WO1990012097A1 - Recombinant trichosanthin and coding sequence - Google Patents
Recombinant trichosanthin and coding sequence Download PDFInfo
- Publication number
- WO1990012097A1 WO1990012097A1 PCT/US1990/001816 US9001816W WO9012097A1 WO 1990012097 A1 WO1990012097 A1 WO 1990012097A1 US 9001816 W US9001816 W US 9001816W WO 9012097 A1 WO9012097 A1 WO 9012097A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- aat
- gct
- att
- protein
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70514—CD4
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Definitions
- the present invention relates to recombinantly produced trichosanthin and DNA coding sequences therefore.
- Trichosanthin is a plant protein which is obtained from the Trichosanthes kirilowii root tuber.
- the protein which is also known as alpha-trichosan- thin (Law) and Radix trichosanthis (Kuo-Fen), is a basic, single-chain protein having a molecular weight of about 25,000 daltons.
- An incorrect protein sequence of TCS has been reported (Gu; Wang), and a molecular model has been derived from X-ray analysis (Pan).
- TCS is a potent inhibitor of protein snythesis in a cell-free lysate system (Maraganore). This activity is consistent with the observed homology in amino acid seguence between TCS and the A chain of ricin, a ribosome-inactivating protein (RIP) which shows amino acid homology with a number of other RIPs, including abrin A chain (Olnes, 1982, 1987) and modeccin (Olsnes, 1982), and various single-chain ribosome-inactivating proteins, such as pokeweed anti-viral protein (PAP) (Irvin), RIPs from a variety of other plants (Coleman; Grasso; Gasperi- Campani) and the A subunit of Shiga-like toxins from E. Coli (Calderwood).
- PAP pokeweed anti-viral protein
- TCS plant extracts containing TCS
- the drug has been administered by intramuscular, intravenous, or intraamniotic routes, typically at a single dose of between about 5-12 mg.
- the phenomenon of raid-term abortion has been attributed to the selective destruction of placental villi.
- Other studies indicate that the syncytiotrophoblast is preferentially affected (Hsu; Kao) and that secretion of hCG may be impaired (Xiong).
- TCS has also been shown to have a suppressive effect on human choriocarcinoma, and the protein appears to be able to pass the
- TCS has a
- HIV immunodeficiency virus
- momorcharin a basic glycoprotein obtained from the seeds of the bitter melon plant
- TCS HIV-infected human T cells and macrophages
- Methods of preparing TCS from the roots of T. kirilowii have been reported (Yueng).
- Analysis of the purified TCS produced by earlier-disclosed known methods indicates that the protein is only partially purified, and in particular, contains hemagglutinating contaminant protein (s).
- TCS preparation which is substantially free of protein contaminants, including hemagglutinating proteins.
- TCS tissue culture
- Synthesis of the protein by recombinant methods would avoid the difficulty of obtaining T. kirilowii roots in fresh form, since at present the tuber roots are available only from certain regions of the Orient.
- Recombinant production of TCS would also avoid the problem of variations in primary amino acid sequence in TCS obtained from natural root material from different geographic areas.
- TCS Recombinant production of TCS would also facilitate the production of peptide derivatives of TCS, including bioactive peptide portions of TCS, and bioactive portions of the protein fused with functional peptides which confer, for example, enhanced target- cell specificity.
- Still another object of the invention is to provide sets of degenerate primers corresponding to spaced amino acid regions of TCS which are homologous to spaced amino acid regions of RIPs, for use in selectively amplifying plant-derived genomic sequences which code for such RIPs.
- the invention includes a cloned nucleic acid molecule which encodes a trichosanthin protein having the functional properties of
- Trichosanthes-obtained trichosanthin The nucleic acid molecule is included in the sequence: EcoRI
- basepairs 409 to 1149 encode the mature form of TCS isolated from Trichosanthes kirilowii .
- the nucleic acid of the invention may include:
- T. kirilowii (b) in addition to (a), basepairs 340-408, which encodes an amino terminal extension of the mature form of TCS from T. kirilowii;
- the invention also includes the coding sequence for TCS from T. kirilowii in combination with an expression vector.
- One preferred expression vector construction contains a promoter, a ribosome binding site, an ATG start codon positioned adjacent the amino-terminal codon of TCS, and a stop codon positioned adjacent the carboxy terminal codon of mature TCS.
- the invention includes a primer mixture for use in selectively amplifying a genomic fragment coding for first and second spaced regions of TCS from T. kirilowii DNA, by repeated primer-initiated strand extension.
- the primer mixture includes a first set of sense-strand degenerate primers, and a second set of anti-sense primers, where each set contains
- each degenerate primer set includes at least one primer species which is effective to hybridize with the coding sequence of the corresponding amino acid region.
- the primers in the first and second primer sets are designed to hybridize to first and second coding regions, respectively, which encode TCS amino acid sequences that are homologous in amino acid sequences to first and second amino-acid sequences in a variety of RIPs, such as ricin A chain, abrin A chain, pokeweed antiviral protein, and barley ribosome
- the two primer sets may be used to obtain genomic coding sequences for the corresponding RIPs, by repeated primer-initiated strand extension .
- a recombinant trichosanthin protein having the functional properties o f mature trichosanthin (a) derived from T . kirilowii and (b) having the sequence :
- the recombinant TCS protein may further include an amino-terminal extension having the sequence :
- the invention further includes a recombinant process for the production of a trichosanthin protein having the functional properties of Trichosanthes-obtained TCS.
- This recombinant process involves inserting a DNA
- sequence encoding the TCS protein into an expression vector transforming a suitable host with the vector, and isolating the recombinant protein expressed by the vector.
- the invention further comprises nucleic acid and
- Figure.1 shows the amino acid sequence of mature TCS isolated from T. kirilowii as determined herein (upper line) and as reported previously (lower line);
- Figure 2 illustrates the steps in the method used to obtain cloned TCS coding sequences
- Figures 3A and 3B show the DNA sequence from an
- Figure 4 shows the nucleotide sequence of the TCS coding region from T. kirilowii and adjacent 5'- and 3'- end sequences;
- Figure 5 illustrates the steps in the method used to express mature TCS in a bacterial system;
- Figure 6 shows plots of percent inhibition of HIV antigen (p24) production as a function of culture concentration of plant-derived TCS (closed boxes) and rTCS (open boxes);
- Figure 7 shows plots of percent inhibition of 3 H-leucine incorporation into trichloroacetic acid precipitable protein as a function of concentration of plant derived TCS (closed boxes) and rTCS (open boxes) in a cell free rabbit reticulocyte lysate protein synthesizing system.
- Figure 8 illustrates the steps in a method for
- Figure 9 compares the amino acid sequence of TCS with those of exemplary RIPs.
- Figure 10 shows a hydropathy index computation for the entire coding sequence of trichosanthin including: the amino-terminal extension, the sequence encoding the mature protein, and the carboxy-terminal extension.
- FIG. 11 illustrates the synthetic gene designed for expression of TCS.
- the bold restriction sites are those flanking the individual synthetic fragments as
- Figure 12A shows the correct orientation of the
- Figure 13 outlines a generalized schematic diagram of the method used for the condensation of cloned synthetic gene fragments to form a complete synthetic gene.
- Figure 14 shows a schematic of the steps taken to clone and condense the synthetic gene for ⁇ -trichosanthin.
- Figure 15 shows the ability of the ⁇ -trichosanthin protein, synthesized from the synthetic gene, to inhibit in vitro translation reactions, relative to mutant forms of the protein.
- Figure 16 shows the nucleic acid sequence of the cloned insert of pQ30E and corresponding protein coding
- Figure 17 shows the nucleic acid sequence of cloned insert of pQ24 and the corresponding protein coding sequence.
- Figure 18 shows the nucleic acid sequence of cloned insert of pQ2 and the corresponding protein coding sequence.
- Figure 19 shows the nucleic acid sequence of cloned insert of pQ3 and the corresponding protein coding sequence.
- Figure 20 shows the nucleic acid sequence of cloned insert of pQ12 and the corresponding protein coding sequence.
- Figure 21 shows an alignment of protein sequences corresponding to the nucleic acid seguences of cloned inserts of pQ2, pQ3, pQ12, and of pQ21D and pQ30E.
- Figure 22 shows an alignment similar to Figure 21 where the protein coding sequence corresponding to the nucleic acid sequence of cloned insert 2 is used as a standard sequence and amino acid substitutions representing the other protein coding sequences are listed in vertical columns for each amino acid residue -- the hyphens act as space holders to allow easier alignment and an asterick indicates a site where omission of an amino acid is possible.
- trichosanthin protein is a protein having at least about 90% amino acid sequence identity with alpha- trichosanthin obtained from T. kirilowwii.
- a trichosanthin protein has the functional properties of Trichosanthes-obtained trichosanthin if it has (a) the ability to selectively inhibit expression of HIV-antigen in HIV-infected T-cells or monocyte/macrophages, and/or (b) protein-synthesis-inhibitory activity.
- This section describes methods for obtaining a genomic region containing the coding sequence for TCS from T. kirilowii, and for expressing mature TCS protein in a bacterial expression system.
- TCS was purified by a novel method which is detailed in co-owned patent application for "Purified Trichosanthin and Method of Purification", u. S. Application No
- Example 1 07/333,181, filed 4 April 1989, and outlined in Example 1.
- the protein was at least about 98% pure as judged by HPLC and gel electrophoresis analysis.
- the present TCS sequence lacks a block of 10 amino acids at position number 69 and contains an additional sequence of 21 amino acids at position number 222.
- the present sequence agrees closely with X-ray diffraction data on crystalized TCS, and resolves inconsistancies between X- ray diffraction data and the previously published TCS sequence.
- the new sequence particularly including the 21-amino acid addition, also provides greater sequence homology with a number of RIPS, such as ricin A chain and abrin A chain (see below) than the earlier published sequence.
- FIG. 2 outlines the steps described below for obtaining the complete coding sequence of TCS from T.
- genomic DNA isolated from T. kirilowii is mixed with at least two sets of degenerate primers in a reaction mixture designed for carrying out selective amplification of a TCS coding sequence.
- Each set of degenerate primers were designed such that at least one primer sequence is effective to hybridize with the DNA sequence coding for the corresponding amino acid sequence.
- Deoxyinosine nucleotides were
- One of the two primer sets is designed for hybridization with the anti-sense strand of one coding region, and the other primer set, for hybridization with the sense strand of the second coding region.
- the primer set corresponding to the 35-mer includes 128 isomers and is of the general sequence:
- a DNA amplification reaction was carried out by repeated primer initiated strand extension, using a
- Figures 3A and 3B show the DNA sequence of the amplified material, and the amino acid sequences corresponding to all three reading frames in both directions.
- the underlined translation shows a sequence that is homolgous to amino acids 128 through 163 in TCS. This sequence is within the region predicted to be amplified and confirmed that a TCS or TCS-like coding region was amplified.
- FIG. 2 the amplified coding sequence from above was used as a probe to identify one or more T. kirilowii genomic library clones containing TCS coding sequences.
- the genomic library clones were prepared and probed conventionally, as outlined in Example 2. Two clearly positive plaques were picked, amplified and converted to plasmids, according to protocols supplied by the
- pQ21D contained an approximate 4kb insert
- pQ30E contained an approximate 0.6 kb insert.
- the pQ21D vector has been deposited with The American Type Culture Collection, 12301 Parklawn Drive, Rockville, MD, 20852, and is identified by ATCC No.
- Plant-derived TCS except for two conservative changes -- a Thr for a Ser substitution at amino acid position 211 and a Met for a Thr substitution at position 224.
- the purified TCS was obtained from T. kirilowii roots from the Canton region of China; the genomic DNA was obtained from T. kirilowii leaves from Korea.
- Plant-derived TCS (Figure 1) and that encoded by the DNA in Figure 4 shows that TCS is likely produced as a
- nucleotides 340 through 408 code for a putative secretory signal peptide having the sequence:
- these first 23 amino acids of the trichosanthin coding sequence have the characteristic hydrophobicity of a secretory signal.
- the nucleic acids encoding this seguence will be useful when expressing trichosanthin proteins in plants cell since the sequence will provide a homologous secretory signal.
- recombinant trichosanthin proteins produced in heterologous expression. systems, which retain the 5' leader sequence can be used as a substrate in assays to identify the leader sequence processing enzyme activity.
- the 23 amino acid sequence itself can be used as an antigen to generate antibodies to examine, for example, the steps of in vivo protein processing in plant cells.
- Nucleotides 1150 through 1206 code for a putative carboxy terminal extension that is not present in the mature protein, and which has the sequence:
- the carboxy-terminal extension will also be useful for expression of the trichosanthin protein in plant cells. Although the role of the carboxy-terminal extension has not yet been determined, it is possible that this peptide functions to neutralize the ribosome inhibiting activity of the peptide prior to cellular secretion:
- carboxy-terminal seguence itself can be used as an antigen to generate antibodies to examine, for example, the steps of in vivo protein maturation in plant cells.
- the invention includes a nucleic acid which encodes for a trichosanthin protein which has the functional properties of Trichosanthes- obtained TCS.
- the nucleic acid preferably has the sequence shown in Figure 4, where basepairs 409-1149 of the sequence code for mature TCS from T. kirilowii.
- the nucleic acid of the invention may include:
- Recombinant TCS was produced using the above TCS coding sequence, following the steps outlined in Figures 4 and 5, and described in Example 5.
- plasmid pQ21D from above was digested with EcoRI and Ncol, releasing a 1.2 kb fragment insert containing the complete coding sequence for TCS.
- This TCS-coding fragment was cloned into plasmid pKK233-2 which was previously digested with EcoRI and Ncol.
- PQ21D/PKK233-2 was divided into two samples. One sample was digested with EcoRI and Sall, and and the second sample with Sall and Ncol to generate an EcoRI/Sall amino portion fragment and a Sall/Ncol carboxy portion
- the two fragments were cloned into M13 phage vectors for site specific mutagenesis, to place a Ncol site containing an ATG start codon at the amino terminal end of the mature TCS coding sequence, and a double TAA translation stop sequence plus a Hindlll cloning site after the carboxy end of the mature sequence, as
- the pQR19 expression vector is exemplary of a TCS coding sequence operatively placed in an expression vector for TCS expression in a suitable host.
- the expression vector construction contains a promoter, a ribosome binding site, and an ATG start codon positioned before and adjacent the amino terminal codon of mature TCS, and a stop codon positioned after and adjacent at the carboxy terminal codon of mature TCS.
- plasmid pQR19 and similar clones were propagated in an appropriate E. coli host strain that carries a laclq gene for regulation of the synthetic trp-lac promoter.
- the host strain XL-1 Blue (Bullock) was employed. Its relevant genotype is recAl, endAl, gyrA96, thi, hsdR17 (rk-, mk+), supE44, relAl, ⁇ -, lac-[F', proAB, lacIgZ ⁇ M15, Tn10 (tet R )].
- Induction of promoter activity may be achieved by adding 5 mM IPTG (isopropylthiogalactoside). Under culture conditions described in Example 3, cells carrying pQR19 and similar plasmids were induced and, at a selected cell density, the cells were harvested and disrupted by sonication. Aliquots of total cell material, of material pelleted at 15,000 x g for 5 min, and of material
- the pQR19 expression vector which contains the TCS coding seguence, and which expresses rTCS in a suitable bacterial host has been deposited with The American Type Culture Collection and is identified by ATCC No. 67908. Clarified cell extract material was fractionated using the steps described in Example 1, yielding rTCS with a purity, as judged by gel band staining with Coomassie blue on SDS polyacrylamide gels, of greater than 90%.
- the rTCS protein produced is exemplary of an rTCS protein derived from the amino acid sequence shown in Figure 4. More generally, the rTCS protein of the invention ineludes a recombinant protein containing the entire amino acid sequence for mature TCS, as described above, and a recombinant TCS protein containing an amino-terminal extension having the sequence: Met lle Arg Phe Leu Val Leu Ser Leu Leu Ile Leu Thr Leu Phe Leu Thr Thr Pro Ala Val Glu Gly; and/or a carboxy-terminal extension having the sequence:
- the invention thus further includes a recombinant process for the production of a trichosanthin protein having the functional properties of Trichosanthes- obtained trichosanthin.
- the method includes the steps of inserting a DNA seguence encoding said protein into an expression vector, transforming a suitable host with the vector, and isolating the recombinant protein expressed by the vector.
- the expression vector is PQR19 and the host is E. coli.
- TCS obtained from T. kirilowii is a potent and selective inhibitor of HIV antigen expression in HlV-in- fected T cells and monocyte/macrophages.
- the inhibitory effect of rTCS on expression of HIV-specific antigens in HIV-infected T cells can be demonstrated as follows.
- Acutely HIV-infected human T cells were treated with varying concentrations of rTCS. After four days culture, the amount of HIV p24 antigen present in cell free culture supernatants was quantitated using a commercially available antigen capture immunoassay (Coulter).
- Example 4A The viral inhibition studies detailed in Example 4A compared the inhibitory activity of plant-produced TCS with the above rTCS protein.
- Tne plots in Figure 6 show percent inhibition of p24 HIV antigen production as a function of culture concentration of plant derived TCS (closed boxes) and rTCS produced as above (open boxes). As seen, both proteins gave substantially the same level of inhibition at higher protein concentrations, although the plant-derived protein was more effective at the lowest protein concentrations.
- plant- produced TCS is a potent inhibitor of protein synthesis m a cell-free lysate system.
- the protein-synthesis inhibitory properties of both plant-produced TCS and rTC were compared in a rabbit reticulocyte lysate system, as outlined in Example 4B.
- the plots in Figure 7 show percent inhibition of 3 H-leucine incorporation as a function of concentration of plant-derived TCS (closed boxes) and rTCS (open boxes) in the rabbit reticulocyte system.
- the plots show that both plant-produced and recombinant TCS have substantially the same specific protein synthesis inhibitory activity.
- a synthetic gene for ⁇ -TCS has been constructed (Example 6, Figure 14) to facilitate mutational analyses of ⁇ -TCS aimed at elucidating structure-function relationships, and to better understanding the ⁇ -TCS mechanism of action in blocking HIV replication.
- the synthetic gene contains unique restriction sites spaced 20 to 90 bp apart ( Figure 11), thus allowing convenient introduction of mutations by cassette replacement.
- the nucleic acid sequence for the synthetic gene was created by assigning nucleic acid codons corresponding to the primary amino acid sequence of the mature ⁇ -trichosanthin protein sequence.
- the translation product of the synthetic gene corresponds to the mature ⁇ -trichosanthin ( ⁇ -TCS) protein sequence.
- mutant proteins were compared to the unmodified protein made from a synthetic gene (KQS; also expressed in E. coli), for their ability to inhibit in vitro translation (IVT) in a rabbit reticulocyte system and to reduce production of p24 antigen in HIV-1 infected T-cells.
- KQS synthetic gene
- IVTT in vitro translation
- the doubly-modified variant (DK12) was found to be almost 3 logs less active at inhibiting in vitro
- the synthetic gene described above provides a tool to generate variants of the ⁇ -trichosanthin protein. These proteins can be screened, as described above, for less active and more active variants which affect the ribosome inhibitory and/or HIV-I inhibitory activities of the wild-type protein.
- the invention includes TCS fused at its amino or carboxy end with a ligand peptide to form a fused ligand/TCS protein.
- the TCS making up the fused protein is preferably rTCS or bioactive portion thereof, as described above.
- the protein may be advantageously fused with a soluble CD4 peptide, which shows specific binding to the HIV-related gpl20 antigen present on the surface of HIV-infected cells (Till), or with a
- the fused TCS protein may be formed by chemical con- jugation or by recombinant techniques. In the former method, the peptide and TCS are modified by conventional coupling agents for covalent attachment. In one
- rCD4 recombinant CD4
- Duncan N- succinimidyl-S-acetyl thioacetate
- the activated CD4 compound is then reacted with TCS derivatized with N-succinimidyl 3-(2- pyridyldithio) propionate (Cumber), to produce the fused protein joined through a disulfide linkage.
- recombinant TCS may be prepared with a cysteine residue to allow disulfide
- TCS expression vector used for production of rTCS can be modified for insertion of an internal or a terminal cysteine codon according to standard methods of site-directed
- the fused protein is prepared recombinantly using an expression vector in which the coding sequence of the fusion peptide is joined to the TCS coding sequence.
- Figure 8 illustrates the
- an EcoRI-StuI DNA fragment containing the coding region for the first 183 amino acids of mature CD4 peptide, which may effectively bind gp120, (Maddon) is inserted into an M13MP19 phage between Smal and EcoRI sites and the vector, in a single-strand form, is then subjected to primer mutagenesis.
- the amino- terminal portion of the CD4 gene is modified with primer MP101 (5'-CCAGCAGCCATGGAGGGAAACAAAG -3'); and the carboxy portion of the gene is modified with primer MP102 (5'- CATCGTGGTGCTAGCT- CCACCACCACCACCACCACCACCACCACCACCACCACCACCACCACCCATGGAGGCATGCAAGCTTG -3').
- the Ncol fragment from the phage vector is inserted into the pQR19 expression vector from above previously cut with Ncol. Successful recombinants are confirmed by restriction analysis for proper orientation of the CD4 sequence insert.
- An expression vector formed as above, and designated PQR19/CD4 in Figure 8 contains (a) a synthetic trp/lac promoter positioned appropriately ahead of a ribosome binding site that is also positioned appropriately ahead of an ATG start codon contained within an Ncol site, (b) the CD4 coding sequence, (c) a spacer coding sequence coding for 10 proline residues, which spaces the CD4 and TCS protein moieties, (d) the coding sequence for mature TCS and (e) a stop codon positioned adjacent the carboxyterminal codon of mature TCS.
- the method generally follows that used in fusing a soluble CD4 to domains 2 and 3 of pseudomonas exotoxin A, as described previously (Chaudhary).
- Plasmid pQR19/CD4 is analysed for expression of fused TCS protein as above. Briefly, the expression vector is cultured in a suitable bacterial host under IPTG
- the cells are harvested, ruptured by sonication, and the cell material is clarified by centrifugation.
- the clarified material is tested for (a) binding to gp120 antigen, to confirm CD4 ligand binding activity, and (b) for ribosome inhibition activity, to confirm TCS enzymatic activity.
- the protein may be purified by molecular-sieve and ion- exchange chromatography methods, with additional purification by polyacrylamide gel electrophoretic separation and/or HPLC chromatography, if necessary.
- ligand/TCS-containing fusion proteins may be prepared.
- One variation on the above fusion is to exchange
- sequences related to ⁇ -trichosanthin designated pQ21D and pQ30E, have been isolated from the genome of T.
- each insert sequence encodes a prepro protein with a putative signal peptide of 23 amino acids, and a carboxy terminal extension consisting of 1, 10 or 19 amino acids; 2) each insert sequence contains amino acid residues which are characteristic for RIPs; 3) the corresponding proteins possess between 0 and 4 potential N-linked glycosylation sites and have
- the coding sequences of the members of this multi-gene family can be used as probes to identify, for example, additional members of the gene family in Trichosanthes or to identify homologous genes in other plants.
- the proteins corresponding to the multi-gene family coding sequences can be expressed in bacterial expression systems (as described above for ⁇ -trichosanthin), and the proteins used to (1) examine the proteins' ribosome- inactivating and anti-HIV-I properties, and, (2) generate antibodies which can be used to examine expression patterns of the proteins in Trichosanthin tissues.
- Figure 22 is a representation of the ribosome-inactivating protein multi-gene family of Trichosanthes
- sequences can be determined for any protein coding sequence derived from Figure 22 and probes or synthetic genes synthesized for the chosen protein coding sequence as described above in Section II-E for ⁇ -TCS.
- the probe can be used to identify, for example, additional members of the ribosome-inactivating protein gene family in
- the synthetic gene can be used to recombinantly express the chosen protein coding sequence: this protein's ribosome-inactivating and anti-HIV-I properties can then be examined.
- the coding sequence of TCS was obtained by selective amplification of a TCS coding region, using sets of degenerate primers for binding to spaced coding regions of a TCS coding sequence in genomic DNA.
- This section describes the use of such sets of degenerate primers for selective amplification of coding sequences for a variety of RIPs.
- the amino acid sequences of TCS and one or more RIPs are examined for regions of sequence homology, i.e., regions where the amino acids sequences are identical or differ at most by one or two amino acid residues.
- the length of the regions being examined should contain at least about 7 amino acids, i.e., at least about 20 nucleotides, although it is appreciated that longer oligonucleotide primers are preferred, even though overall complexity is increased.
- Figure 9 shows the complete amino acid sequences of TCS (top line), and three RIPs whose sequences have been published.
- the RIPs are ricin A chain (ricA; Lamb), abrin A chain (abrA; Funatsu) and barley protein
- BPSI Asano
- MIRA Mirabillis antiviral protein
- the abrin sequence in the same 63-70 amino acid region differs from the corresponding TCS by an alanine-to- glycine substitution in the first position. Since a
- the primers can be made an additional two-fold degenerate at this position to encompass both TCS and abrin coding sequences.
- the abrin sequence also differs from the TCS sequence by a valine-to-alanine substitution in the seventh position.
- An additional two-fold degeneracy at this position can be made that accounts for all possible valine and alanine codons, i.e., G(C,T)N.
- the abrin sequence in this region differs from the corresponding ricin A chain sequence by the same alanine-to-glycine substitution in the first amino acid position. Additionally, the abrin sequence differs from the ricin sequence by an isoleucine-to-leucine substitution in the second position. Since an ITI sequence will hybridize with all the isoleucine and leucine codons, the primer degeneracy can be normalized at this position. The other five amino acid positions are preferably made degenerate, to optimize the
- the total number of primers in the final primer set is preferably between about 16-128 although more complex mixtures can be used.
- the primers are synthesized conventionally using commercially available instruments.
- a second set of degenerate primers from another region of TCS which is homologous in amino acid sequence to RIPs is similarly constructed.
- the two primer sets are useful in a method for selectively amplifying RIP coding sequences present in genomic DNA from selected plant sources, employing repeated primer-initated nucleic acid amplification.
- genomic DNA from Abrus precatorius is isolated, and mixed with the primer sets, all four deoxynucleosides triphosphates, and polymerase, as outlined in Example 2. After repeated cycles of primer binding and strand extension, the material is fractionated by gel
- electrophoresis and amplified fragments are identified, for example, by ethidium bromide staining or by
- the amplified material is then used as a (radiolabeled) probe for detecting genomic library clones prepared from genomic DNA from the plant source, e.g., Abrus precatorius.
- the identified library clones are analysed, as above, for fragments containing a complete RIP coding sequence.
- overlapping genomic library fragments containing amino and carboxy portions of the coding sequence can be combined to produce a complete coding seguence.
- the properties of the coding sequence are then tested as outlined above to determine ribosome-inhibitor properties and/or anti-viral properties. Further, these nucleic acid coding sequences can be used as probes to identify additional RIP sequences.
- this aspect of the invention includes a primer mixture and method of using the mixture for selectively amplifying RIP coding sequences.
- the primer mixture includes a first set of sense-strand degenerate primers, and a second set of anti-sense primers, where each set contains at least one primer sequence which is effective to hybridize with the corresponding coding sequence in TCS which encodes the region of amino acid homology with RIPs, particularly RIPs from dicotyledon plants.
- the sequence can be used as a probe for isolating genomic library fragments containing the desired RIP coding sequence.
- the protein products expressed from these genomic fragments can then be tested for their ribosome-inhibitory activity and/or anti-viral activities as described above for TCS.
- the method can be used to obtain the coding sequence from plants which produce known RIPs, and also to screen other plants for the presence of genes encoding as-yet-unknown RIP or RIP-like proteins.
- the following examples illustrate various methods used to obtain and verify the nature of the coding seguence and recombinant proteins described above. The examples are intended to illustrate, but in no way to limit, the scope of the invention.
- T. kirilowii root tubers were obtained from the Canton region of the People's Republic of China. Leaves of T. kirilowii were obtained from Korea and were collected and immediately frozen on dry ice for shipment. Samples were than stored at -70°C.
- QAE ZetaprepTM anion exchange cartridges and SP ZetaprepTM cation exchange cartridges were supplied by AMF Cuno Corp. (Meridan, CT); and Pellicon ultrafiltration membranes (10,000 MW cutoff), from Millipore Corp.
- M13/MP18 and M13/MP19 were obtained from New England Biolabs (Beverly, MA).
- Lambda-Zap IITM cloning vector system was supplied by Stratagene (La Jolla, CA).
- Restriction enzymes were obtained from New England Biolabs (Beverly, MA) or Promega (Madison, WI).
- DNA primer-initiated amplification reagents were obtained from Perkin-Elmer/Cetus (Norwalk, CT).
- Synthetic oligonucleotide primers were prepared by conventional, automated phosphoramidite methods using either a Biosearch Cyclone or an Applied Biosystems Model 380B instrument.
- TCS The purification of TCS has been described in co-owned, co-pending U. S. Application No. 07/333,181.
- the extract was clarified by centrifugation, and the clarified material was passed through a QAE
- the ion exchange step was carried out at low ionic strength, i.e., low
- the low-conductivity buffer was 20 mM phosphate, pH 8.0.
- the flowthrough from the anion exchange resin was adjusted in pH and ionic strength, and preferably
- the concentration step was carried out by ultrafiltration using a 10,000 molecular weight filtration membrane, yielding a solution which is largely free of low- molecular weight contaminants.
- TCS was now eluted from the column in highly purified form by elution with 50 mM phosphate buffer, pH 6.0 containing 60 mM NaCl, to release bound TCS from the resin.
- The. purified TCS protein was at least about 98% pure, as evidenced by HPLC profile and staining patterns on SDS gel electrophoresis.
- cetyltrimethyl-ammonium bromide 100 mM Tris-Cl, pH 8.0, 20 mM EDTA, 1.4 M NaCl).
- the upper aqueous phase was removed to another container and the DNA precipitated by adding an equal volume of precipitation buffer (1% CTAB, 50 mM Tris-Cl, pH 8.0, 10 mM EDTA) to lower the sodium concentration to 0.35 M.
- the DNA was collected and washed with cold 70% ethanol, 0.1 M sodium acetate to convert the DNA to a sodium salt, followed by a wash by 95% cold ethanol.
- the DNA could then be dried and redissolved in 10 mM Tris-Cl, pH 7.5, ImM EDTA. To further eliminate contaminants, the DNA was re-precipitated from CTAB by adding an equal volume
- the first DNA sequence is a 35-mer and encompasses the protein sequence overlined and denoted A in Figure 1
- the second sequence is a 32-mer and encompasses the protein sequence overlined and denoted B in the figure.
- the probe sets were prepared by conventional automated methods using instruments commercially available and following the manufacturers' instructions. (Biosearch, San Rafael, CA, and Applied Biosystems, Foster City, CA). Deoxyinosine nucleotides were incorporated in order to generate probes longer than 20 nucleotides of manageable complexity (Ohtsuka; Takahashi).
- the sense-strand probe set corresponding to the 35-mer designated MPQP-1, included 128 isomers.
- a DNA amplification reaction was carried out by repeated primer initiated strand extension, in a reaction mixture containing (a) 1-2 micrograms of the T. kirilowii DNA isolated as above, (b) 32 P-labeled MPQP-1 and an equimolar mix of unlabeled MPQP-2 and -3, as primers, (c) all four deoxynucleoside triphosphates, and (d) Tag
- the product of the DNA amplification step was fractionated on 3% Nusieve, 1% ME agarose (SeakemTM, FMC
- Amplified DNA was recovered from polyacrylamide gels by elution followed by ethanol precipitation. A portion of one such preparation, approximately 100 nanograms, was taken for DNA sequence analysis.
- the DNA sample plus 30 ng of unlabeled MPQP-1 were taken up in 10 ⁇ l of TE (10mM Tris-HCl, pH 7.5, ImM EDTA) and heated to 100°C for 5 minutes to denature the double-stranded fragment. The mixture was quick-frozen on dry ice to prevent the template from annealing. Two ⁇ l of 5X Sequenase
- Genomic DNA obtained as above was digested to completion with EcoRI and cloned into a standard library cloning vector, in this case, the Lambda-Zap IITM system of Stratagene (La Jolla, CA).
- a standard library cloning vector in this case, the Lambda-Zap IITM system of Stratagene (La Jolla, CA).
- the amplified 255-bp fragment from above was radiolabeled by random priming (Boehringer-Mannheim kit, Indianapolis, IN).
- plaques were probed with the 32 P-radiolabeled 255-b ⁇ probe. Two clearly positive plaques were picked, amplified and converted to plasmid, according to protocols supplied by stratagene.
- One clone, designated pQ21D contained an approximate 4kb insert which included the complete TCS coding sequence; the other, designated pQ30E, contained an approximate 0.6 kb insert.
- the region of pQ21D containing the TCS coding region was sequenced by standard double-strand sequence methods, using universal sequence primers as well as unique synthetic oligonucleotide primers as needed.
- a smaller subclone containing only the TCS coding region was generated by subcloning the 1.2 kb EcoRI to Ncol fragment ( Figure 4) from pQD21D into pKK233-2.
- the resulting recombinant plasmid was designated pQD12D/pKK233-2.
- the pQ21D/pKK233-2 cloning vector from Example 2 was divided into two samples. One sample was digested with EcoRI and Sall, to release an EcoRI to Sall fragment containing the amino portion of the TCS gene. A second portion of the DNA was digested, first with Ncol, and treated with Klenow to generate a blunt end. The DNA was then digested with Sall to release a Sall to Ncol (blunt) fragment containing the carboxy portion of the gene.
- the phage single-strand DNA's were subjected to primer mutagenesis using standard methods.
- the amino portion of the gene (in the M13MP19 vector) was modified with primer QNcoN (5'- CCTGCTGTGGCCATGGATGTTAGC -3'); and the carboxy portion of the gene was modified with primer QTerl (5'- CGAAACAATATGGCATAATAAAGCTTCCGAGCTCG -3').
- pKK233-2 is a plasmid containing a synthetic trp/lac promoter
- pQR19 The plasmid pQR19 and similar clones were propagated in the E. coli host strain, XL1-blue. The significant feature of the strain is that it carries the lacI 9 repressor gene on a F' episome (discussed above). Laclq protein controls expression from the lac operator and is blocked from repression by the addition of IPTG to 5mM.
- Plasmid pQR19 and another isolate were analyzed for expression of TCS. Cultures were first grown in Luria broth medium supplemented with 100 ⁇ g/ml ampicillin, to select for maintenance of the plasmid, to an A 600 of 0.7 measured at soo nm before adding IPTG, then allowed to grow for 4 hours. These conditions did not result in high levels of expression.
- the insoluble, pelleted material was resuspended in sonication buffer to the same volume as the original aliquot. Samples of each fraction were run on 10% SDS-PAGE One set of samples was stained for total protein with Coomassie Blue; another set of samples was blotted for Western analysis, with the results discussed in Section II.
- rTCS ability of rTCS to mediate selective inhibition of HIV replication in infected T-cells was evaluated in parallel with purified plant-derived material.
- Cells of the CD4+ T-cell line VB (Lifson, 1986) were inoculated with HIV-1 by incubation at 37°C for one hour with an aliquot of a titered cryopreserved HIV-1 virus stock (virus isolate HIV-1 DV (Crowe, 1987)). After washing, the cells were resuspended to 1.11 x 10 5 per ml, and 0.9 ml of this suspension plated in replicate wells of 24 well culture plates.
- the SOAP program from IntelliGenetics PC/GENETM software package was used to generate the hydropathicity plot of Figure 10.
- the SOAP program uses the method of Kyte et al. to plot the hydropathicity of the protein along its sequence. The interval used for the computation was 11 amino acids.
- the hydrophobic side of the plot corresponds to the positive values range and the hydrophilic side to the negative values range.
- the first 23 amino acids of the trichosanthin sequence are as follows:
- this sequence has a high degree of hydrophobicity.
- the length of the sequence and the degree of hydrophobicity make the above sequence an ideal candidate for a secretory signal sequence.
- the protein obtained from the above described alpha- trichosanthin encoding nucleic acid sequence isolated from the genome of T. kirilowii contained two
- This example describes the construction of a nucleic acid coding sequence for a synthetic gene alpha-trichosanthin gene based on codons selected to represent the primary amino acid sequence of the alpha-trichosanthin protein isolated from plant material. The example further describes the creation of mutant alleles of the gene encoding ⁇ -trichosanthin.
- BluescriptTM was purchased from Stratagene (La Jolla, CA); pACYC184 (ATCC no. 37033) was obtained from the American Type Culture Collection, Rockville, Maryland. The expression plasmid, pKK233-2, was obtained from
- the Escherichia coli strains used for transformation include DH5 (F-, recA1, endA1, hsdR17 (r k m k + ) , su ⁇ E44, ⁇ -, thi-1, gyrA, re1A1) , from BRL (Gaithersburg, MD) and XL1-Blue (recA1, endA1, gyrA96, thi, hsdR17 (r k m k + ) , supE44, re1A1, ⁇ -, lac- , (F', proAB, lacI q Z ⁇ M15, Tn10 (tet r ) ) from Stratagene.
- JM105 ⁇ thi, rpsL, endA, sbcB15, hsdR4, ⁇ (lac-proAB), (F', traD36, proAB, lacI q Z ⁇ M15)) was used for expression of the
- LB medium Maniatis et al.
- M9 medium Maniatis et al.
- M9 medium Maniatis et al.
- supplements of glucose or glycerol 0.6% thiamine (2 ⁇ g/ml)
- casamino acids CAA
- IPTG 5 mM
- Restriction endonucleases were purchased from either Bethesda Research Laboratories (Gaithersburg, MD) or Promega Biotec (Madison, WI); the enzymes were used according to the manufacturers' recommendations.
- T4 DNA ligase was purchased from International Biotechnologies, Inc. (IBI, New Haven, CT).
- An 80 base pair (bp) polylinker was constructed which contained the restriction sites Kpnl, Hindlll, Nsil,
- a chloramphenicol-resistant (Cm R ) vector, pPS200 was constructed from ligation of the synthetic polylinker to a 1900 bp Bani-Xbal fragment of pACYC184 containing the chloramphenicol acetyltransferase gene.
- An ampicillin- resistant (Ap) vector, pPS300 was constructed by
- manipulations are a pBluescriptTM vector carrying the synthetic polylinker (pPS300) and a Cm R plasmid carrying the pBluescriptTM polylinker.
- Synthetic gene fragments corresponding to the sequences shown in Figure 11 were synthesized on an ABI 380B DNA synthesizer using cyanoethyl phosphoramidite chemistry and were purified tritylated on a PRP-3 column purchased from Hamilton Company.
- Complementary synthetic oligonucleotides were mixed at 10 picomoles per ⁇ l in 10mM Tris, pH 8; 10 mM MgCl 2 ; 10 mM NaCl. These mixtures were heated to 100°C for 1 minute, and then allowed to cool slowly to room
- Plasmids containing candidate inserts were checked further for mutations or deletions by nucleic acid sequencing of the insert DNA.
- plasmid/fragment combinations were chosen such that oligonucleotide fragments which should be adjacent each other in the synthetic gene could be combined by ligation into a hybrid plasmid which could be selected by
- Figure 13 shows a generalized schematic diagram for condensation of cloned gene fragments.
- the numbers at the ends of synthetic fragments correspond to restriction enzyme sites.
- the figure illustrates the joining of fragment 3-4 to fragment 4-5 using the above described plasmids and cutting at site 4 in each plasmid. These single cut plasmids are then ligated and a plasmid having the two sequences joined in the correct orientation is selected. This plasmid is then, cleaved at a restriction site which will generate a plasmid, carrying the joined fragments, which has the desired drug resistance marker (either Cm r or A ⁇ r ). The restriction enzyme digest is diluted and the fragments self-ligated to generate the desired plasmid.
- the desired drug resistance marker either Cm r or A ⁇ r
- each clone was cut with a restriction enzyme which had a cleavage site common to an end of each synthetic
- Plasmids were isolated from several candidates which were both chloramphenicol (Cm R ) and ampicillin (Ap R ) resistant. These plasmids were analyzed using restriction enzyme digestion to determine the orientation of the two synthetic fragments relative to each other. Plasmids having the correct fragment orientations (in which the two gene fragments were joined together) were identified.
- fragments was selected on the basis of its drug resistance.
- the choice of whether to segregate the linked fragments into a Cm R or Ap R plasmid depended on the nature of the selection marker in the plasmid with which it was to be next combined. For example, if two
- fragments are linked and propagated in a Cm R plasmid they are joined in the next round of combining with two fragments which were linked and propagated in an Ap R plasmid.
- the trichosanthin gene was readily condensed step-wise from eight clones down to one clone.
- Figure 14 shows a schematic of the steps taken to clone and condense the synthetic gene for ⁇ -TCS.
- a linear depiction of the synthetic gene and the restriction sites flanking the individual fragments is shown at the top center. These flanking restriction sites, shown in
- Figure 14 correspond to the restriction sites shown in bold print in Figure 11. Throughout the remainder of the Figure the relevant restriction sites are also referred to in one letter abbreviation where appropriate and convenient. Also shown are unique restriction sites
- pPS200 Cm R
- pPS300 Ap R
- Figure 14 shows a flow chart that depicts the cloning of the individual synthetic fragments into either pPS200 or pPS300 followed by the ligation of two subclones into a single plasmid in which the two gene pieces are properly joined.
- examples of the two alternative orientations in which the subclones could be ligated are shown along with the selection of the correct orientation for further ligation reactions.
- the self ligations to eliminate one vector component from the doubly-resistant plasmids, leaving the fused gene sequences as part of the second component are not shown.
- the final gene fusion is shown as being placed in pPS200 (Cm R ) although it was also placed in pPS300 (Ap R ) using alternative restriction digestion and ligation to eliminate the pPS200 component (v) Expression of synthetic trichosanthin in E. coli
- the coding region of the gene was cloned into the expression vector pKK233-2 to give a construct similar to that described previously for the genomic clone.
- An Ncol to SacI (Klenow repaired to blunt) gene fragment from the pPS200 subclone was placed into pKK233 2 from Ncol to Hindlll (Klenow repaired to blunt) employing the two plasmid cloning approach described above.
- pKQS The resulting plasmid, designated pKQS, was initially transformed into the E. coli strain XL-1 Blue, described above. It was also transformed into another strain, JM105, which also carries lad q for the regulation of the promoter in pKK233-2 from which the synthetic TCS coding sequences were expressed. The latter transformants exhibited better growth characteristics than the XL-1 Blue
- pKQS/JM105 transformant were grown in M9 medium (Maniatis et al.) supplemented with 0.2% glucose, (0.2%) thiamine (2 ⁇ g/ml), casamino acids (CAA) (0.3%), IPTG (5 mM) , and ampicillin
- trichosanthin coding sequence were constructed in vitro. First, a double mutant was made which changed the
- Plasmids containing the mutant coding sequences were screened for the presence, orientation, and number of mutant fragment inserts.
- a clone which contained the correct mutations, DK12, was expressed as described above for pKQS.
- insoluble materials and unbroken cells were then removed by centrifugation at 10,000 X g for 10 minutes.
- the supernatant was diluted with three volumes of water, and the conductivity was measured to ensure that it was less than 2 mmho..
- the pH of the sample was readjusted to 8.5 with dilute NaOH, and the solution was recentrifuged at 10,000 x g to remove any insoluble proteins, cell debris, and additional bacteria.
- a column consisting of A50 QAE Sephadex ion exchange resin (Pharmacia) was activated with 0.1 N HCl followed by 1 M NaCl, and was washed extensively with 10 mM Tris HCl, pH 8.5, to equilibrate.
- the diluted sample was loaded onto the column at a rate of 2-3 ml per minute and the flow-through material was collected.
- the pH of the flow-through was then adjusted to 6.0 with dilute HCl, and the solution was centrifuged at 10,000 x g to pellet any insoluble proteins.
- This flow-through material was then loaded onto a C25 or C50 SP Sephadex column which had been activated with 0.1 N NaOH and 1 M NaCl, and equilibrated with 20 mM phosphate buffer at pH 6.0.
- the mutant trichosanthin protein was eluted with 20 mM phosphate buffer containing 200 mM NaCl, or with standard phosphate buffered saline (Gibco) (140 mM NaCl). Eluted samples were sterilized by filtration through a 0.45 ⁇ low-protein-binding filter (Millex HV, Millipore,
- a second genomic DNA library was generated in the lambda ZAPII vector system (Stratagene) as a Spel
- genomic DNA was prepared as described above in Example 2. Spel digested genomic DNA from T. kirilowii was ligated to commercially available arms of lambda ZAPII (Stratagene, La Jolla, CA). This ligated mixture was packaged using Gigapack goldTM (mcr-;
- NM554 mcr-; available from Stratagene
- the entire packaging reaction was plated.
- DNA was transferred directly to nitrocellulose filters for probing; the bank was not amplified prior to filter lifts to avoid alterin the representation of phage clones resulting from non- uniform plaque growth.
- the genomic DNA bank size was about 1.5 x 10 6 .
- the nitrocellulose filters were probed with the EcoRI-EcoRI insert of pQ30E (ie. sequence shown in Figure 16) which was radiolabelled by random-priming (Boehringer Mannheim). The filters were washed using 2 x SSC at 50°C (i.e., under low stringency conditions).
- Preliminary double-stranded nucleic acid sequencing reactions were performed on the inserts of representative plasmids from each of the 11 groups, using the following primers: #477 - CGATACATCCTATTTTTTCAACG, derived from the insert of pQ21D;
- Figure 16 illustrates the translation product encoded by the insert of pQ30E.
- Figures 17 to 20 illustrate the translation products encoded by the sequences that are the putative pre-pro-proteins homologous to alpha- trichosanthin. The amino acids are numbered below the protein sequence for convenience. The putative secretory signal peptides are indicated by negative numbers (see below). The secreted pro-proteins are labeled with positive numbers.
- An alignment of the protein sequences corresponding to the nucleic acid sequences of inserts 2, 3, 12, and of 21D (alpha-trichosanthin) and 30 (the sequence of the partial clone referred to in Example 2) is presented in Figure 21.
- the proteins have been placed into 3 major groups based on their homologies: 21 / 12; 2 / 30; and 3. With reference to Figure 21: (1) the amino acid residues which differ within a subgroup are shaded; and (2) the putative secretory signal peptide sequences and putative carboxy terminal extension peptides are
- Figure 22 also illustrates a comparison of the proteins encoded by the above-described RIP gene family of T .
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Biotechnology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Immunology (AREA)
- Botany (AREA)
- Oncology (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- General Chemical & Material Sciences (AREA)
- Toxicology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Plant Pathology (AREA)
- Communicable Diseases (AREA)
- Microbiology (AREA)
- Virology (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Saccharide Compounds (AREA)
Abstract
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1019910701253A KR920701438A (en) | 1989-04-04 | 1990-04-04 | Recombinant Tricosanthin and Coding Sequence |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US33318489A | 1989-04-04 | 1989-04-04 | |
US333,184 | 1989-04-04 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1990012097A1 true WO1990012097A1 (en) | 1990-10-18 |
Family
ID=23301693
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1990/001816 WO1990012097A1 (en) | 1989-04-04 | 1990-04-04 | Recombinant trichosanthin and coding sequence |
Country Status (6)
Country | Link |
---|---|
EP (1) | EP0466817A1 (en) |
JP (1) | JPH04504208A (en) |
KR (1) | KR920701438A (en) |
AU (1) | AU641388B2 (en) |
CA (1) | CA2050593A1 (en) |
WO (1) | WO1990012097A1 (en) |
Cited By (10)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0492536A2 (en) * | 1990-12-20 | 1992-07-01 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Method for the production of pathogen resistant plants |
WO1992011372A1 (en) * | 1990-12-20 | 1992-07-09 | Imperial Chemical Industries Plc | Plant dna |
WO1993018149A1 (en) * | 1992-03-03 | 1993-09-16 | Pioneer Hi-Bred International, Inc. | Self-incompatibility alleles of brassica |
EP0580782A1 (en) * | 1991-04-15 | 1994-02-02 | Univ New York | An anti-hiv protein, tap 29, from trichosanthes, dna coding therefor and therapeutic uses thereof. |
WO1994009139A1 (en) * | 1992-10-08 | 1994-04-28 | University Of Guelph | S-locus receptor kinase gene in a self-incompatible brassica napus line |
WO1996030518A1 (en) * | 1995-03-31 | 1996-10-03 | John Innes Centre Innovations Limited | Plant pathogen resistance genes and uses thereof |
EP0759068A1 (en) * | 1994-04-13 | 1997-02-26 | The General Hospital Corporation | $i(RPS2) GENE AND USES THEREOF |
US6287865B1 (en) | 1995-03-31 | 2001-09-11 | Plant Bioscience Limited | Cf-2 plant pathogen resistance genes |
WO2006026906A1 (en) * | 2004-09-09 | 2006-03-16 | Peking University | Trichosanthin mutant and gene coding for the same |
CN110029115A (en) * | 2019-04-19 | 2019-07-19 | 河南牧业经济学院 | The fusion of encoding TCS albumen, its expression albumen and its application |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5701392A (en) * | 1990-02-23 | 1997-12-23 | Universite De Sherbrooke | Depth-first algebraic-codebook search for fast coding of speech |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1988009123A1 (en) * | 1987-05-29 | 1988-12-01 | Genelabs Incorporated | Method of selectively inhibiting hiv |
-
1990
- 1990-04-04 JP JP2506170A patent/JPH04504208A/en active Pending
- 1990-04-04 KR KR1019910701253A patent/KR920701438A/en not_active Application Discontinuation
- 1990-04-04 CA CA002050593A patent/CA2050593A1/en not_active Abandoned
- 1990-04-04 AU AU54214/90A patent/AU641388B2/en not_active Ceased
- 1990-04-04 EP EP90906567A patent/EP0466817A1/en active Pending
- 1990-04-04 WO PCT/US1990/001816 patent/WO1990012097A1/en not_active Application Discontinuation
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1988009123A1 (en) * | 1987-05-29 | 1988-12-01 | Genelabs Incorporated | Method of selectively inhibiting hiv |
Non-Patent Citations (8)
Title |
---|
CHEMICAL ABSTRACTS, Vol. 108, 1988, (Columbus, Ohio, US), Q. WANG et al.: "Trichosanthin has Potent Inhibiting Activity of Protein Synthesis in a Cell-Free System and its Antibody-Conjugate Exhibits Potentiated Cytotoxicity to Tumor Cells in Vitro", see page 232* Abstract 199982y, & Shiyan Shengwu Xuebao 1987, 20(4), 515-19* * |
Nature, Vol. 335, No. 6188, 22 September 1988, (London, GB), V.K. CHAUDHARY et al.: "Selective Killing of HIV-Infected Cells by Recombinant Human CD4-Pseudomonas Exotoxin Hybrid Protein", pages 369-372 * |
Proc, Natl. Acad. Sci. USA, Vol. 85, October 1988, U.B. GYLLENSTEN et al.: "Generation of Single-Stranded DNA by the Polymerase Chain Reaction and its Application to Direct Sequencing of the HLA-DQA Locus", pages 7652-7656 * |
Proteins: Struct. Funct. Genet., Vol. 3, No. 1, 1988, Alan R. Liss, Inc., M.P. READY et al.: "Ribosome-Inhibiting Proteins, Retroviral Reverse Transcriptases, and RNase H Share Common Structural Elements", pages 53-59 * |
Pure & Appl. Chem., Vol. 58, No. 5, 1986, IUPAC, (GB), Y. WANG et al.: "Scientific Evaluation of Tian Hua Fen (THF)- History, Chemistry and Application", pages 789-798 * |
Science, Vol. 239, 11 March 1988, CHENG CHI LEE et al.: "Generation of cDNA Probes Directed by Amino Aid Sequence: Cloning of Urate Oxidase", pages 1288-1291 * |
Science, Vol. 242, November 1988, M.A. TILL et al.: "HIV-Infected Cells are Killed by rCD4-Ricin a Chain", pages 1166-1168, * |
The Journal of Biological Chemistry, Vol. 265, No. 15, 25 May 1990, The American Society for Biochemistry and Molcular Biology, Inc., (US), T.P. CHOW et al.: "Isolation and DNA Sequence of a Gene Encoding alpha-Trichosanthin, a Type I Ribosome-Inactivating Protein", pages 8670-8674 * |
Cited By (25)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5633442A (en) * | 1990-12-20 | 1997-05-27 | Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. | Method of producing pathogen-resistant plants |
WO1992011372A1 (en) * | 1990-12-20 | 1992-07-09 | Imperial Chemical Industries Plc | Plant dna |
WO1992011371A1 (en) * | 1990-12-20 | 1992-07-09 | Imperial Chemical Industries Plc | Dna, dna constructs, cells and plants derived therefrom |
EP0492536A3 (en) * | 1990-12-20 | 1992-08-05 | Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. | Method for the production of pathogen resistant plants |
EP0492536A2 (en) * | 1990-12-20 | 1992-07-01 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Method for the production of pathogen resistant plants |
US5484906A (en) * | 1990-12-20 | 1996-01-16 | Zeneca Limited | DNA clone encoding an ethylene-forming enzyme, constructs, plant cells and plants based thereon |
US6271442B1 (en) | 1990-12-20 | 2001-08-07 | Max-Planck-Gesellschaft Zur Forderung Der Wissenschafen E.V. | Method of producing pathogen-resistant plants |
EP0896059A3 (en) * | 1990-12-20 | 1999-07-07 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Method for the production of pathogen resistant plants |
EP0896059A2 (en) * | 1990-12-20 | 1999-02-10 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Method for the production of pathogen resistant plants |
EP0580782A1 (en) * | 1991-04-15 | 1994-02-02 | Univ New York | An anti-hiv protein, tap 29, from trichosanthes, dna coding therefor and therapeutic uses thereof. |
EP0580782A4 (en) * | 1991-04-15 | 1995-04-26 | Univ New York | An anti-hiv protein, tap 29, from trichosanthes, dna coding therefor and therapeutic uses thereof. |
WO1993018149A1 (en) * | 1992-03-03 | 1993-09-16 | Pioneer Hi-Bred International, Inc. | Self-incompatibility alleles of brassica |
WO1994009139A1 (en) * | 1992-10-08 | 1994-04-28 | University Of Guelph | S-locus receptor kinase gene in a self-incompatible brassica napus line |
EP0763058A4 (en) * | 1994-04-13 | 1998-07-08 | Gen Hospital Corp | -i(RPS) GENE FAMILY, PRIMERS, PROBES, AND DETECTION METHODS |
EP0759068A4 (en) * | 1994-04-13 | 1998-07-15 | Gen Hospital Corp | -i(RPS2) GENE AND USES THEREOF |
EP0763058A1 (en) * | 1994-04-13 | 1997-03-19 | The General Hospital Corporation | $i(RPS) GENE FAMILY, PRIMERS, PROBES, AND DETECTION METHODS |
EP0759068A1 (en) * | 1994-04-13 | 1997-02-26 | The General Hospital Corporation | $i(RPS2) GENE AND USES THEREOF |
US6127607A (en) * | 1994-04-13 | 2000-10-03 | The General Hospital Corporation | Plant resistance gene family encoding resistance polypeptides having P-loop and LRR motifs |
US6262248B1 (en) | 1994-04-13 | 2001-07-17 | Massachusetts General Hospital Corporation | RPS gene family, primers, probes, and detection methods |
US7179601B2 (en) | 1994-04-13 | 2007-02-20 | Ausubel Frederick M | Methods of identifying plant disease-resistance genes |
WO1996030518A1 (en) * | 1995-03-31 | 1996-10-03 | John Innes Centre Innovations Limited | Plant pathogen resistance genes and uses thereof |
US6287865B1 (en) | 1995-03-31 | 2001-09-11 | Plant Bioscience Limited | Cf-2 plant pathogen resistance genes |
WO2006026906A1 (en) * | 2004-09-09 | 2006-03-16 | Peking University | Trichosanthin mutant and gene coding for the same |
US7763581B2 (en) | 2004-09-09 | 2010-07-27 | Chengcai An | Mutants of trichosanthin with anti-tumor activity and lowered side-effects |
CN110029115A (en) * | 2019-04-19 | 2019-07-19 | 河南牧业经济学院 | The fusion of encoding TCS albumen, its expression albumen and its application |
Also Published As
Publication number | Publication date |
---|---|
KR920701438A (en) | 1992-08-11 |
AU5421490A (en) | 1990-11-05 |
EP0466817A1 (en) | 1992-01-22 |
AU641388B2 (en) | 1993-09-23 |
CA2050593A1 (en) | 1990-10-05 |
JPH04504208A (en) | 1992-07-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Lin et al. | DNA sequence analysis of a complementary DNA for cold-regulated Arabidopsis gene cor15 and characterization of the COR 15 polypeptide | |
US5128460A (en) | Recombinant trichosanthin and coding sequence | |
EP0706566B1 (en) | Conotoxins having acetylcholine receptor binding properties | |
AU641388B2 (en) | Recombinant trichosanthin and coding sequence | |
Kooman-Gersmann et al. | Assignment of amino acid residues of the AVR9 peptide of Cladosporium fulvum that determine elicitor activity | |
JPH10509415A (en) | Conotoxin peptide | |
IL103452A (en) | Isolated peptide of a dermatophagoides protein allergen comprising at least one t-cell epitope of the protein allergen | |
Shaw et al. | Cloning of trichosanthin cDNA and its expression in Escherichia coli | |
US5101025A (en) | Recombinant trichosanthin and coding sequence | |
CA2044201A1 (en) | Inactive precursor forms of ribosome inactivating proteins, a process for making and a method of using | |
CA2294568A1 (en) | Lyme disease vaccines | |
AU657917B2 (en) | Allergens of alder pollen and applications thereof | |
OA10177A (en) | Brazzein sweetener | |
AU659609B2 (en) | Birch pollen allergen P14 for diagnosis and therapy of allergic diseases | |
US5166056A (en) | Recombinant trichosanthin and coding sequence | |
EP0909322B1 (en) | Antiviral ricin-like proteins | |
US20020076693A1 (en) | Novel cell surface receptor for HIV retroviruses, therapeutic and diagnostic uses | |
Dore et al. | Mutations dissociating the inhibitory activity of the pokeweed antiviral portein on eukaryote translation and Escherichia coli growth | |
Sisk et al. | Deletion of hydrophobic domains of viral glycoproteins increases the level of their production in Escherichia coli | |
DK172400B1 (en) | Process for preparing purified minactivin, a minactivin- encoding DNA molecule, a recombinant DNA molecule, a fused gene, a host, a reagent for locating and defining the limits of tumours in histological samples, and the use of recombinaint DNA molecule and the minactivin and peptides thereof | |
Copie et al. | Recombinant trichosanthin and coding sequence | |
JPH07501529A (en) | Novel thrombin inhibitory protein from land leech | |
EP0889899A1 (en) | Mycoplasma arthritidis superantigen | |
US5510256A (en) | Eliminating internal initiation of soluble CD4 gene | |
WO2000017351A1 (en) | New human hepatoma-derived growth factor encoding sequence and polypeptide encoded by such dna sequence and producing method thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AU CA JP KR |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE BF BJ CF CG CH CM DE DK ES FR GA GB IT LU ML MR NL SE SN TD TG |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1990906567 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2050593 Country of ref document: CA |
|
WWP | Wipo information: published in national office |
Ref document number: 1990906567 Country of ref document: EP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1990906567 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref country code: CA Ref document number: 2050593 Kind code of ref document: A Format of ref document f/p: F |