WO1991000341A1 - Sparged insect cell culture and the expression of recombinant proteins therein - Google Patents

Abstract

Methods of growing insect cells in sparged culture, particularly in airlift fermentors to high cell densities with high viability are herein disclosed. Further disclosed are media in which to grow airlift insect cell culture which media comprise a non-toxic protective agent, preferably a non-toxic water soluble polymer, and operating parameters, such as sparging rates and bubble sizes, that act to minimize cell damage and cell death from sparging. Further, the invention provides for methods and media for growing insect cells at large scale, for the production of wild type or recombinant viruses; for supporting the production therefrom of recombinant products, such as CSF-1 and IL-6, when the cells are infected by recombinant viruses; and for supporting the production therefrom of viral products, when the cells are infected with wild type viruses.

Description

SPARGED TNSECT CELL CULTURE AND THE EXPRESSION OF RECOMBINANT PROTEINS THEREIN

Field of the Invention This invention is in the field of fermentation and insect cell culture and is particularly addressed to sparged insect culture, particularly airlift insect cell culture, as applied to the production of wild type or recombinant viruses, and expression of viral and recombinant proteins, respectively. Further, the invention provides for large scale jn vitro growth of insect cells which are hosts for the production of wild type or recombinant viruses; viral and recombinant products, preferably CSF-1 and IL-6.

Background

Sparged culture provides a means of increasing the surface/volume ratio of oxygen- containing gas to cell culture liquid in fermenting processes. Airlift fermentation principles are described in several reviews, for example, Onken gigl., 1983, Advances in Biotech. Processes.1:67-95; and Smart, July 1984, "Gaslift Fermentors: Theory and Practice", Laboratory Practice.

Although the cell culture literature contains references concerning cultivation of microbial and mammalian cells by airlift culture, there have been no reports of successful cultivation of insect cells by airlift culture methods. For instance, Hink and Strauss, "Semi- Continuous Cultures of the TN-368 Cell Line in Fermentors with Virus Production in Harvested Cells", page 27-33 in Vertebrate Systems In Vitro. Eds. E. Kurstak, K.

Maramorosch, and A. Dubendorfer (1980), describes sparging a two litre stirred culture of insect cells grown in serum-supplemented medium. A major problem associated with this system is foaming of the medium due to aeration. For instance, the authors state that:

"The aeration necessary to maintain this amount [100% of saturation] of dissolved oxygen caused excessive foaming, vacuolation of cells, and formation of a precipitate."

Tramper el ah, 1986, Enzyme Microb. Technol.. &33-36 is further exemplary wherein it noted at page 33: "A major problem encountered in scaling up [insect] cell culture systems is the shear sensitivity of these cells due to their size (20 μm range) and lack of cell wall. The shear sensitivity may hamper the supply of sufficient oxygen in a conventional manner (e.g., by sparging)." Tramper £t£l., further states at pages 35-36:

"The mechanical strength of insect cells in culture is small This has definite consequences for the scale up of insect cell cultures. Larger volumes of insect cell cultures require more efficient oxygen transfer to the solution than can be achieved by flushing air/oxygen over the liquid surface. However, dispersion of gas by means of stirring and sparging air through the cell suspension to provide sufficient oxygen probably results in a larger decay than growth rate of the cells." Tramper ≤ϊ al. reports that they were repeatedly unable to grow cells from Spodoptera frugiperda pup.al ovmes maintained in a medium containing 10% fetal bovine serum and 0.02% silicon antifoam in an airlift reactor. "Apparently, rising and bursting of bubbles and not fluid velocity disintegrate the cells faster than they are able to grow in such bioreactor." [Tramper el fll-. P- 35]

Weiss ≤t l, In Granados ≤J. aj. (Eds.), The Biology of Baculoviruses. Vol. π, Chapter 3, pp. 63-87 (CRC Press, 1986), note at page 80: "Two problems appear to have delayed the full utilization of suspension systems for the large volume culture of insect cells: the fragility of insect cells . . . and second, the high oxygen demand, particularly for virus-infected cells . . ." [emphasis added; citations omitted as indicated by ellipses are respectively: Weiss ≤i al-,

1980, In Vitro. I6_:222; and Hink ei al-, la Kurstak ≤t al- (Eds.), Invert. Tissue Culture: Applications in Medicine. Biology, and Agriculture.297 (Academic Press 1976).] The instant invention solves these problems.

Because of the literature perceived "fragility of insect cells", poorly aerated conditions have been conventionally used in insect cell culture, limiting scale up. Insect cells have been conventionally cultured in vessels, such as, spinner flasks or slowly stirred vessels, which rely only on above-surface gassing for aeration of the medium. In such conventionally used vessels, the ratio of liquid surface area to volume decreases as the vessel volume increases. Therefore, although the total oxygen demand of the insect cell culture increases in proportion to the increase in the volume of the culture, the capacity for oxygen transfer from above-surface gassing increases only in proportion to the liquid surface area. Oxygen starvation of insect cells thus limits the size of conventional insect culture vessels. The present invention overcomes such an oxygen transfer limitation and consequently the size limitations of insect cell culture. Well-aerated conditions are necessary for optimal large scale growth of insect cells.

Sparged culture is a means for providing the requisite oxygen transfer for such large scale growth. Airlift culture is a particularly desirable method.

Further, there remains a need in the art, as indicated above, for methods of growing insect cells in sparged culture without damaging the cells. The present invention meets such a need by providing methods of growing insect cells at large scale to high cell densities with high viability in sparged culture, particularly in airlift fermentors.

Further, the culture of insect cells in media containing reduced levels or no serum is preferred as serum is costly and serum proteins contaminate the final insect culture product. The sensitivity of insect cells to damage by sparging and agitation is increased in media containing reduced levels or no serum. The present invention overcomes this limitation by providing for protective medium components which allow sparging and agitation of insect cultures even in serum-free media. Insect cells have been successfully used to replicate recombinant baculoviruses to promote the expression of foreign genes carried thereby. [Smith £1 a!-. 1985, PNAS USA. £2:8404-8408; European Patent Application Publication No. 127, 839 (published December 12, 1984) to Smith eial; U.S. Patent No. 4,745,051, to Smith gt al., issued May 17, 1988; and Jeang slflL, 1987, J. Virol. 6J.(3):709-713.]

Insect cells have also been cultured for the production of insect viruses used as biological pesticides. [Vaughn al-, 1977, In Vitro.11:213-217; Lynn ≤£ al-, 1978, J. Invert. Pathol..22:1-5.] Such viruses include, for example, baculoviruses and non-baculoviruses such as infectious flacheriae virus (IFV) and cytoplasmic polyhidrosis virus (CPV). Exemplary are certain baculoviruses, for example, nucleopolyhedrosis viruses (NPV) and granulosis viruses (GV), which are highly virulent for pest insects; some of the most promising have been commercially developed as biological pesticides pathogenic for agriculturally important insects. [Burges (Eds.), Microbial Control of Pests and Plant Diseases 1970-1980 (London. 1981); Miltenburger el al-, 1984. Bioinsecticides II: Baculoviridae. Adv. Biotechnol. Processes.2:291; for a discussion of such NPV and GV products as biological pesticides, see Shieh eial-, 1980, "Production and Efficiency of Baculoviruses", Biotech, and Bioen ineerin Vol. XXII. 1357; see also Huber, 1986, (Eds.) The Biology of Baculoviruses:. Vol. π Practical Applications for Insect Control, pp. 181-202.]

Traditionally, production of baculoviruses was achieved using insect larvae; however, large scale production by such means is not very attractive. Insect cell culture is much more practical. [Vaughn el al-, 1981 , Adv. Cell. Cult..1:281-295; Stockton ei al-, In Burges (Ed.), supra at page 313-328.] Batchwise and semicontinuous production of Spodoptera fru iperda and Trichoplusia ni cells that allow the replication of Autographa californica nuclear polyhidrosis virus have been reported. [Vaughn, 1976, J. Invert. Path.. 2^:233-237; Hink, In Kurstak (Ed.), Microbial Viral Pesticides at pp 493-506.]

The instant invention provides a means not only to grow insect cells at large scale to high cell density with high viability, but also to support the production therefrom of recombinant products, when the cells are infected with recombinant baculoviruses, or of other viral products, when the cells are infected with wild-type viruses. Summary of the Invention The present invention provides for methods of growing insect cells in sparged culture, particularly in airlift fermentors. Such sparged or airlift culture overcomes the oxygen limitation which occurs in conventional insect culture vessels, that is, spinner flasks or slowly stirred vessels, which rely on above surface gassing for aeration of the medium. The present invention overcomes the size limitations of conventional insect cell culture by providing a new means of successfully aerating insect cultures by sparging and thereby overcoming the surface/volume ratio limitations inherent in above-surface gassing for oxygen transfer to the culture. The present invention allows insect cells to grow to high cell densities with high viability at a large scale.

The present invention discloses operating parameters, most notably sparging rates and bubble size diameters, appropriate for sparged and airlift insect cell culture. Optimal sparge rates are preferably in a range of from about 0.01 to about 0.25 volume total gas flow per volume culture per minute (wm), more preferably from about 0.02 to about 0.06 wm. Optimal bubble diameters are preferably from about 0.2 cm to about 2.0 cm, and more preferably from about 0.3 cm to about 1.5 cm.

The present invention further provides for media in which to grow insect cell cultures wherein the media comprise a non-toxic protective agent that minimizes cell damage and death from sparging, that is, from gas bubbles used to drive the agitation/oxygenation system. Preferred non-toxic protective agents of this invention are non-toxic water soluble polymers; further preferred are non-toxie, non-ionic polymeric detergents; further preferred are block co- polymeric detergents comprised of a relatively hydrophobic core region and relatively hydrophilic tails; further preferred are block copolymers of propylene oxide and ethylene oxide (polyoxypropylene and polyoxyethylene condensates); and still further preferred are Pluronic polyols, such as, Pluronic F68 or Pluronic F88. Such protective agents are preferably effective in reducing foaming, especially when the cells are maintained in serum containing media, and thereby preventing the loss of cells from the free suspension into the foam layer and adherence of cells to the vessel wall above the liquid surface.

Further, the invention provides for methods and media for growing insect cells at large scale, as well as for the production of wild type or recombinant viruses that infect insect cells; and for supporting the production therefrom of viral and recombinant products.

Brief Description of the Drawings Figure 1 shows the vectors pAcC5 and pLP37. Figure 2 shows a partial DNA sequence of IL-6. Figure 3 shows an insect cell infected with wild type baculoviruses which exhibited multiple polyhedra. Detailed Description of the Invention Throughout the specification reference is made to various publications including scientific articles, patents etc., that describe materials and methods that facilitate realizing the invention. These publications are hereby incorporated by reference in their entirety. This invention can be applied to cultures of various sizes, however, for the sake of discussion, whenever reference is made herein to large scale culture it is intended to cover a culture in the liter or greater range.

Sparged cultures are herein defined as cultures wherein compressed air or oxygen- containing gas is introduced into the nutrient medium, wherein cells are grown, through a sparger, that is, through either perforations or nozzles through which the compressed air or gas is forced into the medium during the fermenting process.

Airlift culture is herein defined as a method of cultivating cells including the steps of introducing the cells into a nutrient solution in which they tend to settle, and maintaining the cells in a suspended state so as to prevent their settling by introducing an oxygen-containing gas into the solution. Apparati for carrying out airlift culture include a container for a nutrient solution, an arrangement for introducing the oxygen-containing gas into the container and operative for guiding the nutrient solution so that the solution circulates within the container wherein the motive force for such circulation is the oxygen-containing gas. The guide .arrangement may be formed as a tubular member, as a substantially flat partition wall, or as an inner wall of a circumferentially complete tubular container. Said tubular member may be draught tube through the base of which the oxygen-containing gas is introduced by sparging, causing the culture fluid to circulate upward through the draught tube (the upcomer liquid stream) and then downward through the annular space between the draught tube and the vessel wall (the downcomer liquid stream). A gentle circulatory flow is induced in that the upcomer stream containing bubbles of the oxygen-containing gas is less dense than the downcomer stream and is displaced thereby. Dissolved oxygen tension and pH can be controlled by varying the composition of the sparged gas.

As indicated above in the Background, sparging has been noted in the literature to cause cell damage and death attributed to the "rising and bursting of bubbles" [Tramper el al., supral , _Q associated with the art perceived "fragility of insect cells" [Weiss £t al-, supra] and the small "mechanical strength of insect cells in culture", [Tramper el al., M_.] The culture methods and particularly the protective agents added to the medium, of the instant invention protect insect cells from damage and death under the well-aerated conditions of sparged culture.

An aspect of this invention is the specification of sparging rates for insect culture. The ₅ sparging rate is selected to be adequate to maintain good cell suspension and adequate oxygenation, but not so high as to cause cell damage. A further criterion in selecting a sparge rate is to produce a concentration of bubbles in the culture fluid low enough such that bubble-to- bubble interactions are minimized— thus, minimizing bubble coalescence such that the bubble size can be controlled by choice of sparger orifice size without concern for increase in bubble size due to coalescence.

Sparge rates are preferably maintained according to the methods of this invention from about 0.01 to about 0.25 volume total gas flow per volume culture per minute (vvm), and mor preferably from about 0.02 to about 0.06 wm. The sparged gas can be air which can maintain an adequate cell density. However, to avoid cell density limitations, the sparged gas is preferably supplemented with pure oxygen. Thus, the sparged gas can comprise a mixture of oxygen and a non-toxic diluent gas. The dissolved oxygen concentration (DO) of the culture medium can be maintained at a concentration anywhere from about 1% to 150% of air saturation, by methods known to those of ordinary skill in the art, depending on the particular requirements appropriate for the insect cell line and parameters selected. In general, as oxygen can be toxic to cells at high concentrations, the DO is preferably maintained below 100% of air saturation, and more preferably maintained at approximately 20% of air saturation; however, such a statement is only a general guideline, .and the DO for the particular cell line and parameters used should be maintained at the optimal level therefor.

According to the methods of this invention, to reduce damage to the insect cells caused from bubbles introduced through sparging, the bubble size is preferably maintained in a medium range. Preferably, the sparged bubbles range in diameter size from about 0.2 cm to about 2.0 cm, and, more preferably from about 0.3 cm to about 1.5 cm. Bubble size can be regulated by controlling the dimensions of the orifices of the sparger.

A primary aspect of the methods of this invention is the use of a medium containing on or more protective agents. The protective agent or agents acts or act to prevent a disintegration/clumping phenomenon of insect cells grown under sparged conditions and further prevents their adherence to the vessel walls. Further, the protective agent reduces the amount of cellular debris in the culture indicating that cell lysis is reduced by the presence of the protective agent As foaming can occur in sparged culture due to the effects of the sparged gas on certain elements of media used, for example, on serum proteins therein, preferably, the protective agent also acts as an anti-foaming agent preventing the loss of cells from the free suspension into the foam layer, and or acts as a bubble surface tension reducing agent and/or a a cell surface stabilizing agent and or as a viscosifying agent to prevent or reduce bubble damage. Foaming can also be a significant problem in airlift insect cell culture if a microcarrier system, rather than a free-cell suspension system, is used in that microcairiers tend to concentrate in the foam layer. Protective agents are herein defined as non-toxic, water soluble compounds that functionally act to protect insect cells from damage and death under well-aerated culture conditions. The protective agents of this invention are preferably non-toxic, water soluble polymers. A protective agent candidate can be selected by first confirming that it is not toxic to the insect cells to be cultured by methods known to those skilled in the art of insect cell culture, for example, by adding it at appropriate concentration to a suspension or monolayer of the insect cells of choice for cultivation and comparing the growth of the culture to a control. Then, the non-toxic protective agent candidates can be tested for protective ability by adding th candidate agent to rapidly agitated or sparged culture of the insect cells of choice at small scale and observing viability after an appropriate period and comparing the viability of the cells of said culture to the viability of the cells in a control culture.

The general correlation between the effectiveness of a protective agent in both agitated and sparged cultures is helpful in simplifying the selection of a suitable non-toxic protective agent for the sparged insect culture media and methods of this invention. Whereas airlift culture could be considered impractical at culture volumes of less than 5 L, small shake flask cultures (a control and test culture) are good models for determining the protective ability of a candidate protective agent. Still further simplifying such determination is the use of the disintegration/clumping phenomenon as the standard criterion for protective ability. If disintegration and clumping of cells occurs in the control flask but not in the flask containing the candidate agent, the agent is considered to have protective ability. Example 1, infra, provides a model system for such a method of selecting protective agents of this invention. The protective agents in the media of this invention are preferably cell surface stabilizing agents and/or viscosifying agents and/or bubble surface tension reducing agents.

Examples of preferred protective agents are hydroxyethyl starch, methyl cellulose, carboxymethyl cellulose (as, sodium carboxymethyl cellulose), dextran sulfate, polyvinylpyrrolidone, ficoll, alginic acid, polypropyleneglycol, and non-toxic polymeric detergents. Non-toxic polymeric detergents are preferred as protective agents in the methods of thi invention. Further preferred are non-toxic polymeric detergents which are non-ionic. Editions of McCutcheon's Emulsifiers & Detergents (published by the McCutcheon Division of MC Publishing Co., 175 Rock Road, Glenn Rock, N.J., U.S.A.) are examples of a source of finding non-toxic, non-ionic polymeric detergent candidates for protective agents for the media of this invention, which can be tested for non-toxicity and protective ability as indicated above.

Preferred non-toxic, non-ionic detergents are block copolymers comprised of a relatively hydrophobic core and relatively hydrophilic tails. Further preferred non-toxic, non-ionic polymeric detergents are block copolymers of propylene oxide and ethylene oxide (polyoxypropylene polyoxyethylene condensates), preferably Pluronic polyols, such as, Pluronic F68, F77, F88, and F108, preferably F68 and F88, more preferably F68. Such pluronic polyols are further preferred because of their anti-foaming ability. The Pluronic polyols are commercially available from BASF Wyandotte Corp. (101 Cherry Hill Road, P.O. Box 181, Parsippany, NJ. 07054, U.S.A.).

The protective agent is preferably present in the media of this invention at a concentration which is most effective in protecting the insect cells from damage, but which concentration is non-inhibitory to cell growth and reproduction. The Pluronic polyol polymeric protectants are present in the media of this invention preferably at a concentration (weight- volume) of from about .01% to about 1%, more preferably from about .05% to about 0.5%, and still more preferably about 0.1%.

A still further aspect of the methods of this invention to protect insect cells from damage caused by foaming, that can occur in airlift culture, concerns the adjustment of the liquid height above the draught tube to find an optimal level where the culture liquid flow can be used as a foam breaker. Foam height was found to be a function of liquid height above the draught tube. In media containing high concentrations of proteins, as, for example, in media that are supplemented with 9% serum, foam height is minimized when the liquid height is adjusted such that the circumferential area of the cylindrical section above the draught tube (that is, the cylindrical section corresponding to diameter to the draught tube that extends from the top of the draught tube to the surface of the liquid in the fermentor) is preferably from about 1.5 to about 2.5 times, and more preferably about 2 times, the horizontal cross-sectional area of the downcomer annulus. [Said circumferenti area is calculated as πdh wherein "d" is the diameter of the draught tube and "h" is the height of the liquid above the draught tube, that is, the difference between the .surface of the liquid and the top of the draught tube.]

In serum-free, low or no protein media, as, for example, the preferred media disclosed in U.S. Serial No. 77,303, filed July 24, 1987 (Cetus Docket No. 2369) discussed below, foam height is minimized by adjusting the liquid height such that the circumferential area of the cylindrical section above the draught tube is preferably from about 2.5 to about 5.5 times, and more preferably about 4.5 times, the horizontal cross-sectional area of the downcomer annulus.

It is further preferred according to the methods of this invention that the horizontal cross-sectional area of the upcomer section (that is of the draught tube per se is from about 1 to about 1.5 times the horizontal cross-sectional area of the downcomer annulus.

To maintain a relatively stable oxygen concentration throughout the airlift culture, the dimensions of the vessel, at the preferred sparging rates herein defined, are preferably such that the ratio of the height of the vessel to its diameter is in the range of from about 3/1 to about 12/1, and more preferably from about 6/1 to about 8/1. At such dimensions, an environment is created to maximize cell viability and density in that the oxygen concentration is not depleted within the downcomer annulus and adequate agitation and oxygen transfer at a preferred sparging rate is maintained throughout the vessel.

Insect cells can be grown by the sparged culture methods of this invention in any media which provide good nutritional environment, and comprise a non-toxic protective agent as described above. A "basal medium" is herein defined as a nutrient mixture of inorganic salts, sugars, amino acids, optionally also containing vitamins, organic acids and/or buffers. Basal media together with supplements provide the nutrients necessary to support cell life, growth and reproduction. The basal media can be supplemented or not supplemented with serum and proteins, such as, albumin.

If the media is not supplemented with serum and proteins, such media are preferably those described in co-pending, commonly owned U.S. Serial No. 77,303, filed July 24, 1987 (Cetus Docket No.2369) entitled "Serum Free Media for the Growth of Insect Cells and Expression of Products Thereby" which was concurrently filed with the instant application and which is herein incorporated by reference. Such media are serum free and contain no or very little protein, and preferably comprise (1) a basal medium, (2) a lipid/emulsifier component; (3) a peptone component, and preferably (4) a protective agent or agents under well-aerated conditions as in sparged cultures as those described herein.

The peptone component is preferably ultrafiltered to remove any residual proteases, high molecular weight components, or endotoxins. The peptone component of such serum free media can be selected from a wide variety of hydrolyzed protein products, either .alone or in combination, but are preferably yeast extract, more preferably Yeastolate (Difco, USA) alone or in combination with Lactalbumin Hydrolyzate (LH), at a concentration from about 1 g/L to about 12 g L, preferably from about 2 g L to about 8 g/L, and more preferably from about 3 g/L to about 5 g/L. Still more preferably, the peptone component comprises Yeastolate alone at a concentration of about 4 g L or Yeastolate and LH in combination each at a concentration of about 2 g/L.

The lipid/emulsifier component is preferably supplied to the media in the form of a microemulsion, the methods of preparation thereof are disclosed in said U.S. Serial No. 77,303, filed July 24, 1987 (Cetus Docket No. 2369). The lipid/emulsifier component preferably comprises lipids essential for the growth of insect cells and are preferably selected from the group comprising a mixture of polyunsaturated fatty acid esters, preferably methyl esters, and more preferably cod liver oil, preferably at concentration of from about 1 mg/L to about 50 mg L; lipid soluble vitamins, preferably alpha-tocopherol, (preferably at a concentration of from about 0.5 mg L to about 4 mg/L); and steroids, preferably sterols and more preferably cholesterol (preferably at a concentration of about 2 mg/L to about 7 mg/L). The emulsifier or emulsifiers present in the lipid/emulsifier component preferably include phospholipids, more preferably lecithin, and non-toxic, non-ionic polymeric detergents (preferably at a concentration from about 5 mg/L to about 75 mg/L), more preferably polysorbate compounds, and still more preferably polysorbate 80.

There are a wide variety of commercially available basal media that can be used in the media of this invention. Such commercially available basal media include, for example, TC10 without tryptose broth [commercially available from Microbiological Associates; see Gardiner ei l-, 1975, J. Invert. Pathol.. 2£:363]; Grace's Antheraea medium [Vaughn al, 1976, TCA Manual.3(1): Yunker ei -, 1976, TCA Manual.311}; Marks, In Kruse eial-, (Eds.), 1973, Tissue Culture Methods and Applications, pp. 153-156], Goodwin's IPL-52 Medium [Goodwin, 1975, In Vitro.11:369-378], Goodwin's IPL Medium [Goodwin ei al-, la Kurstak eial, (Eds.), 1980, Invertebrate Systems In Vitrol. Goodwin's IPL-76 Peptone Medium [Goodwin fit al-, M.-, Goodwin sLal, 1978, In Vitro. 14:485-494], Hink's TMH FH Medium (Revised) [Hink, 1970, Nature (London), 22^:466-467], Medium S-301 of Hansen [Hansen, In Maramorosch (Ed.), 1976, Invertebrate Tissue Culture Rese.arch Applications, pp. 75-99; Vaughn fit al-, 1976, TCA Manual.2(1)], and IPL-41 Medium [Weiss e_t al., 1981, In Vitro. 12(6):495-502], wherein IPL-41 is a preferred basal medium.

As indicated, IPL-41 is a preferred basal medium for the preparation of the media for this invention. IPL-41 basal medium is commercially available from a number of vendors and is described in Weiss eial-, June 1981, In Vitro.12(6):495-502 and in Weiss eial-, 1986, CRC Press, supra, pp. 70-72. Table 1 of Weiss el al- (In Vitro) at page 496, and Table 3 of Weiss el ai- CRC Press, at pages 71-72 outline all the components of IPL-41 and provide their proportions in mg L; said tables are herein incorporated by reference. At page 497 of Weiss ei al, (In Vitro), the preparation of the complete medium IPL-41 is described wherein tryptose phosphate broth (TPB) and fetal bovine serum (FBS) are added. The IPL-41 basal medium employed in preparing the media of this invention preferably do not contain tryptose phosphate broth (TPB), and more preferably contains a replacement therefor, yeast extract, preferably Yeastolate (Difco) or Yeastolate and Lactalbumin Hydrolyzate at appropriate concentrations.

The media for the sparged culture of this invention can be inoculated with insect cells maintained in any variety of culture modes and conditions but preferably are inoculated with cells that are in an exponential growth phase, that is, cells that have been maintained under non- oxygen limited and non-nutrient limited conditions.

The media employed in the methods of this invention are preferably those which enhance cell growth and viability and support the production of viral and recombinant products from insect cells infected respectively by wild-type or recombinant viruses. The insect cells grown according to the sparged culture methods of this invention are cultured in a temperature range and under conditions appropriate for the particular cell line selected. For example. Spodoptera frugip»srda cells, that is Sf9 cells, are cultured in a temperature range of from about 25^βC to about 32^βC, preferably from about 27°C to about 28°C and wherein the pH of the culture medium is preferably maintained in a range of from about 6 to about 7.0, more preferably about 6.2 to about 6.4.

Insect cells that can be grown successfully by the sparged culture methods of this invention are those which grow successfully in agitated culture, such as, shake flasks, wherein the medium contains a protective agent or agents. Therefore, a simple test can be designed to determine whether a particular insect cell line can be grown successfully by the sparged culture methods of this invention wherein the candidate insect cells are tested for appropriate growth and viability criteria in a small shake flask culture wherein the medium contains a non-toxic protective agent as herein described.

Analogously, insect cells which can be grown successfully and which can produce wild type or recombinant viruses, viral products or recombinant proteins, respectively, upon infection with either wild-type viruses or recombinant viruses, are those which have been shown to grow, reproduce or express recombinant or viral products in agitated culture wherein the medium contains a non-toxic protective agent. Candidate insect cells grown for production of wild type or recombinant viruses, viral or recombinant products can be tested analogously as indicated above.

Candidate insect cells that can be grown according to the airlift culture methods of this invention can be from any order of the Class Insecta, preferably those which can be hosts to a baculovirus expression vector system, or other wild-type viruses. Preferably, the insect cells are selected from the Diptera or Lepidoptera orders. About 300 insect species have been reported to have nuclear polyhedrosis virus (NPV) diseases, the majority (243) of which were isolated from Lepidoptera. [Weiss el al-, "Cell Culture Methods for Large-Scale Propagation of Baculoviruses", In Granados el al- (Eds.), The Biology of Baculoviruses: Vol. II Practical Application for Insect Control, pp. 63-87 at p. 64, (1986).] Insect cell lines derived from the following insects are exemplary: Carposapsa pomonella (preferably cell line CP-128); Trichoplusia ni (preferably cell line TN-368); Aυtographa californica: Spodoptera frugiperda (preferably cell line Sf9); Lymantria dispar. Mamestra brassicae: Aedes albopictus: Orgyia pseudotsu ata: Neodiprion sertifer. Aedes aegypti: Antheraea eucalypti: Gnorimoschema opercullela: Galleria mellonella: Spodoptera littolaris: Blatella germanica: Drosophila melanogaster: Heliothis zea: Spodoptera exigua: Rachiplusia ou: Plodia interpunctella: Amsaeta moorei: Agrotis c-nigrum. Adoxophyes orana. Agrotis segetum. Bombyx mori. Hyponomeuta malinellus. Colias eurytheme. Anticarsia germmetalia. Apanteles melanoscelus. Arctia caja. an Porthetria dispar. Preferred insect cell lines are from Spodoptera frugiperda. and especially preferred is cell line Sf9. The Sf9 cell line used in the examples herein was obtained from Max D. Summers (Texas A & M University, College Station, TX 77843 USA). Other £. frugiperda cell lines, such as IPL-Sf-21 AE IE, are described in Vaughn ei al-, 1977, In Vitro. 12:213-217. The insect cell lines of this invention are preferably suitable for the reproduction of numerous insect-pathogenic viruses such as parvoviruses, pox viruses, baculoviruses and rhabdoviruses, of which nucleopolyhedrosis viruses (NPV) and granulosis viruses (GV) from the group of baculoviruses are preferred. Further preferred are NPV viruses such as those from Autographa spp., Spodoptera spp., Trichoplusia spp., Rachiplusia spp., Galleria spp., and Lymantria spp. More preferred are baculovirus strains Auto.grapha californica NPV (AcNPV), Rachiplusia ou. NPV, Galleria mellonella NPV and any plague-purified strains of AcNPV, such as E2, R9, SI, M3, characterized and described by Smith £ al, 1979, J. Virol.. 20:828-838; Smith fit al-, 1978, Virol.. £2:517-527.

European Patent Application Publication No. 127, 839 (published December 12, 1984) to Smith eial; U.S. Patent No. 4,745,051, to Smith eial-, issued May 17, 1988, describes a method for producing a recombinant baculovirus expression vector, capable of expressing a selected gene in a host insect cell. The recombinant baculovirus expression vector is cotransfected with wild-type baculovirus DNA into a host insect cell, wherein recombination occurs. Recombinant baculoviruses are then detected and isolated according to methods described in European Patent Application Publication No. 127, 839 (published December 12, 1984) to Smith ei l.; U.S. Patent No. 4,745,051, to Smith eial-, issued May 17, 1988 and Summers fit al-, "A Manual and Methods for Baculovirus Vectors and Insect Cell Culture Procedures" (January 17, 1986). The resultant recombinant baculovirus is then used to infect cultured insect cells and the protein product from the incorporated selected gene is expressed by the insect cells and secreted into the medium. Exemplified therein is the production of recombinant β-interferon, interleukin-2, and chloramphenicol acetyltransferase (CAT) via the culturing of f frugiperda cells infected with a recombinant AcNPV expression vector into the genome of which the appropriate gene had been inserted. Further information concerning such recombinant proteins can be found in Summers el al-, Id..

Copending, commonly owned patent applications, U.S. Serial No. 77,188, filed July 24, 1987 (Cetus Docket No.2347), entitled "Production of a Biologically Active Form of CSF- 1 Using a Baculovirus-Insect Cell Expression System", U.S. Serial No.77,586, filed July 24, 1987 (Cetus Docket No.2382) entitled "Production of a Modified Plasminogen Activator

Using a Baculovirus-Insect Cell Expression System", and U.S. Serial No. 77,126, filed July 24, 1987 (Cetus Docket No.2383) entitled "Production of Ricin Toxin Proteins Using a Baculovirus-Insect Cell Expression System", describe, respectively, the expression at high levels of biologically active recombinant colony stimulating factors, modified pro-urokinase, urokinase and novel hybrid proteins thereof, and ricin toxin proteins, wherein an insect cell/baculovirus expression system is employed to produce such proteins. Said applications have been filed concurrently with this application and are herein incorporated by reference. U.S. Serial No. 77,188, filed July 24, 1987 (Cetus Docket No. 2347) specifically describes the construction of baculovirus CSF-1 expression and transfer vectors, including pAcM4 and pAcM6 used to prepare the recombinant baculoviruses AcM4 and AcM6 by cotransfection with baculovirus DNA in Sf9 cells. Said recombinant baculovirus transfer vectors pAcM4 and pAcM6 in E. £ρJj/MM294 have been deposited at the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, MD 20852 (USA) on June 12, 1987 respectively under the designation ATCC Nos. 67428 and 67429. [Said vectors have also been deposited and are maintained in the Cetus Master Culture Collection (CMCC) under the respective designations CMCC No. 3002 and CMCC No. 2996.] European Patent Application Publication No. 127, 839 (published December 12, 1984) to Smith eial-; U.S. Patent No. 4,745,051, to Smith eial-, issued May 17, 1988, and U.S. Serial Nos. 77,188, 77,586, and 77,126, filed July 24, 1987 (Cetus Docket Nos. 2347, 2382 and 2383) provide enablement concerning methods for producing recombinant baculovirus transfer vectors, and recombinant baculoviruses and for the use of the recombinant baculovirus expression system for expressing recombinant proteins in host insect cells. Said European patent application, U.S. Patents, and U.S. patent applications are herein incorporated by reference.

A specific example of the recombinant products that can be produced by the sparged culture methods of this invention is recombinant CSF-1 which can be produced by the host insect cells and infected with recombinant baculoviruses, such as AcM4 or AcM6, and cultured according to this invention. However, those skilled in the art who have the benefit of this disclosure, as well as the above applications incorporated by reference, will recognize that many other recombinant proteins can be produced by insect cells infected with recombinant baculovirus according to this invention. Other heterologous proteins that have been expressed n insect cells via the BEVS are outlined in Summers el al-, 1985, "Genetic Engineering of the Genome of the Auto rapha californica nuclear polyhedrosis virus", Banbury Report: Genetically Altered Viruses in the Environment.22:319-329. Exemplary recombinant proteins include, without limitation, colony stimulating factors [for example, long and short form CSF-

1 (described below), G-CSF, GM-CSF among others] interferons (α, β and γ and hybrids thereof), interleukins, tumor necrosis factor, erythropoietin, albumin human growth hormone, as well as porcine, bovine and other growth hormones, epidermal growth factor, insulin, modified prourokinase or urokinase, tissue plasminogen activator (TPA), TPA-urokinase hybrids, hepatitis B vaccine, superoxide dismutase, Factor VIII, atrial natriuretic factor, feline leukemia virus vaccines, as, for example, gp70 polypeptides, toxic proteins such as whole ricin toxin, ricin A chain, products containing ricin A, other lectins such as Ricin communis agglutinin (RCA), diphtheria toxin, gelonin, exotoxin from Pseudomonas aeruginosa. toxic proteins from Phytolacca americana (PAPI, PAPII, and PAP-S), insecticidal proteins from Bacillus thuringiensis. many enzymes as for example, CAT, as well as innumerable other hybrid proteins.

"Colony stimulating factor (CSF-1)" refers to a protein which exhibits the spectrum of activity understood in the art for CSF-1, that is, when applied to the standard in vitro colony stimulating assay of Metcalf, 1970, J. Cell Physiol..7.6:89, it results in the formation of primarily macrophage colonies. Native CSF-1 is a glycosylated dimer, dimerization may be necessary for activity. The term CSF-1 herein refers to both dimeric and monomeric forms. Human CSF-1 is operative both on human and murine bone marrow cells, whereas murine CSF-1 does not show activity with human cells. Therefore, human CSF-1 should be positive in the specific murine radioreceptor assay of Das el al., 1981, Blood, _>&630. The biological activity of the protein is also inhibited by neutralizing antiserum to human urinary

CSF-1. Das eial, LI

CSF-1 is able to stimulate the secretion of series E prostaglandins, interleukin-1 and interferon from mature macrophages. [Moore el al-, 1984, Science.222:178.] However, the protein's ability to stimulate the formation of monocyte/macrophage colonies using bone marrow cells (bone marrow assay) and its susceptibility to inhibition by neutralizing antiserum against purified human urinary CSF-1 as well as a positive response to the radioreceptor assay (RRA) or a conventional radioimmunoassay (RIA) can be employed to identify CSF-1 produced by insect cells via a recombinant baculovirus expression vector system (BEVS).

As described in commonly owned, copending application U.S. Serial No. 39,654, filed April 16, 1987, the production of biologically active CSF-1 is complicated by the high degree of post-translational processing which includes glycosylation and dimerization. As indicated in commonly owned, copending U.S. Serial No. 77,188, filed July 24, 1987 (Cetus Docket No.2347), it is clear that the colony stimulating factors are secreted into the medium. Molecular weights of the CSF proteins produced indicate that the signal peptide is cleaved. The products also appear to be glycosylated.

Various forms of CSF-1, including a short form and a long form, have been described. Sfifi Kawasaki fit al-, October 18, 1985, Science. 22Q:291-296; Wong £t al-, March 20, 1987, Science.221:1504-1508; U.S. Serial No. 77,188, filed July 24, 1987 (Cetus Docket No.

2347); Clark ei l, June 5, 1987, Science.226:1229-1237; Metcalf, supra. Recombinant CSF- 1 as well as muteins corresponding to the cDNA encoded forms are disclosed and claims in copending, commonly owned U.S. Serial Nos. 39,654, filed April 16, 1987; 39,657, filed April 15, 1987; 923,067, filed October 24, 1986; and 876,819, filed June 20, 1986. Each of said applications are entitled "Recombinant Colony Stimulating Factor- 1 ".

Recombinant baculovirus AcM4 carries a nucleotide sequence which encodes a 150 amino acid form of rCSF whereas the baculovirus AcM6 carries a nucleotide sequence which encodes a 522 amino acid form of rCSF-1. Details concerning AcM4 and AcM6 used in the examples below can be found in U.S. Serial No. 77,188, filed July 24, 1987 (Cetus Docket No. 2347).

The effect of timing of the infection of the insect cells with a recombinant baculovirus has been shown to be critical for enhanced specific productivity. The specific production of the recombinant protein was found to be constant during the exponential phase of cell growth under non-oxygen limited conditions. Late infection, under non-exponential growth conditions, resulted in lower specific productivity and lower final titer. It is preferred that the exponential growth phase be extended to the highest possible cell densities to achieve the highest total productivity of the recombinant protein product. Infection of the host insect cells under conditions that limit growth, for example, in the stationary phase of cell growth, results in a reduced specific productivity of the recombinant protein product.

Specific productivity of the recombinant protein is relatively independent of cell density at the time of infection as long as the culture is in exponential growth. For example, when Spodoptera frugiperda cells are the host insect cells and using the medium described in co- pending U.S. patent application, Serial No. 77,303, filed July 24, 1987, cell densities of from about 1.0 to about 4.0 x 10⁶ cells/ml are preferred for infection with the recombinant baculovirus, more preferably from about 2.5 to about 3.5 x 10⁶ cells/ml.

The timing of the harvest of the recombinant protein product is critical to minimize contamination of the recombinant protein by viral and cell lysis proteins and to simplify thereby the downstream purification of the recombinant product. With considerations for the stability of the product, it would be preferred to harvest the recombinant product before significant cell lysis has occurred. Further, each recombinant protein or viral product to be produced according to the methods and media of this invention should be checked for stability and degradation over the course of the fermentation run. Such considerations should enter into a determination of the optimal harvest time.

The following examples further illustrate the sparged culture methods of this invention. These examples are not intended to limit the invention in any manner.

Example 1

This example provides a model small scale shake flask culture method for selecting appropriate protective agents for the sparged culture media and methods of this invention. The particular parameters described in this example may not be appropriate for all insect cell lines.

For a particular insect cell line, conditions should be found whereby agitation is sufficient to cause within one or two days a disintegration/clumping phenomenon in a control culture without a protective agent.

Two 100 ml cultures of Sf9 inoculated at 1 x 10⁵ cells/ml were grown in 250 ml shake flasks agitated at 100-150 rpm (with an orbital radius of one-half inch) at approximately 27°C.

One culture, the control culture, was maintained in IPL-41 basal medium supplemented with 9.1% fetal bovine serum and 4 g/L Yeastolate (Difco); whereas, the test culture was maintained in a medium corresponding to the control but with the protective agent, Pluronic F68 at 0.1%

(weight-volume) concentration. The two cultures were then observed for growth and viability. After about 36 hours, the control culture evidenced the disintegration/clumping phenomenon; the cells therein were not growing but dying as determined by Trypan blue exclusion. The test culture with the protective agent grew well with greater than 99% viability and by the fifth day had reached a 5 cell density of about 5 x 10⁶ cells/ml.

Example 2 This example demonstrates that Spodoptera fru iperda cells (Sf9) were successfully grown in a 25 liter airlift feπnentor from 9 x 10 cells/ml up to 5 x 10⁶ cells/ml. By contrast, a 2.4 L spinner with only surface aeration reached a cell density of only 1.5 x 10⁶ cells/ml. The ° Sf9 airlift culture grew with a doubling time (Td) of from 23-29 hours, .and with viability in excess of 97%.

A static culture of Sf9 cells was transferred into, and maintained in, IPL-41 complete medium with, that i&_t tryptose phosphate broth (2.6 g L) and 9.1% heat inactivated fetal bovine serum, to which was added 0.1% Pluronic polyol (Pluronic F68). This medium was used for 5 all the experiments recorded in this example. Suspension cultures were maintained in spinner flasks at 60 rpm at room temperature (26-32°C). Growth was monitored with a Coulter Counter. Cell viability was determined with Trypan Blue vital stain and microscopic counting. In most cases, viability was 99+%. The cell densities referred to herein are viable cell counts. A 100 ml spinner flask (Bellco Catalog #196500100) with a surface/volume ratio of 0 0.25 cm2/ml was inoculated at 1 x 10⁵ cells/ml with Sf9 cells that had been resuspended from a 6 day old static culture. The culture volume was reduced from 100 ml to 50 ml after 96 hours of growth (1.4 x 10⁶ cells/ml) thereby doubling the surface/volume ratio. ⁵ A 2.4 L culture was grown in a 3 liter spinner flask (Bellco Catalog #196503000) with a surface/volume ratio of about 0.084 cm²/ml. The initial cell density was 1.4 x 10⁵ cells/ml inoculated from a 500 ml spinner in mid-exponential phase of growth.

A 25 liter Chemap airlift feπnentor (Catalog No.9100167406) was inoculated at 9 x 104 cells/ml with Sf9 cells that had been grown to late exponent phase (9.3 x 10⁵ cells/ml) in 0 a 3 liter spinner. The initial culture volume was 22 liters. The fermentor was operated at 28°C. Agitation was maintained by .sparging with nitrogen and oxygen at 0.02 volume total gas flow per volume culture per minute (about 0.4 liters per minute). Dissolved oxygen was maintained at approximately 20% air saturation by controlling the concentration of oxygen in the sparge gas. ⁵ The growth curve for the 100 ml spinner culture indicated that cell density plateaued at over 5 x 10⁶ cells/ml with 97-99% viability. This small spinner was assumed to provide relatively good oxygen transfer properties due to the low volume to surface area ratios therein. Cell growth was nearly exponential up to 2.7 x 106 cell/ml. The population doubling time (Td) was 19-25 hours. There was a halt in cell growth at 5.3 x 10⁶ cells/ml, which was attributed to a depletion of nutrients.

The growth curve for the 2.4 liter spinner culture indicated that growth was nearly 5 exponential up to 5 x 10⁵ cells/ml with a population doubling time of 24-28 hours. Cell growth became linear above 8 x 105 cells/ml. The culture viability dropped significantly before the culture reached 1.5 x 10⁶ total cells/ml, and the peak viable cell density almost reached 1.2 x 10⁶ cells/ml. A linear (versus exponential) increase in cell density is diagnostic of oxygen limitation. The poor oxygen transfer associated with the increased culture volume was ¹ ° considered the reason for the poor performance of the 2.4 liter spinner culture as compared to the 100 ml spinner culture.

The growth curve of the 25 liter Chemap airlift fermentor indicated that cell growth was similar to that found in the 100 ml spinner culture. The cell density peaked at about 5 x 106 cells/ml with 97% viability. The exponential phase of growth up to 1 x 10⁶ cells/ml had a Td ⁱ⁵ of 23 hours, followed by a Td of 29 hours up to 3.6 x 106 cells/ml. The cell density increased until levels similar to those seen in the small-scale 100 milliliter spinner were reached.

As indicated above, both the smaller spinner (100 ml) culture and the airlift fermentor culture had peak cell densities of about 5 x 10⁶ cells/ml with 97-99% viability. Whereas the 2.4 liter spinner culture reached a viable cell density of only 1.2 x 10⁶ cells/ml.

²⁰ Example 3

Experiments were done to determine the effect sparged culture conditions have on the expression of recombinant CSF (rCSF) by Sf9 cells. Thus, Sf9 cells were grown in serum free ISFM-4 medium starting with an initial inoculum of 2.8 x 10⁵ cells/ml. ISFM-4 medium is described in copending U.S. Patent Application Serial No. 77,303, filed July 24, 1987. Th

25 formulation of ISFM-4 is shown below in Table 1.

Table 1 ISFM-4 Medium

1. IPL-41 Basal Medium

2. Ultrafiltered Yeastolate 4 g/l ³⁰ 3. Pluronic Polyol-Lipid Emulsion

(a) Pluronic Polyol F68 1 g 1

(b) Cod Liver Oil 10 mg/1

(c) Tween 80 25 mg/1

(d) Cholesterol 4.5 mg/1 (e) Alpha-Tocopherol Acetate 2 mg/1

(f) Ethanol 1 ml/1

The basal medium IPL-41 is commercially available and is described by Weiss eial-, 1981, In Vitro.12(6):495-502 and in Weiss el _Ll, The Biology of Baculoviruses, vol.2 (Chapter 3) at page 80 (CRC Press page 70-72), 1986. Table I of Weiss fit al On vitro) at page 496 and Table HI of Weiss el al-, CRC Press, at pages 71-72 outline all the components of IPL-41 and provide their proportions.

Thirty-six liters of ISFM-4 media was added to a 39 liter spinner flask (345 centimeters x 400 centimeters) 3 impellors were used to agitate the solution, two having dimensions of 83 mm x 19 mm, with the third being 75 mm x 12 mm. The solution was agitated at 150 revolutions per minute, and oxygen was supplied by a silicon tubing causing the solution to be sparged with air/θ₂ at a flow rate of 1 liter per minute. The ratio of the gases was controlled with a Braun dissolved oxygen controller to maintain greater than or equal to 20% air saturation in the culture. About 2.8 x 105 cells/ml were inoculated into the media. Eighty-seven hours later, the cells were infected with recombinant baculovirus capable of inducing expression of rCSF-1. Subsequently, over several days several parameters were measured including cell number, cell viability, and the amount of rCSF-1 . These data are shown in Table 2, below. It was observed that 25 hours post-infection, there was measurable rCSF-1 activity as determined by standard radioimmune assays, wherein the amount of rCSF-1 was about 2 x 10⁴ micrograms per milliliter. This amount increased to about 1.2 x 10⁶ by 121 hours post-infection. During this time of recombinant protein production, cell viability ranged from 99% viable at the time of infection to 30% viable at 121 hours post-infection. The cell number increased from the initial inoculant of 2.8 x 10⁵ cells/ml, to 25.2 x 10⁵ cells/ml at the time of infection, and sufferred a rapid halt in cell growth after infection, reaching a maximum of 30.4 viable cells/ml at 49 hours post infection.

Table 2 Expression of rCSF-1

Growth Data

Da\

Experiments similar to those described in Example 3 were conducted to measure the effectiveness of the instant culture system on the production of IL-6 by insect cells. This consisted of making the appropriate recombinant IL-6 baculovirus that could be used to infect Sf9 cells, thereby introducing the IL-6 encoding sequences into these cells. Because recombinant baculovirus are made by homologous recombination with DNA transfer vectors, in this case transfer vectors carrying IL-6 sequences, it was first necessary to construct the appropriate transfer vectors. The cDNA encoding for IL-6 is described by Hirano et al., 1986, Nature. 324(6). and was used to make the transfer vectors.

Recombinant Techniques

Recombinant IL-6 having the desired restriction sites can be produced using the techniques of molecular biology, either those known in the art, or newly discovered technique presented below. Those techniques generally known in the art are described by Maniatis et al. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory. Cold Spring Laboratory. New York. (1982). In addition, many of the materials and methods described herein are also exemplified in Methods & Enzvmologv. 153-155. Editor Ray Wu/Lawrence Grossman, Academic Press. Inc.. Volume 153 covers methods related to vectors for cloning DNA and for the expression of cloned genes. Particularly note worthy is volume 154, which describes methods for cloning cDNA, identification of various cloned genes and mapping techniques useful to characterize the genes, chemical synthesis and analysis of oligodeoxynucleotides, mutagenesis, and protein engineering. Finally, volume 155 presents the description of restriction enzymes, particularly those discovered in recent years, as well as methods for DNA sequence analysis. These references are hereby incorporated in their entirety, as well as are additional references described below. Construction of IL-6 With Nco I and Bam HI Restriction Sites

As mentioned above, in order to express IL-6 in insect cells it was desired to construct a transfer vector that could be used to produce recombinant baculovirus which, in turn, could be used to infect Sf9 cells that would express IL-6. Thus, the initial step was to produce the appropriate transfer vector, pLP37, which contains the cDNA sequence that encodes IL-6. pLP37 was made by ligating IL-6 sequences into an already existing transfer vector, pAcC5, as shown in Figure 1. The derivation of pAcC5 is described in European Patent Application No. 87311523.3, filed December 30, 1987 and U.S. patent application, Serial No. 947,846, filed December 30, 1986, to Devlin, eial- Because pAcC5 has Ncol and Bam HI restriction sites downstream of the polyhedrin promoter, Ncol and Bam HI sites were created at the 5' and 3' ends of the IL-6 encoding sequence to permit insertion of the IL-6 sequences into pAcC5 so that transcription of IL-6 would be under the control of the polyhedrin promoter. The construction of IL-6 with the desired restriction sites was accomplished using the recently developed technique, Polymerase Chain Reaction (PCR). Similar results can be obtained using standard M13 mutagensis techniques. Both approaches are described below.

PCR: Oligonucleotides were synthesized having Nco I and Bam HI sites. These oligonucleotides were used in the PCR reaction to mutagenize IL-6 to introduce at the 5' and 3' ends of the molecule Nco I and Bam HI sites, respectively. The oligonucleotides employed have the following structures:

LP58 CCCAGCjCAJIiGCTTCCTTCTCCACAAGCGCC

Nco l LP59 AGTCXJACIQAICCTCACATTTGCCGAAGAGCCC

Bam HI

The oligonucleotides shown above can be prepared by the triester method of Matteucci fit al-, J. Am. Chem. Soc.102:3185, or using commercially available automated oligonucleotide synthesizers. Herein after the oligonucleotides are referred to by number as LP58 and LP59. The DNA sequence of 100 bases of IL-6 at the 5' and 3' end is shown in Figure 2. Above the sequences are shown those nucleotides that form the Nco I and Bam HI restriction sites.

PCR was carried out using IL-6, the oligonucleotides LP58 and LP59, and standard procedures known in the art. The conditions for performing PCR are described in U. S. Patent Nos. 4,683,202; 4,683,195 and 4,800,159. The resulting IL-6 Nco 1/ Bam HI DNA sequence was inserted into pAcC5 as shown in Figure 1, to yield the transfer vector pLP37. pLP37 was in turn used to produce recombinant virus encoding for EL-6. Detailed methods for the generation of recombinant virus can be found in European Patent Application Publication No. 127, 839 (published December 12, 1984) to Smith el al-; and U.S. Patent No. 4,745,051, to Smith el al-, issued May 17, 1988. In general, 2 μg of pLP37 and 1 μg of AcNPv viral DNA are cotransfected onto monolayer culture cells of Spodoptera frugiperda wherein recombination occurs. Recombinant baculoviruses are then detected and isolated according to methods described in European Patent Application Publication No. 127, 839 (published December 12, 1984) to Smith ei l-, U.S. Patent No. 4,745,051, Id-, and Summers ei al-, "A Manual and Methods for Baculovirus Vectors and Insect Cell Culture Procedures" (January 17, 1986), and the resultant recombinant baculovirus used to infect cultured insect cells and the protein product, EL-6, from the incorporated selected gene is expressed by the insect cells and secreted into the medium.

M13 Mutagensis: The IL-6 cDNA sequence can be mutagenized to produce IL-6 having the desired Nco I and Bam HI restriction sites using site specific mutagenesis employing M13 mutagensis techniques. Generally, this entails subcloning the IL-6 sequence into a suitable M13 vector, and isolating the phage DNA, preferably single-stranded DNA.

The latter is used to mutagenize the sequence. The revelant subcloning and mutagenesis procedures are described by Maniatis el al-, and in Methods in Enzymology. above.

Typically the IL-6 chain sequence is mutagenized using oligonucleotide directed mutagenesis to introduce the appropriate restriction sites wherein synthetic oligonucleotide primers are employed that are complementary, except for limited mismatching that brings about the desired mutation in the IL-6 sequences present in the single-stranded phage DNA to be mutagenized. Briefly, the IL-6 sequence to be mutated is ligated into a phage vector such as M13mpl8 or the like, and preferably into a polylinker site. A synthetic oligonucleotide is used as a primer to direct synthesis of a strand complementary to the single-stranded DNA and the resulting double-stranded DNA is transfected into phage-supporting host bacteria. The oligonucleotides shown above in Table 1 may similarly be employed here. Cultures of the transformed bacteria are plated in top agar containing susceptible bacteria, permitting plague formation from single cells which harbor the phage.

Following construction of IL-6 with the desired restriction sites, the construct may be cloned into a expression vector. Construction of suitable vectors containing the desired IL-6 construct, plus coding and control sequences involves using standard ligation and restriction techniques which are generally well understood in the art. Isolated plasmids, DNA sequences, or synthesized oligonucleotides are cleaved, tailored, and religated in the form desired.

Site specific DNA cleavage is performed by treating with a suitable restriction enzyme (or enzymes) under conditions which are also generally understood in the art, and the particulars of which are specified by the manufacturer of these commercially available restriction enzymes. See, e.g., New England Biolabs, Product Catalog. In general, about 1 μg of plasmid or DNA sequence is cleaved by one unit of enzyme in about 20 μl of buffer solution. In the examples described herein, typically, an excess of restriction enzyme is used to insure complete digestion of the DNA substrate. Incubation times of about one hour to two hours at about 37°C are workable, although variations can be tolerated. After each incubation, protein is removed by extraction with phenol chloroform, and may be followed by ether extraction, and the nucleic acid recovered from aqueous fractions by precipitation with ethanol followed by running over a Sephadex G-50 or Biogel P-6 spin column. If desired, size separation of the cleaved fragments may be performed by polyacrylamide or agarose gel electrophoresis using standard techniques. A general description of size separations is found in Methods of Enzvmologv. 1980, 6^:499-560.

Restriction cleaved fragments may be blunt ended by treating with the large fragment of E. coli DNA polymerase I (Klenow) in the presence of the four deoxynucleotide triphosphates (dNTPs) using incubation times of about 15 to 25 minutes at 20° to 25°C in 50 mM Tris pH 7.6, 50 mM NaCl, 6 mM MgCl₂, 6 mM DTT and 5-10 μM dNTPs. The Klenow fragment fills in at 5' sticky ends but chews back protruding 3' single strands, even though the four dNTPs are present. If desired, selective repair can be performed by supplying only one of the, or selected, dNTPs within the limitations dictated by the nature of the sticky ends. After treatment with Klenow, the mixture is extracted with phenol/chloroform and ethanol precipitated followed by running over a Sephadex G-50 spin column. Treatment under appropriate conditions with SI nuclease results in hydrolysis of any single-stranded portion.

Host strains that may be used in cloning and expressing the desired IL-6 constructs are as follows. For clorώag and sequencing, and for the expression of constructions under the control of most bacterid promoters, E. coli strain MM294 may be used as the host. Talmadge, K. fit al., 1980, Gene, 12:235; Messelson, M. eial-, 1968, Nature.217:1110. For expression under the control of the PL N-RBS promoter, E. coli strain K12 MC1000 Lambda lysogen,

N₇N₅3cI857£usP₈0, ATCC No. 39531, may be used, as well as E. coH strain DG116 also a MM294 strain. This strain is deposited in the assignees culture collection under accession number CMCC 2298. For Ml 3 phage recombinants, E. coH strains susceptible to phage infection, such as E. ∞H K12 strain DG98 are employed. It will be appreciated that transformation of particular host cells is a procedure known in the art, and is done using standard techniques appropriate to the host cell sought to be transformed. Host cells that exhibit substantial cell wall barriers, such as prokaryotes are generally transformed using calcium chloride as described by Cohen, S.N., 1972, Proc. Natl. Acad. Sci, USA. 69:2110, or the RbCl method described by Maniatis et al., above. Alternative methods are known, and that disclosed by D. Hanahan, in J. Mol. Biol.(1983). 16^:557-580, is preferred. In this method, the cells to be transformed are incubated at 37°C, 275 revs/min., until the cell density is 4 x 107 to 7 x lOVml (absorbance at 550 nm=0.45 to 0.55). The cells are collected in 50 ml polypropylene tubes (e.g. Falcon 2070), placed on ice for 10 to 15 minutes, and pelleted by centrifugation at 2500 revs/min. for 12 minutes at 4°C. The cells are resuspended in 1/3 volume TFB (10 mM-K-2-N-morphalinoethine sulfonic acid (pH 6.20), 100 mM RbCl, 45 mM MnCl₂4H₂0, 10 mM CaCl₂2H₂0, 3 mM HAC0CI3) by gentle vortexing, placed on ice for 10 to 15 minutes, and pelleted again at 2500 revs/min. for

10 minutes at 4°C. The pellet is resuspended in TFB at 1/12.5 of the original volume of cells (2.5 ml of the culture is concentrated into 200 μl, one discrete transformation). Fresh dimethyl sulfoxide (DMSO) is added to 3.5% (7 μl of stock/200 μl), swirled, and left on ice for 5 minutes. Dithiothreitol (DTT) is added to 75 mM (7 μl of stock/200 μl), swirled, and left on ice for 10 minutes. Another equal portion of DMSO is added, and the cells incubated for five minutes on ice. Samples (210 μl) are then placed into chilled 17 mm x 10 mm polypropylene tubes -(Falcon 2059). DNA is added in a volume of less than 10 μl and the mixture swirled and incubated on ice for 30 minutes. The mixture is heat-pulsed without agitation at 42°C for 90 seconds, and placed on ice for one to two minutes. Next, 800.μl of growth medium (=20°C) is added and the tubes incubated at 37°C, 225 revs/min. for 1 hour. Following growth, the cells are plated on selective medium.

The resulting plaques are hybridized with kinased synthetic primer at a temperature which permits hybridization of an exact match, but at which mismatches with the original strand are sufficient to prevent hybridization. Plaques containing phage which hybridize with probe are then picked, cultured, and the DNA recovered.

In more detail, approximately 1 pmole of phage single-stranded DNA template containing the IL-6 sequences is mixed with 10 pmoles of the appropriate synthetic oligonucleotide primer to effect mutagenesis in 15 μl of 10 mM Tris, 10 mM MgCl₂, 90 mM NaCl. The mixture is heated to 67°C for 3-5 minutes and then to 42°C for 30 minutes. The mixture is cooled on ice, and a ice cold solution containing the four dNTPs at 500 μM and 3-5 units of Polymerase I (Klenow) in sufficient buffer to bring the volume to 20-25 μl is added. The mixture is left at 0°C for 5 minutes and then brought to 37°C for 30 minutes. The Klenow enzyme is then inactivated for 15 minutes at 75°C, and the mixture transformed into an appropriate host, such as E. coli JM103 or JM105, which are grown on yeast extract-tryptone agar plates. The resulting phage plaques are transferred to filters by lifting onto nitrocellulose, or another suitable filter such as Biodyne A nylon filters, and prehybridized in 5 ml/filter of 6 x SCC, pH 7.0, 5 x Denhardts, 0.1% SDS, 50 μg/ml carrier (Salmon sperm DNA) at the desired temperature for 1-2 hours.

In --rder to detect plagues that contain the sought after IL-6 sequence, the fixed, prehybridized filters are hybridized with an appropriate suitably radiolabelled kinased synthetic primer oligonucleotide, generally about 2 x 105 cpm/ml (approximately 2 - 10 x 107 cpm/μg) for 3-16 hours. Subsequent processing of the filters depends on the degree of complementarity of oligonucleotide binding to the IL-6 sequences, and determines the degree of stringency to be apphed to washing the filters. Typical moderately stringent conditions employ a temperature of 42°C for 24-36 hours with 1-5 ml/filter of DNA hybridization buffer containing probe. For higher stringencies, high temperatures and shorter times are employed. The filters are washed four times for 30 minutes each time at 37°C with 2 x SSC, 0.2% SDS and 50 mM sodium phosphate buffer at pH 7, then twice with 2 x SSC and 0.2% SDS, air dried, and are autoradiographed at -70°C for 2 to 3 days. DNA hybridization buffer generally consist of (5 x SSC, pH 7.0, 5 x Denhardt's solution (polyvinylpyrrolidine, plus Ficoll and bovine serum albumin; 1 x = 0.02% of each), 50 mM sodium phosphate buffer at pH 7.0, 0.2% SDS, 20 μg/ml Poly U, and 50 μg ml denatured salmon sperm DNA. Positive plaques are picked, and the resulting Ml 3 vector expanded by infection of a suitable host cell. DG98 is the preferred host cell as it is readily infected by M13. The DG98 strain has been deposited with ATCC July 13, 1984, and has accession number 39768. Single stranded M13 DNA can be isolated from DG98 culture media, and double-stranded replicative form DNA (RF DNA) from a cell pellet A representative procedure whereby the oligonucleotides are kinased includes using an excess, that is, approximately 10 units of polynucleotide kinase to 10 pmole substrate in the presence of 50 mM Tris, pH 7.6, 10 mM MgCl₂, 5 mM dithiothreitol, 40 pmoles of 2P-ATP (3000 Ci/mmole), 0.1 mM spermidine, and 0.1 mM EDTA.

As alluded to above, introducing the desired restricition sites into IL-6 consist of combining the oligonucleotide primers to 11-6 DNA sequences ligated into Ml 3 at an appropriate oligonucleotide site. These ligations, as well as those described subsequently, can generally be performed in 15-30 μl volumes under the following standard conditions and temperatures: 20 mM Tris-Cl pH 7.5, 10 mM MgCl₂, 10 mM DTT, 33 μg/ml BSA, 10 mM-50 mM NaCl, and either 40 μM ATP, 0.01-0.02 (Weiss) units T4 DNA ligase at 0°C. This reaction is generally used to ligate "sticky ends". "Blunt end" ligations can be carried out using 1 mM ATP and 0.3-0.6 (Weiss) units T4 DNA ligase at 14°C. Typically "sticky end" ligations are performed at 33-100 μg ml total DNA which generally corresponds to 5-100 mM total end concentration. "Blunt end" ligations usually employ a 10-30 fold molar excess of linkers, and are generally performed at 1 μM total end concentration. In vector construction employing "vector fragments", the vector fragment is commonly treated with bacterial alkaline phosphatase (BAP) in order to remove the 5' phosphate and prevent religation of the vector. BAP digestions are conducted at pH 8 in approximately 150 mM Tris, in the presence of Na+ and Mg+2 using about 1 unit of BAP per μg of vector at 60°C for about 1 hour. Vector fragments subjected to this treatment are referred to herein as "BAPped". If unkinased oligodeoxyribonucleotides are used however, the vector fragments are not "BAPped". In order to recover the nucleic acid fragments, the preparation is extracted with phenol/chloroform and ethanol precipitated and desalted by application to a Sephadex G- 50 spin column. Alternatively, religatrn can be prevented in vectors that have been double digested by additional restriction enzyme digestion of the unwanted fragments.

The presence of the proper DNA fragment can be confirmed by restriction fragment analysis and by sequencing selected fragments. DNA sequencing can be conducted using the dideoxynucleotide chain-termination method (Sanger eial-, 1977, Proc. Nat'l Acad. Sci. USA. 24:54-63) on single-stranded M13 templates or alkali-denatured supercoiled plasmids (Chen and Seeburg,1985, DNA.4:165).

Following expansion of the desired IL-6 construct in M13, the phage DNA can be isolated and digested with suitable restriction enzymes to remove the mutein sequence in order to ligate it into an expression vector to express the mutein. The techniques for carrying out these procedures have been previously described, or are described by Manitias fit al, above. A preferred expression vector is pPL231 and a preferred host cell is HB2154. Transformation of pPL231 into HB2154, as well as the identification and isolation of transformed colonies can be realized also using techniques described above or that are standard in the art.

Expression of the IL-6 construct may be realized in a suitable procaryotic host cell, such as various strains of £. fioli. However, other microbial strains may also be used, such as bacilli, for example Bacillus subtilis, various species of Pseudomonas, or other bacterial strains. In such procaryotic systems, plasmid vectors which contain replication sites and control sequences derived from a species compatible with the host .are used. For example, E. coli is typically transformed using derivatives of pBR322, a plasmid derived from an E. coli species by Bolivar, el al-, 1977, Gene.2:95. pBR322 contains genes for ampicillin and tetracycline resistance, and thus provides additional markers which can be either retained or destroyed in constructing the desired vector. Commonly used procaryotic control sequences which are defined herein include promoters for transcription initiation, optionally with an operator, along with ribosome binding site sequences. Examples are the beta-lactamase (penicillinase) and lactose (lac) promoter systems (Chang, eial-, 1977, Nature. 198:1056) and the tryptophan (tip) promoter system (Goeddel, ei al-, 1980, Nucleic Acids Res. &4057) and the lambda derived PL promoter and N-gene ribosome binding site (Shimatake, fit al-, 1981, Nature. 292: 128), which has been made useful as a portable control cassette, as set forth in copending application Serial No. 578,133, filed February 8, 1984, and assigned to the same assignee. However, any available promoter system compatible with procaryotes can be used. In one embodiment of the invention DNA encoding recombinant IL-6 that is soluble in the cytosol of E. coli and active biologically, is cloned into an expression vector that replicates in E. coh and expresses recombinant IL-6 under the control of control sequences operable in E. coli. Expression vectors of this type are known to those having ordinary skill in the art and include the operator and promoter wherein expression is induced by limiting availability of tryptophan in the medium, and the PL promoter wherein expression is controlled by a temperature sensitive repressor factor which is contained as a part of the bacterial chromosome.

Example 5 The expression of IL-6 in sparged insect cell culture was demonstrated as follows. Approximately 2.4 x 10⁵ Sf-9 cells per milliliter were inoculated into 6.5 liters of ISFM-4 cell culture media. The culture vessel was a 6 liter spinner flask having a height of 235 cm and a diameter of 200 cm. Two impellors were used having dimensions of 83 mm x 19 mm. The impellors were rotated at 150 revolutions per minute, and the culture was sparged with air at 1 liter per minute. Sixty nine hours after the Sf-9 cells were inoculated into the culture media, at about 1.3 x 10⁶ cells/ml, they were infected with recombinant baculovirus at a multiplicity of infection of 3.

The cell culture medium was assayed at 24 and 47 hours post baculovirus infection for IL-6. The assay was performed as described by Helle, el al,.1988, European J. Immunol.. 18:1535-1539. It was determined that at 24 and 47 hours there was about 2.6 and 8.1 mg/liter of IL-6 present in the media.

Example 6 This example demonstrates that wild type baculoviruses with occlusion bodies, i.e., polyhedra, were successfully grown in a sparged culture comprising serum free ISFM-4 medium. In this example, insect cell line Sf9, previously adapted for growth in ISFM-4 serum free medium, was grown in a 6 liter suspension culture. The culture was inoculated at 2.0 x 10⁵ viable cells/ml and allowed to grow for 96 hours, to a cell density of 2.2 x 10⁶ viable cells/ml. The culture was then infected at a multiphcity of infection (MOI) of 2.5, with a mixed virus stock of wild type virus and virus co-transfected with recombinant plasminogen activator plasmid pLP19. Wild type (polyhedra forming) virus was present due to incomplete plaque purification of the virus stock. Forty-seven hours after infection, the recombinant plasminogen activator protein was harvested. Simultaneously, it was observed that many infected cells exhibited multiple polyhedra, which evidenced infection with wild type baculovirus. The photograph shown in Figure 3 was typical of such cells. Having generally described the invention, it will be appreciated by those skilled in the art that the scope of the invention is limited only by the appended claims, and not by the particular materials and methods described above.

Claims

WE CLAIM:

1. A method of cultivating insect cells to high cell density with high viability comprising supplying oxygen by sparging to culture media containing said cells.

2. A method according to claim 1, wherein the media comprises one or more non- toxic protective agents.

3. A method according to claim 2, wherein the protective agents prevent disintegration or clumping of insect cells.

4. A method according to claim 3, wherein the protective agents are anti-foaming agents.

5. A method according to claim 3, wherein the protective agents are non-toxic, water soluble compounds that protect insect cells from death under well-aerated culture conditions.

6. A method according to claim 5, wherein the protective agent comprises a non- toxic, water soluble polymer.

7. A method according to claim 6, wherein the protective agent is a cell surface stabihzing agent, and/or a viscosifying agent and/or a bubble surface tension reducing agent.

8. A method according to claim 6, wherein the protective agent is selected from the group consisting of hydroxyethyl starch, methyl cellulose, carboxymethyl cellulose, dextran sulfate, polyvinylpyrrolidone, ficoll, alginic acid, polypropyleneglycol, and non-toxic polymeric detergents.

9. A method according to claim 8, wherein the non-toxic polymeric detergents are non-ionic.

10. A method according to claim 9, wherein the non-toxic detergents are block copolymers comprising a substantial hydrophobic core and substantial hydrophilic tail(s).

11. A method according to claim 10, wherein the non-toxic, non-ionic polymeric detergents are block copolymers of propylene oxide and ethylene oxide.

12. A method according to claim 11 , wherein the protective agent comprises Pluronic polyols.

13. A method according to claim 12, wherein the Pluronic polyols are selected from the group consisting of Pluronic F68, F77, F88 and F108.

14. A method according to claim 13, wherein the Pluronic polyols are selected from the group consisting of Pluronic F68 and F88.

15. A method according to claim 14, wherein the Pluronic polyol is Pluronic F68.

16. A method according to claim 13, wherein the Pluronic polyol(s) are present in the media at a total concentration (weight volume) of from about 0.01% to about 1%.

17. A method according to claim 16, wherein the total concentration of the Pluronic polyol(s) in the media is from about 0.05% to about 0.5%.

18. A method according to claim 17, wherein the total concentration of Pluronic polyol(s) is about 0.1%.

19. A method according to claim 16, wherein said sparging comprises supplying oxygen to said culture media as bubbles that range in diameter size from about 0.2 cm to about 2.0 cm.

20. A method according to claim 19, wherein the sparged bubbles range in diameter from about 0.3 cm to about 1.5 cm.

21. A method according to claim 19, wherein said sparged bubbles are delivered at a rate from about 0.01 wm to about 0.25 wm.

22. A method according to claim 21 , wherein the sparging rate is from about 0.02 vvm to about 0.06 wm.

23. A method according to claim 21, comprising providing oxygen primarily via sparging and agitating said media.

24. A method according to claim 23, wherein said stirred culture format comprises growing cells in a vessel wherein the ratio of the height of the liquid in the vessel employed to the vessel's diameter is in the range of about 0.2/1 to 4/1.

25. A method according to claim 21, wherein supplying oxygen to the culture media is by an airlift format.

26. A method according to claim 25, wherein said airlift format comprises growing said cells in a culture vessel having a ratio of the height of the liquid in the airlift vessel employed to its diameter in the range of from about 3/1 to about 12/1.

27. A method according to claim 26, wherein the ratio is from about 6/1 to about 8/1.

28. Insect cell culture media for sparged culture of insect cells which comprises one or more protective agents wherein the protective agents comprises non-toxic, non-ionic polymeric detergents.

29. Insect cell culture media for sparged culture of insect cells which comprise one or more protective agents wherein the protective agents comprise Pluronic polyols.

30. A method of selecting a protective agent for the media of claim 28 , comprising the steps of; a) adding said protective agent to a small shake flask culture of insect cells; b) agitating said cells under sparged cell culture conditions; and c) determining if said cells disintegrate or clump.

31. Insect cell culture media according to claim 29, which comprise a basal medium which is either supplemented or not supplemented with serum.

32. Insect cell culture media according to claim 29, wherein the media are not supplemented with serum.

33. Insect cell culture media according to claim 29, wherein the medium is not supplemented with serum and which further comprises a lipid component, and a peptone component.

34. Insect cell culture media according to claim 33, wherein the protective agents are selected from the group comprising Pluronic polyols at a total concentration of about 0.01% to about 1%.

35. Insect cell culture media according to claim 34, wherein the protective agent is Pluronic F68 at a concentration of about 0.1%.

36. A method for the production of wild type or recombinant virus, or viral or recombinant products, comprising the steps of: a) growing insect cells in the media of claim 2; b) infecting the insect cells with the wild type or recombinant virus; and c) harvesting the wild type or recombinant virus, viral or recombinant products therefrom.

37. A method according to claim 36, wherein the insect cells are infected with wildtype or recombinant virus during the exponential growth phase of insect cells in culture.

38. A method according to claim 37, wherein the wild type or recombinant virus is baculovirus.

39. A method according to claim 38, wherein the insect cells are selected from the group consisting of Diptera or Lepidoptera orders.

40. A method according to claim 39, wherein the insect cells are from Spodoptera frugiperda.

41. A method according to claim 40, wherein the insect cells are Sf9 cells.

42. A method according to claim 41, wherein said baculovirus comprises recombinant NPV virus from Autographa species.

43. A method according to claim 42, wherein the recombinant NPV virus is either AcM4 or AcM6.

44. A method according to claim 36, wherein the recombinant products are selected from the group consisting of colony stimulating factor, an interferon, an interleukin, tumor necrosis factor, erythropoietin, human, porcine or bovine growth hormone, epidermal growth factor, insulin, Factor VIII, modified pro-urokinase, urokinase, tissue plasminogen activator (tpa), a tpa-urokinase hybrid protein, albumin, hepatitis B vaccine protein, feline leukemia virus vaccine protein, superoxide dismutase, atrial natriuretic factor, whole ricin toxin, ricin A chain, ricin A hybrid protein, a lectin, diphtheria toxin, gelonin, Pseudomonas aeruginosa exotoxin, PAPI, PAPJH, PAP-S, CAT, or a Bacillus thuringiensis toxic protein.

45. A method according to claim 36, wherein the recombinant products are selected from the group consisting of colony stimulating factor and IL-6.

46. Colony stimulating factor produced by the method of claim 36.

47. IL-6 produced by the method of claim 36.

48. Wild type or recombinant virus produced by the method of claim 36.

49. Occluded or nonoccluded virus produced by the method of claim 48.