sequences for prokaryotes include promoters, optionally containing operator portions, and ribosome binding sites.
  • Transfer vectors compatible with prokaryotic hosts are commonly derived from, for example, pBR322, a plasmid containing operons conferring ampicillin and tetracycline resistance, and the various pUC vectors, which also contain sequences conferring antibiotic resistance markers. These plasmids are commercially available. The markers may be used to obtain suc ⁇ cessful transformants by selection.
  • prokaryotic control sequences include the ⁇ -lactamase (penicillinase) and lactose promoter systems (Chang et al, Nature (1977) 198:1056).
  • trp tryptophan
  • trp tryptophan
  • the foregoing systems are particularly compatible with E. coli; if desired, other prokaryotic hosts such as strains of Bacillus or Pseudomonas may be used, with corresponding control sequences.
  • Eukaryotic hosts include without limitation yeast and mammalian ceUs in culture systems.
  • Yeast expression hosts include Saccharomyces, Klebsiella, Picia, and the Hke. Saccharomyces cerevisiae and Saccharomyces carlsbergensis and K. lactis are the most commonly used yeast hosts, and are convenient fungal hosts.
  • Yeast-compatible vectors carry markers which permit selection of successful transfor- mants by conferring prototrophy to auxotrophic mutants or resistance to heavy metals on wild-type strains.
  • Yeast compatible vectors may employ the 2 ⁇ origin of replication (Broach et al, Meth Enzvmol (1983) JO1:307), the combination of CEN3 and ARS1 or other means for assuring replication, such as sequences which will result in incorporation of an appropriate fragment into the host cell genome.
  • Control sequences for yeast vectors are known in the art and include promoters for the synthesis of glycolytic enzymes (Hess et al, J Adv Enzyme Reg (1968) 2:149; Holland et al, Biochem (1978), J :4900), including the promoter for 3-phos- phoglycerate kinase (R. Hitzeman et al, J Biol Chem (1980) 255:2073). Terminators may also be included, such as those derived from the enolase gene (Holland, J Biol
  • GAPDH glyceraldehyde-3 phosphate dehydrogenase
  • ADH alcohol dehydrogenase
  • a presently preferred expression system employs the ubiquitin leader as the fusion partner.
  • Copending application USSN 7/390,599 filed 7 August 1989 disclosed vectors for high expression of yeast ubiquitin fusion proteins.
  • Yeast ubiquitin provides a 76 amino acid polypeptide which is automatically cleaved from the fused protein upon expression.
  • the ubiquitin amino acid sequence is as follows:
  • Polynucleotides encoding the ubiquitin polypeptide may be synthesized by standard methods, for example following the technique of Barr et al, J Biol Chem (1988) 268:1671-78 using an Applied Biosystem 380A DNA synthesizer. Using appropriate linkers, the ubiquitin gene may be inserted into a suitable vector and ligated to a sequence encoding the HCV protease or a fragment thereof.
  • the transcriptional regulatory region and the transcriptional initiation region which are operably linked may be such that they are not naturally associated in the wild-type organism.
  • Mammalian ceU lines available as hosts for expression are known in the art and include many immortalized cell lines available from the American Type Culture CoUection (ATCC), including HeLa cells, Chinese hamster ovary (CHO) cells, baby hamster kidney (BHK) cells, and a number of other cell lines.
  • ATCC American Type Culture CoUection
  • HeLa cells including HeLa cells, Chinese hamster ovary (CHO) cells, baby hamster kidney (BHK) cells, and a number of other cell lines.
  • Suitable promoters for mammalian cells are also known in the art and include viral promoters such as that from Simian Virus 40 (SV40) (Fiers et al, Nature (1978) 273:113), Rous sarcoma virus (RSV), adenovirus (ADV), and bovine papilloma virus (BPV). Mammalian cells may also require terminator sequences and poly-A addition sequences. Enhancer sequences which increase expression may also be included, and sequences which promote amplification of the gene may also be desirable (for example methotrexate resistance genes). These sequences are known in the art.
  • Simian Virus 40 SV40
  • RSV Rous sarcoma virus
  • ADV adenovirus
  • BDV bovine papilloma virus
  • Mammalian cells may also require terminator sequences and poly-A addition sequences. Enhancer sequences which increase expression may also be included, and sequences which promote amplification of the gene may also be desirable (for example met
  • Vectors suitable for replication in mammalian cells are known in the art, and may include viral replicons, or sequences whic insure integration of the appropriate sequences encoding HCV epitopes into the host genome.
  • another vector used to express foreign DNA is Vaccinia virus.
  • the heterologous DNA is inserted into the Vaccinia genome.
  • Techniques for the insertion of foreign DNA into the vaccinia virus genome are known in the art, and may utilize, for example, homologous recombination.
  • the heterologous DNA is generally inserted into a gene which is non-essential to the virus, for example, the thymidine kinase gene (ti ), which also provides a selectable marker.
  • Plasmid vectors that greatly facilitate the construction of recombinant viruses have been described (see, for example, Mackett et al, J Virol (1984) 49:857; Chakrabarti et al, Mol Cell Biol (1985) 5:3403; Moss, in GENE TRANSFER VECTORS FOR MAMMALIAN CELLS (Miller and Calos, eds., Cold Spring Harbor Laboratory, NY, 1987), p. 10). Expression of the HCV polypeptide then occurs in cells or animals which are infected with the live recombinant vaccinia virus.
  • BSC 1 cells may be infected with the recombinant vector and grown on microscope slides under conditions which aUow expression. The cells may then be acetone-fixed, and immunofluorescence assays performed using serum which is known to contain anti-HCV antibodies to a polypeptide(s) encoded in the region of the HCV genome from which the HCV segment in the recombinant expression vector was derived.
  • eukaryotic or viral genomes include insect cells and vectors suitable for use in these ceUs. These systems are known in the art, and include, for example, insect expression transfer vectors derived from the baculovirus Autographa californica nuclear polyhedrosis virus (AcNPV), which is a helper-independent, viral expression vector. Expression vectors derived from this system usually use the strong viral polyhedrin gene promoter to drive expression of heterologous genes. Currently the most commonly used transfer vector for introducing foreign genes into AcNPV is pAc373 (see PCT WO89/046699 and USSN 7/456,637). Many other vectors known to those of skill in the art have also been designed for improved expression.
  • AdNPV baculovirus Autographa californica nuclear polyhedrosis virus
  • pVL985 which alters the polyhedrin start codon from ATG to ATT, and introduces a BamHI cloning site 32 bp downstream from the ATT; See Luckow and Summers, Virol (1989) 17:31).
  • AcNPV transfer vectors for high level expression of nonfused foreign proteins are described in copending applications PCT WO89/046699 and USSN 7/456,637.
  • a unique BamHI site is located following position -8 with respect to the translation initiation codon ATG of the polyhedrin gene. There are no cleavage sites for Smal, PstI, BgHI, Xbal or Sstl.
  • the plasmid also contains the polyhedrin poly- adenylation signal and the ampicillin-resistance (amp) gene and origin of replication for selection and propagation in E. coli.
  • heterologous DNA can be inserted into a gene such as the polyhedrin gene by homologous recombination, or into a restriction enzyme site engineered into the desired baculovirus gene.
  • the inserted sequences may be those which encode all or varying segments of the polyprotein, or other orfs which encode viral polypeptides.
  • the insert could encode the following numbers of amino acid segments from the polyprotein: amino acids 1-1078; amino acids 332-662; amino acids 406-662; amino acids 156-328, and amino acids 199-328.
  • the signals for post-translational modifications such as signal peptide cleavage, proteolytic cleavage, and phosphorylation, appear to be recognized by insect cells.
  • the signals required for secretion and nuclear accumulation also appear to be conserved between the invertebrate cells and vertebrate cells. Examples of the signal sequences from vertebrate cells which are effective in invertebrate cells are known in the art, for example, the human interleukin-2 signal (IL2 s ) which signals for secretion from the ceU, is recognized and property removed in insect cells.
  • IL2 s human interleukin-2 signal
  • Transformation may be by any known method for introducing polynucleotides into a host cell, including, for example packaging the polynucleotide in a virus and transducing a host cell with the virus, and by direct uptake of the polynucleotide.
  • the transformation procedure used depends upon the host to be transformed.
  • Bacterial transformation by direct uptake generally employs treatment with calcium or rubidium chloride (Cohen, Proc Nat Acad Sci USA (1972) 69:2110; T. Maniatis et al, "Molecular Cloning; A Laboratory Manual” (Cold Spring Harbor Press, Cold Spring Harbor, NY, 1982).
  • Yeast transformation by direct uptake may be carried out using the method of Hinnen et al, Proc Nat Acad Sci USA (1978) 75:1929. Mammalian transformations by direct uptake may be conducted using the calcium phosphate precipitation method of Graham and Van der Eb, Virol (1978) 52:546, or the various known modifications thereof.
  • Other methods for introducing recombinant polynucleotides into cells, particularly into mammalian cells include dextran-mediated transfection, calcium phosphate mediated transfection, polybrene mediated transfection, protoplast fusion, electroporation, encapsulation of the polynucleotide(s) in liposomes, and direct microinjection of the polynucleotides into nuclei.
  • Vector construction employs techniques which are known in the art. Site-specific DNA cleavage is performed by treating with suitable restriction enzymes under conditions which generally are specified by the manufacturer of these commercially available enzymes. In general, about 1 ⁇ g of plasmid or DNA sequence is cleaved by 1 unit of enzyme in about 20 ⁇ L buffer solution by incubation for 1-2 hr at 37°C. After incubation with the restriction enzyme, protein is removed by phenol/chloroform extraction and the DNA recovered by precipitation with ethanol. The cleaved fragments may be separated using polyacrylamide or agarose gel electrophoresis techniques, according to the general procedures described in Meth Enzvmol (1980) 65:499-560.
  • Sticky-ended cleavage fragments may be blunt ended using E. coli DNA polymerase I (Klenow fragment) with the appropriate deoxynucleotide triphosphates (dNTPs) present in the mature. Treatment with SI nuclease may also be used, resulting in the hydrolysis of any single stranded DNA portions. Ligations are carried out under standard buffer and temperature conditions using T4 DNA ligase and ATP; sticky end ligations require less ATP and less ligase than blunt end ligations.
  • vector fragments When vector fragments are used as part of a ligation mixture, the vector fragment is often treated with bacterial alkaline phosphatase (BAP) or calf intestinal alkaline phosphatase to remove the 5 '-phosphate, thus preventing religation of the vector.
  • BAP bacterial alkaline phosphatase
  • restriction enzyme digestion of unwanted fragments can be used to prevent ligation.
  • Ligation mixtures are transformed into suitable cloning hosts, such as E. coli, and successful transformants selected using the markers incorporated (e.g., antibiotic resistance), and screened for the correct construction.
  • Synthetic oligonucleotides may be prepared using an automated oligonucleotide synthesizer as described by Warner, DNA (1984) 1:401. If desired, the synthetic strands may be labeled with 32 P by treatment with polynucleotide kinase in the presence of ⁇ P-ATP under standard reaction conditions.
  • DNA sequences may be modified by known techniques, for example by site directed mutagenesis (see e.g., Zoller, Nuc Acids Res (1982) 10:6487). Briefly, the DNA to be modified is packaged into phage as a single stranded sequence, and converted to a double stranded DNA with DNA polymerase, using as a primer a synthetic oligonucleotide complementary to the portion of the DNA to be modified, where the desired modification is included in the primer sequence. The resulting double stranded DNA is transformed into a phage- supporting host bacterium. Cultures of the transformed bacteria which contain copies of each strand of the phage are plated in agar to obtain plaques.
  • site directed mutagenesis see e.g., Zoller, Nuc Acids Res (1982) 10:6487. Briefly, the DNA to be modified is packaged into phage as a single stranded sequence, and converted to a double stranded DNA with DNA polymerase, using as a
  • TheoreticaUy 50% of the new plaques contain phage having the mutated sequence, and the remaining 50% have the original sequence. Replicates of the plaques are hybridized to labeled synthetic probe at temperatures and conditions which permit hybridization with the correct strand, but not with the unmodified sequence. The sequences which have been identified by hybridization are recovered and cloned.
  • DNA libraries may be probed using the procedure of Grunstein and Hogness Proc Nat Acad Sci USA (1975) 73:3961. Briefly, in this procedure the DNA to be probed is immobilized on nitroceUulose filters, denatured, and prehybridized with a buffer containing 0-50% formamide, 0.75 M NaCl, 75 mM Na citrate, 0.02% (wt/v) each of bovine serum albumin, polyvinylpyrrolidone, and Ficoll®, 50 mM NaH2PO4 (pH 6.5), 0.1% SDS, and 100 ⁇ g mL carrier denatured DNA.
  • the percentage of formamide in the buffer, as well as the time and temperature conditions of the prehybridization and subsequent hybridization steps depend on the stringency required. Oligomeric probes which require lower stringency conditions are generaUy used with low percentages of formamide, lower temperatures, and longer hybridization times. Probes containing more than 30 or 40 nucleotides, such as those derived from cDNA or genomic sequences generally employ higher temperatures, e.g., about 40-42°C, and a high percentage formamide, e.g., 50%.
  • S'- ⁇ P-labeled oligonucleotide probe is added to the buffer, and the filters are incubated in this mixture under hybridization conditions. After washing, the treated filters are subjected to autoradiography to show the location of the hybridized probe; DNA in cor- responding locations on the original agar plates is used as the source of the desired DNA.
  • ligation mixtures are transformed into E. coli strain HB101 or other suitable hosts, and successful transformants selected by antibiotic resistance or other markers. Plasmids from the transformants are then prepared according to the method of Clewell et al, Proc Nat Acad Sci USA (1969) 62:1159, usually foUowing chloramphenicol amplification (Clewell, J Bacteriol (1972) 110:667). The DNA is isolated and analyzed, usually by restriction enzyme analysis and or sequencing.
  • Sequencing may be performed by the dideoxy method of Sanger et al, Proc Nat Acad Sci USA (1977) 74:5463, as further described by Messing et al, Nuc Acids Res (1981) 9:309, or by the method of Maxam et al, Meth Enzvmol (1980) 65:499. Problems with band compression, which are sometimes observed in GC-rich regions, were overcome by use of T-deazoguanosine according to Barr et al, Biotechni ⁇ ues (1986) 4:428.
  • the enzyme-linked immunosorbent assay can be used to measure either antigen or antibody concentrations. This method depends upon conjugation of an enzyme to either an antigen or an antibody, and uses the bound enzyme activity as a quantitative label.
  • the known antigen is fixed to a solid phase (e.g., a microtiter dish, plastic cup, dipstick, plastic bead, or the Hke), incubated with test serum dilutions, washed, incubated with anti-immunoglobulin labeled with an enzyme, and washed again.
  • Enzymes suitable for labeling are known in the art, and include, for example, horseradish peroxidase (HRP).
  • Enzyme activity bound to the solid phase is usually measured by adding a specific substrate, and deter- mining product formation or substrate utilization colorimetrically. The enzyme activity bound is a direct function of the amount of antibody bound.
  • a known specific antibody is fixed to the solid phase, the test material containing antigen is added, after an incubation the solid phase is washed, and a second enzyme-labeled antibody is added. After washing, substrate is added, and enzyme activity is measured colorimetrically, and related to antigen concentration.
  • Proteases of the invention may be assayed for activity by cleaving a substrate which provides detectable cleavage products.
  • the HCV protease normally cleaves itself from the genomic polyprotein, one can employ this autocatalytic activity both to assay expression of the protein and determine activity. For example, if the protease is joined to its fusion partner so that the HCV protease N-terminal cleavage signal (Arg-Arg) is included, the expression product will cleave itself into fusion partner and active HCV protease.
  • One may then assay the products, for example by western blot, to verify that the proteins produced correspond in size to the separate fusion partner and protease proteins.
  • cleavage may then be followed by spectrophotometric or fluorescent assays.
  • spectrophotometric or fluorescent assays Following the method described by E.D. Matayoshi et al, Science (1990) 247:231-35, one may attach a fluorescent label to one end of the substrate and a quenching molecule to the other end: cleavage is then determined by measuring the resulting increase in fluorescence. If a suitable enzyme or antigen has been employed as the fusion partner, the quantity of protein produced may easily be determined.
  • HCV protease N- terminal cleavage signal preventing self-cleavage
  • a separate cleavage sub- strate such as a fragment of the HCV NS3 domain including the native processing signal or a synthetic analog
  • the HCV polyprotein In the absence of this protease activity, the HCV polyprotein should remain in its unprocessed form, and thus render the virus noninfectious.
  • the protease is useful for assaying pharmaceutical agents for control of HCV, as com ⁇ pounds which inhibit the protease activity sufficiently will also inhibit viral infectivity.
  • Such inhibitors may take the form of organic compounds, particularly compounds which mimic the cleavage site of HCV recognized by the protease.
  • Three of the putative cleavage sites of the HCV polyprotein have the following amino acid sequences:
  • Val-Ser-Ala-Arg-Arg // Gly-Arg-Glu-Ile-Leu-Leu-Gly Ala-He-Leu-Arg-Arg // His-Val-Gly-Pro- Val-Ser-Cys-Gln-Arg // Gly-Tyr-
  • protease inhibitors may be prepared which mimic the basic/basic/small neutral motif of the HCV cleavage sites, but substituting a nonlabile linkage for the peptide bond cleaved in the natural substrate.
  • Suitable inhibitors include peptide trifluoromethyl ketones, peptide boronic acids, peptide ⁇ -ketoesters, peptide difluoroketo compounds, peptide aldehydes, peptide diketones, and the like.
  • the peptide aldehyde N-acetyl-phenylalanyl- glycinaldehyde is a potent inhibitor of the protease papain.
  • This application teaches methods for generating mixtures of peptides up to hexapeptides having all possible amino acid sequences, and further teaches assay methods for identifying those peptides capable of binding to proteases.
  • protease inhibitors may be proteins, particularly antibodies and antibody derivatives.
  • Recombinant expression systems may be used to generate quantities of protease sufficient for production of monoclonal antibodies (MAbs) specific for the protease.
  • MAbs monoclonal antibodies
  • Suitable antibodies for protease inhibition will bind to the protease in a manner reducing or eliminating the enzymatic activity, typically by obscuring the active site.
  • Suitable MAbs may be used to generate derivatives, such as Fab fragments, chimeric antibodies, altered antibodies, univalent antibodies, and single domain antibodies, using methods known in the art.
  • Protease inhibitors are screened using methods of the invention.
  • a substrate is employed which mimics the enzyme's natural substrate, but which provides a quantifiable signal when cleaved.
  • the signal is preferably detectable by colorimetric or fluorometric means: however, other methods such as HPLC or silica gel chromatography, GC-MS, nuclear magnetic resonance, and the like may also be useful.
  • a candidate protease inhibitor is added to the reaction mixture at a range of concentrations.
  • the assay conditions ideally should resemble the conditions under which the protease is to be inhibited in vivo, i.e., under physiologic pH, temperature, ionic strength, etc.
  • Suitable inhibitors will exhibit strong protease inhibition at con ⁇ centrations which do not raise toxic side effects in the subject.
  • Inhibitors which compete for binding to the protease active site may require concentrations equal to or greater than the substrate concentration, while inhibitors capable of binding irrev ⁇ ersibly to the protease active site may be added in concentrations on the order of the enzyme concentration.
  • an inactive protease mutein is employed rather than an active enzyme. It has been found that replacing a critical residue within the active site of a protease (e.g., replacing the active site Ser of a serine protease) does not significantly alter the structure of the enzyme, and thus preserves the binding specificity. The altered enzyme still recognizes and binds to its proper substrate, but fails to effect cleavage. Thus, in one method of the invention an inactivated HCV protease is immobilized, and a mixture of candidate inhibitors added. Inhibitors that closely mimic the enzyme's preferred recognition sequence will compete more successfully for binding than other candidate inhibitors. The poorly- binding candidates may then be separated, and the identity of the strongly-binding inhibitors determined.
  • HCV protease may be prepared substituting Ala for Ser 221 (Fig. 1), providing an enzyme capable of binding the HCV protease sub- strate, but incapable of cleaving it.
  • the resulting protease mutein is then bound to a solid support, for example Sephadex® beads, and packed into a column.
  • a mixture of candidate protease inhibitors in solution is then passed through the column and fractions coUected. The last fractions to elute will contain the strongest-binding compounds, and provide the preferred protease inhibitor candidates.
  • Protease inhibitors may be administered by a variety of methods, such as intravenously, orally, intramuscularly, intraperitoneally, bronchially, intranasally, and so forth. The preferred route of administration will depend upon the nature of the inhibitor. Inhibitors prepared as organic compounds may often be administered orally (which is generally preferred) if well absorbed. Protein-based inhibitors (such as most antibody derivatives) must generally be administered by parenteral routes.
  • Example 1 (Preparation of HCV cDNA) A genomic Hbrary of HCV cDNA was prepared as described in PCT WO89/046699 and USSN 7/456,637. This Hbrary, ATCC accession no. 40394, has been deposited as set forth below.
  • Example 2 (Expression of the Polypeptide Encoded in Clone 5-1-1.)
  • SOD human superoxide dismutase
  • DNA isolated from pSODCFl was treated with BamHI and EcoRI, and the following linker was ligated into the linear DNA created by the restriction enzymes:
  • the plasmid containing the insert was isolated.
  • Plasmid containing the insert was restricted with EcoRI.
  • the HCV cDNA insert in clone 5-1-1 was excised with EcoRI, and ligated into this EcoRI lin ⁇ earized plasmid DNA.
  • the DNA mixture was used to transform E. coli strain D1210 (Sadler et al, Gene (1980) £:279). Recombinants with the 5-1-1 cDNA in the correct orientation for expressing the ORF shown in Figure 1 were identified by restriction mapping and nucleotide sequencing.
  • Recombinant bacteria from one clone were induced to express the SOD- HCV j , , polypeptide by growing the bacteria in the presence of IPTG.
  • Three separate expression vectors, pcflAB, pcflCD, and pcflEF were created by ligating three new linkers, AB, CD, and EF to a BamHI-EcoRI fragment derived by digesting to completion the vector pSODCFl with EcoRI and BamHI, followed by treatment with alkaline phosphatase.
  • the linkers were created from six oligomers, A, B, C, D, E, and F. Each oligomer was phosphorylated by treatment with kinase in the presence of ATP prior to annealing to its complementary oligomer.
  • the sequences of the synthetic linkers were the following:
  • Each of the three linkers destroys the original EcoRI site, and creates a new EcoRI site within the linker, but within a different reading frame.
  • the HCV cDNA EcoRI fragments isolated from the clones, when inserted into the expression vector, were in three different reading frames.
  • HCV cDNA fragments in the designated Xgtl 1 clones were excised by digestion with EcoRI; each fragment was inserted into pcflAB, pcflCD, and pcflEF. These expression constructs were then transformed into D1210 E. coli cells, the transformants cloned, and polypeptides expressed as described in part B below.
  • Expression products of the indicated HCV cDNAs were tested for antigenicity by direct immunological screening of the colonies, using a modification of the method described in Helfman et al, Proc Nat Acad Sci USA (1983), 80:31. Briefly, the bacteria were plated onto nkroceilulose filters overlaid on ampicillin plates to give approximately 40 colonies per filter.
  • Colonies were replica plated onto nitrocellulose filters, and the replicas were regrown overnight in the pres ⁇ ence of 2 mM IPTG and ampicillin.
  • the bacterial colonies were lysed by suspending the nitrocellulose filters for about 15 to 20 min in an atmosphere saturated with CHCU vapor.
  • Each filter then was placed in an individual 100 mm Petri dish contain- ing 10 mL of 50 mM Tris HCl, pH 7.5, 150 mM NaCl, 5 mM MgC ⁇ , 3% (w/v) BSA, 40 ⁇ g mL lysozyme, and 0.1 ⁇ g/mL DNase. The plates were agitated gently for at least 8 hours at room temperature.
  • the filters were rinsed in TBST (50 mM Tris HCl, pH 8.0, 150 mM NaCl, 0.005% Tween® 20). After incubation, the ceU residues were rinsed and incubated for one hour in TBS (TBST without Tween®) containing 10% sheep serum.
  • the filters were then incubated with pretreated sera in TBS from individuals with NANBH, which included 3 chimpanzees; 8 patients with chronic NANBH whose sera were positive with respect to antibodies to HCV C100-3 polypeptide (also caUed C100); 8 patients with chronic NANBH whose sera were negative for anti-ClOO antibodies; a convalescent patient whose serum was negative for anti-ClOO antibodies; and 6 patients with community-acquired NANBH, including one whose sera was strongly positive with respect to anti-ClOO antibodies, and one whose sera was marginally positive with respect to anti-ClOO antibodies.
  • the sera, diluted in TBS was pretreated by preabsorption with hSOD for at least 30 minutes at 37°C.
  • the filters were washed twice for 30 min with TBST.
  • the expressed proteins which bound antibodies in the sera were labeled by incubation for 2 hours with 125 I-labeled sheep anti-human antibody. After washing, the filters were washed twice for 30 min with TBST, dried, and autoradiographed.
  • Clone 35 was isolated by screening with a synthetic polynucleotide hav ⁇ ing the sequence:
  • Clone C31 is shown in Figure 6, which also shows the amino acids encoded therein.
  • a C200 cassette was constructed by ligating together a 718 bp frag ⁇ ment obtained by digestion of clone C33c DNA with EcoRI and Hinfl, a 179 bp fragment obtained by digestion of clone C31 DNA with Hinfl and Bgll, and a 377 bp fragment obtained by digesting clone C35 DNA with Bgll and EcoRI.
  • the construct of ligated fragments were inserted into the EcoRI site of pBR322, yielding the plasmid pBR322-C200.
  • Clone C20c is isolated using a probe having the following sequence: 5'-TGC ATC AAT GGG GTG TGC TGG-3'
  • Clones C26d and C33c were transformed into the metfiylation minus E. coli strain GM48.
  • Clone C26d was digested with EcoRH and Ddel to provide a 100 bp fragment.
  • Clone C33c was digested with EcoRH and EcoRI to provide a 700 bp fragment.
  • Clone C8h was digested with EcoRI and Ddel to provide a 208 bp fragment. These three fragments were then ligated into the EcoRI site of pBR322, and transformed into E. coli HBlOl, to provide the vector C300.
  • D Preparation of Full Length Clones:
  • a 600 bp fragment was obtained from C7f+C20c by digestion with EcoRI and Nael, and tigated to a 945 bp Nael/EcoRI fragment from C300, and the construct inserted into the EcoRI site of pGEM4Z (commercially available from Promega) to form the vector C7fC20cC300.
  • C7fC20cC300 was digested with Ndel and EcoRI to provide a 892 bp fragment, which was Ugated with a 1160 bp fragment obtained by digesting C200 with
  • This vector contains a full-length HCV protease coding sequence fused to a functional hSOD leader.
  • the vector C7fC20cC300C200 was cleaved with EcoRI to provide a 2000 bp fragment, which was then ligated into the EcoRI site of plasmid cflCD (Example 2A).
  • the resulting vector encodes amino acids 1-151 of hSOD, and amino acids 946-1630 of HCV (numbered from the beginning of the polyprotein, cor ⁇ responding to amino acids 1-686 in Figure 1).
  • the vector was labeled cflSODp600 (sometimes referred to as P600), and was transformed into E. coli D1210 ceUs. These cells, ATCC accession no. 68275, were deposited as set forth below.
  • P190 P190:
  • a truncated SOD-protease fusion polynucleotide was prepared by excis ⁇ ing a 600 bp EcoRI/Nael fragment from C7f+C20c, blunting the fragment with Klenow fragment, ligating the blunted fragment into the Klenow-blunted EcoRI site of cf 1EF (Example 2A).
  • This polynucleotide encodes a fusion protein having amino acids 1-151 of hSOD, and amino acids 1-199 of HCV protease.
  • a longer truncated SOD-protease fusion polynucleotide was prepared by excising an 892 bp EcoRI Ndel fragment from C7fC20cC300, blunting the fragment with Klenow fragment, ligating the blunted fragment into the Klenow-blunted EcoRI site of cflEF.
  • This polynucleotide encodes a fusion protein having amino acids 1-151 of hSOD, and amino acids 1-299 of HCV protease.
  • a longer truncated SOD-protease fusion polynucleotide was prepared by excising a 1550 bp EcoRI EcoRI fragment from C7fC20cC300, and ligating the fragment into the EcoRI site of cflCD to form P500.
  • This polynucleotide encodes a fusion protein having amino acids 1-151 of hSOD, and amino acids 946-1457 of HCV protease (amino acids 1-513 in Figure 1).
  • This vector contains a full-length HCV protease coding sequence fused to the FLAG sequence, Hopp et al. (1988) Biotechnology 6: 1204-1210. PCR was used to produce a HCV protease gene with special restriction ends for cloning ease. Plasmid p500 was digested with EcoRI and Ndel to yield a 900 bp fragment. This fragment and two primers were used in a polymerase chain reaction to introduce a unique BglH site at amino acid 1009 and a stop codon with a SaH site at amino acid 1262 of the HCV-1, as shown in Figure 17 of WO 90/11089, published 4 October 1990. The sequence of the primers is as foUows:
  • MetAspTyrLysAspAspAspAsp ysGlyArgGlu CATGGACTACAAAGACGATGACGATAAAGGCCGGGA CTGATGTTTCTGCTACTGCTATTTCCGGCCCTCTAG
  • the duplex encodes the FLAG sequence, and initiator methionine, and a 5' Ncol restriction site.
  • the resulting Ncol/Sall fragment was ligated into a derivative of pCFl, which lacks the SOD gene and contains an optimized ribosome binding site for enhanced translational efficiency.
  • This construct is then transformed into E. coli D1210 cells and expression of the protease is induced by the addition of IPTG.
  • the FLAG sequence was fused to the HCV protease to facilitate purification.
  • a calcium dependent monoclonal antibody which binds to the FLAG encoded peptide, is used to purify the fusion protein without harsh eluting conditions.
  • Example 5 E. coli Expression of SOD-Protease Fusion Proteins
  • E. coli D1210 ceUs were transformed with cflSODp ⁇ OO and grown in Luria broth containing 100 ⁇ g/mL ampicillin to an OD of 0.3-0.5. IPTG was then added to a concentration of 2 mM, and the cells cultured to a final OD of 0.9 to 1.3. The cells were then lysed, and the lysate analyzed by Western blot using anti-HCV sera, as described in USSN 7/456,637.
  • coli D1210 cells were transformed with P500 and grown in Luria broth containing 100 ⁇ g/mL ampicillin to an OD of 0.3-0.5. IPTG was then added to a concentration of 2 mM, and the cells cultured to a final OD of 0.8 to 1.0. The cells were then lysed, and the lysate analyzed as described above.
  • Example 6 Purification of E. coli Expressed Protease
  • the HCV protease and fragments expressed in Example 5 may be purified as foUows:
  • the bacterial ceUs in which the polypeptide was expressed are subjected to osmotic shock and mechanical disruption, the insoluble fraction containing the protease is isolated and subjected to differential extraction with an alkaline-NaCl solution, and the polypeptide in the extract purified by chromatography on columns of S- Sepharose® and Q-Sepharose®.
  • the crude extract resulting from osmotic shock and mechanical disruption is prepared by suspending 1 g of the packed cells in 10 mL of a solution containing 0.02 M Tris HCl, pH 7.5, 10 mM EDTA, 20% sucrose, and incubating for 10 minutes on ice. The cells are then pelleted by centrifugation at 4,000 x g for 15 min at 4°G. After the supernatant is removed, the cell peUets are resuspended in 10 mL of Buffer Al (0.01 M Tris HCl, pH 7.5, 1 mM EDTA, 14 mM ⁇ -mercaptoethanol - " ⁇ ME”), and incubated on ice for 10 minutes.
  • Buffer Al (0.01 M Tris HCl, pH 7.5, 1 mM EDTA, 14 mM ⁇ -mercaptoethanol - " ⁇ ME"
  • the cells are again pelleted at 4,000 x g for 15 minutes at 4°G.
  • the cell peUets are resuspended in Buffer Al, incubated on ice for 10 minutes, and again centrifuged at 4,000 x g for 15 minutes at 4°G.
  • the clear supernatant (periplasmic fraction II) is removed, and the cell pellet resuspended in 5 mL of Buffer T2 (0.02 M Tris HCl, pH 7.5, 14 mM ⁇ ME, 1 mM EDTA, 1 mM PMSF).
  • the suspension (5 mL) and 7.5 mL of Dyno-miU lead-free acid washed glass beads (0.10-0.15 mm diameter) (available from Glen-MUls, Inc.) are placed in a Falcon tube and vortexed at top speed for two minutes, followed by cooUng for at least 2 min on ice. The vortexing-cooling procedure is repeated another four times. After vortexing, the slurry is filtered through a sintered glass funnel using low suction, the glass beads washed twice with Buffer A2, and the filtrate and washes combined. The insoluble fraction of the crude extract is coUected by centrifugation at
  • a fraction containing the HCV protease is isolated from the insoluble material by adding to the suspension NaOH (2 M) and NaCl (2 M) to yield a final concentation of 20 mM each, vortexing the mixture for 1 minute, centrifuging it 20,000 x g for 20 min at 4°C, and retaining the supernatant.
  • the partiaUy purified protease is then purified by SDS-PAGE.
  • the protease may be identified by western blot, and the band excised from the gel.
  • the protease is then eluted from the band, and analyzed to confirm its amino acid sequence.
  • N- terminal sequences may be analyzed using an automated amino acid sequencer, while C-terminal sequences may be analyzed by automated amino acid sequencing of a series of tryptic fragments.
  • Example 7 Preparation of Yeast Expression Vector
  • A P650 (SOD/Protease Fusion)
  • This vector contains HCV sequence, which includes the wUd-type fuU-length HCV protease coding sequence, fused at the 5' end to a SOD coding sequence.
  • Two fragments a 441 bp EcoRI Bgi ⁇ fragment from clone lib and a 1471 bp BglH EcoRI fragment from expression vector P500, were used to reconstruct a wUd-type, fuU- length HCV protease coding sequence. These two fragments were Ugated together with an EcoRI digested pS356 vector to produce an expression cassette.
  • the expression cassette encodes the ADH2/GAPDH hybrid yeast promoter, human SOD, the HCV protease, and a GAPDH transcription terminator.
  • p650 expresses a polyprotein containing, from its amino terminal end, amino acids 1-154 of hSOD, an oUgopeptide -Asn-Leu-Gly-He-Arg- , and amino acids 819 to 1458 of HCV-1, as shown in Figure 17 of WO 90/11089, pubUshed 4 October 1990.
  • Clone lib was isolated from the genomic library of HCV cDNA, ATCC accession no. 40394, as described above in Example 3A, using a hybridization probe having the foUowing sequence: 5' CAC CTA TGT TTA TAA CCA TCT CAC TCC TCT 3'.
  • the vector pS3EF which is a pBR322 derivative, contains the ADH2/GAPDH hybrid yeast promoter upstream of the human superoxide dimutase gene, an adaptor, and a downstream yeast effective transcription terminator.
  • a similar expression vector containing these control elements and the superoxide dismutase gene is described in Cousens et al. (1987) Gene 61: 265, and in copending application EPO 196,056, published October 1, 1986.
  • pS3EF differs from that in Cousens et al. in that the heterologous proinsuUn gene and the immunoglobulin hinge are deleted, and
  • Gln 154 of SOD is foUowed by an adaptor sequence which contains an EcoRI site.
  • the sequence of the adaptor is:
  • pS3EF contains an oligopeptide that links SOD to the heterologous sequences.
  • pS3EF is exactly the same as pS356 except that pS356 contains a different adaptor.
  • the sequence of the adaptor is shown below: 5' AAT TTG GGA ATT CCA TAA TGA G 3'
  • Plasmid pAB24 is a yeast shuttle vector, which contains pBR322 sequences, the complete 2 ⁇ sequence for DNA replication in yeast (Broach (1981) in: Molecular Biology of the Yeast Saccharomyces, Vol. 1, p. 445, Cold spring Harbor Press.) and the yeast LEU 2d gene derived from plasmid pCl/1, described in EPO Pub. No. 116 201.
  • Piasmid pAB24 was constructed by digesting YEp24 with EcoRI and re-Ugating the vector to remove the partial 2 micron sequences. The resulting plasmid, YEp24deltaRI, was linearized with Clal and Ugated with the complete 2 micron plasmid which had been linearized with Clal.
  • the resulting plasmid, pCBou was then digested with Xbal, and the 8605 bp vector fragment was gel isolated.
  • This isolated Xbal fragment was ligated with a 4460 bp Xbal fragment containing the LEU 2 * 1 gene isolated from pCl/1; the orientation of LEU 2d gene is in the same direction as the URA3 gene.
  • S. cerevisae, 2150-2-3 ( ⁇ AB24-GAP-env2), accession no. 20827, is deposited with the American Type Culture CoUection as set forth below.
  • the plasmid pAB24-GAP-env2 can be recovered from the yeast ceUs by known techniques.
  • the GAP-env2 expression cassette can be removed by digesting pAB24-GAP-env2 with BamHI. pAB24 is recovered by religating the vector without the BamHI insert.
  • Example 8 Yeast Expression of SOD-Protease Fusion Protein
  • p650 was transformed in S. cerevisae strain JSC310, Mata, leu2, ura3- 52, prbl-1122, pep4-3, prcl-407, cir°: DM15 (g418 resistance). The transformation is as described by Hinnen et al. (1978) Proc Natl Acad Sci USA 75: 1929. The transformed ceUs were selected on ura- plates with 8% glucose. The plates were incubated at 30°C for 4-5 days.
  • the tranformants were further selected on leu- plates with 8% glucose putatively for high numbers of the p650 plasmid. Colonies from the leu- plates were inoculated into leu- medium with 3% glucose. These cultures were shaken at 30°C for 2 days and then diluted 1/20 into YEPD medium with 2% glucose and shaken for 2 more days at 30°C.
  • S. cerevisae JSC310 contains DM15 DNA, described in EPO Pub. No. 340 986, pubUshed 8 NOvember 1989. This DM15 DNA enhances ADH2 regulated expression of heterologous proteins.
  • pDM15 accession no. 40453, is deposited with the American Type Culture CoUection as set forth below.
  • Example 9 (Yeast Ubiquitin Expression of Mature HCV Protease)
  • Mature HCV protease is prepared by cleaving vector C7fC20cC300C200 with EcoRI to obtain a 2 Kb coding sequence, and inserting the sequence with the appropriate linkers into a ubiquitin expression vector, such as that described in WO 88/02406, published 7 April 1988, or USSN 7/390,599 filed 7 August 1989, incorporated herein by reference.
  • Mature HCV protease is recovered upon expression of the vector in suitable hosts, particularly yeast. SpecificaUy, the yeast expression protocol described in Example 8 is used to express a ubiquitin HCV protease vector.
  • Example 10 (Preparation of an In- Vitro Expression Vector) (A) PGEM®-3Z YeUow Fever Leader Vector
  • a clone p6000 was constructed from sequences available from the genomic library of HCV cDNA, ATCC accession no. 40394.
  • the HCV encoding DNA sequence of p6000 is identical to nucleotide -275 to nucleotide 6372 of Figure 17 of WO 90/11089, published 4 October 1990.
  • p6000 was digested with PvuII, and from the digest, a 2,864 bp fragment was isolated. This 2,864 bp fragment was Ugated to the prepared pGEM®-3Z/Yellow Fever leader vector fragment, described above.
  • the pGEM®-3Z ⁇ ellow Fever leader/Pvu ⁇ vector was linearized with Xbal and transcribed using the materials and protocols from Promega's Riboprobe® Gemini H Core system.
  • RNA produced by the above protocol was translated using Promega's rabbit reticulocyte lysate, minus methionine, canine pancreatic microsomal membranes, as weU as, other necessary materials and instructions from Promega.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

Procédé d'analyse de composés pour déceler dans ceux-ci une activité dirigée contre le virus de l'hépatite C (HCV), ledit procédé consistant à mettre un analogue inactif de HCV en contact avec un mélange de composés candidats anti-HCV, puis à déterminer les composés candidats qui se lient audit analogue des protéases de HCV.
PCT/US1991/002209 1990-04-04 1991-04-04 Inhibiteurs de la protease du virus de l'hepatite c WO1991015596A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US50543490A 1990-04-04 1990-04-04
US505,434 1990-04-04

Publications (1)

Publication Number Publication Date
WO1991015596A1 true WO1991015596A1 (fr) 1991-10-17

Family

ID=24010301

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1991/002209 WO1991015596A1 (fr) 1990-04-04 1991-04-04 Inhibiteurs de la protease du virus de l'hepatite c

Country Status (3)

Country Link
AU (1) AU7679491A (fr)
IE (1) IE911130A1 (fr)
WO (1) WO1991015596A1 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0518313A2 (fr) * 1991-06-11 1992-12-16 Mitsubishi Chemical Corporation Gène du virus de l'hépatite C ou fragment de celui-ci, polypeptide codé par ledit gène
WO1994013700A1 (fr) * 1992-12-07 1994-06-23 Akzo Nobel N.V. Peptides provenant de la region c33 du vhc, anticorps diriges contre ces peptides et procedes de detection du vhc
EP0625204A1 (fr) * 1992-02-04 1994-11-23 Chiron Viagene, Inc. Therapeutique de l'hepatite
EP0979867A2 (fr) * 1993-11-04 2000-02-16 Innogenetics N.V. Epitopes de lymphocytes T humains immunodominants du virus de l'hépatite C
ES2143918A1 (es) * 1997-05-23 2000-05-16 Inst Cientifico Tecnol Navarra Peptidos inhibidores de la proteasa c y su utilizacion en la preparacion de composiciones utiles en las infecciones causadas por el virus de la hepatitis c.
WO2001096540A2 (fr) * 2000-06-11 2001-12-20 Dupont Pharmaceuticals Company Exosite de la protease de l'hepatite c servant a la mise au point d'inhibiteurs

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0388232A1 (fr) * 1989-03-17 1990-09-19 Chiron Corporation Diagnostics et vaccins de NANBV
EP0414475A1 (fr) * 1989-08-25 1991-02-27 Chiron Corporation Procédé de culture du HCV dans des cellules eucaryotes

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0388232A1 (fr) * 1989-03-17 1990-09-19 Chiron Corporation Diagnostics et vaccins de NANBV
EP0414475A1 (fr) * 1989-08-25 1991-02-27 Chiron Corporation Procédé de culture du HCV dans des cellules eucaryotes

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CRC Critical Reviews in Biotechnology, vol. 8, issue 2, 1988, B.D. Korant et al. "Viral Proteases: An Emer- ging Therapeutic Targe *
Science, vol. 247, January 26, 1990 (26.01.90), T.J. McQuade et al. "A synthetic HIV-1 Protease inhibitor with antiviral activity *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0518313A2 (fr) * 1991-06-11 1992-12-16 Mitsubishi Chemical Corporation Gène du virus de l'hépatite C ou fragment de celui-ci, polypeptide codé par ledit gène
EP0518313A3 (en) * 1991-06-11 1993-03-24 Mitsubishi Kasei Corporation Gene of hepatitis c virus or fragment thereof, polypeptide encoded by the same
EP0625204A1 (fr) * 1992-02-04 1994-11-23 Chiron Viagene, Inc. Therapeutique de l'hepatite
WO1994013700A1 (fr) * 1992-12-07 1994-06-23 Akzo Nobel N.V. Peptides provenant de la region c33 du vhc, anticorps diriges contre ces peptides et procedes de detection du vhc
EP0979867A2 (fr) * 1993-11-04 2000-02-16 Innogenetics N.V. Epitopes de lymphocytes T humains immunodominants du virus de l'hépatite C
EP0979867A3 (fr) * 1993-11-04 2007-06-13 Innogenetics N.V. Epitopes de lymphocytes T humains immunodominants du virus de l'hépatite C
ES2143918A1 (es) * 1997-05-23 2000-05-16 Inst Cientifico Tecnol Navarra Peptidos inhibidores de la proteasa c y su utilizacion en la preparacion de composiciones utiles en las infecciones causadas por el virus de la hepatitis c.
WO2001096540A2 (fr) * 2000-06-11 2001-12-20 Dupont Pharmaceuticals Company Exosite de la protease de l'hepatite c servant a la mise au point d'inhibiteurs
WO2001096540A3 (fr) * 2000-06-11 2003-03-06 Du Pont Pharm Co Exosite de la protease de l'hepatite c servant a la mise au point d'inhibiteurs

Also Published As

Publication number Publication date
AU7679491A (en) 1991-10-30
IE911130A1 (en) 1991-10-09

Similar Documents

Publication Publication Date Title
US5585258A (en) Hepatitis C virus protease
US5989905A (en) HCV NS3 protein fragments having helicase activity and improved solubility
IE84608B1 (en) Hepatitis C virus protease
Falgout et al. Deletion analysis of dengue virus type 4 nonstructural protein NS2B: identification of a domain required for NS2B-NS3 protease activity
EP0846164B1 (fr) Procede pour tester l'activite proteolytique de polypeptides ayant une activite de protease hcv ns3 et peptides substrats a utiliser dans cette methode.
WO1991015596A1 (fr) Inhibiteurs de la protease du virus de l'hepatite c
IE85503B1 (en) Hepatitis c virus protease
JPH05192160A (ja) Ｃ型肝炎ウイルスゲノムＲＮＡ、ｃＤＮＡ及びポリペプチド

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU BB BG BR CA CH FI HU JP KP KR LK MC MG MW NO PL RO SD SU

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE BF BJ CF CG CH CM DE DK ES FR GA GB GR IT LU ML MR NL SE SN TD TG

WWE Wipo information: entry into national phase

Ref document number: 08070442

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: CA