WO1991008304A1 - Diagnostic genetique prenatal - Google Patents

Diagnostic genetique prenatal Download PDF

Info

Publication number
WO1991008304A1
WO1991008304A1 PCT/GB1990/001813 GB9001813W WO9108304A1 WO 1991008304 A1 WO1991008304 A1 WO 1991008304A1 GB 9001813 W GB9001813 W GB 9001813W WO 9108304 A1 WO9108304 A1 WO 9108304A1
Authority
WO
WIPO (PCT)
Prior art keywords
foetal
amplification
cells
pcr
dna
Prior art date
Application number
PCT/GB1990/001813
Other languages
English (en)
Inventor
Kenneth Anthony Fleming
James Stephen Wainscoat
Pushpa Patel
Yuk-Ming Dennis Lo
Original Assignee
Isis Innovation Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GB898926594A external-priority patent/GB8926594D0/en
Priority claimed from GB909008269A external-priority patent/GB9008269D0/en
Application filed by Isis Innovation Limited filed Critical Isis Innovation Limited
Publication of WO1991008304A1 publication Critical patent/WO1991008304A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6879—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for sex determination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the present invention relates to a method of genetic testing and in particular to a method of 5 detecting the presence or absence of a given genotype or genotypes in the genome of a foetus by testing a sample during pregnancy from the maternal circulation.
  • the present invention is based upon the discovery of a method for detecting the presence or absence of a given genotype(s) (as hereinafter defined) in the genome of a foetus by testing a sample
  • ⁇ Q hereinafter defined in the genome of a foetus, which comprises subjecting foetal nucleic acid obtained from the maternal circulation to amplification, in the absence of nucleic acid foreign to the foetus and to the mother, such foreign nucleic acid being capable of
  • genotype as used herein means the genetic constitution of a cell which is responsible for or contributory to a recognisable phenotype.
  • the expression "genotype” thus encompasses for example, genetic sequences characteristic of male sex (Y chromosome) and genetic variants responsible for or contributory to disease, for example genetic disorders such as cystic fibrosis and the thalassaemias as well as predisposition to disease such as coronary heart disease and cancers.
  • the foetal nucleic acid subjected to amplification is not contaminated with foreign nucleic acid which foreign nucleic acid is capable of amplification under the amplification conditions employed.
  • amplification is effected by use of the polymerase chain reaction and appropriate primers are employed for the amplification of foetal nucleic acid it is irrelevant that foreign nucleic acid may be present which is incapable of amplification in the presence of the aforementioned primers, but it is important that foreign nucleic acid which is capable of amplification in the presence of such primers is absent.
  • Foreign nucleic acid which should be absent from the material to be amplified would be foreign in the sense that it would be foreign to both the foetus and to the mother. The presence of such foreign nucleic acid in a sample to be amplified may give rise to erroneous results.
  • the target nucleic acid sequence may be any sequence which is specific to the foetus.
  • the sequence may be present in multiple copies but the present invention can also be applied to single copy foetal sequences allowing for prenatal diagnosis of single gene disorders.
  • the target sequence may be any Y-chromosome specific nucleic acid sequence.
  • the sequence may be present in multiple copies as illustrated in Example 1 below or as a single copy sequence as shown in Example 2. If the mother tested is bearing a male foetus the target sequence will be amplified to give a positive result, a female foetus will result in no DNA amplification.
  • extracted nucleic acid preferably DNA be used.
  • nucleic acids comprising repetitive sequences; the use of extracted DNA rather than whole cells, may also increase sensitivity since in
  • Example 1 referred to hereinafter the Y-specific sequence chosen is present as a tandem array of 800- 5000 subunits (see Nakahori Y. e_£. al- "A human Y- chromosome specific repeated DNA family (DYZI) " consists of a tandem array of pentanucleotides,
  • nucleic Acids Res. 1986; ⁇ , 7569-7580 which is broken up into much smaller subunits and dispersed into solution by the extraction procedure.
  • nucleic acids comprising repetitive sequences
  • the nucleic acid from the rare foetal cells be mixed thoroughly with the maternal nucleic acid and such mixing may for example also be effected by vortexing.
  • the foetal nucleic acid is subjected to at least two rounds of amplification in order to increase the sensitivity of the method. It is advantageous however that no more than two rounds of amplification are employed since further rounds of amplification compound the risk of detection of contamination of the foetal nucleic acid with foreign nucleic acid.
  • each round of amplification will consist of multiple cycles of heating and cooling and the terms "round” and "cycle” are used in this context throughout the specification.
  • Amplification may be effected according to the method described by Klappe K. e_t. al- in J. Mol. Biol.
  • PCR polymerase chain reaction
  • linear amplification is used herein to refer to amplification using a single primer for each diagnostic portion in the presence of agent for polymerisation and appropriate nucleoside triphosphates whereby amplification is effected by primer extension based on the use of a single strand of sample nucleic acid as template.
  • An important feature of the application of PCR to this method of the present invention is the need to avoid contamination. Another important feature is that the present invention requires that two rounds of PCR are effected (dual PCR amplification) . This is preferably achieved using 2 pairs of nested amplification primers. It is important that the degree of specificity of the primers is as high as possible. If the primers are not specific the number of cycles of PCR which can be effected without producing false positives will be reduced i.e. sensitivity will be reduced. This is particularly important when amplifying sequences present in low copy numbers.
  • the ability to detect male foetuses allows one to advise mother bearing male foetuses to have further more invasive diagnostic tests such as chorionic villus sampling and amniocentesis. Mothers bearing female foetuses could be spared the potential dangers of such invasive procedures.
  • the present invention thus permits genetic analysis of the foetus by the use of maternal blood without the requirement of first separating foetal and maternal cells.
  • the method of the present invention may be of interest in the prenatal diagnosis of sex-linked conditions such as haemophilia where, if desired, chorionic villus sampling or amniocentesis could subsequently be performed to allow further analysis depending on the predicted sex of the foetus. It may also be possible to determine the presence in the foetus of a dominant condition carried by the father by analysis of amplified paternal derived sequences in foetal DNA. Such mutations may be detected using the amplification refractory mutation system (ARMS) . The use of this amplification refractory mutation system (ARMS) as described in Nucleic Acids Research Vol. 17, No. 7 1989 p2503-2516 and as described and claimed in European Patent Publication No. 332435. The present invention may also be useful in the veterinary field where sexing of the foetus is of wide practical importance.
  • sex-linked conditions such as haemophilia
  • the method of the present invention is however of wider applicability than the prenatal diagnosis of sex-linked conditions since it is possible to selectively eliminate maternal nucleic acid from a mixture of maternal and foetal cells for example by the discriminatory use of acid or alkali media, by the use of antibodies, for example improved monoclonal antibodies capable of binding either maternal or foetal cells, by the discriminatory use of osmotic shock, by the discriminatory use of heat and/or by the discriminatory use of lysing agents such as dithiothreitol (DTT) .
  • acid or alkali may be used to lyse maternal cells whilst leaving foetal cells intact.
  • This may be performed by adding an ever increasing quantity of acid or alkali to a mixture of maternal and foetal cells and determining the quantity of acid or alkali necessary to lyse maternal cells whilst leaving foetal cells intact.
  • Examples of this type of differential lysis experiment are well known, for instance in this area of forensic medicine where various concentrations of dithiothreitol. DTT may be used to effect selective lysis of blood or sperm cells from mixtures of the two allowing DNA specimens from either cell type in the mixture to be separately prepared (Hopkins B. e_£. al- Technique November 1989; and Gill e_i. al- Nature Vol. 318, pages 577-579, 1985).
  • These techniques may be of use in the separation of foetal cells from maternal cells or in the relative enrichment of the foetal component in a mixture of maternal and foetal cells. Where foetal cells are separated from maternal cells prenatal diagnosis of genetic disorders and predispositions other than sex-linked conditions becomes possible.
  • the present invention also allows an estimation to be made of the number of foetal cells per unit volume of maternal blood.
  • an estimation of the number of circulating foetal cells may be made.
  • the DNA sample may either be undiluted or diluted by a known factor. This approach is based on the Poisson ' s distribution, which states that:
  • n the actual number of foetal cells in an aliquot for PCR
  • the proportion of reactions that fail to generate a signal may be approximated to P(0), and using equation (2) the mean number of foetal cells in the starting DNA sample may be calculated.
  • the proportion of negative reactions is only an approximation because it is known that occasional PCR may fail sporadically.
  • the proportion of sporadic PCR failure may be taken into account, e.g., by running a series of control tubes to estimate the failure rate.
  • PCR is carried out using the dual amplification system with primers Y1.5/1.6 (40 cycles) followed by Y1.7/1.8 (25 cycles). (Primer sequences are given in Example 2) . Summing up the three early pregnancy cases, the proportion of negative results is 50%. Thus,
  • our method may aid in the study of the physiology of feto-maternal cell trafficking.
  • the number of foetal cells in maternal blood can be correlated to events in individual pregnancies e.g. the development of preeclampsia or placental insufficiency.
  • this system may be useful for the assessment of placental function.
  • Figure 1 shows the relative positions of the primers Y1.1 , Y1.2, Y1.3 and Y1.4 and of a 102 base- pair fragment flanked by the latter pair.
  • the primers Y1 •1 and Y1.2 flank a 149 base-pair fragment of a Y- specific repeat sequence (see Kogan K. C. ⁇ i. al- "An improved method for prenatal diagnosis of genetic diseases by analysis of amplified DNA sequences". N. Engl. J. Med. 1987; JUZ, 985-990).
  • each DNA sample was vortexed for 30 seconds in order to achieve partial shearing (fragmentation) f long strands of DNA and to allow DNA from the rare foetal cells to mix thoroughly with maternal DNA.
  • a human Y-chromosome specific repeated DNA family (DYZI)a consists of a tandem array of pentanucleotides, Nucleic Acids Res. 1986; 14: 7569-80) . The relative positions of these primers are illustrated in Figure 1. Fifteen to twenty cycles were performed for this second amplification step using the same cycling parameters as above. Ten ⁇ 1 of PCR product were then analysed on an ethidium bromide stained agarose gel. Reagents, including the Taq DNA polymerase (5 units per 100 ⁇ l reaction) were obtained from a Perkin-Elmer Cetus GeneAmp DNA Amplification Reagent Kit. Thermal cycling was performed using a Hybaid Intelligent Heating Block.
  • PCR reagents including the Taq polymerase were also routinely incubated with EcoRI (30 units per 100 ⁇ l PCR reagents) for 2 hours at 37° just prior to amplification. EcoRI was chosen as it cleaves inside the 149 base-pair region delineated by primers Y1.1 and Y1.2.
  • the restriction enzyme was then destroyed by heating at 94 C for 10 minutes before the addition of DNA samples.
  • no DNA samples from male individuals were extracted whilst these experiments were in progress and the blood samples were taken and subsequently handled only by female operators. The chances of contamination were reduced to a minimum by taking all these measures.
  • This Example shows the amplification of a single-copy Y-specific sequence from peripheral blood DNA extracted from pregnant women.
  • This sequence constitutes part of a gene which is expressed in testicular tissue (Arnemann e_£. al- Nucleic Acids Res. 1987; 15: 8713-24).
  • the single-copy nature of the sequence chosen was based on Southern blotting (Arnemann et. al. ) and co-amplification experiments, in which both the Y-sequence and alpha-1 antitrypsin sequence were amplified to the same extent (Lawler e_fc. al. B. R. J. Haematology 1989; 73: 205-10).
  • the new primer sequences are Y1.5: CTAGACCGCAGAGGCGCCAT
  • Y1.6 TAGTACCCACGCCTGCTCCGG
  • Y1.7 CATCCAGAGCGTCCCTGGCTT
  • Y1.8 CTTTCCACAGCCACATTTGTC.
  • Y1.5 and Y1.6 are the external pair of primers and have been used by Lawler e_fc. al- previously to amplify a 239 base pairs Y-specific fragment.
  • Y1.7 and Y1.8 flank a 198 base pairs sequence internal to Y1.5 and Y1.6 and were designed from published sequence (Arnemann e_£. al. ) .
  • the dual amplification procedure was described above except that the cycle combination used was 40 cycles (with primers Y1.5/Y1.6) plus 25 cycles (with primers Y1.7/Y1.8).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention décrit une méthode de dignostic génétique prénatal qui détecte la présence ou l'absence d'acide nucléique foetal dans un échantillon sanguin de la circulation maternelle. Cette méthode convient particulièrement pour déterminer le sexe du foetus, ainsi que pour émettre le diagnostic prénatal de certains troubles et prédispositions d'ordre génétique, fonctions du sexe ou autres, et pour évaluer la perméabilité placentaire aux cellules foetales dans divers états physiologiques ou pathologiques.
PCT/GB1990/001813 1989-11-24 1990-11-23 Diagnostic genetique prenatal WO1991008304A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
GB898926594A GB8926594D0 (en) 1989-11-24 1989-11-24 Diagnostic method
GB8926594.6 1989-11-24
GB9008269.4 1990-04-11
GB909008269A GB9008269D0 (en) 1990-04-11 1990-04-11 Diagnostic method

Publications (1)

Publication Number Publication Date
WO1991008304A1 true WO1991008304A1 (fr) 1991-06-13

Family

ID=26296250

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB1990/001813 WO1991008304A1 (fr) 1989-11-24 1990-11-23 Diagnostic genetique prenatal

Country Status (2)

Country Link
EP (1) EP0502037A1 (fr)
WO (1) WO1991008304A1 (fr)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5641628A (en) * 1989-11-13 1997-06-24 Children's Medical Center Corporation Non-invasive method for isolation and detection of fetal DNA
WO1998039474A1 (fr) * 1997-03-04 1998-09-11 Isis Innovation Limited Diagnostique prenatal non invasif
US6977162B2 (en) 2002-03-01 2005-12-20 Ravgen, Inc. Rapid analysis of variations in a genome
US7208274B2 (en) 2002-03-01 2007-04-24 Ravgen, Inc. Rapid analysis of variations in a genome
US7252946B2 (en) 2004-01-27 2007-08-07 Zoragen, Inc. Nucleic acid detection
US7709210B2 (en) * 2005-10-05 2010-05-04 Children's Hospital Medical Center Diagnosis and prevention of fetal heart disease
US8585971B2 (en) 2005-04-05 2013-11-19 The General Hospital Corporation Devices and method for enrichment and alteration of cells and other particles
US8895298B2 (en) 2002-09-27 2014-11-25 The General Hospital Corporation Microfluidic device for cell separation and uses thereof
US8921102B2 (en) 2005-07-29 2014-12-30 Gpb Scientific, Llc Devices and methods for enrichment and alteration of circulating tumor cells and other particles

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0200362B1 (fr) * 1985-03-28 1993-01-20 F. Hoffmann-La Roche Ag Procédé pour l'amplification, la détection et/ou le clonage des séquences d'acide nucléique

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0200362B1 (fr) * 1985-03-28 1993-01-20 F. Hoffmann-La Roche Ag Procédé pour l'amplification, la détection et/ou le clonage des séquences d'acide nucléique

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
American Journal of Obstetrics and Gynecology, vol. 161, no. 3, September 1989, The C.V. Mosby co., (St. Louis, miussouri, US), T.L. Pinckert et al.: "Rapid determination of fetal sex by deoxyribonucleic acid amplification of Y chromosome-specific sequences", pages 693-698 *
Human Genetics, vol. 79, no. 4, August 1988, Springer-Verlag, (Berlin, DE), A. Selypes et al.: "A noninvasive method for determination of the sex and karyotype of the fetus from the maternal blood", pages 357-359 *
New England Journal of Medicine, vol. 317, no. 16, 15 October 1987, S.C. Kogan et al.: "An improved method for prenatal diagnosis of genetic diseases by analysis of amplified DNA sequences", pages 985-990 *
Proc. Natl. Acad. Sci. USA, vol. 76, no. 3, March 1979, L.A. Herzenberg et al.: "Fetal cells in the blood of pregnant women: Detection and enrichment by fluorescence-activated cell sorting", pages 1453-1455 *
The Lancet, vol. 2, 9 December 1989, Y.-M.D. Lo et al.: "Prenatal sex determination by DNA amplification from maternal peripheral blood", pages 1363-1365 *

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5641628A (en) * 1989-11-13 1997-06-24 Children's Medical Center Corporation Non-invasive method for isolation and detection of fetal DNA
WO1998039474A1 (fr) * 1997-03-04 1998-09-11 Isis Innovation Limited Diagnostique prenatal non invasif
US6258540B1 (en) 1997-03-04 2001-07-10 Isis Innovation Limited Non-invasive prenatal diagnosis
US6977162B2 (en) 2002-03-01 2005-12-20 Ravgen, Inc. Rapid analysis of variations in a genome
US7208274B2 (en) 2002-03-01 2007-04-24 Ravgen, Inc. Rapid analysis of variations in a genome
US8895298B2 (en) 2002-09-27 2014-11-25 The General Hospital Corporation Microfluidic device for cell separation and uses thereof
US8986966B2 (en) 2002-09-27 2015-03-24 The General Hospital Corporation Microfluidic device for cell separation and uses thereof
US10081014B2 (en) 2002-09-27 2018-09-25 The General Hospital Corporation Microfluidic device for cell separation and uses thereof
US11052392B2 (en) 2002-09-27 2021-07-06 The General Hospital Corporation Microfluidic device for cell separation and uses thereof
US7252946B2 (en) 2004-01-27 2007-08-07 Zoragen, Inc. Nucleic acid detection
US8585971B2 (en) 2005-04-05 2013-11-19 The General Hospital Corporation Devices and method for enrichment and alteration of cells and other particles
US9174222B2 (en) 2005-04-05 2015-11-03 The General Hospital Corporation Devices and method for enrichment and alteration of cells and other particles
US9956562B2 (en) 2005-04-05 2018-05-01 The General Hospital Corporation Devices and method for enrichment and alteration of cells and other particles
US10786817B2 (en) 2005-04-05 2020-09-29 The General Hospital Corporation Devices and method for enrichment and alteration of cells and other particles
US8921102B2 (en) 2005-07-29 2014-12-30 Gpb Scientific, Llc Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US7709210B2 (en) * 2005-10-05 2010-05-04 Children's Hospital Medical Center Diagnosis and prevention of fetal heart disease

Also Published As

Publication number Publication date
EP0502037A1 (fr) 1992-09-09

Similar Documents

Publication Publication Date Title
SEKIZAWA et al. Prenatal diagnosis of the fetal RhD blood type using a single fetal nucleated erythrocyte from maternal blood
Bianchi Prenatal diagnosis by analysis of fetal cells in maternal blood
Lissens et al. Preimplantation genetic diagnosis: current status and new developments.
Al‐Yatama et al. Detection of Y chromosome‐specific DNA in the plasma and urine of pregnant women using nested polymerase chain reaction
Pertl et al. Detection of male and female fetal DNA in maternal plasma by multiplex fluorescent polymerase chain reaction amplification of short tandem repeats
JP4245666B2 (ja) 非侵入性の出生前診断
Lambert et al. Male microchimerism in healthy women and women with scleroderma: cells or circulating DNA? A quantitative answer
Lo Non-invasive prenatal diagnosis using fetal cells in maternal blood.
Harper Preimplantation diagnosis of inherited disease by embryo biopsy: an update of the world figures
Lo et al. Detection of fetal RhD sequence from peripheral blood of sensitized RhD‐negative pregnant women
Bianchi et al. Fetomaternal cellular and plasma DNA trafficking: the Yin and the Yang
US20010051341A1 (en) Non-invasive prenatal diagnosis
Houfflin-Debarge et al. High sensitivity of fetal DNA in plasma compared to serum and nucleated cells using unnested PCR in maternal blood
JP2004533243A (ja) 単離された母体血液の胎児細胞に対する出生前診断の方法
Hamada et al. Fetal nucleated cells in maternal peripheral blood after delivery
Chen et al. New perspectives on preimplantation genetic diagnosis and preimplantation genetic screening
Jie et al. Successful preimplantation genetic diagnosis for alpha‐and beta‐thalassemia in China
WO1991008304A1 (fr) Diagnostic genetique prenatal
Schreck et al. Fetal loss
Sekizawa et al. Fetal cell recycling: diagnosis of gender and RhD genotype in the same fetal cell retrieved from maternal blood
CN101323877A (zh) 检测21号染色体和性染色体数目异常的试剂盒
Dziennik et al. Genotyping of STR and DIP–STR Markers in Plasma Cell-Free DNA for Simple and Rapid Noninvasive Prenatal Diagnosis of Zygosity of Twin Pregnancies
Findlay et al. Diagnostic techniques: Rapid genetic diagnosis at 7–9 weeks gestation: diagnosis of sex, single gene defects and DNA fingerprint from coelomic samples
Rebello et al. Maternal contamination of amniotic fluid demonstrated by DNA analysis
Falcinelli et al. First-trimester fetal sex prediction by deoxyribonucleic acid analysis of maternal peripheral blood

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 1990917260

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1990917260

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1990917260

Country of ref document: EP