WO1990014423A1

WO1990014423A1 - Microorganism transformation

Info

Publication number: WO1990014423A1
Application number: PCT/US1990/002776
Authority: WO
Inventors: Brent E. Esmon; Timothy L. Legerton; Aubrey Bruce Amsden; Charles D. +Di Field
Original assignee: The Infergene Company; Reyes, Anne, M. +Ef
Priority date: 1989-05-18
Filing date: 1990-05-17
Publication date: 1990-11-29

Abstract

Linear transforming segments are prepared having reduced vector DNA. A vector incorporating a segment having a region of homology with a target chromosomal site of a host microorganism is severed at two sites outside of the segment to remove vector sequences and at a site within the region of homology to form two segment portions, each with a part of the region of homology at one end thereof. The segment is reassembled with one of said parts of the region of homology at each end and with the ends of the segment portions opposed to the parts of the region of homology connected together. The sequence desired for integration, such as a gene, may be incorporated in the segment either intermediate the regions of homology at the ends or they may form the regions of homology. Alternatively, the linear transforming segment is prepared by circularizing a DNA segment containing the desired sequence and having the region of homology and then amplifying this construct by inverse polymerase chain reaction. Host microorganisms are transformed with these segments to obtain transformants with reduced vector DNA and particularly amylolytic S. cerevisiae transformants incorporating glucoamylase genes of S. diastaticus.

Description

MICROORGANISM TRANSFORMATION

Technical Field

This invention relates to the transformation of prokaryotic and eukaryotic microorganisms, through the the introduction into the genome thereof of a nucleotide sequence or sequences, to obtain a desired condition or result, for example, the ability to express a particular protein. In a conventional procedure the sequence to be introduced, either taken from a donor organism or artificially synthesized, can be inserted into a plasmid and the plasmid used to transform the microorganism by homologous recombination by a so-called double crossover event, wherein the sequence is integrated into the genome at a chromosomal site that is homologous to the sequence by displacement out of the chromosome of the resident homologous portion. In this procedure the sequence is typically integrated free of plasmid DNA. However, results with this technique are unpredictable and frequently unsuccessful, particularly with many yeasts even if substantial homologous regions are available, and only a single copy may be integrated at the site

Background Art

It is known that integration of a plasmid containing a desired nucleotide sequence into a chromosome can be stimulated by first cleaving the plasmid within a region that is homologous with a region or site in the chromosome (see e.g. Orr-Weaver, T.L., et al., 1981. Yeast transformation: a model system for the study of recombination, Proc. Natl. Acad. Sci. U.S.A., 786354-6358 and Orr-Weaver. T.L., et al., 1983, Genetic Applications of Yeast Transformation with Linear and Gapped Plasmids, Methods in Enzymology, 101228-245). This procedure results in an integration by insertion rather than by a displacement event, i.e. wherein the plasmid is inserted at the resident homologous sequence, rather than displacing the resident sequence from the chromosome. In addition to enhancing integration, this procedure permits integration of multiple copies at a given site since the region of homology remains and in fact is amplified. However, in this technique the entire plasmid is inserted into the chromosome, including unwanted sequences, such as DNA sequences from the vector(s) no longer needed after preparation of the transforming segment, including their origins of replication and marker sequences necessary for selection, such as auxotropic or nutrient markers and resistance markers, e.g. resistance to antibiotics or heavy metal ions. This is a substantial disadvantage, particularly where the contemplated use of the transformed microorganism or products thereof will be introduced into the food chain or environment or used in medicine.

C otransformation has been employed as a method of chromosomal integration of a desired DNA sequence and at the same time introduction into the same organism a selectable plasmid (bearing a marker) that is unstably inheritable and thus removable to eliminate marker and marker plasmid sequences no longer needed. However, chromosomally integrated vector sequences will still remain from conventional transformation with linear transforming DNA.

This invention also relates to the yeast Saccharomyces cererisiae. Although S. cerevisiae is known to possess genes which code for a sporulation specific glucoamylase. it is not secreted. Thus, in nature. S. cererisiae is unable to hydrolyze starch. It has long been a goal in the fermentation industries to develop a genetically stable, satisfactory amylolytic yeast for brewing, bread making and the like. To be satisfactory, such yeasts must be otherwise unaltered as to the important properties, e.g. flocculation. growth rate, flavor production etc., which have been developed through many years of selection. Moreover due to regulatory, social and other considerations it is important that fermentation yeasts, particularly those employed in the food chain, are essentially free of non-yeast DNA.

Amylolytic brewing yeasts have been prepared through recombinant techniques, by introducing into a chromosome of the yeast a glucoamylase gene from various fungal microorganisms. However, such foreign DNA, in a yeast used in the food chain is unsatisfactory due to possible health implications.

The yeast Saccharomyces diastaticus does possess genes that code for an extracellular glucoamylase and this species is closely related to S. cererisiae. Studies have indicated homology of one of the S. diastaticus glucoamylase genes, STA1. with three regions of the S. cererisiae genome (see Yamashita, I., et al. 1985. Polymorphic Extracellular Glucoamylase Genes and Their Erolutionary Origin in th Yeast Saccharomyces diastaticus J. fiacteriol. 1161:574). These S. diastaticus genes have been considered for introduction into S. cererisiae to impart amylolytic capability and the amylolytic gene DEX1 has been inserted into fermenting yeasts, incorporated in various plasmids (see Meaden P.G. and R. S. Tubb 1985, A plasmid rector system for the genetic manipulation of brewing strains and Hinchliffe 1986, Enzymes by genetic manipulation, The Brewer July:256). However, although initially amylolytic, these constructs have proven genetically unstable.

The STA1 and STA3 genes for glucoamylase of S diastaticus have been integrated experimentally into the genome of haploidal progenies from a cross between strains of S. diastaticusnnd S. cererisiae, utilizing a plasmid vector which was cleaved at a site in the gene sequence to stimulate insertion into the chromosome, and these genes have functioned to produce extracellular amylolytic enzyme in these haploid yeasts (see Yamashita et al., supra and the paper of J./M Pardo et al., (1986) Nucleic Acids Research Vol 14, No 12 pp 4701- 4717). The homology between the glucoamylase coding S. diastaticus genes and regions in the S. cererisiae genome has further led to speculation as to the use of this homology in the design of gene integration protocols for polyploid yeast represented by the more complex brewing and other fermentation strains and the possibility of amplifying expression of this gene when integrated as a single copy, by splicing to it a highly efficient promoter sequence (see Current Developments in Malting Brewing and Distilling, F.G. Priest and I. Campbell, Editors, Proceedings of the Aviemore Conference 24-27 May 1982, published by The Institute of Brewing. London). However, the use of such homology to achieve effective recombination in the case of the complex fermentation yeasts has been questioned due to the possibility for recombinational re-arrangements in polyploid yeasts resulting in instability of the glucoamylase and no successful protocol utilizing such homology has been suggested for polyploid fermentation yeasts. Moreover, it has been uncertain whether a single copy or low copy number of such genes would be capable of supplying sufficient enzyme or, if not, that a larger multiple of such genes could be successfully incorporated into the genome of the polyploid strains.

Disclosure of the Invention

The invention relates to homologous transformation of prokaryotic and eυkaryotic microorganisms, acting at a chromosomal site and utilizing a linear nucleotide segment having end sections composed of formerly adjacent portions of a region in a gene that is homologous to the chromosomal site, such portions being cleaved from each other and each being at a respective end of the segment and connected thereto at its end opposite the cleavage. By the methods of this invention unwanted sequences in such segments, such as those introduced in cloning and isolating the segment, have been reduced or eliminated entirely. The invention further provides novel constructs for carrying out such transformation, and microorganisms so transformed and their use to generate desired proteins.

In carrying out the invention, vectors, e.g. a plasmid or bacteriophage, prepared to contain a segment with a region that is homologous to a chromosomal site of the host microorganism, are cleaved in the region of homology and at at least two sites in the vector sequences and the cleaved segment portions are assembled to form the described transforming segment which is free of the vector sequences between the cleavage sites in the vector sequences.

In one mode of the invention the vector is first cut at two sites, desirably both outside the region of homology. to form a segment containing the homologous region with a reduced portion, or none, of the nucleotide sequences originating from this and any other vectors used in cloning and isolating the segment. The ends of this segment are then connected together to form a cyclic (continuous) construct. This construct is then cut within the homologous region thereby to again form a linear segment, this time with a portion of the homologous region at either end and with any other sequences in the construct including any remaining sequences from the vector(s), in between, connected through the previously connected ends of the segment. This segment may then be used to transform the host microorganism by integration at the homologous chromosomal site, desirably after first amplifying the segment by cloning it in a plasmid and then liberating the amplified segment, desirably with the restriction enzyme used in its construction (for severing the construct in the region of homology).

In another mode, the vector is first cut within the region of homology in the segment and the linear DNA thus formed inserted in a second vector, which is then severed in two sites in the sequences of the first vector to remove the first vector sequences boardered by such sites. The free ends of the second vector are then connected. The segment, now free of the first plasmid sequences, may then be excised from the plasmid and used for transforming, desirably after cloning. In yet another mode, the vector is cut both in the region of homology in the segment and at sites in the plasmid sequences to free two segment portions. These portions are then reassembled in a plasmid by trimolecular ligation with the ends having homology connected to the plasmid sequences and their opposed ends connected together. The segment thus formed may then be excised from the plasmid and used for transforming, desirably after cloning. In still another mode of the invention, the technique of inverse polymer chain reaction (inverse PCR) is employed to prepare a vector DNA-free transforming segment. Inverse PCR is used conventionally to amplify, without cloning in a vector, specific DNA sequences for the purpose of identification or simply to recover a desired sequence. The segment containing the DNA sequence is first circularized and then it is amplified by a series of denaturing, annealing and synthesis cycles in the presence of DNA polymerase and a high concentration of primers hybridizing to a known sequence in the segment. A gene so amplified will be inverted, i.e. it will constitute a linear segment with the known sequence at the terminal ends. For conventional applications, the gene will require rearrangement (by manipulation in a vector) in order to reestablish the gene in its proper progression of sequences so that it will be functional. However, advantageously, in accordance with this invention a segment containing the sequences desired for transformation and having a region of homology at a chromosomal site of the host organism is amplified by inverse PCR by utilizing primers which code at a site within the region of homology, thereby to directly produce an expanded vector DNA-free, linear transforming segment with a portion of the region of homology at either end.

The transforming segment thus formed may already contain the sequence or sequences desired for the transformation, being either a part of or connected to the homologous region (e.g. by introduction thereof into the segment when it is in the plasmid prior to the first cloning). However, as a further feature of this invention, this segment may be used as an advantageous vectoring system wherein the desired sequence is introduced into the segment after its preparation. So employed the desired sequence(s) may be inserted into the segment between the homologous end portions, and, advantageously, at the site in the segment where the segment was reconnected after removal of vector sequences. Such insertion may be made at the time of such reconnection or, afterwards by recleaving the segment while inserted in a vector or in the form of a circular construct. The segment, now containing the added sequence intermediate the homologous ends is then cleaved from the plasmid and used to transform the microorganism, thereby to incorporate the added sequence, along with the homologous regions, into the microorganism genome at the homologous chromosomal site.

Another aspect of this invention, also with the objective of a securing a transformant with minimum of unwanted DNA, is the use together with the novel transforming technique of a selection procedure wherein the microorganism is cotransformed with a selectable plasmid that remains extrachromσsomal and is unstably inheritable. Following selection for cotransformants. a strain without the selectable marker is obtained by screening, after non-selective growth, for individual colonies of selectable marker-free transformants.

A further feature of this invention relates to the transformation of yeasts from the genus Saccharomyces to incorporate at a chromosomal site an exogenous gene for expressing a desired protein not normally expressed by the yeast, desirably with such exogenous gene also from the genus Saccharomyces, with the transformed yeast containing a reduced amount of vector DNA. Incorporation into S. cererisiae of lase genes of S. diastaticus in this manner is of particular importance.

In yet a further feature polypioidic and/or aneuploidic wild type fermentation strains are genetically modified to incorporate glucoamylase genes from S. diastaticus by a procedure that results in a yeast having adequate amylolytic properties yet which is otherwise unaltered as to the specific and essential properties possessed by the S. cererisiae fermentation yeast strain.

In preparing the yeast one or more of the glucoamylase genes from S. diastaticus is isolated and cloned in a plasmid. the promoter region of the gene is then removed and replaced with a promoter from a S. cererisiae gene that is unregulated and desirably strong, the plasmid is then cut at an intermediate point in the gene and the polypioidic S. cererisiae is transformed with the linear segment. Active transformants are selected into which at least two copies of the gene have been introduced into a chromosomal site homologous to the gene. Surprisingly, by so targeting by homology to the non-expressing glucoamylase gene of the polypioidic and aneuploidic fermentation strains of S. cererisiae no recombinational re-arrangements occur that effect the properties of the yeast and, by the combination of appropriate substitution of the promoter and introduction of multiple copies, satisfactory glucoamylase activity was obtainable.

Brief Description of the Drawings

FIG. 1 depicts the relevant DNA sequences at each step of one procedure of preparing a transforming vector in accordance with this invention and shows restriction or cleavage sites in and between sequences, from an initial plasmid pDM84 to a final plasmid pDM90 containing the vector. The abbreviation pUC designates the plasmid pUC118 into which has been introduced the glucoamylase gene of S. diastaticus designated STA2 which has been modified as will be described to include a promoter PRCl derived from a gene of S. cererisiae . Pst and Xba designate restriction sites.

FIG.2 is a gene map of a plasmid designated pBE4 utilized as a selection marker in transforming a microorganism in accordance with this invention. The abbreviation Bam represents restriction sites for the endonuclease Bam and they border a fragment that confers resistance to tunicamycin designated tunir. Ura3 and bla designate selection marker genes as will be described. 2 micron origin is the designation of the origin of replication of the 2 micron plasmid of S. cererisiae

FIG. 3 is a is a representation of the steps of a procedure for transforming a microorganism with a vector of this invention as will be described.

Best Mode of Carrying Out The Invention

Broadly, the invention for the homologous transformation of prokaryotes and eukaryotes with a linear transforming segment by a technique that will redυce the content of unwanted exogenous DNA in the transformant may proceed as follows. The procedure is generally applicable to prokaryotes, particularly to bacteria, and to eukaryotic microorganisms, particularly yeasts and molds. Bacteria of paricular interest are from the Escherica , and paricularly the species E coli. Yeasts include the following species and the various other species of the indicated genera: Saccharomyces cererisiae. S. diastaticus. S. lipolytica. S. carlsbergensis, S. rouxii, S. capsularis, S. urarum, Schizosaccharomyces pombe, Candida utilis, Trichosporon cutaneum, Hanseniaspora guilliermondii, Hansenula capsυlata, Rhodotorula rubra, P. palida, Phaffia rhodozyma, Pichia pastoris, Cryptococcus laurentii and Metschnikowia pulcherrima. Molds include the following species and the various other species of the indicated genera: Penicilliυm chrysogenum, P. notatum, Shizopus stolonifer, Monascus pυrpυrea, Aspergillus niger, A. nidulans and A. oryzae. A DNA segment is selected or constructed that has a region of homology with a desired chromosomal site in microorganism that is to be transformed. Segments with suitable regions of homology may be found in related microorganisms or microorganisms that produce the same or similar proteins. For example, Aspergillus satoi could be transformed with its own acid protease gene to enhance production of acid protease and Aspergillus oryzae could be transformed with its own alpha amylase gene to increase the copy number and, hence, the amount of enzyme produced. The literature may be consulted for suitable homology candidates. Also, the segment may be taken from the same microorganism that is to be transformed, with the addition thereto at a later point in the procedure of the new DNA desired in the transformant, as will be explained. Desirably for best results the segment has a region of homology of at least 50 base pairs and preferably more than 300. The chromosomal site of introduction is dictated by the homology so it is desirable to select a homology at a chromosomal region where the possibility for undesired recombinations or for interference with normal gene function is minimized. Preferably homology is selected for a site on a non-essential sequence or gene or a multicopy gene. These and other considerations and procedures known in the art for transforming with linear DNA, and specifically those discussed in the above Orr- Weaver et al. citations, may be employed.

The homologous segment in this invention serves as a targeting system or "vector" for the DNA sequence(s) desired for modification of the microorganism but the segment, itself, may also constitute or contain such sequence or sequences and this may indeed be the homologous region thereof. The modifying sequence(s) may include a gene coding for a protein to be expressed in the transformant. such as an enzyme, hormone, etc. Examples will include all of the proteins presently produced for medical, veterinary and agricultural and food use, including TPA bovine growth hormone, erythropσetin, insulin, beta- glucanases, alpha-amylases, beta-amylases, etc. Alternatively, the transforming sequence(s) desired in the transformant may be introduced into the homologous segment at a later stage prior to transformation as will be described. As needed, appropriate regulatory signals for operation of the exogenous gene in the host organism are to be provided by conventional procedures appropriate to the particular gene. To prepare a DNA segment for introduction into the genome of a host organism in accordance with this invention the segment is inserted into a plasmid and this may be carried out by conventional procedures either by introduction directly into the plasmid by splicing techniques or by use of a bacteriophage as a vector. A typical procedure is to first create a DNA fragment containing the sequence by enzymatic digestion of the DNA of a source microorganism having the sequence and then, to identify and isolate this fragment from other DNA fragments, it is introduced into a suitable cloning vector, e.g. into the chromosome of a bacteriophage. and the clone is identified by hybridization with an appropriate oligonucleotide probe. The fragment is then subcloned in an appropriate plasmid or bacteriophage. The fragment is desirably manipulated in vitro in the vector to remove any unnecessary DNA sequences and, if the fragment contains the gene or other sequence(s) that are intended for modification of the host microorganism to replace transcriptional and translational control sequences consistent with the intended pattern of expression of the gene. The segment selected with a sufficient number of homologous base pairs to support transformation will be of sufficient size to permit the manipulations of the segment as will be explained. In total the segment is desirably less than 20 kb and preferably less than 10 kb.

Such a plasmid containing the homologous segment, designated pDM84, is exemplified at 1 in FIG. 1 of the drawings and will be described in detail at a later point. Any convenient vector/plasmid/host system may be employed for isolating, cloning and manipulating the transforming segment as described herein. Advantageously, selection of a particular plasmid or vector is facilitated in that by this invention their DNA is removed prior to transformation.

Following insertion of the transforming sequence in the plasmid. and cloning, the plasmid is cut at two positions outside of the transforming segment, the positions being close enough to one and the other respective ends of the transforming segment so that the segment is severed free of the major portion of the DNA originating from the plasmid and any other vectors employed, preferably leaving no vector DNA at all (i.e. severing exactly at the ends of the transforming segment). In the absence of restriction sites at desired points of severance, restriction sites may be inserted by conventional techniques, such as by site-directed mutagenesis. Such a segment, severed from pDM84. is shown at 2 in FIG 1, with severed ends 6.

However, in cases where some degree of unnecessary exogenous DNA is acceptable it may be desirable (e.g. to take advantage of convenient restriction sites) to sever the plasmid at locations that will leave a portion, typically minor, of vector or other unneeded DNA on the segment. A portion of exogenous DNA will be removed which desirably includes sequences that are potentially toxigenic either known or suspected such as selection markers, particularly those conferring antibiotic resistance, that could have the potential for imparting toxicity to the microorganism or its expression products. It is also desirable to remove the origin of replication of any vectors thus removing the ability to replicate autonomously.

As the next step, the severed segment is ligated to connect the ends 6 to form a circular construct which contains only the transforming segment with a residual amount, if any of vector DNA, as shown at 3 in FIG 1. This construct, in turn, is severed at a position in the homologous region, thus to form a linear transforming segment having a part of the region of homology at either end as shown at 4 in FIG1. Preferably, the region of homology is severed in the middle rather than near an edge of homology to insure adequate region of homology at either end for transformation. End portions should have, minimally, at least 20 base pairs of homology and more than 50 are desired. A desirable restriction site may be located by conventional gene mapping procedures or, if necessary is inserted by mutagenesis. Some homologous sequences may be destroyed in forming the segment ends from the adjacent portions of the region of homology, particularly where a restriction site must be inserted. However, the segment may usually still be employed with the gap so created, because of the of gap repair reaction that will occur during the transformation event.

Alternatively, the transforming segment may be prepared and manipulated essentially as described, but using exclusively bacteriophage vectors, as for example M13. However, the manipulative steps and procedure for a bacteriophage with a linear chromosome, such as bacteriophage lambda, will differ in that the chromosome to be cut to free the segment from vector DNA is linear and in this case the sites for severance are to either side of the segment. Prior to using the segment for transformation it is first reintroduced into a plasmid, as shown at 5 in FIG 1 (designated pDM90) and amplified by cloning in an appropriate host microorganism. Advantageously, by maintaining the segment in the plasmid in a host organism it may also be conveniently transported or stored for later use or amplification. When desired the segment is excised from the plasmid and in linear form with a region of homology at each end used for transforming the target microorganism.

As a further alternative procedure for removal of the unwanted sequences, a cyclic first vector containing the segment, such as pDM84 at 1 in FIG 1. may be cut in the region of homology of the segment and the entire linear segment so produced inserted into a second vector, e.g. plasmid. This cyclic contract can then be severed at two sites in and preferably at the margins of the first vector to remove unwanted sequences. The second plasmid, now having a portion of the segment at either end, can be recyciized by ligating to join these ends to form a plasmid which resembles the plasmid pDM90 at 5 in FIG.1. This plasmid can then be treated in the same manner as pDM90 to free the segment, now with reduced vector DNA. and use it as for transformation, rather than removing unwanted sequences. Yet another alternative procedure for removal of the unwanted sequences is through the use of trimolecular ligation. A plasmid bearing the homologous segment, such as pDM84 in FIG 1, is cut at three sites, two sites in and preferably at the margins of the vector sequences to free the segment from the unwanted vector sequences and the third site within the homologous region of the segment The cut portions of the segment are then reassembled in reverse order by ligating them with another cyclic vector, preferably a plasmid. that has been cut at restriction site common with the site at which the homologous region was cut. In this fashion a plasmid resembling pDM90 will be formed. Referring again to pDM84, the plasmid may thus be cut at the Pst site and at both Xba sites, as by digestion with the enzyme Xbal and Pstl. Then a plasmid having a Pst restriction site may be cut at that site and then ligated in the presence of the cut portion of the segment to form pDM90.

The transforming sequence(s) desired in the transformant may, instead, be introduced into the homologous segment subsequent to the removal of the unwanted sequences. Advantageously, the desired sequence(s) may be inserted into the segment at the point where the unwanted sequences have been removed. Thus the construct at 3 or the plasmid at 5 of FIG 1 may be severed at the Xba restriction site and the desired sequences inserted. Similarly, if in the alternative procedure described in the preceding paragraph, the sequences may be introduced at the time the second plasmid is recyciized.

It may be possible to use the transforming segments immediately after they are reassembled in accordance with this invention, if the volume of DNA material processed is sufficiently large. However, it is desirable, and a further feature of this invention to first amplify such segments by further cloning. The segment may be inserted into a vector for that purpose, if it is not already in a vector used in its rearrangement.

For preparation of the transforming segment in accordance with this invention utilizing inverse PCR, a DNA segment containing the sequences desired for transformation and having a region of homology at a chromosomal site of a host organism is first separated from a genome containing it by digestion with an appropriate restriction enzyme to form a DNA library containing the released segment. The separated segment is circularized by ligation under conditions that favor formation of monomeric circles, particularly by appropriate dilution.

Sequence of base pairs at appropriate sites within the region of homology of the segment must be known or determined so that primer pairs may be constructed for amplification. As pointed out previously, the transforming segment need not include the entire homologous region that it is desired to replicate at the target chromosomal site because of the gap repair reaction that will take place in a transformation by insertion. Therefore the sites for primer annealing may be at positions within the region of homology that will result in an expanded transforming segment that is abbreviated, i.e. with a substantial gap in the region of homology that it is desired to replicate. It is only necessary that one of the characterized sequences for a primer annealing site is located downstream of the ligation site of the circular construct and the other upstream of the ligation site, in each case desirably a distance of at least around 500 base pairs.

Primer pairs corresponding to the characterized sequences at the annealing sites selected in the region of homology are synthesized with opposite orientations to those normally employed for PCR. (Unlike the oligonucieotide primers normally employed in PCR, those used for inverse PCR are complementary to the opposite strand and, therefore, oriented such that extension proceeds outwardly from the annealed region.)

The poiymerase chain reaction is carried out with the circularized DNA utilizing the synthesized primer pairs, preferably with known PCR mixtures and conditions (e.g.30 cycles of denaturation at 94 degrees C. for 30 seconds, primer annealing at 50 degrees C. for 30 seconds and extension by Taq poiymerase at 70 degrees C. for 2 minutes). The amplified segment can then be purified and used to transform the host microorganism.

Transformation of the host microorganism is carried out in a conventional manner as may normally be employed for homologous transformation for the particular species of microorganism. For example, a transformation technique for the prokaryote E coli is described in the article of C. B. Russell, et al., (1989) J. of Bacteriology 1712609-2613 and a techniques for the eukaryσte S. cererisiae is described in the aforementioned Orr-Weaver papers.

For the amylolytic S. cererisiae yeasts generally, in accordance with this invention, i.e. of either wild strains or laboratory strains, including haploidic and diploidic yeasts, the transforming DNA is any of the extracellular glucoamylase coding genes of S. diastaticus may be selected, including the STA1. STA2 and STA3 genes and their allelic counterparts. PEX2 DEX 1 AND DEX3. respectively. The genes all have substantial regions of homology with the resident sporulaiion-specific glucoamylase gene of S. cererisiae (Spo gene). The desired gene may be obtained from S. diastaticus by conventional techniques as by enzyme digestion, cloning in a bacteriophage and selection by the use of an oligonucieotide probe. It has been found that with appropriate replacement of the gene promoter section the S. diastaticus genes and transformation therewith of S. cererisiae in accordance with this invention, quite satisfactory amylolytic activity is achieved, even in the case of wild strains of cererisiae. Thus, prior to transformation, the promoter is desirably replaced. The substitute promoter may be any reasonably active promoter from a S. cererisiae gene, as for example, the promoter from the PRCl gene. Substitution may be accomplished by conventional techniques as by insertion in a plasmid vector followed by mutagenesis. The plasmid containing the S. diastaticus gene, so modified, after introduction of a restriction site if necessary, may then be cleaved at a location in the gene to form a linear transforming segment having a region at each end homologous to regions in a non-secreting, sporulation specific gene in the S. cererisiae genome. The transformation may then be carried out with this segment, generally by conventional techniques. The recombinant is selected based upon substantial starch clearing capability and is found to have a minimum of two copies of the modified S. diastaticus gene.

The foregoing method is applicable to S. cererisiae fermentation yeasts of poorly sporulating, polypioidic and/or aneuploidic stains of S. cererisiae used for fermentation processes (including those formerly classified as S. carlsbergensis or S. υrarum) and, particularly to the strains of these yeasts that have been empirically selected for brewing and baking (brewing and baking strains). Surprisingly, a stable recombinant fermentation yeast is achieved having amylolytic capability while retaining fermentation and other properties. The recombinant contains only yeast DNA, except for residual sequences from vectors and any retained marker sequences .

Advantageously, however, the transforming segment may be further modified before transformation, as described previously, to remove most or all of vector DNA, and the transformation may be carried out along with a cotransforming marker bearing plasmid that is unstably inheritable in S. cererisiae, also as previously described, thereby to produce a amylolytic fermentation yeast transformant that has a reduced amount of vector DNA. By this procedure an amylolytic yeast may be obtained entirely free of exogenous DNA, except for the glucoamylase gene from the closely related S. diastaticus species. The steps of such cotransformation and selection are shown in FIG. 3 with a plasmid 8 bearing a marker for tunicamycin resistance and the transforming segment 9 as described with a region of homology from the STA 2 gene at either end for transforming a spheroplast of S. cererisiae 10. First, the transformants are selected for tunicamycin resistance as at 11 and then for starch clearing as at 12. The transformants thus selected are then cultivated as at 13 and screened for loss of tunicamycin marker as at 14. Colonies that have regained tunicamycin sensitivity are selected as marker free transformants containing the operative STA2 gene.

Eiample 1 Preparation of Brewing Yeast With A Functional Glucoamylase Gene

Preparation of transforming DNA segment

The STA2 gene of S. diastaticus is employed for preparation of a transforming DNA segment. Genσmic DNA is isolated from the SPX101-lc strain available from the American Type Culture Collection under ATCC No. 60270. as described in laboratory Course Manual for Methods in Yeast Genetics (1986), Sherman, F. et al. Cold Spring Harbor Laboratory. A lambda EMBL 3 library of DNA partially restricted with Sau3A is prepared as described in Molecular Cloning (1982) Maniatis, T. et al. Cold Spring Harbor .Laboratory. The STA2 gene is isolated using conventional oligonucieotide.piaque hybridization. An oUgonucleotide with the sequence 5" CTACTGGCACTACTGTCACTCC3' is synthesized on a Biosearch 8600 DNA synthesizer. The library is plated and screened as described in Molecular Cloning. Hybridizing clones are plaque purified and the DNA isolated, also as described in Molecular Cloning. A clone is obtained with the 5' end of the STA2 gene near the Kpnl restriction site of EMBL3 (around 1.5 kb from the BamH1 site). The STA2 gene is subcloned on a Kpn1-Bg111 fragment into pUC118 which has had the PstI restriction site removed in the manner described in the paper of Thomas A. Kunkel (1985). Proc. Nat1. Acad. Sci.82: 488-92. pUC 118 is essentially the same plasmid as pUC18 available from Boehringer-Mannheim Biochemicals, but with an M 13 bacteriophage origin inserted at Ndel site.

The unregulated, active promoter from the PRC1 gene of S. cererisiae is selected for replacement of the resident promoter of that gene. This promoter may be obtained from S. cererisiae as described in the articles of Stevens, T.H., et al. (1986), J. Cell. Biol.102:1551-1557 and Vails, L.A., et al. (1987) Cell 48:887-897. This promoter is mutagenized as described in the above paper of Thomas A. Kunkel to yield the sequence ATGGTAGGCCT where the first three nucleotides code for the initiating methionine. The promoter is then excised as an approximately 600 base pair fragment with Ndel and StuI enzymes and after such cleavage it is cloned into the plasmid. This plasmid is then cleaved at the Sad site and the linker 5' CTCTAGAGAGCT 3" is inserted by the procedure described in Molecular Cloning referenced above. The resulting plasmid is pDM84 as shown at 1 in FIG. 1, which may be used for transformation after cleavage in the region of homology with the Spo glucoamylase gene, and particularly at the Pstl restriction site.

Preparation of transformant selection marker A tunicamycin resistance marker is prepared as generally described in the paper of Rine, J. et al. (1983) Proc. Nat1. Acad. Sci.80: 6750-6754 to have, as shown in FIG 2, a sequence for Tunicamycin resistance, an origin of replication from the 2 micron plasmid of S. cererisiae, a bla gene for Ampiciilin resistance and the Ura gene of S. cererisiae also for selection.

Preparation of yeast spheroplast for transformation

Spheroplasts of S. cererisiae fermentation strains are prepared by the methodology described in G. Bogυslawski in Gene Manipulations in Fungi Editors J.W. Bennett and Linda L. Lasure (1985) Academic Press, pp 163-65 from typical baking and brewings strains and in particular Fleischmann's Rapid Rise Yeast and BRY 203 and BRY 118 brewing yeasts, available from Seibel and Sons as slants. Transformation of the spheroplasts

To 0.1 ml of spheroplasts prepared as above is added 5 to 10 micrograms of each of the cotransforming plasmids. The pBE4 selection plasmid is in the covalently closed circular form, while the integrative plasmid (pDM84) is first cleaved with Pstl. After 20 minutes at room temperature, 0.9 ml of 20% polyethylene glycol (MW 3350) is added, gently mixed and incubated 20 minutes further at room temperature. 13 ml of plating agar (1 M sorbitol, 1% Bacto- Yeast Extract. 2% Bacto-Peptone, 2% glucose and 3% Bacto-Agar) is added at 50 degrees C, mixed and poured into empty sterile petri dishes. After 18 hours incubation at room temperature, 13 ml of selection agar (1% Bacto- Yeast Extract. 2% Bacto-Peptone, 2% glucose and 2% Bacto-Agar and 10 microgram /ml of tunicamycin) is overlayed and incubation continued for 3 days at 30 degrees C. Individual colonies are streaked onto YEPD/BCP lintner starch plates which are made by mixing two freshly autoclaved solutions as follows and then adding 10 ml of 50% glucose to the mixture. Solution 1: A solution of 20 grams Bacto-Agar, 10 grams Bacto- Yeast Extract, 20 grams Bacto-Peptone, 8 ml of 0.4% firomocresol purple in 95% ethanoi and water to a 500 ml total. Solution 2: A solution of 30 grams of Lintner Soluble Starch prepared by heating to a boil while stirring with 500 ml cold water until all the starch dissolves. After four days incubation at 30 degrees C. the plates are refrigerated for 24 hours. Colonies which are secreting glucoamylase show a zone of clearing in the precipitated starch.

To obtain a strain without the cotransforming plasmid a colony is picked and grown overnight at 30 degrees C. in YEPD (1% Bacto-Yeast Extract 2% Bacto- Peptone and 2% glucose) and streaked onto YEPD agar plates (YEPD plus 2% Bact- Agar). Individual colonies are then picked onto replicate plates of YEPD with or without 5 micrograms/ml tunicamycin and grown at 30 degrees C. for three days. Colonies which grow only in the absence of tunicamycin have lost the cotransforming plasmid. These selected colonies constitute a stable, amylolytic fermentation strain of S. cererisiae that has unchanged fermentation properties and that contains, other than the vector DNA, only the the exogenous glucoamylase gene of S. diastaticus. which is at a copy level of at least two and located at the Spo gene site.

Example 2

Preparation of Fermentation Yeast With A Functional Glucoamylase Gene By Transformation Procedure With Reduced Incorporation of Vector DNA

One microgram of plasmid pDM84 of Example 1 is digested with restriction enzyme Xba1, the reaction stopped with phenol/chloroform, chloroform extracted and the DNA precipitated with ethanoi by procedures described in Molecular Cloning, cited above. The DNA is then ligated with T4 DNA Ligase as described in Molecular Cloning. The ligated DNA is then extracted and precipitated as above and cleaved with Pstl. Pstl cleaved pUC118 is added and fragments are ligated with T4 DNA Ligase per Molecular Cloning. E coli strain JM83 is transformed and the transformants are screened for those with plasmid of the structure of pDM90 at 5 in FIG.1. These plasmids are then amplified and purified on CsCl gradients also as described in Molecular Cloning. This plasmid is then used in the transformation protocol of Example 1 for the yeasts indicated to yield transformants with, no pUC sequences integrated into the yeast genome, which contain about 300 base pairs of the lambda EMBL3 sequence along with each copy of the STA2 gene.

A stable amylolytic fermentation strain of S. cererisiae with unchanged fermentation properties is thus created which has, as determined by Southern Blot analysis, at least two copies of the STA2 gene integrated in the genome free of non-yeast DNA except for the small residual sequence of the Lambda phage vector. The resulting yeast may be employed in the conventional manner as a fermentation yeast. Transformants from brewing strain hosts may be used to inoculate a wort containing starch and sugars to produce beer or other fermented beverages using the usual fermentation conditions. Those from baking strain hosts may be used for innoculating cereal doughs under fermentation conditions preparatory to baking in the usual manner.

The transformant, designated strain DMR 195, produced according to the above procedure with Fleischmann's Rapid Rise yeast as the host microorganism, has been deposited with the Agricultural Research Service Culture Collection, Peoria, Illinois, U.S.A. and has been designated NRRL No. NRRLY-18494.

Example 3

Preparation of Fermentation Yeast With A Functional Glucoamylase Gene By Transformation Procedure With Complete Elimination of Vector DNA

One microgram of plasmid pDM90 is digested with Xpnl and Ndel, the ends are blunted with the Klenow fragment of DNA poiymerase I and religated according to the procedures found in Molecular Cloning. E coli JM83 is then transformed and screened as described in Example 2. Colonies bearing KpnI-Ndel deletion are then amplified and purified and used for transforming the spheroplasts of

Examples 1 and 2 in the same manner as for the pDM90 plasmid in Example 2. The result is an amylolytic S. cererisiae thai is completely free of exogenous DNA except for the glucoamylase gene of the closely related S. diastaticus.

As an alternative for removal of the Lambda phage DNA sequence, a modified version of pDM90 may be employed. In this alternative the DNA segment prepared from pDM84 in Example 2 (the construct as shown at 4 of FIG. 1 of the drawings) is ligated to pUC 8, rather than to pUC 118, and then cloned. The resulting plasmid containg the pUC8 segment, rather than the pUC118 segment, may then be used in place of pDM90 and manipulated as in this example for removal of the KpnI-Ndel sequence to prepare the linear transforming segment for transforming the spheroplasts of Examples 1 and 2. The advantage of cloning with pUC8 instead of pUC118 is the absence of any Kpn cleavage site in pUC8 so that the plasmid may be completely digested with Kpnl without unwanted cleavage occurring within the pUC segment. This will avoid the reduced efficiency and extra care needed when pUC118 is used, because it contains a Kpn cleavage site and therefore must be partially digested in order to retrieve the intact plasmid with only the KpnI-Ndel sequence removed. Example 4

Incorporation of a Gene in the Transforming Segment after Removal of the First Vector In the preceding examples the sequences for transformation (the glucoamylase gene) were incorporated into the segment before removal of sequences from the first cloning vector. This example will illustrate the incorporation of such sequences after such sequences are removed. This approach may be more convenient and versatile. Additionally, when an expressing gene is used for homology with the host organism, particularly one known to be safe and predictable, such as the the glucoamylase gene of S. diastaticus, the transforming segment will have a convenient and safe marker for the transformant. Moreover, the transformant will have a reduction in vector sequences.

The gene for hexokinase production may be sequenced by the procedures described in the paper of K. Froehlich et al. (1985), Gene 36:105-111. The gene may be cloned according to the procedures described in the paper of K. Froehlich et al. (1984), Molecular and General Genetics, 194:144-8. The Pst sites may then be removed by in vitro mutagenesis and Xba linkers added both as described in Example 1 for promoter substitution. The gene may then be cloned into the Xba site of the plasmid pDM90 prepared according to either example 2 or 3.

Alternatively to the above procedure, the transforming segment may be cloned into the modified version of pDM90 described in Example 3. namely ρDM90 prepared by ligating the DNA segment prepared from pDM84 to pUC8 rather than to p UC118. The advantage of using the modified pDM90 is that pUC8 has no Xba cleavage sites, so the resulting plasmid may be completely digested with Xba without unwanted cleavage occurring within the pUC segment. This will avoid the reduced efficiency and extra care needed when pUC118 is used, because it contains the Xba cleavage site and therefore must be partially digested in order to obtain a sufficient quantity of the segment cleaved only at the Xba site internally of the glucoamylase gene, at which the hexokinase gene may then be ligated to form the plasmid for cloning.

The resulting transforming segment is then used to transform the spheroplasts of Examples 1 and 2 by the same procedure described in those example and the same procedures are employed for selection of the transformant. The transformant has at least two copies of the DEX2 glucoamylase gene, each along with a gene that codes for the production of hexokinase. integrated in the genome. This transformant may be used to produce hexokinase in a standard fermentation. Example 5

Preparation of Vector DNA-Free Transforming Segment by Inverse PCR

This example will illustrate the preparation of transforming segments of this invention using the technique of inverse PCR. The hexokinase B gene may be digested from genomic DNA, such as from Baker's yeast, utilizing EcoR1, producing a segment of approximately 3500 base pairs. Primer pairs for inverse PCR may be synthesized for a known sequence within the gene desirably at least 500 base pairs removed from the EcoR1 site. Typical of such primers which may be employed are the following sequences:

5' end primer: AAT ATT AAG AAA CTTTGA AGTTAA

3' end primer: ACT CAA ACCTCA CTA GAC GACTAC

The foregoing 5' end primer hybridizes at a site 72 base pairs upstream from the methionine start code on the hexokinase gene and the 3' primer hybridizes at the codon for threonine 441.

Inverse PCR may be carried out in the manner described in chapter 27 of PCR Protocols. Ed. Michael Innis. David Gelfand, John Sninsky and Thomas White.

Academic Press, 1990. Proceeding with a digest desirably containing at least 1 microgram of the genomic DNA, the segments are circularized by ligation at the EcoRi site and then amplified by inverse PCR all by the procedures detailed at pages 220 and 221 of PCR Protocols. The size of the product is confirmed by agarose gel electrophoresis and the DNA then purified. The linear transforming segment thus formed has portions of the hexokinase gene at either end that together form a region that is homologous to a corresponding region in the hexokinase B gene of S. cererisiae. Thus this segment may be used to transform S. cererisiae to impart increased hexokinase activity. The purified segment may thus be used for cotransformation of S cererisiae following the procedures of Example 1. In this case, however, individual transformants must be cultured and assayed for increased levels of hexokinase activity as there is no visual marker as in the case of the starch clearing glucoamylase gene of Example 1.

It will be understood that various modifications, changes and variations may be made in the arrangement, operation and details of construction of the elements disclosed herein without departing from the spirit and scope of this invention.

Claims

1. In a method for preparing a linear transforming segment having homology with a target chromosomal site of a host microorganism from a plasmid or bacteriophage chromosome vector which incorporates a segment having a region of such homology the improvement which comprises the steps of

a. severing the vector at tw o sites outside of the segment, vhereby to remove therefrom the vector sequences between such sites, and at a site within the region of homology to form tiro segment portions, each with a part of the region of homology at one end thereof and

b. reassembling said segment with one of said parts of the region of homology at each end thereof and with the ends of the segment portions opposed to the said parts of the region of homology connected together, whereby to form a transforming segment free of unwanted vector DNA for integration by insertion at a chromosome site.

2. A method as in claim 1 and wherein said vector is first severed at the tvo sites outside the segment to remove the vector sequences from the segment, the free ends thus formed are then connected to form a cyclic construct and the segment is then severed in the region of homology to form the transforming segment.

3. A method as in claim 1 and wherein the vector is first severed in the region of homology, the linear vector thus formed with the severed segment portions connected thereto is then inserted into a second vector, the vector thus constructed is then severed at tvo sites in the first vector sequences and the free ends thus formed are connected to form the transforming segment

4. A method as in claim 1 and wherein the vector is severed in the homologous region and at sites outside the segment to create tvo free tvo segment portions with vector sequences excised therefrom, reassembling said segment by trimolecular ligation with the ends of the segment portions opposed to the said parts of the region of homology connected together to form the transforming segment.

5. A method as in claim 1 and wherein said sites outside of the segment include therebetveen the origin of replication of the vector and said segment includes a gene for expression of a protein in the transformant.

6. A method as in claim 1 and including the step of amplifying the reassembled segment by cloning the segment in a vector.

7. A method as in claim 1 and wherein said sites outside of the segment include a selection marker and wherein said segment includes a gene capable of directing the expression of a protein in the transformant.

8. A method as in claim 1 and wherein said microorganism is S. cererisiae and said segment includes a glucoamylase gene from S. diastaticus.

9. A method as in claim 1 and including the additional step, after removal of said vector sequences, of inserting betveen said segment portions a DNA sequence desired for integration into the host microorganism, vhereby said segment portions are connected together through said sequence.

10. A method as in claim 9 and wherein said DNA sequence includes a gene capable of directing the expression of a protein in the host microorganism.

11. A method of transforming a microorganism comprises the steps of

a. inserting into a plasmid or bacteriophage chromosome vector a segment having a region of homology with a target chromosomal site of a host microorganism.

b. severing the vector at tvo sites outside of the segment, vhereby to remove therefrom the vector sequences betveen such sites, and at a site within the region of homology to form tvo segment portions, each with a part of the region of homology at one end thereof,

c. reassembling said segment with one of said parts of the region of homology at each end thereof and with the ends of the segment portions opposed to the said parts of the region of homology connected together, vhereby to form a transforming segment free of unvanted vector DNA and d. integrating the transforming segment into the host microorganism chromosome under recombination conditions.

12. A method as in claim 11 and including the step of amplifying the reassembled segment by cloning the segment in a vector prior to integration thereof into the host microorganism.

13. A method as in claim 11 and wherein said transforming segment includes a gene capable of directing the expression of a protein in the host microorganism.

14. A method as in claim 13 and said microorganism is cotransformed with an inheritabiy unstable plasmid having a selection marker sequence said cotransformants are selected by said marker and the selected cotransformants are cultivated and selected for transformants that have lost the marker-bearing plasmid. vhereby to produce a transformant free of unvanted DNA except for any remaining vector sequences.

15. A method as in claim 13 and wherein said microorganism is S. cererisiae and said segment includes a glucoamylase gene from S. diastaticus.

16. A method as in claim 15 and wherein said microorganism is polypioidic and/or aneuploidic fermentation strain of S. cererisiae.

17. A transformant microorganism prepared by the method of claim 13 and wherein the chromosome thereof is provided with gene regulatory sequences for regulating the expression of said protein.

18. A transformant microorganism prepared by the method of claim 14 and wherein said microorganism is a yeast.

19. A transformant microorganism prepared by the method of claim 15 and wherein the chromosomal site of integration of said gene is in a non-expressing glucoamylase gene thereof.

20. A transformant microorganism prepared by the method of claim 16 and wherein the chromosomal site of integration of said gene is in a non-expressing glucoamylase gene thereof.

21. A method of producing a protein comprising cultivating in a nutrient medium the microorganism of claim 17.

22. A method of preparing a cereal dough for baking which comprises inoculating the dough with the microorganism of claim 19 and maintaining the dough at fermentation conditions.

23. A method of breving which comprises inoculating a vort containing sugars and starch with the microorganism of claim 19 and maintaining the wort at fermentation conditions.

24. A method of preparing an amylolytic fermentation strain of S. cererisiae which comprises

a. preparing a transforming segment having at the ends, respectively, one and the other portions of an amylolytic gene from S. diastaticus cleaved at an intermediate site, each portion being connected in the segment at the opposite ends from the cleavage, said gene having its indigenous promoter replaced by an active promoter section from a gene of S. cererisiae and b. integrating the transforming segment into a polypioidic and/or aneuploidic fermentation strain of S. cererisiae under recombination conditions at a chromosomal site in a non-expressing glucoamylase gene.

25. A transforming segment of DNA for integrating at a chromosomal site of a host microorganism, said segment having as end sections two formerly adjacent portions of a region which is homologous to a target chromosomal site of a host microorganism, which portions have been cleaved from each other and each of which is connected in the segment at the opposite ends from the cleavage, which segment is free of origins of replication of vector DNA.

26. A transforming segment as in claim 25 and wherein said segment is free of resistance marker DNA.

27. A transforming segment as in claim 25 and wherein said segment includes a gene that is capable when integrated at the chromosomal site of directing the expression of a desired protein and wherein said segment is substantially free of vector DNA.

28. A transforming segment as in claim 27 and wherein said end sections comprise an amylolytic gene from S. diastaticus.

29. A transforming segment as in claim 25 and wherein said segment includes a gene that is capable when integrated at the chromosomal site of directing the expression of a desired protein, said gene being located intermediate of and connecting said end sections.

30. A transforming segment as in claim 25 and wherein said segment is located in a plasmid vector with said end portions thereof connected to the plasmid sequences.

31. A cyclic DNA construct useful for creating a transforming segment for integrating at a chromosomal site of a host microorganism by severance within a region of homology therein to said site, said construct comprising sequences desired for integration incuding a region of homology with said chromosomal site, said construct being free of origins of replication of vector DNA.

32. An amylolytic strain of polyploid and/or aneuploidic S. cererisiae fermentation yeast, wherein the chromosome of said yeast comprises at least two genes which are capable of directing the expression of glucoamylase integrated at a non-expressing glucoamylase gene therein, said genes being from S. diastaticus and having the indigenous promoter section thereof replaced by an active promoter of a gene from a species of Saccharomyces.

33. The strain of claim 32 and wherein said replacement promoter is from a gene from S. cererisiae and said chromosome of said yeast is substantially free of vector DNA.

34. An amylolytic strain of S. cererisiae wherein the chromosome of said yeast is substantially free of vector DNA and comprises at least tvo genes which are capable of directing the expression of glucoamylase, said genes being from S. diastaticus.

35. Saccharomyces sp. strain DMR 195 (Accession No. NRRL Y- 18494).

36. In a method for preparing a linear transforming segment having homology with a target chromosomal site of a host microorganism from a segment having a region of homology with a target chromosomal site of a host microorganism, the improvement which comprises the steps of

a. circularizing the segment and

b. amplifying the circularized segment by inverse PCR, utilizing primers which hybridize with sequences located within the region of homology. whereby to form a vector DNA-free, linear transforming segment having a portion of the region of homology at either end thereof, for integration by insertion at the target chromosomal site.

37. A method as in claim 36 and wherein said region of homology comprises sequences which, upon integration, replicate in the host microorganism a gene capable of directing the expression of a protein.

38. A method of transforming a microorganism comprises the steps of

a. selecting a segment having a region of homology with a target chromosomal site of a host microorganism and containing sequences desired for integration at such site

b. circularizing the segment,

c. amplifying the circularized segment by inverse PCR. utilizing primers which hybridize with sequences located within the region of homology to form a vector DNA-free, linear transforming segment having a portion of the region of homology at either end thereof, and

d. integrating the transforming segment into the host microorganism chromosome under recombination conditions to create a vector-free transformant.

39. A method as in claim 38 and wherein said region of homology comprises sequences which upon integration replicate in the host microorganism a gene capable of directing the expression of a protein.