WO1990015075A1

WO1990015075A1 - HTLV-1 ENV GENE PRODUCTS EXPRESSED IN $i(E. COLI)

Info

Publication number: WO1990015075A1
Application number: PCT/US1990/002727
Authority: WO
Inventors: Mark D. Chamberlain; Radonna J. Tritch; David E. Tribe
Original assignee: E.I. Du Pont De Nemours And Company
Priority date: 1989-06-01
Filing date: 1990-05-23
Publication date: 1990-12-13
Also published as: AU5827590A; CA2017936A1

Abstract

This invention relates to recombinant HTLV env-encoded peptides expressed in E. coli, and their use for detecting HTLV antibodies in biological specimens.

Description

Title

HTLV-1 env Gene Products Expressed in E. coli

Background of the Invention

Human T-cell leukemia viruses are a group of retrovi ruses that have been implicated as the etiological agents in several human malignancies, including a type of acute T-cell

leukemia/lymphoma (ATLL) (Poiez et al. (1980) Proc. Natl. Acad. Sci. USA 77:7415-7419; Yoshida et al. (1982) Proc. Natl. Acad. Sci. USA 79:2031-2035; Kalyanaraman et al. (1982) Science

218:571-573; Weiss "Human T-Cell Retroviruses" in RNA Tumor Viruses. Second Edition (Weiss, Teich, Varmus, Coffin, Eds.), Cold Spring Harbor, NY, 1985, pp 405-485). In addition to its ability to induce leukemia, HTLV type 1 (HTLV-1) may also play an important role in certain disorders of the central nervous system, including multiple sclerosis and tropical spastic paraparesis (Reddy et al. (1988) Proc. Natl. Acad. Sci. USA

85:3599-3603).

The HTLV-1 env gene codes for a protein precursor, designated gp62, which contains about 488 amino acids (aa) and contains two major domains. The N-terminal domain, aa 1 to 312, is the exterior glycoprotein region and is designated gp46; the

C-terminal domain, aa 313 to 488, is the transmembrane region and is designated p21E (Shultz et al. (1984) Virology 135:417-427; Schupback et al. (1984) Science 224:604-607; Lee et al. (1984) Proc. Natl. Acad. Sci. USA 81:3856-3860). The env precursor protein, aa 1 to 488, is proteolytically cleaved into gp46 and p21E during virus assembly and maturation.

The entire DNA sequence of the HTLV-1 provirus has been reported (Seiki et al. (1983) Proc. Natl. Acad. Sci. USA

80:3618-3622). The complete aa sequence of HTLV-1 ATK strain env protein (Seiki et al.) is shown below in Table 1.

Expression in E. coli of proteins containing various segments of HTLV-1 env has previously been reported. Yoshida and coworkers reported the expression of a fusion protein in E. coli containing aa 284 to 466 of HTLV-1 env (Kiyokawa et al. (1984) Proc. Natl. Acad. Sci. USA 81:6202-6206; U.S. Patent Number 4,724,258). The plasmid vector used by Kiyokawa et al. is designated pEAI. It comprises an HTLV-1 env DNA sequence inserted into the pORF1 plasmid expression vector (Weinstock et al. (1983) Proc. Natl. Acad. Sci. USA 80:4432-4436). The env fragment aa 284 to 466 expressed by Kiyokawa et al. is expressed as a fusion protein containing at the N-terminus a short sequence for an E. coli outer membrane protein, env aa 284 to 466, and at the C-terminus a large segment of E. coli β-galactosidase. The fusion protein reacts with human serum containing antibodies to HTLV env protein. The fusion protein has a molecular weight of about 150 kDa, most of which (about 110 kDa) is derived from E. coli β-galactosidase. Samuel et al. (Gene Anal. Techn. (1985) 2:60-66) report expression in E. coli of the segment of HTLV-1 env protein corresponding to aa number 307 to 440 as a fusion protein, with 13 aa from the phage λ cll gene at the N-terminus. Plasmid pJLA16, a derivative of expression vector PJL6 (Lautenberger et al. (1983) Gene 23:75-84). was used. The expressed protein is reported to react with serum samples containing HTLV-1

antibodies. Summary of the Invention

This invention relates to recombinant peptides displaying the antigenicity of HTLV viral antigens, comprising an antigenie segment of about 128 amino acids, comprising an amino acid sequence corresponding to about 27 amino acids of the C-terminal region of the gp46 domain and about 101 amino acids of the N- terminal region of the p21E domain, as shown in Table 5. Also included is such a peptide additionally comprising about 60 amino acids encoded by the poliovirus protease gene of plasmid pEXC (Ivanoff et al. (1987) Proc. Natl. Acad. Sci. USA 83:5392-5396) fused to the N-terminus of the recombinant peptide, as shown in Table 4.

This invention also relates to recombinant peptides

displaying the antigenicity of HTLV viral antigens comprising an antigenie segment of about 212 amino acids, comprising an aa sequence corresponding to about 84 amino acids of the C-terminal region of the gp46 domain and about 128 amino acids of the N- terminal region of the p21E domain, as shown in Tables 6 and 7.

The peptides, which comprise an important antigenie subregion of the HTLV env gene product, represent a key reagent for detecting human HTLV infection. The antigenie segment spans the junction between env-encoded proteins, gp46 and p21E.

Also disclosed is a method of detecting antibodies to HTLV in a biological sample wherein the biological sample is contacted with an HTLV-derived peptide of the invention, and an

immunological reaction is detected. The peptides of the invention are highly sensitive and specific for detecting antibodies to HTLV; they show considerable promise for blood screening and other diagnostic purposes. Detailed Description of the Invention

This invention relates to recombinant peptides displaying the antigenicity of HTLV env viral antigens, comprising an antigenic segment of about 128 amino acids, corresponding to about 27 amino acids of the C-terminal region of the gp46 domain and about 101 amino acids of the N-terminal region of the p21E domain, as shown in Table 5. The antigenic segment of about 128 amino acids, comprising an amino acid sequence corresponding to about 27 amino acids of the C-terminal region of the gp46 domain and about 101 amino acids of the N-terminal region of the p21E domain,

corresponds to aa number 286-413 of HTLV-1 strain ATK env, as shown in Table 5. The env segment aa number 286-413 was

expressed in E. coli as a poliovirus protease-env fusion protein, designated HL0-8P (Example 2), which is expressed at high levels in E. coli using a plasmid expression vector under the control of the trp operon promoter, and which is conveniently purified as an insoluble aggregate. Alternatively, a larger env segment of about 212 amino acids containing aa number 229-440 is expressed in E. coli from a phage lambda P_L promoter-containing plasmid expression vector. The latter HTLV-1 env segment contains only 2 non-env-encoded aa at the N-terminus and 5 non-env aa at the C- terminus and is expressed as a soluble approximately 25 kDa peptide (Example 4; DAB847).

Expression of the recombinant peptides of the invention in E. coli proved to be difficult. A number of expression vectors that were tried failed to produce detectable levels of protein.

Notably, Samuel et al. (Gene. Anal. Tech. (1985) 2:60-66) report that a derivative of plasmid pJL6 (Lautenberger et al. (1983) Gene 23:75-84), which places 13 amino-terminal codons of the phage lambda cll gene under transcriptional control of the phage lambda P_L promoter, was used to express a segment of HTLV-1 env al so contai ni ng a C-termi nal portion of gp46 and the N-termi nal region of p21E (aa number 307-440) . However, our pl asmid pJL0-8, al so based on the Lautenberger et al . pJL6 pl asmi d, fai l ed to produce detectabl e l evel s of an env-deri ved peptide compri si ng aa number 286-413.

Because β-galactosidase was found by us to react with an unacceptably high frequency with serum samples from HTLV-1- infected, HIV-1-infected, and normal individuals (Example 9) and would be expected, therefore, to greatly reduce the selectivity and specificity of an assay employing a β-galactosidase fusion protein, the expression system of Yoshida et al. was considered unacceptable.

We have undertaken to express in E. coli certain segments of the HTLV env gene product for the purpose of producing the protein at high levels for use in diagnostic assays and vaccines for HTLV infection. Based on our previous experience with the HIV env gene product (copending coassigned U.S. Patent

Application Serial Number 07/010,056, filed 02/02/87), we selected a segment including the C-terminal portion of the exterior glycoprotein gp46 and the N-terminal portion of the transmembrane p21E region. We decided to investigate whether two particular fragments of HTLV env contained most of the important epi topes useful for the detection of HTLV-1 env-reactive antibodies in human serum samples. Initially, we attempted to express env segment aa number 286-413 as a fusion protein to 15 N-terminal aa from β-galactosidase, under the transcriptional control of the lac promoter, using the plasmid pHL0-8 (Example 1). However, pHL0-8 did not express detectable env-derived protein in E. coli. We were also unable to express env aa

286-413 using various derivations of the pJL6 expression plasmid (Lautenberger et al., supra). These plasmids, including pCE0-8, pJL0-8, and pCEera0-8, also did not express env-derived protein containing aa 286- 413 at detectable levels in E. coli (Example 5 and 6). We were, however, successful in expressing aa 286- 413 at reasonably high levels in E. coli as a fusion protein with N- terminal aa derived from the polio virus protease, using plasmid pHL0-8P (Example 2). Furthermore, HL0-8P was shown to be a sensiti ve and specifi c reagent for the detection of HTLV env- specific antibodies in human serum samples (Examples 8 and 9).

Kiyokawa et al., supra, previously reported the expression at high level in E. coli of a somewhat larger segment of HTLV-1 env (aa 286-466) as a fusion to an approximately 110 kDa segment of β-galactosidase, using plasmid pEA1. This product is, however, completely unacceptable as a diagnostic reagent for detection of HTLV-1 env specific antibodies in human serum samples because of the frequent high immunoreactivity of β-galactosidase with normal, as well as HIV-1 seropositive and HTLV-1 seropositive serum samples (Example 9). Thus, the presence of β-galactosidase results in a significant decrease in the specificity of the assay. Thus, our peptide HL0-8P and plasmid expression vector pHL0-8P have overcome the limitations of the Kiyokawa et al.

system.

Samuel et al. (supra) expressed at high levels in E. coli the HTLV-1 env segment aa number 307 to 440. We have tested this same segment of HTLV-1 env as an antigen for the detection of HTLV-1 env-specific antibodies in human serum samples (pC3, Example 8). It was found that env segment aa number 307-440 was immunoreactive with only 44/56 HTLV-1 seropositive serum samples tested, whereas aa number 286-413 (HL0-8P) was immunoreactive with 81/82 of the HTLV-1 seropositive serum samples tested. It is clear that aa number 286-413 contains most of the important env-specific epitopes and that aa number 307-440 is missing many important epitopes. It is also evident that there are important epitopes within the aa segment 286-307.

U.S. Patent Application 6-664,972, filed October 26, 1984, inventors: Papas, Samuel, Lautenberger and Wong-Staal, published by the NTIS, discloses the same expression system and env-derived product as Samuel et al. (supra). In this patent application it is stated that attempts to express the entire HTLV-1 env were unsuccessful (p3, lines 1-3). This statement is consistent with our great difficulty in expressing aa segment 286-413. Indeed, we were unable to express aa 286-413 at high levels in E. coli using the same expression system used by Samuel, Papas, et al.

It is noted that the polio protease pEXC plasmid expression vector also proved useful for the expression in E. coli of an HIV-1 env segment as a polio protease-env fusion protein

(copending coassigned U.S. Patent Application Serial Number 07/010,056, filed 02/02/87).

It is, however, desirable to express HTLV env protein in E. coli without a substantial number of non-env aa fused either to the N- or C-terminus. In order to maximize the specificity of the reagent, it is particularly desirable that there be 5 or fewer non-env aa fused to the recombinent antigen at either the C- or N-terminus. To that end, we were able to express a segment of HTLV env encompassing aa number 229 to 440, with only 5 aa or less fused at the N- or C-terminus, using plasmid pDAB847

(Example 4). The pDAB847 expression vector contains the phage lambda P_L promoter and also contains a deletion in the rop

function, which results in an increase in plasmid copy number (Polisky in Maximizing Gene Expression (Eds. Reznikoff and Gold), Butterworths, Boston, MA, 1986, pp 143-170) and a consequent increase in total product expressed from the plasmid vector.

Although the DAB847 product contains 2 non-env aa at the N- terminus and 5 non-env aa at the C-terminus, the aa 229-440 segment of HTLV env could be expressed using the high copy number plasmid, with rop deletion and containing the P_L promoter, with only an additional N-terminal Met aa and no non-env aa at C- terminus. The segment of HTLV env aa 286-413 could also be expressed with only an additional N-terminal Met aa at the N- terminus using the plasmid vector containing the rop deletion and P_L promoter. The N-terminal Met aa may be removed by

aminopeptidases in E. coli during biosynthesis or following isolation of the product, to yield a recombinant antigen with no non-env aa.

The HTLV env segment aa number 286-413 is 128 aa in length. Although it may not presently be commercially possible to chemically synthesize peptides of such length, it is anticipated that the 128 aa length HTLV env peptide of the invention could also be prepared by non-recombinant, direct chemical synthesis methods.

It would be noted that there exists substantial homology in aa sequence between HTLV-1 and HTLV-2 (Shimotohno et al. (1985) Proc. Natl. Acad. Sci. USA 82:3101: Seiki et al., supra), that results in substantial cross-reactivity between HTLV-1 and HTLV-2 (Lee et al. (1989) Science 244:471-475). Thus, the HTLV-1 env- derived antigens of the invention are expected to also be useful for the detection of HTLV-2 env-specific antibodies in human serum samples.

The nucleotide sequences for several independent isolates and strains of HTLV-1 and HTLV-2 have been reported. The nucleotide sequences for these different HTLV variants are compiled in Human Retrovirus and AIDS 1989, Los Alamos National Laboratory, Los Alamos, NM. The segments of the env gene product for these variants of HTLV corresponding to aa number 229-440 and aa number 286-413 (according to Table 1; taken from Seiki et al., supra for HTLV-1 strain ATK) can be readily identified when the env-coded amino acid sequences are aligned for homology, e.g., by using standard computer programs available from, for example,

IntelliGenetics, Inc., Mountain View, CA, or Genetics Computer Group, University of Wisconsin Biotechnology Center, Madison, WI.

The term "corresponding to", as used herein in reference to amino acid sequences, refers to the relationship between aa which are aligned with one another when two or more aa sequences are compared and aligned for homology using the above standard computer programs. The term "corresponding to" also includes modifications of the specified aa sequence which do not adversely affect the antigenic and immunoreactivity characteristics of the recombinant peptides defined herein.

Nakamura et al. (Int. J. Cancer (1987) 40:403-407) report the use of the E. coli-expressed EA1 HTLV-1 env protein of Kiyokowa et al. (Proc. Natl. Acad. Sci. USA (1984) 81:6202-6206), for the protective immunization of monkeys against HTLV-1 infection.

These authors note on p. 406 that improvements are required in the baeterially synthesized env products before they can be used as an HTLV-1 vaccine, such as the development of env products without the portion of β-galactosidase. The authors state further that a fairly long time will be necessary before such a vaccine can be produced. The product DAB847 (Example 4) of the present invention provides such an env product, which is substantially free of fused non-env aa.

Plasmid pDAB853 (pHL0-8P, Example 2) in E. coli XL1-Blue, and plasmid pDAB847 (Example 4) in E. coli TAP 106, have been deposited in the American Type Culture Collection (ATCC),

Rockville, MD. Both deposits were made in accordance with the provisions of MPEP 608.01 (p) (C) (1) (2) and (3) and the

Budapest Treaty. The ATCC accession numbers are 67917 and 67947, respectively. Access to the cultures will be available during pendency of the patent application to one determined by the Commissioner to be entitled thereto under 37 CFR 1.14 and 35 USC 122. Upon granting of a patent, all restrictions on the availability of the cultures to the public will be irrevocably removed.

Construction of Plasmid Expression Vectors for Production of HTLV-1 env-derived Proteins in E. coli

EXAMPLE 1

Construction of Plasmid pHL0-8 and Expression of HL0-8

The construction of a synthetic HTLV-1 env coding sequence for env segment for aa 286-413 is described below. To obtain a DNA sequence coding for the desired segment of the HTLV-1 env polypeptide a synthetic coding sequence, referred to as HL0-8, was assembled from chemically synthesized oligonucleotides.

Standard methods for ligation of the synthetic oligonucleotides were used to form the complete desired coding sequence. Oligodeoxynucleotide Synthesis:

All oligonucleotide synthesis reagents were purchased from Applied Biosystems Inc. (Foster City, CA) (ABI) with the exception of acetonitrile (American Scientific, McGraw Park, IL) and sodium hydroxide (VWR, Bridgeport, NJ). All oligonucleotides were synthesized using an ABI 380B synthesizer. Syntheses were carried out using methyl- or 2-cyanoethylphosphoramidites and protocols provided by ABI. The protected CPG-bound

oligonucleotide product was cleaved from the support and fully deblocked according to standard procedures (ABI user manual).

Enzymatic 5'-phosphorylation and Annealing of

01 igodeoxynucleotides:

Phosphorylations were performed in 70 mM Tris Cl (pH 7.6), 10 mM MgCl₂, 5 mM DTT, and 10 mM ATP plus 20 μg of oligonucleotide, and 5 units T4 polynucleotide kinase (total volume = 20 μ l ) . The kinase reaction was incubated at 37°C for 1 hour, 5 additional units of kinase were added, and the reaction incubated at 37°C for another 1/2 hour. Each kinased single-stranded

oligonucleotide was incubated at 95°C for 3 minutes to inactivate the enzyme. Annealings were performed in 2 steps: (1) 2 μg of the unkinased complementary oligonucleotide was prepared in the above buffer (total volume = 20 μl), and (2) 10 μl of the unkinased oligonucleotide was mixed with 10 μ l of the kinased oligonucleotide. This annealing reaction was heated to 95°C and allowed to slowly cool to room temperature.

Ligation of Oligonucleotides Prior to Molecular Cloning:

Only the 5'-ends of the non-pal indromic overhangs were kinased as above. The 5'-ends of the external palindromic overhangs were not kinased. Each single-stranded oligonucleotide and its antisense complement were annealed as above. Each double-stranded oligonucleotide (25 pmoles) was added to the ligation buffer (66 mM Tris pH 7.6, 5 mM MgCl₂, 5 mM DTT, and 1 mM ATP) plus 400 units T4 DNA ligase (total volume = 20 μl ) and the mixture was ligated at 14°C overnight. Each ligation product was analyzed on a polyacrylamide gel to determine the amount of full length product formed. Any reaction which did not yield at least 10% full length product was further analyzed by

electrophoresis to determine which constituent oligonucleotide or oligonucleotide pair was defective. Any defective

oligonucleotide or oligonucleotide pair was either resynthesized or purified.

Each unpurified, ligated double-stranded oligonucleotide was inserted into a plasmid vector, pDAB712, which was derived from the plasmid vector pTZ18R (Pharmacia, Piscataway, NJ).

Plasmid pDAB712 was constructed to facilitate the assembly of the synthetic oligonucleotides encoding a segment of HTLV-1 env. Plasmid pDAB712 was constructed by replacing the small Xbal to Hindlll DNA segment in the multiple cloning site region of pTZ18R with an Xbal to Hindlll oligonucleotide containing an Xhol site. The multiple cloning restriction sites in pDAB712 are shown below in Table 2.

The HTLV-1 eriy synthetic coding sequence used to express the segment of HTLV-1 env corresponding to aa number 286-413, using the numbering of Seiki et al. (Proc. Natl. Acad. Sci USA (1983) 80:3618-3622), was assembled using a series of oligonucleotides with cohesive ends as indicated schematically in Table 3.

The oligonucleotide number is indicated below the coding sequence; for example the Kpnl to Ncol DNA fragment is formed by oligonucleotide #2. The nucleotide sequence of the SacI to Xhol DNA segment and encoded aa sequence are given in Table 4. The SacI site (GAGCTC) is located at nucleotide 186 and the Xhol site (CTCGAG) is located at nucleotide 591 in Table 4; the positions of the other restriction sites are also indicated in Table 4.

A multistep procedure was used to assemble the SacI to Xhol synthetic HTLV-1 coding sequence. This procedure is outlined below. The Kpnl to BamHI DNA fragment, designated as

oligonucleotides #2 and 3 in Table 3, was inserted between the Kpnl and BamHI sites of pDAB712, to yield pTZ2,3. The BamHI to Sail oligonucleotide #4 (Table 3) was inserted between the BamHI and Sail sites of pTZ2,3 to yield pTZ2,3,4. The Sail to Kpnl oligonucleotide #0 and 1 fragment (Table 3) was inserted between the SacI and Kpnl sites of pTZ2,3,4 to yield pTZ0-4.

Plasmid pHL0-8 was then constructed by insertion of the Sail to Xhol DNA fragment, formed by ligation of oligonucleotides #5-1, 5-2, 6, 7, and 8, between the Sail and Xhol sites of pTZ0-4. Plasmid pHL0-8 contains a coding sequence for an HTLV-1 env-derived protein corresponding to aa number 286 to 413 of the HTLV-I ATK strain env fused at the N-terminus to about 15 aa from the E. coli lacZ gene product (β-galactosidase) (M-T-M-I-T-N-L-I- R-L-T-I-G-N-S-). The region of HTLV-I env encoded by the synthetic SacI to Xhol coding sequence (Table 4) corresponding to aa number 286 to 413 of HTLV-I env, is shown below in Table 5. In Table 5 the aa sequence encoded by the synthetic coding sequence is aligned with the corresponding sequence of HTLV-1 strain ATK.

The coding sequence for the lac-env fusion protein in pHL0-8 is under the control of the lac operon promoter.

Table 5

Comparison of the aa sequence of the HTLV-1 env portion of the polio protease/HTLV-1 env fusion protein expressed by pHL0- 8P/pDAB853 (designated HL0-8P) with the corresponding aa sequence of HTLV-1 strain ATK env (Seiki et al. (1983) Proc. Natl. Acad. Sci. USA 80:3618-3622). The top row sequence is that of HTLV-1 strain ATK env and the bottom row sequence is that encoded by the synthetic HTLV-1 env coding sequence in pDAB853. The numbers at the left and right indicate the aa number of the first or last amino acid in the row, respectively. Thus, aa number 61 to 188 of HL0-8P corresponds to aa 286 to 413 of ATK env.

EXAMPLE 2

Construction of Plasmid DHL0-8P/DDAB853 and Expression of HL0- 8P/DAB853

A plasmid was constructed containing the synthetic HTLV-1 env coding sequence for aa number 286-413, fused to the polio virus protease coding sequence, under the control of the trp operon promoter. This plasmid is designated alternatively as pHL0-8P or pDAB853; the construction of this plasmid is given below.

A plasmid expression vector, designated pDAB730, which utilizes the trp operon promoter, was prepared to allow fusion of the HL0-8 synthetic coding sequence in-frame and downstream of the polio virus protease coding sequence. Plasmid pDAB730 was derived from the trp promoter-containing polio virus protease expression vector pEXC (Ivanoff et al. (1987) Proc. Natl. Acad. Sci. USA 83:5392-5396). pDAB730 was obtained by ligation of a Bglll to Sail oligonucleotide with the trp promoter-containing Sail to Bglll DNA fragment from pEXC. The Bglll to Sail oligonucleotide inserted into pEXC to yield plasmid pDAB730 contains the following restriction sites:

5' - Bglll-NcoI-SacI-KpnI-XhoI-Sall -3'

The sequence of Bglll to Sail oligonucleotide added to the polio protease coding sequence which includes unique SacI and Xhol sites is: 5'-G ATC TCC ATG GCG AGC TCG GTA CCC TCG AGT AAA TAA GTA G-3'.

Plasmid pHL0-8P was constructed by ligation of the SacI to Xhol env-containing DNA fragment from pHL0-8 (Example 1) to the Xhol to SacI trp promoter- and polio protease-containing fragment from pDAB730. The polio protease/HTLV-1 env fusion protein expressed by product pHL0-8P is designated HL0-8P, and contains about 128 aa of the HTLV-1 env, including about 27 aa

corresponding to the C-terminus of HTLV-1 env gp46 and about 101 aa corresponding to the N-terminus of the HTLV-1 env p21E protein. This segment of env is fused at the N-terminus to about 60 aa derived from the polio virus protease. The HL0-8P coding sequence and encoded aa sequence are shown above in Table 4. The alignment of the HL0-8P env region with the corresponding segment of HTLV-1 strain ATK, is shown above in Table 5. EXAMPLE 3

Construction of Plasmid PDAB832 and Expression of DAB832

A plasmid, designated pROSSENSCRIPT, containing the HTLV-1 provirus DNA insert described by Reddy et al. (Proc. Natl. Acad. Sci. USA (1988) 85: 3599-3103), was obtained from Dr. E. P. Reddy of the Wistar Institute, Philadelphia, PA. The 3.9 kbp Hindlll to Hindlll DNA fragment of HTLV-1 provirus DNA containing the env coding region was inserted at the Hindlll site of plasmid pGEM3 (Stratagene, San Diego, CA), to yield pDAB829. The approximately 631 base pairs (bp) Clal to Xhol DNA fragment from pDAB829 containing a segment of the HTLV-1 env coding sequence was ligated to the large P_L promoter-containing Sail to Clal DNA fragment from pDAB818 to yield pDAB832. In pDAB832, the env coding sequence is fused in-frame with a sequence encoding 2 N- terminal aa (M-S-) from the E. coli era gene. Expression of the HTLV-1 env-derived product of pDAB832 (designated DAB832) is under the control of the phage l ambda PL promoter. Pl asmid vector pDAB818 is a derivative of the pJL6 expression vector (Lautenberger et al. (1983) Gene 23:75-84), and expresses the E. coli era gene product at high levels in E. coli (20% of total E. coli protein). It was, therefore, expected that pDAB832 would also express the HTLV-1 env-derived protein at high levels in E. coli. However, expression of the env-derived protein from pDAB832 was not detectable by Coomassie blue staining of SDS-PAGE gels or by immunoblot analysis using HTLV-1 seropositive patient serum.

The Clal to Xhol fragment of the env coding sequence spans the gp46 - p21E junction (aa number 229-440) and includes the enti re fragment of HTLV-1 env correspondi ng to that present in HL0-8P (aa number 286-413) (Example 2).

The product of pDAB832 is predicted to be an approximately 35 kDa fusion protein, including 2 N-terminal aa from the era coding sequence, aa number 229-440 of HTLV-1 env, and 92 C-terminal aa derived from a nonsense coding frame in the tet region of the plasmid vector, which codes for an additional approximately 11 kDa of protein.

EXAMPLE 4

Construction of Plasmid PDAB847 and Expression of DAB847:

In an effort to improve the expression of the HTLV-1 env- derived product in E. coli the DNA downstream of (3' to) the env coding sequence in pDAB832 (Example 3) was replaced with DNA which contained the following information and gene expression control signals: 1) a translation stop codon in-frame with the env coding sequence, thereby adding only 5 non-env aa at the C-terminus of the env-derived protein; 2) a transcription terminator (the phage lambda sib3 terminator); and 3) a deletion in the rop locus, which increases the plasmid copy number

[Polisky, "Replication Control of the Col E1-Type Plasmids," ppl43-170, in Maximizing Gene Expression (Reznikoff and Gold, Eds., Butterworths, 1986)]. The resultant plasmid is designated pDAB847. It is noted that a translation stop codon could have been engineered such that no additional non-env aa were added to the C-terminus of the recombinant antigen. Indeed, this was the case for the HL0-8P product (Example 2). The 5 non-env C- terminal residues on DAB847 are not important for the expression of product in E. coli.

Plasmid pDAB847 codes for an approximately 24 kDa protein consisting almost entirely of HTLV-1 env sequences. As shown in Tables 6 and 7, the product of pDAB847 (designated DAB847) contains 2 non-env aa at the N-terminus (M-S-), aa number 229-440 from HTLV-1 env, and 5 non-env aa at the C-terminus (-R-I-L-A-S). Expression of protein from pDAB847 was carried out using the E. coli TAP106 host, by temperature induction, as previously described (Davis et al., copending coassigned U.S. patent application serial number 07/350,264, filed May 11, 1989), the teaching of which is hereby incorporated by reference.

Immunoblot analysis using HTLV-1 positive serum established the production of an approximately 24 kDa env-related protein in E. coli TAP106 cells containing pDAB847. This product was found to be mostly (80% of the total protein) in the soluble fraction of E. coli extracts. The product of pDAB847 is designated DAB847. DAB847 accumulated to levels of approximately 1% of total E. coli protein, based on Coomassie blue staining of SDS-PAGE gels.

Tabl e 7

Comparison of the aa sequence of DAB847 (bottom row) with that of HTLV-1 strain ATK env (Seiki et al. (1983) Proc. Natl. Acad. Sci. USA 80:3618-3622) (top row).

EXAMPLE 5

Construction of Plasmid pCE0-8 and Expression of CE0-8:

The plasmid expression vector pCE31 was constructed from plasmid pJL6 (Lautenberger et al. (1983) Gene 23:75-84). A BstXI to Clal synthetic DNA fragment, containing a concensus E. coli translation initiation signal, including a ribosome binding site (SD) and an initiation ATG codon, was ligated to the Clal to BstXI P_L promoter-containing DNA fragment of pJL6. The sequence of the synthetic BstXI to Clal DNA is shown below:

BstXI Clal

SD M S I

5 ' CCAACCTCTGGACATT6CAAGGAGTTTATAAATGAGTATCGAT 3'

3' GGTTGGAGACCTGTAACGTTCCTCAAATATTTACTCATAGCTA 5' pCE31 was cut with Clal and BamHI and the large BamHI to Clal P_L promoter-containing fragment was ligated to a synthetic Clal to BamHI oligonucleotide containing the following restriction endonuclease sites:

5' - Clal - SacI - Hindlll - BamHI - 3'.

The resultant plasmid is designated pCE21 (also referred to as pCE-Sac/Bam).

Plasmid pCE21 was then cut with SacI and Hindlll and the large Hindlll to SacI P_L-containing DNA fragment was ligated to the SacI to Hindlll DNA fragment containing the env coding sequence from pHL0-8 (also referred to as pTZ0-8) (Example 1). The sequence of the SacI to Hindlll env DNA sequence is shown in Table 4; the Hindlll site occurs 1 bp 3' to the Xhol site and is not shown in Table 4. The resultant plasmid is designated pCE0-8. Plasmid pCE0-8 contains a coding sequence for an HTLV-1 env fusion protein operably linked to a translation start signal and signals, including the P_L promoter, controlling the transcription of the coding sequence. The product of pCE0-8 (designated CE0-8) contains at the N-terminus 5 non-env aa (M-S-I-D-L-), env aa 286 to 413, and 0 non-env aa at the C-terminus.

Since the pCE31 vector has been used to express other mammalian proteins at high level in E. coli (Davis et al., copending coassigned U.S. patent application serial number 07/350,264, filed May 11, 1989), it was expected that pCE0-8 would express the env-derived product efficiently in E. coli. However, the product of pCE0-8 was not detectable, even by the sensitive immunoblot assay using HTLV-1 positive serum

antibodies. EXAMPLE 6

Construction of pJL0-8 and Expression of JL0-8:

Plasmid pJL6 (Lautenberger et al. (1983) Gene 23:75-84) was cut with Clal and BamHI and the BamHI to Clal P_L promoter- containing DNA fragment was ligated to the Clal to BamHI HTLV-1 env-containing DNA fragment from pCE0-8. The resultant vector is designated pJL0-8. Plasmid vector pJL0-8 contains coding information for a fusion protein. The fusion protein contains 15 non-env aa at the N-terminus (including 13 aa derived from the phage lambda cll protein), aa 286 to 413 of HTLV-1 env, and 0 aa at the C-terminus. The non-env N-terminal aa of the product of pJL0-8 are M-V-R-A-N-K-R-N-E-A-L-R-I-D-L-.

Plasmid vector pJL6 has been shown previously to be useful for the expression of mammalian virus proteins, such as v-myc, at high levels in E. coli (Lautenberger et al. (1983) Gene 23:75-84) Moreover, the same vector system was used by Samuel et al. (Gene. Anal. Techn. (1985) 2:60-66) to express at high levels in E. coli a segment of HTLV-1 env corresponding to approximately aa number 307 to 440. As in pJL0-8, the env segment expressed by Samuel et al. is fused to 13 aa derived from phage lambda cll, and the same P_L promoter and translation start signal are used. It was, therefore, expected that pJL0-8 would express the env-derived product efficiently in E. coli. However, in contrast to Samuel et al., we were unable to detect expression in E. coli of cll-env fusion protein encoded by pJL0-8. Thus, as with pCE0-8, the product was not detectable in E. coli, even by immunoblot analysis.

The results obtained for the expression in E. coli of various segments of HTLV-1 env using various plasmid expression vectors is given in Table 8.

*The pC1, pC2, and pC3 products were obtained from Centocor, Inc., Malvern, PA. These products are expressed using plasmid vectors designated pC1 (codes for env aa 165 to 307), pC2 (codes for env aa 200 to 307), and pC3 (codes for aa 307 to 440). These env- derived products were expressed as fusion proteins; the products of pC1 and pC2 contain 35 additional

N-terminal residues and the pC3 product contains an additional 41 aa residues at the N-terminus of vector- derived aa sequence.

**Kiyokawa et al. (1984) Proc. Natl. Acad.

Sci. USA 81:6202-6206; U.S. Patent Number 4,724,258. EXAMPLE 7

Purification of PDAB853 HTLV-1 env-derived Product

E. coli containing pDAB853 (pHL0-8P; Example 2) that express HTLV-1 env-derived protein, were grown overnight at 37°C. Cells were harvested, lysed by French press and the DAB853 (HL0-8P) env protein, an insoluble protein is recovered in the pellet. The cell lysate pellet, from 200 mL of cell culture, was resuspended in 1 mL deionized water. The DAB853 product in the pellet fraction was partially purified by washing the pellet fraction with deionized water (5x the pellet volume) and centrifuging at 12,000xg for 2 to 3 min. This step was repeated 10 times.

The resultant insoluble material was then solubilized in 20 mM Tris pH 8.0/20 mM dithiothreitol/6 M guanidine hydrochloride (buffer A) for 16 hours at 4°C. The suspension was centrifuged at 10,000xg for 10 minutes. The supernatant was applied to a C4 reverse phase column (VYDAC, 2.2 cm x 25 cm). Proteins were eluted from the column with an acetonitrile gradient from 0 to 80 percent in 0.1% trifluoroacetic acid. The recombinant proteins of interest were eluted as a single peak, collected and

lyophilized. Proteins of interest were identified by immunoblot analysis using human serum containing HTLV-1 env antibodies. The dried fractions were solubilized in buffer A at an approximate concentration of 1 mg/mL and applied to a Sephacryl S-200 gel filtration column (Pharmacia, Piscataway, NJ) (1.1 cm x 100 cm) which was equilibrated in buffer A. The fractions containing the recombinant proteins were pooled, applied to a C4 column, eluted, and dried, as described above.

EXAMPLE 8

Immunoreactivity of DAB853 HTLV-1 env-derived

Product with Human Serum Samples

DAB853 ELISA

The purified DAB853 (HL0-8P; Example 2)protein was redissolved in deionized water or PBS and stored frozen. A solution containing 5 μglml of DAB853 in 0.1 M bicarbonate buffer, pH 9.6 was used to coat microtiter plates 100 μL/well.

Plates were incubated overnight at 4°C or room temperature and washed with PBS-T wash buffer (0.05% Tween-20 in PBS) and stored in a sealed bag at 4°C.

The procedure and the reagents used for carrying out the

ELISA analysis were from the DuPont HTLV-III ELISA kit (E. I. du

Pont de Nemours and Company, Wilmington, DE).

The reactivity of twenty-two HTLV-1 positive and eleven normal sera were tested on the HTLV-1 env in the ELISA format. Results in Table 10 clearly show that the HL0-8P recombinant antigen is a very sensitive and specific reagent for the detection of HTLV-1 antibodies in human serum samples. HL0-8P clearly distinguishes HTLV-1 positive from normal serum samples; even for some relatively low signals in the positive serum samples, the signal to cut-off ratio is very good.

The same serum samples were also tested by immunoblot analysis, where the antigen performed well in distinguishing

HTLV-1 serum samples from normal HTLV-1 seronegative serum samples.

Total number of serum samples tested = 33

Total number of HTLV-1 positive serum samples = 22

Total number of normal serum samples = 11

Mean of normal serum samples = 0.035 + 0.005

Positive to negative cut-off = 2x normal mean = 0.070

Highest positive/cut-off ratio = 16.6

Lowest positive/cut-off ratio = 1.8

Immunoblot Analysis

Purified HL0-8P (alternatively referred to as DAB853) (10 μg/100 μL) was separated on a 4 to 20% precast mini -gel (Novex, Encinitas, CA) (Laemmli (1970) Nature 227:680). The gels were transblotted according to Towbin et al. (Proc. Natl. Acad. Sci. USA (1979) 76:4350) and the blots were cut into strips and stored at 4°C.

The immunoblots were analyzed according to the procedure outlined in the Human Immunodeficiency Virus Type 1 (HIV-1) Western Blot IgG Assay kit from DuPont (Wilmington, DE).

Reagents used for the assay were also from the kit.

We have compared the immunoreactivity of the pC1, pC2, and pC3 products with the HL0-8P. The results are shown in Table 11. 1

* Weakly reactive

The analysis shown in Table 11 clearly shows the advantage of HL0-8P (aa number 286-413) in comparison with the pC1, pC2 and pC3 products, which contain aa number 165-307, 200-307, and 307- 440, respectively. As shown in Table 11, a large number of HTLV- 1 and HTLV-2 seropositi ve serum sampl es are not immunoreacti ve with the pC1, pC2, or pC3 products, whereas 81/82 of the HTLV-1 seropositive serum samples tested (the only exception was MW29, which is also non-reactive with pC1, pC2, and pC3) were

immunoreactive with HL0-8P. These results show clearly that there are immunoreactive epitopes presented on HL0-8P that are not presented on the pC1, pC2 or pC3 products individually.

Since the pC1, pC2, and pC3 products together (aa number 165-440) span the entire HTLV-1 env segment represented in HL0-8P (aa number 286-413), the pC1, pC2, and pC3 products in combination might be expected to detect any serum sample detected by HL0-8P. In fact, one serum sample (HW23) was not positive with either pC1, pC2, or pC3, but was positive using HL0-8P. This result indicates that in this serum sample, an epitope around aa 307 is immunodominant and is destroyed when the peptide is cut at aa 307. Thus, this important epitope is presented by HL0-8P (aa 286-413), but not pC1 (aa 165-307), pC2 (aa 200-307), or pC3 (aa 307-440). EXAMPLE 9

Apparent Immunoreactivity of Human Serum Samples with

E. coli β-galactosidase

Commercially purchased β-galactosidase (Boehringer-Mannheim) was immobilized on microtiter plates at 1 μglml concentrations under the same conditions as described above for DAB853 env protein. β-galactosidase-containing plates were used to analyze by ELISA human serum samples. These results are shown in Table 13.

Immunoblot of the same serum samples analyzed by ELISA in Table 13 showed that the HIV-1 and HTLV-1 seropositive serum samples reacted with β-galactosidase to various extents, whereas the normal serum samples generally had little or no reactivity with β-galactosidase.

Results from both ELISA and immunoblots indicated that HIV-1 and HTLV-1 infected serum samples will react to different degrees with β-galactosidase. In addition, some normal serum samples also gave high readings with β-galactosidase in the ELISA. The results show that apparent positive ELISA signals are seen in the β-galactosidase ELISA with HIV-1, HTLV-1, and normal serum samples. Thus, the presence of β-galactosidase protein in the ELISA is shown to strongly interfere with the specificity of the assay for diagnostic purposes.

VACCINES

The vaccines of the present invention comprise a protective amount of the recombinant HTLV-1 peptides of the invention and a pharmaceutically acceptable vehicle. Suitable vehicles include pharmaceutically acceptable solutions suitable for parenteral use, various adjuvants, and other additives known in the art. A useful text in the field of vaccines is New Trends and

Developments in Vaccines, Eds. A. Voller and H. Friedman,

University Park Press, Baltimore, MD (1978). See also

Remington's Pharmaceutical Sciences for information about pharmaceutical formulations. The teaching of these references is hereby incorporated by reference.

Claims

1. A recombinant peptide displaying the antigenlcity of HTLV env antigens, comprising an antigenic segment of about 128 amino acids, comprising an amino acid sequence corresponding to about 27 amino acids of the C-terminus of the gp46 domain and about 101 amino acids of the N-terminus of the p21E domain, as shown in Table 5.

2. A recombinant peptide of Claim 1, further comprising about 60 amino acids encoded by the N-terminal region of the poliovirus protease gene of plasmid pEXC fused to the N-terminus of the antigenic segment, as shown in Table 4.

3. A recombinant peptide displaying the antigenicity of HTLV env antigens, comprising an antigenic segment of about 212 amino acids, comprising an amino add sequence corresponding to about 84 amino acids of the C-terminus of the gp46 domain and about 128 amino acids of the N-terminus of the p21E domain, as shown in Table 6.

4. A recombinant peptide of Claim 1, fused at the N- and C- termini of the antigenic segment to zero to five non-HTLV env amino acids.

5. A recombinant peptide of Claim 3, fused at the N- and C- termini of the antigenic segment to zero to five non-HTLV env amino acids.

6. A recombinant peptide of Claim 5, fused at the N- terminus of the antigenic segment to amino acids Met-Ser and at the C-terrainus of the antigenic segment to amino acids Arg-Ile- Leu-Al a-Ser, as shown in Tabl e 6.

7. A nucleotide sequence encoding a peptide of Claim 1.

8. A nucleotide sequence encoding a peptide of Claim 2.

9. A nucleotide sequence encoding a peptide of Claim 3.

10. A nucleotide sequence encoding a peptide of Claim 4.

11. A nucleotide sequence encoding a peptide of Claim 5.

12. A nucleotide sequence encoding a peptide of Claim 6.

13. A recombinant plasmid expression vector capable of expression in E. coli of an HTLV peptide of Claim 2, wherein the DNA sequence coding for the antigenic segment is fused to the polio protease coding sequence of plasmid pEXC operably linked to the trp operon promoter.

14. A plasmid of Claim 13, which is or which has the identifying characteristics of pDAB853 (ATCC#67917).

15. A high copy number plasmid expression vector capable of expression 1n E. coli of a peptide of Claim 1, wherein the plasmid contains a deletion in the rop function.

16. A plasmid of Claim 15, wherein the DNA sequence coding for the antigenic segment is operatively linked to a phage lambda

P_L promoter.

17. A high copy number plasmid expression vector capable of expression in E. coli of a peptide of Claim 4, wherein the plasmid contains a deletion in the rop function.

18. A plasmid of Claim 17, wherein the DNA sequence coding for the antigenic segment is operatively linked to a phage lambda P_L promoter.

19. A high copy number plasmid expression vector capable of expression in E. coli of a peptide of Claim 3, wherein the plasmid contains a deletion in the rop function.

20. A plasmid of Claim 19, wherein the DNA sequence coding for the antigenic segment is operatively linked to a phage lambda P_L promoter.

21. A high copy number plasmid expression vector capable of expression in E. coli of a peptide of Claim 5, wherein the plasmid contains a deletion in the rop function.

22. A plasmid of Claim 21, wherein the DNA sequence coding for the antigenic segment is operatively linked to a phage lambda P_L promoter.

23. A recombinant plasmid expression vector of Claim 22, which is or which has the identifying characteristics of pDAB847 (ATCC#67947).

24. An E. coli cell line transformed with a plasmid of Claim 13.

25. An E. coli cell line transformed with a plasmid of Claim 14.

26. An E. coli cell line transformed with a plasmid of Claim 15.

27. An E. coli cell line transformed with a plasmid of Claim 16.

28. An E. coli cell line transformed with a plasmid of Claim 17.

29. An E. coli cell line transformed with a plasmid of Claim 18.

30. An E. coli cell line transformed with a plasmid of Claim 19.

31. An E. coli cell line transformed with a plasmid of Claim 20.

32. An E. coli cell line transformed with a plasmid of Claim 21.

33. An E. coli cell line transformed with a plasmid of Claim 22.

34. An E. coli cell line transformed with a plasmid of Claim 23.

35. A method of detecting antibodies to HTLV in a biological sample containing such antibodies wherein the biological sample is contacted with an HTLV antigen and an immunological reaction is detected, the improvement comprising contacting the biological sample with a peptide of Claim 1.

36. A method of detecting antibodies to HTLV in a biological sample containing such antibodies wherein the biological sample is contacted with an HTLV antigen and an immunological reaction is detected, the improvement comprising contacting the biological sample with a peptide of Claim 2.

37. A method of detecting antibodies to HTLV in a biological sample containing such antibodies wherein the biological sample is contacted with an HTLV antigen and an immunological reaction is detected, the improvement comprising contacting the biological sample with a peptide of Claim 3.

38. A method of detecting antibodies to HTLV in a biological sample containing such antibodies wherein the biological sample is contacted with an HTLV antigen and an immunological reaction is detected, the improvement comprising contacting the biological sample with a peptide of Claim 4.

39. A method of detecting antibodies to HTLV in a biological sample containing such antibodies wherein the biological sample is contacted with an HTLV antigen and an immunological reaction is detected, the improvement comprising contacting the biological sample with a peptide of Claim 5

40. A method of detecting antibodies to HTLV in a biological sample containing such antibodies wherein the biological sample is contacted with an HTLV antigen and an immunological reaction is detected, the improvement comprising contacting the biological sample with a peptide of Claim 6.

41. In a diagnostic kit comprising a collection of materials containing all major components used for detecting antibodies to HTLV in a biological sample, and comprising a container

containing an HTLV antigen and means for detecting an immune reaction of HTLV antibodies with said HTLV antigen, the

improvement comprising contacting the biological sample with a peptide of Claim 1.

42. In a diagnostic kit comprising a collection of materials containing all major components used for detecting antibodies to HTLV in a biological sample, and comprising a container

improvement comprising contacting the biological sample with a peptide of Claim 2.

43. In a diagnostic kit comprising a collection of materials containing all major components used for detecting antibodies to HTLV in a biological sample, and comprising a container

containing an HTLV antigen and means for detecting an immune reaction of HTLV antibodies with said HTLV antigen, the improvement comprising contacting the biological sample with a peptide of Claim 3.

44. In a diagnostic kit comprising a collection of materials containing all major components used for detecting antibodies to HTLV in a biological sample, and comprising a container

improvement comprising contacting the biological sample with a peptide of Claim 4.

45. In a diagnostic kit comprising a collection of materials containing all major components used for detecting antibodies to HTLV in a biological sample, and comprising a container

improvement comprising contacting the biological sample with a peptide of Claim 5.

46. In a diagnostic kit comprising a collection of materials containing all major components used for detecting antibodies to HTLV in a biological sample, and comprising a container

improvement comprising contacting the biological sample with a peptide of Claim 6.

47. A vaccine protective against HTLV comprising a

protective amount of a peptide of Claim 1 and a pharmaceutically acceptable vehicle.

48. A vaccine protective against HTLV comprising a

protective amount of a peptide of Claim 2 and a pharmaceutically acceptable vehicle.

49. A vaccine protective against HTLV comprising a

protective amount of a peptide of Claim 3 and a pharmaceutically acceptable vehicle.

50. A vaccine protective against HTLV comprising a

protective amount of a peptide of Claim 4 and a pharmaceutically acceptable vehicle.

51. A vaccine protective against HTLV comprising a protective amount of a peptide of Claim 5 and a pharmaceutically acceptable vehicle.

52. A vaccine protective against HTLV comprising a protective amount of a peptide of Claim 6 and a pharmaceutically acceptable vehicle.