WO1990014842A1 - Vaccine against hiv - Google Patents

Vaccine against hiv Download PDF

Info

Publication number
WO1990014842A1
WO1990014842A1 PCT/GB1990/000842 GB9000842W WO9014842A1 WO 1990014842 A1 WO1990014842 A1 WO 1990014842A1 GB 9000842 W GB9000842 W GB 9000842W WO 9014842 A1 WO9014842 A1 WO 9014842A1
Authority
WO
WIPO (PCT)
Prior art keywords
hiv
binding site
receptor binding
protein
sequence
Prior art date
Application number
PCT/GB1990/000842
Other languages
French (fr)
Inventor
Jeffrey William Almond
David John Evans
Jane Alison Mckeating
Robin Anthony Weiss
Original Assignee
Medical Research Council
University Of Reading
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Medical Research Council, University Of Reading filed Critical Medical Research Council
Publication of WO1990014842A1 publication Critical patent/WO1990014842A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16111—Human Immunodeficiency Virus, HIV concerning HIV env
    • C12N2740/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/32011—Picornaviridae
    • C12N2770/32611—Poliovirus
    • C12N2770/32641—Use of virus, viral particle or viral elements as a vector
    • C12N2770/32643—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00—Vectors comprising a targeting moiety
    • C12N2810/50—Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/80—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates
    • C12N2810/85—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian
    • C12N2810/855—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian from receptors; from cell surface antigens; from cell surface determinants
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to vaccines against human immunodeficiency virus (HIV), more particularly HIV-1 and HIV-2.
  • HIV human immunodeficiency virus
  • HIV preferentially infects cells which carry the CD4 surface antigen.
  • a region of the gpl20 glycoprotein of HIV-1 has been shown to be critical for interaction with the CD4 receptor (Lasky et al, Cell 5.0, 975-985, 1987). This region is referred to here as the CD4 receptor binding site.
  • the chimaera was capable of raising antibodies which neutralised both HIV-1 and HIV-2 isolates.
  • the present invention provides use of a chimaeric protein which presents the CD4 receptor binding site of HIV-1 or HIV-2 in the preparation of a medicament fo use as a vaccine against both HIV-1 and HIV-2.
  • the inventio also comprises an agent for use as a vaccine against HIV-1 and HIV-2 comprising a chimaeric protein which presents the CD4 receptor binding site of HIV-1 and HIV-2.
  • the chimaeric protein employed in the present invention is a protein, other than the gp120 glycoprotein of HIV-1 and the corresponding HIV-2 glycoprotein, which has been modified so that its amino acid sequence also comprises the sequence of the CD4 receptor binding site of HIV-1 or -2. Some of the amino acid residues of a protein may be replaced by those of the CD4 receptor binding site. Alternatively, the amino acid sequence of the CD4 receptor binding site may be fused to a foreign protein. The amino acid sequence of the CD4 receptor binding site is exposed on the surface of the chimaeric protein so that the sequence is presented to the immune system.
  • the carrier protein may take the form of a particle or form part of a particulate aggregation. Such an
  • aggregation may comprise a plurality of chimaeric proteins and/or may be a viral particle.
  • the aggregation may comprise either a single type of chimeric protein or a heterogeneous mixture of two or more types of chimeric proteins.
  • a protein to which the amino acid sequence of the CD4 receptor binding site may be fused may be a particle-forming protein such as hepatitis B surface antigen (EP-A-0175261).
  • the sequence of the CD4 receptor binding site may be inserted into the sequence of a viral protein exposed on the surface of the virus (GB-A-2125065).
  • the viral protein may be a capsid protein of a virus.
  • the CD4 receptor binding site may therefore be provided at one of the antigenic sites of a picornavirus such as a poliovirus (EP-A-0302801).
  • the CD4 receptor binding site may be presented at one of the
  • antigenic sites for example site 1, 2 or 3, on a capsid protein of an attenuated strain of type 1 poliovirus, or at an antigenic site of type 2 or 3 polio virus.
  • Other picornaviruses suitably modified, may be used, e.g. Bovine enterovirus.
  • picornavirus may be replaced completely or partly by the amino acid sequence of the CD4 receptor binding site.
  • the CD4 receptor binding site is provided in plac of some or all of antigenic site 1 of an attenuated strain of type 1 poliovirus.
  • the attenuated strain is typically the Sabin 1 vaccine strain.
  • poliovirus is composed of amino acid residues 91 to 102 of the VP1 capsid protein.
  • the CD4 receptor binding site which is presented by a chimaeric protein may be residues 423-439 of gpl20 of HIV-1 or the corresponding HIV-2 residues.
  • the numbering of the HIV-1 residues is according to the sequence of the molecular clone NY5/LAV-1 as referenced in "AIDS and Human Retroviruse 1988" compiled by G. Myers, Los Alamos, U.S.
  • the specific amino acids denoted by these residues may vary from isolate to isolate, as shown in Lasky et al., 1987.
  • the residues ma be according to the one letter code (Eur. J. Biochem. 138. 9- 37, 1984):
  • HIV-1 NMWQEVGKAMYAPPISG
  • HIV-2 NTWHKVGRNVYLPPREG
  • sequences may be varied by one or more amino acid substitutions, insertions or deletions providing the
  • additional amino acids may be provided at either or both ends. Up to 8, for example up to 4, additional amino acids may be provided at the N-terminal end and/or up to 8, for example up to 4, additional amino acids may be provided at the C-terminal end. Typically these are the amino acids naturally flanking residues 423-439 in the gpl20 HIV-1 glycoprotein or the corresponding HIV-2 residues. It is also possible to use a hybrid sequence comprising a portion of the HIV-1 sequence mentioned above attached at the N or C
  • the chimaeric proteins are recombinant proteins. They may be obtained by inserting a DNA fragment encoding the CD4 receptor binding site into a vector at a location which enable the CD4 receptor binding site to be expressed, as part of a chimaeric protein, exposed on the surface of the
  • the protein may self-assemble into particles.
  • a cassette vector may be employed into which a DNA
  • a cassette vector suitable for use in constructing poliovirus
  • chimaeras comprises, under the control of a promoter, a full length infections cDNA of an attenuated strain of type 1 poliovirus having Sal 1 and Dra 1 sites flanking antigenic site 1 of the poliovirus as follows:
  • the numbers represent the numbers of amino acids of the VPl capsid protein and X represents one or more intervening nucleotides of DNA, present in sufficient numbers to allow the vector to be digested with both Sal 1 and Dra 1 the said Sal 1 and Dra 1 sites being the only Sal 1 and Dra 1 sites in the vector.
  • the cassette vect has the additional advantage that the Sal 1 and Dra 1 sites are unique to the entire vector, allowing replacement of the region flanked by these sites in a single step and thus obviating the need for subcloning steps in the construction of recombinant cDNAs.
  • the amino acid change at position 102 from aspartic acid to phenylalanine, resulting from the creation of the Dra 1 site, does not affect viability or growth of the virus.
  • the cassette vector comprises an infectious full length cDNA clone of the Sabin strain of poliovirus type 1 into which the Sal 1 and Dra 1 sites have been engineered.
  • X represents the codons for amino acid residues 94 to 101 of the VPl capsid protein of Sabin type 1. It is generally preferred that X represents a DNA sequence encoding VPl amino acid residues 94 to 101 of the attenuated strain of type 1 poliovirus being used. X can, however, denote a DNA sequence from which one or more of these codons is missing or, indeed, represent a longer sequence.
  • X consists of from 6 to 30 nucleotides, for example from 9 to 24 nucleotides.
  • the cassette vector is typically a plasmid.
  • the plasmid generally comprises an origin of replication, so that it is replicates in the host which harbors it.
  • the host is a microbial host such as a strain of bacterium, e.g.
  • the plasmid also generally comprises a marker gene such as an antibiotic-resistance gene.
  • a particularly preferred plasmid is pCASl.
  • E. coli MC1061 harbouring pCASl has been deposited at the National Collection of Industrial and Marine Bacteria, Aberdeen, GB on 25th May 1989 under accession number NCIMB 40148.
  • Cassette vectors according to the present invention are, like pCASl, generally double-stranded.
  • the nucleotide sequence, and amino acid sequence according to the one lette code, for pCASl and other type 1 vectors which do not have missing any site 1 codons in the region of antigenic site 1 is:
  • a cassette vector according to the invention may be prepared by first engineering the Sal 1 and Dra 1 sites into a full length infectious cDNA of an attenuated strain of type 1 poliovirus. This may be achieved by subcloning a partial fragment at the cDNA into a single-stranded cloning vector such as one of the M13 vectors and creating the Sal 1 and Dra 1 sites by site-directed mutagenesis using appropriate oligo- nucleotides. The modified fragment is then reintroduced into the cDNA from which it has been derived.
  • the cDNA is provided with a suitable promoter, for example a T7 promoter, and is introduced into a vector having no Sal 1 and Dra 1 sites.
  • the vector may be pFBI 2 (Pharmacia) which has been modified to remove its three Dra 1 sites.
  • a cassette vector prepared as just described is digested with Sal 1 and Dra 1 and an appropriate DNA fragment is ligated with the digested vector.
  • such a vector may be obtained by site directed mutagenesis.
  • Poliovirus chimaeras which present the CD4 receptor binding site at antigenic site 1 are prepared by a process comprising: (i) constructing a double-stranded DNA fragment which encodes the CD4 receptor binding site and which has a 5 '-Sal 1 cohesive end and a 3'-blunt end;
  • step (iii) obtaining live virus from the modified vector obtained in step (ii).
  • Step (i) is generally conducted by synthesizing
  • oligonucleotides may be boiled together for from 2 to 5 minutes, for example for about 3 minutes, and allowed to cool to room temperature.
  • the arfriealed oligonucleotides are ligated with a cassette vector which has been digested with Sal 1 and Dra 1 to excise the DNA encoding antigenic site 1.
  • E. coli may then be transformed with the ligation mix and screened for the presence of the recombinant vector.
  • Live virus is recovered from the modified full length cDN by production of a positive sense RNA.
  • incorporating the DNA fragment encoding the CD4 receptor binding site is cut by a restriction enzyme outside the cDNA.
  • the promoter controlling transcription of the cDNA then enables RNA to be obtained.
  • a T7 promoter is
  • RNA particularly suitable for directing transcription in vitro (van der Werf et al , Proc. Natl. Acad. Sci. USA 83, 2330- 2334, 1986).
  • the recovered RNA may be applied to tissue cultures by standard techniques (Koch, Curr. Top, Microbiol. Immunol, 61, 89-138, 1973).
  • the RNA can be used to transfect Hep2C monolayers. After 2 to 8 days incubation, from example after 4 to 6 days incubation, virus can be recovered from the supernatant of the tissue culture.
  • the chimaeric proteins are useful as vaccines against both HIV-1 and HIV-2.
  • An effective amount is administered to a patient requiring vaccination. They may be administered orally, nasally or parenterally for example intravenously, subcutaneously or intramuscularly.
  • the dose of the chimaeric protein depends on a variety of factors including the age and weight of a patient and the type of carrier protein which has been modified so that its amino acid sequence includes the sequence of the CD4 receptor binding site.
  • a dose corresponding to the amount administered for a conventional live virus vaccine may be given, usually in the range 10 4 -10 8 TCID 50 , and more usually between 10 5 and 10 6.5 TCID 50 .
  • the dose will depend in part on the viability and replicative capacity of the virus used.
  • compositions comprising the chimaeric protein and a pharmaceutically acceptable carrier or diluent are formulated to enable the chimaeric protein to be
  • Any appropriate carrier or diluent may be employed, for example an isotonic saline solution for parenteral administration.
  • a nasal spray may be formulated with a liquid carrier.
  • An adjuvant may be
  • a live attenuated poliovirus chimaera may be formulated stabilised in a solution of 1M MgCl 2 .
  • the type of carrier or diluent will depend upon the nature of the
  • compositions intended for oral use may be prepared according to any method known in the art for the manufacture of pharmaceutical compositions and such
  • compositions may contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations.
  • Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets.
  • excipients may be for example, inert diluents, such as calcium
  • granulating and disintegrating agents for example, maize starch, or alginic acid
  • binding agents for example starch, gelatin or acacia
  • lubricating agents for example magnesium stearate, stearic acid or talc.
  • the tablets may be uncoated or they may be coated by know techniques to delay disintegration and adsorption in the gastrointestinal tract and thereby provide a sustained action over a longer period.
  • a time delay material such as glycerol monostearate or glycerol distearate may be employed.
  • Formulation for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example peanut oil, liquid paraffin, or olive oil.
  • an inert solid diluent for example, calcium carbonate, calcium phosphate or kaolin
  • water or an oil medium for example peanut oil, liquid paraffin, or olive oil.
  • Aqueous suspensions contain the active materials in admixture with excipients suitable for the manufacture of aqueous suspensions.
  • excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinyl- pyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents may be naturally-occurring phosphatides, for example lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearat or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethyleneoxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyoxyethylene sorbitan monooleate
  • the said aqueous suspensions may also contain one or more preservatives, for example ethyl or n-propyl phydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose or saccharin.
  • preservatives for example ethyl or n-propyl phydroxybenzoate
  • coloring agents for example ethyl or n-propyl phydroxybenzoate
  • flavoring agents such as sucrose or saccharin.
  • sweetening agents such as sucrose or saccharin.
  • Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin.
  • the oily suspensions may contain a thickening agent, for example beeswax, hard
  • Dispersable powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, a suspending agent and one or more
  • Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above
  • Additional excipients for example sweetening, flavouring and coloring agents, may also be present.
  • the pharmaceutical compositions of the invention may also be in the form of oil-in-water emulsions.
  • the oily phase may be a vegetable oil, for example olive oil or arachis oil, or a mineral oil, for example liquid paraffin or mixtures of these.
  • Suitable emulsifying agents may be naturally- occurring gums, for example gum acacia or gum tragacanth, naturally-occurring phosphatides, for example soy bean, lecithin, esters or partial esters derived from fatty acids and hexitol anhydrides, for example sorbitan mono-oleate, and condensation products of the said partial esters with
  • ethylene oxide for example polyoxyethylene sorbitan
  • the emulsion may also contain sweetening and flavoring agents.
  • Syrups and elixirs may be formulated with sweetening agents, for example glycerol, sorbitol and sucrose. Such formulations may also contain a demulcent, a preservative and flavoring and coloring agents.
  • oleagenous suspensions may be formulated.
  • Such a suspension may be formulated according to the known art using those suitable dispersing of wetting agents and suspending agents which have been mentioned above.
  • the sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example as a solution in 1,3-butane diol.
  • acceptable vehicles and solvents that may be employed are water. Ringer's solution and isotonic sodium chloride
  • fatty acids such as oleic acid find use in the preparation of injectables.
  • aerosols or solutions for nebulizers may be formulated.
  • the nucleotide sequence of Sabin 1 cDNA in the region 2740-2800 was searche for sequences at which restriction endonuclease sites unique to the cDNA cpuld be introduced with minimal alteration to the amino acid sequence. It was observed that a Sal 1 site at nucleotide 2753 could be created without alteration to the amino acid sequence and that this site would be unique within the virus sequence. Similarly a unique Dra 1 site could be created at position 2783 resulting in the replacement of aspartic acid (VPl residue 102) by phenylalanine.
  • the synthetic oligonucleotides 5'- GGAAGCTGAGTTGTCGACGGTTATAATGG-3' and 5'- CACTGTAAATAGTTTAAACTTATTCTGG-3 ' (bases inducing changes underlined) were used to create Sal 1 and Dra 1 restriction sites at positions 2753 and 2783 respectively on a 3.6kb
  • nucleotide and amino acid sequence of poliovirus Sabin 1 illustrating changes introduced in the construction of pCASl are shown below. Nucleotides 2750-2794 of the cDNA sequence of the viral sense strand are shown, together with the location of the introduced restriction sites. The resulting amino acid change to phenylalanine from aspartic acid at position 102 is shown in parenthesis.
  • oligonucleotides 100 ng each of complementary oligonucleotides encoding the HIV-1 sequence of choice were boiled for three minutes and allowed to cool to room temperature.
  • the oligonucleotides were:
  • RNA sequence of approximately 200 bp spanning antigenic site 1 of the recovered chimaeric virus SI/env/4 was
  • Sl/env/4 by inoculation of approximately 0.5 ml of tissue culture supernatant from Example 1 in adjuvant, and boosted two to four times in a similar manner. Antisera were also raised by injecting rabbits with about 10 8 TCID 50 of purified Sl/env/4.
  • Neutralization titres were determined by incubation 10 ⁇ l of heat inactivated antiserum with 40 ⁇ l of virus supernatan containing 10 3 infectious units of HIV at 37°C for 1 hour.
  • Antisera R10, R11 and R12 are sera raised using tissue culture supernatant for immunizations.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

A chimaeric protein which presents the CD4 receptor 5 binding site of HIV-1 or HIV-2 is useful as a vaccine against both HIV-1 and HIV-2. Preferably, the CD4 receptor binding site is present at antigenic site 1 of an attenuated type 1 poliovirus.

Description

Vaccine against HIV
The present invention relates to vaccines against human immunodeficiency virus (HIV), more particularly HIV-1 and HIV-2.
HIV preferentially infects cells which carry the CD4 surface antigen. A region of the gpl20 glycoprotein of HIV-1 has been shown to be critical for interaction with the CD4 receptor (Lasky et al, Cell 5.0, 975-985, 1987). This region is referred to here as the CD4 receptor binding site. We have prepared a poliovirus chimaera in which the amino acids of antigenic site 1 of the poliovirus have been replaced by amino acids corresponding to the HIV-1 binding site for the CD4 receptor. Surprisingly, the chimaera was capable of raising antibodies which neutralised both HIV-1 and HIV-2 isolates.
Accordingly, the present invention provides use of a chimaeric protein which presents the CD4 receptor binding site of HIV-1 or HIV-2 in the preparation of a medicament fo use as a vaccine against both HIV-1 and HIV-2. The inventio also comprises an agent for use as a vaccine against HIV-1 and HIV-2 comprising a chimaeric protein which presents the CD4 receptor binding site of HIV-1 and HIV-2.
The chimaeric protein employed in the present invention is a protein, other than the gp120 glycoprotein of HIV-1 and the corresponding HIV-2 glycoprotein, which has been modified so that its amino acid sequence also comprises the sequence of the CD4 receptor binding site of HIV-1 or -2. Some of the amino acid residues of a protein may be replaced by those of the CD4 receptor binding site. Alternatively, the amino acid sequence of the CD4 receptor binding site may be fused to a foreign protein. The amino acid sequence of the CD4 receptor binding site is exposed on the surface of the chimaeric protein so that the sequence is presented to the immune system. The carrier protein may take the form of a particle or form part of a particulate aggregation. Such an
aggregation may comprise a plurality of chimaeric proteins and/or may be a viral particle. The aggregation may comprise either a single type of chimeric protein or a heterogeneous mixture of two or more types of chimeric proteins.
A protein to which the amino acid sequence of the CD4 receptor binding site may be fused may be a particle-forming protein such as hepatitis B surface antigen (EP-A-0175261). The sequence of the CD4 receptor binding site may be inserted into the sequence of a viral protein exposed on the surface of the virus (GB-A-2125065). The viral protein may be a capsid protein of a virus. The CD4 receptor binding site may therefore be provided at one of the antigenic sites of a picornavirus such as a poliovirus (EP-A-0302801). The CD4 receptor binding site may be presented at one of the
antigenic sites, for example site 1, 2 or 3, on a capsid protein of an attenuated strain of type 1 poliovirus, or at an antigenic site of type 2 or 3 polio virus. Other picornaviruses, suitably modified, may be used, e.g. Bovine enterovirus.
The amino acid sequence of an antigenic site of a
picornavirus may be replaced completely or partly by the amino acid sequence of the CD4 receptor binding site.
Preferably the CD4 receptor binding site is provided in plac of some or all of antigenic site 1 of an attenuated strain of type 1 poliovirus. The attenuated strain is typically the Sabin 1 vaccine strain. Antigenic site 1 of a type 1
poliovirus is composed of amino acid residues 91 to 102 of the VP1 capsid protein.
The CD4 receptor binding site which is presented by a chimaeric protein may be residues 423-439 of gpl20 of HIV-1 or the corresponding HIV-2 residues. The numbering of the HIV-1 residues is according to the sequence of the molecular clone NY5/LAV-1 as referenced in "AIDS and Human Retroviruse 1988" compiled by G. Myers, Los Alamos, U.S. The specific amino acids denoted by these residues may vary from isolate to isolate, as shown in Lasky et al., 1987. The residues ma be according to the one letter code (Eur. J. Biochem. 138. 9- 37, 1984):
HIV-1: NMWQEVGKAMYAPPISG
HIV-2: NTWHKVGRNVYLPPREG
These sequences may be varied by one or more amino acid substitutions, insertions or deletions providing the
resulting sequence still acts as a CD4 receptor binding sit Further, additional amino acids may be provided at either or both ends. Up to 8, for example up to 4, additional amino acids may be provided at the N-terminal end and/or up to 8, for example up to 4, additional amino acids may be provided at the C-terminal end. Typically these are the amino acids naturally flanking residues 423-439 in the gpl20 HIV-1 glycoprotein or the corresponding HIV-2 residues. It is also possible to use a hybrid sequence comprising a portion of the HIV-1 sequence mentioned above attached at the N or C
terminal end to a portion of the HIV-2 sequence. Selection of appropriate sequences may lead to an improvement of the HIV-1/HIV-2 cross reactivity of antibodies produced in response to such a chimeric protein.
The chimaeric proteins are recombinant proteins. They may be obtained by inserting a DNA fragment encoding the CD4 receptor binding site into a vector at a location which enable the CD4 receptor binding site to be expressed, as part of a chimaeric protein, exposed on the surface of the
protein, and expressing the chimaeric protein. Depending on the type of chimaeric protein, the protein may self-assemble into particles.
A cassette vector may be employed into which a DNA
fragment encoding the CD4 receptor binding site is inserted such that the chimaeric protein can be expressed. A cassette vector, suitable for use in constructing poliovirus
chimaeras, comprises, under the control of a promoter, a full length infections cDNA of an attenuated strain of type 1 poliovirus having Sal 1 and Dra 1 sites flanking antigenic site 1 of the poliovirus as follows:
92 93 102 103
GTC GAC - X - TTT AAA
Sal 1 Dra 1
where the numbers represent the numbers of amino acids of the VPl capsid protein and X represents one or more intervening nucleotides of DNA, present in sufficient numbers to allow the vector to be digested with both Sal 1 and Dra 1 the said Sal 1 and Dra 1 sites being the only Sal 1 and Dra 1 sites in the vector.
Using this cassette vector, an amino acid sequence
comprising the CD4 receptor binding site can be inserted at antigenic site 1 of the attenuated poliovirus to replace VPl amino acid residues 94 to 102, thereby obtaining poliovirus chimaeras capable of acting as vaccines. The cassette vect has the additional advantage that the Sal 1 and Dra 1 sites are unique to the entire vector, allowing replacement of the region flanked by these sites in a single step and thus obviating the need for subcloning steps in the construction of recombinant cDNAs. The amino acid change at position 102 from aspartic acid to phenylalanine, resulting from the creation of the Dra 1 site, does not affect viability or growth of the virus.
Preferably the cassette vector comprises an infectious full length cDNA clone of the Sabin strain of poliovirus type 1 into which the Sal 1 and Dra 1 sites have been engineered. In such circumstances, X represents the codons for amino acid residues 94 to 101 of the VPl capsid protein of Sabin type 1. It is generally preferred that X represents a DNA sequence encoding VPl amino acid residues 94 to 101 of the attenuated strain of type 1 poliovirus being used. X can, however, denote a DNA sequence from which one or more of these codons is missing or, indeed, represent a longer sequence.
Typically X consists of from 6 to 30 nucleotides, for example from 9 to 24 nucleotides.
The cassette vector is typically a plasmid. The plasmid generally comprises an origin of replication, so that it is replicates in the host which harbors it. Typically the host is a microbial host such as a strain of bacterium, e.g.
E.coli. The plasmid also generally comprises a marker gene such as an antibiotic-resistance gene. A particularly preferred plasmid is pCASl. E. coli MC1061 harbouring pCASl has been deposited at the National Collection of Industrial and Marine Bacteria, Aberdeen, GB on 25th May 1989 under accession number NCIMB 40148.
Cassette vectors according to the present invention are, like pCASl, generally double-stranded. The nucleotide sequence, and amino acid sequence according to the one lette code, for pCASl and other type 1 vectors which do not have missing any site 1 codons in the region of antigenic site 1 is:
91 105
T V D N S A S T K N K F K L F ACCGTCGACAACTCAGCTTCCACCAAGAATAAGTTTAAACTATTT TGGCAGCTGTTGAGTCGAAGGTGGTTCTTATTCAAATTTGATAAA
Sal 1 Dra 1
A cassette vector according to the invention may be prepared by first engineering the Sal 1 and Dra 1 sites into a full length infectious cDNA of an attenuated strain of type 1 poliovirus. This may be achieved by subcloning a partial fragment at the cDNA into a single-stranded cloning vector such as one of the M13 vectors and creating the Sal 1 and Dra 1 sites by site-directed mutagenesis using appropriate oligo- nucleotides. The modified fragment is then reintroduced into the cDNA from which it has been derived.
The cDNA is provided with a suitable promoter, for example a T7 promoter, and is introduced into a vector having no Sal 1 and Dra 1 sites. The vector may be pFBI 2 (Pharmacia) which has been modified to remove its three Dra 1 sites. In order to obtain a cassette vector which does not include the normal codons for VPl amino acid residues 94 to 101, a cassette vector prepared as just described is digested with Sal 1 and Dra 1 and an appropriate DNA fragment is ligated with the digested vector. Alternatively, such a vector may be obtained by site directed mutagenesis.
Poliovirus chimaeras which present the CD4 receptor binding site at antigenic site 1 are prepared by a process comprising: (i) constructing a double-stranded DNA fragment which encodes the CD4 receptor binding site and which has a 5 '-Sal 1 cohesive end and a 3'-blunt end;
(ii) digesting a cassette vector according to the
invention with Sal 1 and Dra 1 and ligating the fragment constructed in step (i) with the digested vector; and
(iii) obtaining live virus from the modified vector obtained in step (ii).
Step (i) is generally conducted by synthesizing
complementary oligonucleotides and annealing the
oligonucleotides. The oligonucleotides may be boiled together for from 2 to 5 minutes, for example for about 3 minutes, and allowed to cool to room temperature. In step (ii) the arfriealed oligonucleotides are ligated with a cassette vector which has been digested with Sal 1 and Dra 1 to excise the DNA encoding antigenic site 1. E. coli may then be transformed with the ligation mix and screened for the presence of the recombinant vector.
Live virus is recovered from the modified full length cDN by production of a positive sense RNA. The vector
incorporating the DNA fragment encoding the CD4 receptor binding site is cut by a restriction enzyme outside the cDNA. The promoter controlling transcription of the cDNA then enables RNA to be obtained. A T7 promoter is
particularly suitable for directing transcription in vitro (van der Werf et al , Proc. Natl. Acad. Sci. USA 83, 2330- 2334, 1986). The recovered RNA may be applied to tissue cultures by standard techniques (Koch, Curr. Top, Microbiol. Immunol, 61, 89-138, 1973). For example, the RNA can be used to transfect Hep2C monolayers. After 2 to 8 days incubation, from example after 4 to 6 days incubation, virus can be recovered from the supernatant of the tissue culture.
The chimaeric proteins are useful as vaccines against both HIV-1 and HIV-2. An effective amount is administered to a patient requiring vaccination. They may be administered orally, nasally or parenterally for example intravenously, subcutaneously or intramuscularly. The dose of the chimaeric protein depends on a variety of factors including the age and weight of a patient and the type of carrier protein which has been modified so that its amino acid sequence includes the sequence of the CD4 receptor binding site.
Typically, however, from 10 to 1000 μg of protein may be administered for each route of administration. More
preferably from 10 to 100 μg may be given. The chimaeric protein may be given once but preferably a second dose is given from 2 to 4 weeks later. In the case of a poliovirus chimaera, a dose corresponding to the amount administered for a conventional live virus vaccine may be given, usually in the range 104-108TCID50, and more usually between 105 and 106.5TCID50. The dose will depend in part on the viability and replicative capacity of the virus used.
Pharmaceutical compositions comprising the chimaeric protein and a pharmaceutically acceptable carrier or diluent are formulated to enable the chimaeric protein to be
administered as a vaccine. Any appropriate carrier or diluent may be employed, for example an isotonic saline solution for parenteral administration. A nasal spray may be formulated with a liquid carrier. An adjuvant may be
present. A live attenuated poliovirus chimaera may be formulated stabilised in a solution of 1M MgCl2. The type of carrier or diluent will depend upon the nature of the
chimaeric protein, but the following ways of formulating vaccines can be adopted as appropriate:
(a) For oral administration, tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs may be formulated. Compositions intended for oral use may be prepared according to any method known in the art for the manufacture of pharmaceutical compositions and such
compositions may contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations.
Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets. These excipients may be for example, inert diluents, such as calcium
carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, maize starch, or alginic acid; binding agents, for example starch, gelatin or acacia, and lubricating agents, for example magnesium stearate, stearic acid or talc.
The tablets may be uncoated or they may be coated by know techniques to delay disintegration and adsorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a time delay material such as glycerol monostearate or glycerol distearate may be employed.
Formulation for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example peanut oil, liquid paraffin, or olive oil.
Aqueous suspensions contain the active materials in admixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinyl- pyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents may be naturally-occurring phosphatides, for example lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearat or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethyleneoxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyoxyethylene sorbitan monooleate. The said aqueous suspensions may also contain one or more preservatives, for example ethyl or n-propyl phydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose or saccharin.
Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin. The oily suspensions may contain a thickening agent, for example beeswax, hard
paraffin or cetyl alcohol . Sweetening agents, such as those set forth above, and flavouring agents may be added to provide a palatable oral preparation. These compositions may be preserved by the addition of an antioxidant such as ascorbic acid. Dispersable powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, a suspending agent and one or more
preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above
Additional excipients, for example sweetening, flavouring and coloring agents, may also be present.
The pharmaceutical compositions of the invention may also be in the form of oil-in-water emulsions. The oily phase may be a vegetable oil, for example olive oil or arachis oil, or a mineral oil, for example liquid paraffin or mixtures of these. Suitable emulsifying agents may be naturally- occurring gums, for example gum acacia or gum tragacanth, naturally-occurring phosphatides, for example soy bean, lecithin, esters or partial esters derived from fatty acids and hexitol anhydrides, for example sorbitan mono-oleate, and condensation products of the said partial esters with
ethylene oxide, for example polyoxyethylene sorbitan
monooleate. The emulsion may also contain sweetening and flavoring agents.
Syrups and elixirs may be formulated with sweetening agents, for example glycerol, sorbitol and sucrose. Such formulations may also contain a demulcent, a preservative and flavoring and coloring agents.
(b) For parenteral administration, either subcutaneously, or intravenously, or intramuscularly, or intrasternally, or by infusion techniques, sterile injectable aqueous or
oleagenous suspensions may be formulated. Such a suspension may be formulated according to the known art using those suitable dispersing of wetting agents and suspending agents which have been mentioned above. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example as a solution in 1,3-butane diol. Among the acceptable vehicles and solvents that may be employed are water. Ringer's solution and isotonic sodium chloride
solution. In addition, sterile, fixed oils are
conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil may be employed
including synthetic mono- or diglycerides. In addition fatty acids such as oleic acid find use in the preparation of injectables.
(c) For inhalation, aerosols or solutions for nebulizers may be formulated.
The following Examples illustrate the invention. A
Reference Example is provided.
Reference Example: Construction of cassette vector pCASl
Taking advantage of codon degeneracy, the nucleotide sequence of Sabin 1 cDNA in the region 2740-2800 was searche for sequences at which restriction endonuclease sites unique to the cDNA cpuld be introduced with minimal alteration to the amino acid sequence. It was observed that a Sal 1 site at nucleotide 2753 could be created without alteration to the amino acid sequence and that this site would be unique within the virus sequence. Similarly a unique Dra 1 site could be created at position 2783 resulting in the replacement of aspartic acid (VPl residue 102) by phenylalanine.
The synthetic oligonucleotides 5'- GGAAGCTGAGTTGTCGACGGTTATAATGG-3' and 5'- CACTGTAAATAGTTTAAACTTATTCTGG-3 ' (bases inducing changes underlined) were used to create Sal 1 and Dra 1 restriction sites at positions 2753 and 2783 respectively on a 3.6kb
Kpn 1 partial fragment (nucleotides 66-3660) of an infectious Sabin 1 cDNA (Stanway et al, J. Virol. 52, 1189-1190, 1986) subcloned in M13mp18, using the gapped-duplex mutagenesis technique (Kramer et al, Nuc. Acids Res. 12 , 9441-9456,
1984). The alterations made to the antigenic site were confirmed by dideoxy chain termination sequencing.
The nucleotide and amino acid sequence of poliovirus Sabin 1 illustrating changes introduced in the construction of pCASl are shown below. Nucleotides 2750-2794 of the cDNA sequence of the viral sense strand are shown, together with the location of the introduced restriction sites. The resulting amino acid change to phenylalanine from aspartic acid at position 102 is shown in parenthesis.
ANTIGENIC SITE 1
91 (F) 105 : :
T V D N S A S T K N K D K L F ACC GTG GAT AAC TCA GCT TCC ACC AAG AAC AAG GAT AAG CTA TTT GTC GAC TTT AAA
Sal 1 Dra 1 The mutated fragment was introduced into a full-length 1 cDNA of Sabdn type 1 onto which a T7 promoter had previously been engineered at the extreme 5' end. This full-length clone was subsequently transferred into vector pFBI 2
(Pharmacia), which had been modified to remove its 3 Dra 1 sites at positions 2052, 2071 and 2763, by insertion of an Eco Rl linker following Dra 1 digestion. An Eco Rl - Sal 1 fragment carrying this modified full-length poliovirus clone was ligated into Eco Rl-Xho 1 digested pFBI 2-derived vector thereby destroying this Sal 1 site. The resulting plasmid, pCASl, therefore contained a full-length Sabin 1 cDNA under the control of a T7 promoter and in which the introduced Sal 1 and Dra 1 sites were unique.
Recovery of infectious virus from Nael linearised pCASl was achieved following transfection of Hep 2C monolayers with transcripts produced in vitro by T7 RNA polymerase
(Stratagene). as previously described (van der Werf et al, Proc. Natl. Acad. Sci. USA fLl, 2330-2334, 1986). The genomic sequence of recovered virus was verified by primer extension sequencing of viral RNA (Rico-Hesse et al, Virology 160, 311- 322, 1987). The single substitution of aspartic acid for phenylalanine at residue 102 had no apparent affect on virus viability. Furthermore the design of the cassette was such that the altered amino acid would be lost upon insertion of replacement sequences. Example 1: Construction of a chimaeric poliovirus containing residues 423-439 of the glycoprotein qp120 of HIV-1
100 ng each of complementary oligonucleotides encoding the HIV-1 sequence of choice were boiled for three minutes and allowed to cool to room temperature. The oligonucleotides were:
TCGACAACATGTGGCAAGAGGTAGGTAAGGCAATGTACGCTCCACCAATTTCAGGT GTTGTACACCGTTCTCCATCCATTCCGTTACATGCGAGGTGGTTAAAGTCCA
Aliquots of this annealed mix were then ligated with Sal - Dra 1 digested pCASl. Competent E. coli were transformed with the ligation mix and recombinant plasmids screened for the presence of the HIV sequence inserted. The resulting recombinant plasmid, pSI/env/4 was linearised with Nae l, which cuts within vector sequences of the construct, and use as a template in a T7 transcription reaction (van der Werf et al, Proc. Natl. Acad. Ser. USA 80, 5080-5084, 1983) prior to transfection of sub-confluent Hep2C monolayers.
After three to four days a cytopathic effect was observed. The RNA sequence of approximately 200 bp spanning antigenic site 1 of the recovered chimaeric virus SI/env/4 was
confirmed by primer directed chain termination sequencing. The nucleotide and amino acid sequence of the region of antigenic site 1 of pCASl and of the corresponding region of pSI/env/4 are shown below. 91 105 pCASl T V D N S A S T K N K F K L F
ACCGTCGACAACTCAGCTTCCACCAAGAATAAGTTTAAACTATTT
Sal 1 Dra 1
S1/env/4
T V D N M W Q E V G K A M Y A P P I S G K L F ACCGTCGACAACATGTGGCAAGAGGTAGGTAAGGCAATGTACGCTCCACCAATTTCAGGTAAACTATTT TGGCAGCTGTTGTACACCTGGCTCCATCCATTCOGTTACATG CGAGGTGGTTAAAGTCCATTTGATAAA
Example 2: Neutralization of HIV-1 and HIV-2 isolates
Rabbit antisera were raised to poliovirus chimaera
Sl/env/4 by inoculation of approximately 0.5 ml of tissue culture supernatant from Example 1 in adjuvant, and boosted two to four times in a similar manner. Antisera were also raised by injecting rabbits with about 108TCID50 of purified Sl/env/4.
Neutralization titres were determined by incubation 10 μl of heat inactivated antiserum with 40 μl of virus supernatan containing 103 infectious units of HIV at 37°C for 1 hour.
The results are shown in Table 1 below and are expressed as the reciprocal of the serum dilution giving > 90 % reduction in HIV infectivity. Antisera R10, R11 and R12 are sera raised using tissue culture supernatant for immunizations.
Antisera R19 and R20 are sera raised using purified Sl/env/4 as immunogen nt = not tested.
Figure imgf000021_0001

Claims

1. Use of a chimaeric protein which presents the CD4 receptor binding site of HIV-1 or HIV-2 in the
preparation of a medicament for use as a vaccine against both HIV-1 and HIV-2.
2. Use according to claim 1, wherein the chimaeric protein takes the form of a particle or forms part of a particulate aggregation.
3. Use according to claim 2, wherein the aggregation is a viral particle.
4. Use according to claim 3, wherein the sequence of the CD4 receptor binding site is present in the sequence of a capsid protein of an attenuated virus.
5. Use according to claim 4, wherein the CD4 receptor binding site is presented at one of the antigenic sites on a capsid protein of an attenuated strain of type 1 poliovirus.
6. Use according to claim 5, wherein the CD4 receptor binding site is provided in place of some or all of antigenic site 1.
7. Use according to claim 6, wherein the CD4 receptor binding site replaces amino acid residues 94 to 102 of the VP1 capsid protein of an attenuated strain of type 1 poliovirus.
8. Use according to claim 1, wherein the CD4 receptor binding site is the HIV-1 site having the sequence NMWQEVGKAMYAPPISG or the HIV-2 site having the sequence NTWHKVGRNVYLPPREG.
9. An agent for use as a vaccine against HIV-1 and HIV-2 comprising a chimaeric protein which presents the CD4 receptor binding site of HIV-1 or HIV-2.
10. A method of vaccinating a patient against both HIV-1 and HIV-2, which method comprises administering thereto an effective amount of a chimaeric protein which presents the CD4 receptor binding site of HIV-1 or HIV-2.
PCT/GB1990/000842 1989-05-31 1990-05-31 Vaccine against hiv WO1990014842A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB8912496.0 1989-05-31
GB898912496A GB8912496D0 (en) 1989-05-31 1989-05-31 Vaccines

Publications (1)

Publication Number Publication Date
WO1990014842A1 true WO1990014842A1 (en) 1990-12-13

Family

ID=10657648

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB1990/000842 WO1990014842A1 (en) 1989-05-31 1990-05-31 Vaccine against hiv

Country Status (4)

Country Link
EP (1) EP0475987A1 (en)
CA (1) CA2055616A1 (en)
GB (1) GB8912496D0 (en)
WO (1) WO1990014842A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993011251A1 (en) * 1991-12-06 1993-06-10 Whitehead Institute For Biomedical Research Recombinant viruses comprising artificial proteolytic cleavage site
US5965124A (en) * 1991-12-06 1999-10-12 Whitehead Institute For Biomedical Research Replication-competent recombinant viral vaccines and method of producing same
WO2000078990A2 (en) * 1999-06-21 2000-12-28 Bio Merieux Search method for resistance to anti-proteases of a strain of the hiv 2 virus from a biological sample taken from a patient

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0243029A1 (en) * 1986-04-08 1987-10-28 THE UNITED STATES OF AMERICA as represented by the Secretary United States Department of Commerce Recombinant vaccinia virus expressing human retrovirus gene
WO1987007616A1 (en) * 1986-06-12 1987-12-17 Biogen N.V. Peptides involved in the pathogenesis of hiv infection
EP0279688A2 (en) * 1987-02-20 1988-08-24 Genentech, Inc. Methods and compositions for the use of HIV env polypeptides and antibodies thereto
EP0328403A2 (en) * 1988-02-12 1989-08-16 United Biomedical Inc. Synthetic peptides related to the HIV-GP120-env-protein, and their use
EP0302801B1 (en) * 1987-08-07 1995-10-18 Institut Pasteur Vaccines of which the characteristic epitope is incorporated in a picorna virus protein, particularly in that of the polio virus

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0243029A1 (en) * 1986-04-08 1987-10-28 THE UNITED STATES OF AMERICA as represented by the Secretary United States Department of Commerce Recombinant vaccinia virus expressing human retrovirus gene
WO1987007616A1 (en) * 1986-06-12 1987-12-17 Biogen N.V. Peptides involved in the pathogenesis of hiv infection
EP0279688A2 (en) * 1987-02-20 1988-08-24 Genentech, Inc. Methods and compositions for the use of HIV env polypeptides and antibodies thereto
EP0302801B1 (en) * 1987-08-07 1995-10-18 Institut Pasteur Vaccines of which the characteristic epitope is incorporated in a picorna virus protein, particularly in that of the polio virus
EP0328403A2 (en) * 1988-02-12 1989-08-16 United Biomedical Inc. Synthetic peptides related to the HIV-GP120-env-protein, and their use

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Cell, Volume 50, 11 September 1987, Cell Press, L.A. LASKY et al.: "Delineation of a Region of the Human Immunodeficiency Virus Type 1 gp120 Glycoprotein Critical for Interaction with the CD4 Receptor", pages 975-985 *
Nature, Volume 332, 3 March 1988, K.L. BURKE et al.: "Antigen Chimaeras of Poliovirus as Potential New Vaccines", pages 81-82 *
Nature, Volume 339, 1 June 1989, D.J. EVANS et al.: "An Engineered Poliovirus Chimaera Elicits Broadly Reactive HIV-1 Neutralizing Antibodies", pages 385-388 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993011251A1 (en) * 1991-12-06 1993-06-10 Whitehead Institute For Biomedical Research Recombinant viruses comprising artificial proteolytic cleavage site
AU674134B2 (en) * 1991-12-06 1996-12-12 American Cyanamid Company Recombinant viruses comprising artificial proteolytic cleavage site
US5965124A (en) * 1991-12-06 1999-10-12 Whitehead Institute For Biomedical Research Replication-competent recombinant viral vaccines and method of producing same
CN1055726C (en) * 1991-12-06 2000-08-23 怀特黑德生物制剂研究所 Reconstitued body vaccine and method of prepn. thereof
WO2000078990A2 (en) * 1999-06-21 2000-12-28 Bio Merieux Search method for resistance to anti-proteases of a strain of the hiv 2 virus from a biological sample taken from a patient
WO2000078990A3 (en) * 1999-06-21 2001-03-01 Bio Merieux Search method for resistance to anti-proteases of a strain of the hiv 2 virus from a biological sample taken from a patient
FR2798385A1 (en) * 1999-06-21 2001-03-16 Bio Merieux METHOD FOR SEARCHING FOR ANTI-PROTEASE RESISTANCE IN STRAINS OF THE HIV-2 VIRUS
US6794129B1 (en) 1999-06-21 2004-09-21 Bio Merieux Method for measuring anti-protease resistance of HIV-2 in a patient
US7632635B2 (en) 1999-06-21 2009-12-15 Biomerieux Method for measuring resistance of a patient HIV-2 to protease inhibitors

Also Published As

Publication number Publication date
CA2055616A1 (en) 1990-12-01
EP0475987A1 (en) 1992-03-25
GB8912496D0 (en) 1989-07-19

Similar Documents

Publication Publication Date Title
JP3681753B2 (en) Modified plant viruses as vectors for heterologous peptides
EP1078105B1 (en) Replication defective hiv vaccine
CA2025598C (en) Chimaeric hepadnavirus core antigen proteins
Goudsmit et al. Genomic diversity and antigenic variation of HIV‐1: links between pathogenesis, epidemiology and vaccine development
JP2010099084A (en) Fusion protein of hiv regulatory/accessory protein
JP2010001290A (en) ATTENUATED vif DNA IMMUNIZATION CASSETTE FOR GENETIC VACCINE
US5541100A (en) Chimeric rhinoviruses
AU588462B2 (en) Non-cytopathic clone of human t-cell lymphotropic virus type iii
JPH01500161A (en) Glycoprotein of the virus causing AIDS, method for producing the glycoprotein, and vaccine
Gritz et al. Generation of hybrid genes and proteins by vaccinia virus-mediated recombination: application to human immunodeficiency virus type 1 env
EP0651806B1 (en) Anti-feline immunodeficiency virus (fiv) vaccines
JP3164351B2 (en) Isolates of prototype FeLV for use in disease models and vaccines
US5652119A (en) Recombinant feline herpesvirus vaccine
JP3453611B2 (en) Novel soluble, non-cleavable gp160 variants in hybrid form
WO1990014842A1 (en) Vaccine against hiv
US6696289B1 (en) Replication-competent recombinant Sabin type 1 strain of poliovirus
EP0606452B1 (en) Vector vaccines of recombinant feline herpesvirus
AU622129B2 (en) Vector for the expression of proteins of the hiv-2 virus, one of the casual agents of aids, cell culture infected or transformed by this vector, proteins obtained, vaccine and antibodies obtained
Johnson et al. Pathogenesis of AIDS: the non-human primate model
Voss et al. Morphogenesis of recombinant HIV-2 gag core particles
WO1992014489A1 (en) Poliovirus-based vaccines
CN115845042B (en) Recombinant novel coronavirus S protein trimer vaccine composition and application thereof
US5152982A (en) Compositions and methods for FeLV vaccination
WO1990015145A2 (en) Poliovirus chimaeras
WO1995004546A1 (en) Novel mutated human and simian immunodeficiency viruses and vaccines containing said viruses

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): CA GB JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 2055616

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1990908574

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1990908574

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1990908574

Country of ref document: EP